211 lines
22 KiB
XML
211 lines
22 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.375.6222" ID-GBIF-Dataset="89f16d40-bb9c-4b0f-b2e6-f08e88f0fb9a" ID-PMC="PMC3921562" ID-Pensoft-Pub="1313-2970-375-15" ID-PubMed="24526844" ID-ZBK="8BCC6418E8CD470A8A1A57CC67822F53" ModsDocAuthor="" ModsDocDate="2014" ModsDocID="1313-2970-375-15" ModsDocOrigin="ZooKeys 375" ModsDocTitle="Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae)" checkinTime="1451246388436" checkinUser="pensoft" docAuthor="Leger, Theo, Landry, Bernard, Nuss, Matthias & Mally, Richard" docDate="2014" docId="B6C5D5999FE042B1A94EB5B1179641C2" docLanguage="en" docName="ZooKeys 375: 15-73" docOrigin="ZooKeys 375" docSource="http://dx.doi.org/10.3897/zookeys.375.6222" docTitle="Catharylla mayrabonillae T. Leger & B. Landry, sp. n." docType="treatment" docUuid="5078E6D0-DDA4-4B9F-8089-F7FFECC725C6" docUuidSource="ZooBank" docVersion="4" lastPageNumber="47" masterDocId="9036FFB11B3EFFAFA138FFCA1A5BFFCE" masterDocTitle="Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae)" masterLastPageNumber="73" masterPageNumber="15" pageNumber="43" updateTime="1668157587888" updateUser="ExternalLinkService">
|
||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||
<mods:titleInfo>
|
||
<mods:title>Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae)</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Leger, Theo</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Landry, Bernard</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Nuss, Matthias</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Mally, Richard</mods:namePart>
|
||
</mods:name>
|
||
<mods:typeOfResource>text</mods:typeOfResource>
|
||
<mods:relatedItem type="host">
|
||
<mods:titleInfo>
|
||
<mods:title>ZooKeys</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:part>
|
||
<mods:date>2014</mods:date>
|
||
<mods:detail type="volume">
|
||
<mods:number>375</mods:number>
|
||
</mods:detail>
|
||
<mods:extent unit="page">
|
||
<mods:start>15</mods:start>
|
||
<mods:end>73</mods:end>
|
||
</mods:extent>
|
||
</mods:part>
|
||
</mods:relatedItem>
|
||
<mods:location>
|
||
<mods:url>http://dx.doi.org/10.3897/zookeys.375.6222</mods:url>
|
||
</mods:location>
|
||
<mods:classification>journal article</mods:classification>
|
||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.375.6222</mods:identifier>
|
||
<mods:identifier type="Pensoft-Pub">1313-2970-375-15</mods:identifier>
|
||
<mods:identifier type="ZBK">8BCC6418E8CD470A8A1A57CC67822F53</mods:identifier>
|
||
<mods:identifier type="ZooBank">8BCC6418E8CD470A8A1A57CC67822F53</mods:identifier>
|
||
</mods:mods>
|
||
<treatment ID-GBIF-Taxon="152050783" LSID="urn:lsid:zoobank.org:act:5078E6D0-DDA4-4B9F-8089-F7FFECC725C6" httpUri="http://treatment.plazi.org/id/B6C5D5999FE042B1A94EB5B1179641C2" lastPageId="32" lastPageNumber="47" pageId="28" pageNumber="43">
|
||
<subSubSection pageId="28" pageNumber="43" type="nomenclature">
|
||
<paragraph pageId="28" pageNumber="43">
|
||
<taxonomicName LSID="http://zoobank.org/5078E6D0-DDA4-4B9F-8089-F7FFECC725C6" authority="T. Leger & B. Landry" class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla mayrabonillae" order="Lepidoptera" pageId="28" pageNumber="43" phylum="Arthropoda" rank="species" species="mayrabonillae">
|
||
Catharylla mayrabonillae T.
|
||
<normalizedToken originalValue="Léger">Leger</normalizedToken>
|
||
& B. Landry
|
||
</taxonomicName>
|
||
<taxonomicNameLabel pageId="28" pageNumber="43">sp. n.</taxonomicNameLabel>
|
||
Figs 7, 30, 31, 40, 44
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="30" lastPageNumber="45" pageId="29" pageNumber="44" type="type material">
|
||
<paragraph pageId="29" pageNumber="44">
|
||
<pageBreakToken pageId="29" pageNumber="44" start="start">Type</pageBreakToken>
|
||
material.
