Add updates up until 2024-08-03 11:38:07

This commit is contained in:
ggserver 2024-08-03 11:40:13 +00:00
parent d79bc065f6
commit 44a4fab0f8
26 changed files with 3905 additions and 456 deletions

View file

@ -0,0 +1,78 @@
<document id="9BE8EC1CA9C90616D0A1805C2CDA7930" ID-DOI="10.1590/1806-9665-RBENT-2024-0012" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722640294143" checkinUser="felipe" docAuthor="Cavalcanti, Joshua Pablo &amp; Lattke, John Edwin" docDate="2024" docId="03A2732DE05ABF156F03EDC367F8F89C" docLanguage="en" docName="RevBrasEntomol.68.2.e20240012.pdf" docOrigin="Revista Brasileira de Entomologia (e 20240012) 68 (2)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2024-0012" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Leptogenys pujoli Cavalcanti &amp; Lattke, 2024, n. sp." docType="treatment" docUuid="6A286AEB-6924-49DA-B669-36AACEC9F5A3" docUuidSource="ZooBank" docVersion="1" lastPageNumber="4" masterDocId="FF9B0B55E059BF166F50EB74650BFFBC" masterDocTitle="Leptogenys pujoli, a new amazonian species, and the redescription of Leptogenys famelica Emery, 1896 (Formicidae: Ponerinae)" masterLastPageNumber="9" masterPageNumber="1" pageNumber="4" updateTime="1722683866738" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="BEB300C945BD64091CFD0BBC5F0C2994" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="CE81A48D258C136A87751F3D707E090F">
<mods:title id="F5B51AA73122578D4AD0F0C0D3C951B5">Leptogenys pujoli, a new amazonian species, and the redescription of Leptogenys famelica Emery, 1896 (Formicidae: Ponerinae)</mods:title>
</mods:titleInfo>
<mods:name id="946E84CDEBE1742C47B1C1C8482D180A" type="personal">
<mods:role id="95989A938F54D8D31D8C91989562785D">
<mods:roleTerm id="F85C0914AAC1E175BD6E27DE0B20AACF">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="6DCF734848D2339041784CFC758DC32B">Cavalcanti, Joshua Pablo</mods:namePart>
<mods:affiliation id="52EEEEA9DE9374AE8047DC2E5E2AAADE">Universidade Federal do Paraná, Departamento de Zoologia, Curitiba, PR, Brasil. urn: lsid: zoobank. org: act: 6 A 286 AEB- 6924 - 49 DA-B 669 - 36 AACEC 9 F 5 A 3</mods:affiliation>
</mods:name>
<mods:name id="7F2FE32391913425C7BEDB1F1EE894BC" type="personal">
<mods:role id="584B6862B4D3676766DBE9BA837EC359">
<mods:roleTerm id="5BFE95FEB6F2C55232912C32732EFC14">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="D8E8BF1F1D98A233FDD5489D63916A3B">Lattke, John Edwin</mods:namePart>
<mods:affiliation id="DFC13D899519AB851151309F231206D1">Universidade Federal do Paraná, Departamento de Zoologia, Curitiba, PR, Brasil. urn: lsid: zoobank. org: act: 6 A 286 AEB- 6924 - 49 DA-B 669 - 36 AACEC 9 F 5 A 3</mods:affiliation>
</mods:name>
<mods:typeOfResource id="8E98433B8CFE079D0B7036F7E02FD2D8">text</mods:typeOfResource>
<mods:relatedItem id="B7CB250C54ABEAB935B65FF330BC533C" type="host">
<mods:titleInfo id