|
||
</paragraph>
|
||
<paragraph pageId="29" pageNumber="44">
|
||
Holotype. ♂, with labels as follows: "Col. BECKER | 101668"; "ECUADOR: NAPO | Misahualli | 450m xii.1992 | V.O.Becker Col"; "HOLOTYPE | Catharylla | mayrabonillae |
|
||
<normalizedToken originalValue="Léger">Leger</normalizedToken>
|
||
& Landry" [red label]. Deposited in Becker Collection.
|
||
</paragraph>
|
||
<paragraph lastPageId="30" lastPageNumber="45" pageId="29" pageNumber="44">
|
||
Paratypes. 16 ♂, 37 ♀. BRAZIL: 1 ♀ (genitalia on slide BL 1729), [Acre] Rio Branco, 1924 (Dengler) (SMNS); 2 ♀, Amazonas, Manaus, Reserva Ducke, AM-010, km 26,
|
||
<geoCoordinate direction="south" orientation="latitude" precision="925" value="-2.9166667">2°55'S</geoCoordinate>
|
||
,
|
||
<geoCoordinate direction="west" orientation="longitude" precision="925" value="-59.983334">59°59'W</geoCoordinate>
|
||
, 15.xii.1993, U[ltra]V[iolet] Light (J. B. Sullivan & R. W. Hutchings) (USNM); 1 ♂ (genitalia on
|
||
<taxonomicName family="Pyralidae" lsidName="" pageId="29" pageNumber="44" rank="family">Pyralidae</taxonomicName>
|
||
Brit. Mus. Slide No. 11341), Amazonas, Fonte Boa, ix.1906 (S. M. Klages) (BMNH); 1 ♀ (genitalia on slide BL 1713), Federal District,
|
||
<normalizedToken originalValue="Estaçao">Estacao</normalizedToken>
|
||
Florestal, Cabeca do Vedao, 1100m, 18.x.1971 (E.G., I. & E.A. Munroe) (CNC); 2 ♂,
|
||
<normalizedToken originalValue="Maranhão">Maranhao</normalizedToken>
|
||
, Feira Nova, Faz[enda]. Retiro, 480m,
|
||
<geoCoordinate direction="south" orientation="latitude" precision="925" value="-7.0">07°00'S</geoCoordinate>
|
||
,
|
||
<geoCoordinate direction="west" orientation="longitude" precision="925" value="-46.433334">46°26'W</geoCoordinate>
|
||
, 1-3.xii.2011 (V. O. Becker n°148263) (Becker Coll.); 2 ♀,
|
||
<normalizedToken originalValue="Pará">Para</normalizedToken>
|
||
,
|
||
<normalizedToken originalValue="Belém">Belem</normalizedToken>
|
||
, 20m, i.1984 (V. O. Becker n°46981) (Becker Coll.); 1 ♀,
|
||
<normalizedToken originalValue="Pará">Para</normalizedToken>
|
||
, Capitao Poco, 25-31.i.1984 (V. O. Becker n°97880) (Becker Coll.); 1 ♂, Rondonia,
|
||
<normalizedToken originalValue="Cacaulãndia">Cacaulandia</normalizedToken>
|
||
, 140m, xi.1991 (V. O. Becker n°79592) (Becker Coll.); 1 ♀, Rondonia, 62km S[outh] Ariquemes, Fazenda Rancho Grande, 165m,
|
||
<geoCoordinate direction="south" orientation="latitude" precision="925" value="-10.533334">10°32'S</geoCoordinate>
|
||
,
|
||
<geoCoordinate direction="west" orientation="longitude" precision="925" value="-62.8">62°48'W</geoCoordinate>
|
||
, 18-26.iv.1991 (R. Leuschner) (USNM). COLOMBIA: 1 ♂, Valle, J[un]ct[ion]. Old
|
||
<normalizedToken originalValue="B’">B'</normalizedToken>
|
||
[uena]v[en]tura R[oa]d. and Rio Dagua, 50m, 8.ii.1989 (J. B. Sullivan) (USNM). COSTA RICA: 1 ♀ (used for DNA Barcoding by Janzen, 07-SRNP-113921), Alajuela, Area de Conservacion Guanacaste, Estacion Caribe, 12.xi.2007 (S. Rios & H. Cambronero) (INBio); 1 ♀, Alajuela, Area de Conservacion Guanacaste, Rio Negro, 25.i.2009 (H. Cambronero & F. Quesada) (INBio); 2 ♂ (one used for DNA sequencing LEP 966, with genitalia on slide TL 3, other used for DNA sequencing LEP 967, with genitalia on slide TL 4), Alajuela, San Carlos, Arenal National Park, Send[ero]
|
||
<normalizedToken originalValue="Pilón">Pilon</normalizedToken>
|
||
, Rio Celeste, 700m, light trap, 17-19.x.2001 (G. Rodriguez) (INBio); 1 ♂, Prov[incia] Guanacaste, F[in]ca Pasmompa, Est[acion] Pitilla, 5km SO S[an]ta Cecilia, 400m, xii.1990 (P. Rios & C. Moraga) (INBio). ECUADOR: 4 ♀ with same data and deposition as holotype; 4 ♂, 8 ♀ (1 ♂ used for DNA barcoding BC MTD 01844) with same data (USNM); 1 ♀ (genitalia on slide BL 1726, used for DNA sequencing and barcoding LEP 969, BC MTD 1707), Napo, 6km NW Tena, Lumu Caspi,
|
||
<geoCoordinate direction="south" orientation="latitude" precision="15" value="-0.9102777">0°54'37"S</geoCoordinate>
|
||
,
|
||
<geoCoordinate direction="west" orientation="longitude" precision="15" value="-77.825554">77°49'32"W</geoCoordinate>
|
||
, 590m, 29.ix.2002 (Schouten Coll.); 1 ♀ (genitalia on slide BL 1715, used for DNA sequencing and barcoding LEP 968, BC MTD 1706), Pastaza, 1km N Santa Clara,
|
||
<geoCoordinate direction="south" orientation="latitude" precision="15" value="-1.2672222">1°16'02"S</geoCoordinate>
|
||
,
|
||
<geoCoordinate direction="west" orientation="longitude" precision="15" value="-77.8825">77°52'57"W</geoCoordinate>
|
||
, 630m, 28.ix.2002 (Schouten Coll.). FRENCH GUIANA: 1 ♂, 4 ♀ (♂ genitalia on
|
||
<taxonomicName family="Pyralidae" lsidName="" pageId="29" pageNumber="44" rank="family">Pyralidae</taxonomicName>
|
||
Brit. Mus. Slide No 7816, ♀ genitalia on slides BL 1720, BL 1725, and
|
||
<taxonomicName family="Pyralidae" lsidName="" pageId="29" pageNumber="44" rank="family">Pyralidae</taxonomicName>
|
||
Brit. Mus. Slides No. 5953 and 19020), Saint Jean de Maroni (E. Le Moult) (BMNH); 2 ♀, Piste Nancibo, km 6, 4°41'N,; 52°25'W, in logged rain forest, at 125W[atts] mer[cury]-vapor light and 15W[atts] U[ltra]V[iolet], 11.i.1985 (J.[-]F. Landry) (USNM); 1 ♂, Roura, Montagne des Chevaux, xii.2008 (S. Delmas) (MHNG); 1 ♂ (genitalia on slide
|
||
<taxonomicName family="Pyralidae" lsidName="" pageId="29" pageNumber="44" rank="family">Pyralidae</taxonomicName>
|
||
Brit. Mus. Slide No 7792), Cayen[ne] (BMNH). GUYANA: 1 ♀ (genitalia on slide BL 1723), Omai, vi.1908 (S. M. Klages) (BMNH); 1 ♀ (genitalia on slide BL 1722), Potaro i.1908 (S. M. Klages) (BMNH). PANAMA: 1 ♀, Rio Trinidad, 12.iii [no year data] (A. Busck) (USNM). PERU: 1 ♂ (genitalia on slide BL 1724), Agnaytia, Huallaga, 400m, ix.1961 (F. H. Walz) (CNC); 1 ♀ (genitalia on slide GS-6908-SB), Yurimaguas,
|
||
<pageBreakToken pageId="30" pageNumber="45" start="start">Huallaga</pageBreakToken>
|
||
14.iv.[19]20 (CMNH). SURINAME: 2 ♀ (genitalia on slides BL 1727 and BL 1728), Kabo,
|
||
<geoCoordinate direction="north" orientation="latitude" precision="925" value="5.266667">5°16'N</geoCoordinate>
|
||
,
|
||
<geoCoordinate direction="west" orientation="longitude" precision="925" value="-55.733334">55°44'W</geoCoordinate>
|
||
, Saramaca, black light, respectively 15-16.iii.1983 and 13-14.i.1983 (K.E.Neerling) (Schouten Coll.); 1 ♀ (genitalia on slide BL 1710), Sipaliwini Distr[ict]., Tibiti area, Kabo Creek, partly swampy primary forest on hilly slopes, ca 2km from river, vi.1989 (J. Beerlink) (Schouten Coll.).
|
||
</paragraph>
|
||
<paragraph pageId="30" pageNumber="45">
|
||
Other specimen examined. 1♀ (used for DNA sequencing Lep 1126), Peru,
|
||
<normalizedToken originalValue="Huánuco">Huanuco</normalizedToken>
|
||
, Rio Llullapichis, Panguana, 74,945°W / 9,614°S, 23.9.-10.10.2011 (SMTD).
|
||
</paragraph>
|
||
<paragraph pageId="30" pageNumber="45">COI barcode sequence of paratype 07-SRNP-113921 (654 bp): ACATTATATTTTATTTTCGGGATTTGAGCAGGTATAGTAGGAACTTCACTTAGATTATTAATTCGTGCTGAATTAGGTAACCCTGGCTCTCTTATTGGAGATGATCAAATTTATAATACTATTGTAACAGCCCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCACCAGATATAGCTTTCCCTCGAATAAATAACATAAGATTTTGATTATTACCACCATCATTAACTCTTTTAATTTCTAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTATCCACCTTTATCATCTAATATTGCCCATGGGGGTAGATCTGTAGATTTAACAATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCATTTGATCAATTATCATTATTTATTTGATCAGTAGGAATTACTGCTTTACTTTTATTATTATCATTACCAGTTTTAGCTGGGGCTATTACTATACTTTTAACTGATCGAAATCTTAATACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTA</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="30" pageNumber="45" type="diagnosis">
|
||
<paragraph pageId="30" pageNumber="45">Diagnosis.</paragraph>
|
||
<paragraph pageId="30" pageNumber="45">
|
||
The best discriminant characters externally between the two species of the mayrabonillae group are the shape of the forewing outer margin, which is slightly produced apically in
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla mayrabonillae" order="Lepidoptera" pageId="30" pageNumber="45" phylum="Arthropoda" rank="species" species="mayrabonillae">Catharylla mayrabonillae</taxonomicName>
|
||
and not produced in
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla paulella" order="Lepidoptera" pageId="30" pageNumber="45" phylum="Arthropoda" rank="species" species="paulella">Catharylla paulella</taxonomicName>
|
||
, and the forewing median transverse line with two strongly pronounced spots at 1/3 and 2/3 in
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla paulella" order="Lepidoptera" pageId="30" pageNumber="45" phylum="Arthropoda" rank="species" species="paulella">Catharylla paulella</taxonomicName>
|
||
, whereas these spots are lacking in
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla mayrabonillae" order="Lepidoptera" pageId="30" pageNumber="45" phylum="Arthropoda" rank="species" species="mayrabonillae">Catharylla mayrabonillae</taxonomicName>
|
||
. The hindwing of
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla mayrabonillae" order="Lepidoptera" pageId="30" pageNumber="45" phylum="Arthropoda" rank="species" species="mayrabonillae">Catharylla mayrabonillae</taxonomicName>
|
||
has a faded subterminal transverse line on costal half whereas the hindwing of
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla paulella" order="Lepidoptera" pageId="30" pageNumber="45" phylum="Arthropoda" rank="species" species="paulella">Catharylla paulella</taxonomicName>
|
||
lacks this marking. In male genitalia, the heavily sclerotized sacculus bears a dorso-lateral sclerotized string of short spines on distal 1/4 whereas the two processes of the costa are S-shaped in
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla paulella" order="Lepidoptera" pageId="30" pageNumber="45" phylum="Arthropoda" rank="species" species="paulella">Catharylla paulella</taxonomicName>
|
||
, and the apex of the phallus is trifid, rounded medially, shortly triangular laterally, whereas it is simply rounded in
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla paulella" order="Lepidoptera" pageId="30" pageNumber="45" phylum="Arthropoda" rank="species" species="paulella">Catharylla paulella</taxonomicName>
|
||
. In female genitalia, the sterigma forms double rounded cavities with a mustachio-shape arrangement of short spines in ventral view, and the ductus bursae is wide, progressively widening toward corpus in
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla mayrabonillae" order="Lepidoptera" pageId="30" pageNumber="45" phylum="Arthropoda" rank="species" species="mayrabonillae">Catharylla mayrabonillae</taxonomicName>
|
||
, whereas the sterigma forms a pair of shallow rounded pockets on each side of middle and the ductus bursae is narrow, with the rounded corpus bursae clearly differentiated from it in
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla paulella" order="Lepidoptera" pageId="30" pageNumber="45" phylum="Arthropoda" rank="species" species="paulella">Catharylla paulella</taxonomicName>
|
||
.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="32" lastPageNumber="47" pageId="30" pageNumber="45" type="description">
|
||
<paragraph pageId="30" pageNumber="45">Description.</paragraph>
|
||
<paragraph lastPageId="31" lastPageNumber="46" pageId="30" pageNumber="45">
|
||
Male (n = 17) (Fig. 7): Head with light ochreous chaetosemata. Antenna brown, with white scales dorsally and patch of dark brown scales at base. Maxillary palpus light ochreous, ringed with dark brown at 2/3; white tipped. Labial palpus: 1-1.4 mm; white, with patch of dark brown scales at 1/3 and 2/3 laterally. Thorax with patch of light ochreous scales at collar. Foreleg coxa whitish brown, femur white,
|
||
<pageBreakToken pageId="31" pageNumber="46" start="start">dorsally</pageBreakToken>
|
||
ashen brown, tibia and tarsomeres ochreous, distally ringed with dark brown. Midleg femur white, tibia light ochreous, basally brown, tarsomeres
|
||
<normalizedToken originalValue="II–V">II-V</normalizedToken>
|
||
ochreous with tips ringed white. Hindleg white, except tarsomeres, as in midleg. Abdomen dull white. Forewing length: 7.5-8.5 mm; with apex slightly produced; costal line thin, ochreous or white in basal half, white in apical half; median transverse line ochreous, slightly undulated; subterminal transverse line ochreous; transverse lines enlarging into brown spot on costal margin with ochreous bar on costa following subterminal transverse line; terminal sector with light ochreous between veins, margin with thin, dark brown line from apex to CuA1, with two dark brown spots in cubital sector, with spot between CuA1 and CuA2 slightly displaced toward base; fringes brass colored; underside light ochreous with some brownish scales, with thin brown margin. Hindwing white with thin transverse subterminal line faded ochreous, in continuity with forewing median transverse line; outer margin line pronounced, dark brown; underside dull white with thin faded brown margin; fringes white.
|
||
</paragraph>
|
||
<paragraph pageId="31" pageNumber="46">Tympanal organs (n=7): Transverse ridge regularly rounded, medially slightly flattened. Tympanic pockets broadly rounded, extended widely beyond transverse ridge, connected medially at base of praecinctorium. Tympanic drum bean-shaped, elongated, extended beyond tympanic pockets.</paragraph>
|
||
<paragraph pageId="31" pageNumber="46">Male genitalia (n = 7) (Figs 30, 31): Uncus thick and wide, about 2/5 length of tegumen arms, densely setose, with shortly projecting apex dorsally rounded. Gnathos reaching about 1/4 longer than uncus; arms wide, joining at 2/5 of length; distal 2/5 at angle of about 85°. Tegumen almost regularly narrow, joined in last 1/4. Cucculus narrow, shorter than sacculus, apically rounded; sacculus greatly enlarged, thickly sclerotized, directed upward, then apically straight, slightly narrowing toward apex, laterally with string of short spines and 2-3 longer basal spines pointing downward; costal arm of valva directed upward, located at about 1/3 of costal margin, thin, strongly sclerotized, slightly curved. Vinculum arms narrow; saccus short and wide, tongue shaped, projecting posterad apically. Juxta elongate, distal 1/4 narrowed with rounded tip; wide base with ear-like lobes laterally and baso-lateral angle projected anterad. Phallus slightly bent sideways in distal 1/4, with trifid sclerotized apex rounded medially and shortly triangular laterally; vesica basally covered with tiny spicules, microspicules barely visible all along, with long spine-like, down-curved cornutus of about 2/5 length of phallus.</paragraph>
|
||
<paragraph pageId="31" pageNumber="46">Female (n = 37): Labial palpi length: 1.1-1.3 mm. Forewing length: 9.5-10.5 mm; frenulum triple.</paragraph>
|
||
<paragraph lastPageId="32" lastPageNumber="47" pageId="31" pageNumber="46">
|
||
Female genitalia (n = 16) (Fig. 40): Papillae anales strongly curved in lateral view; sclerotized line along papillae expanding ventrally into triangle. Posterior apophyses 0.35-0.45
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
length of papillae anales. Tergite VIII about 1/3 length of sternite VIII; postero-dorsal margin with few setae of moderate length; anterior apophyses 0.03-0.1
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
papillae anales; sternite VIII with patches of minute setae antero-ventrally on each side of bare median band. Sterigma forming double rounded cavities with mustachio-shaped arrangement of short spines (in ventral view); remaining cavity wall with tiny spines. Ductus bursae short and wide, enlarged near middle; partly sclerotized on right
|
||
<pageBreakToken pageId="32" pageNumber="47" start="start">side</pageBreakToken>
|
||
of enlargement and posterior section. Corpus bursae circular to elongate, about as long as tergite VII; single signum faintly pronounced.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="32" pageNumber="47" type="distribution">
|
||
<paragraph pageId="32" pageNumber="47">Distribution.</paragraph>
|
||
<paragraph pageId="32" pageNumber="47">
|
||
The species has been found so far in Panama, Costa Rica, Colombia, Venezuela, Guyana, Suriname, French Guiana, Ecuador, Peru and Brazil (Acre, Amazonas,
|
||
<normalizedToken originalValue="Distritò">Distrito</normalizedToken>
|
||
Federal,
|
||
<normalizedToken originalValue="Pará">Para</normalizedToken>
|
||
,
|
||
<normalizedToken originalValue="Rondônia">Rondonia</normalizedToken>
|
||
) (Fig. 44). It is the most widespread species of
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla" order="Lepidoptera" pageId="32" pageNumber="47" phylum="Arthropoda" rank="genus">Catharylla</taxonomicName>
|
||
and the only one so far found in Central America and in Venezuela, Columbia, Ecuador and Peru.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="32" pageNumber="47" type="etymology">
|
||
<paragraph pageId="32" pageNumber="47">Etymology.</paragraph>
|
||
<paragraph pageId="32" pageNumber="47">
|
||
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla mayrabonillae" order="Lepidoptera" pageId="32" pageNumber="47" phylum="Arthropoda" rank="species" species="mayrabonillae">Catharylla mayrabonillae</taxonomicName>
|
||
is named in honor of Ms. Mayra Bonilla of San Jose, Costa Rica, in recognition of her artistic portrayal of the biodiversity and ecosystems of Costa Rica and her many years of support for the existence of the rain forest in Area de Conservacion Guanacaste.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="32" pageNumber="47" type="notes">
|
||
<paragraph pageId="32" pageNumber="47">Notes.</paragraph>
|
||
<paragraph pageId="32" pageNumber="47">The relatively strong COI barcode divergence of 4.34% between samples LEP 1126 from Peru and 07-SRNP-113921 from Costa Rica (Table 5) is notable but it is not associated with morphological variation.</paragraph>
|
||
</subSubSection>
|
||
</treatment>
|
||
</document> |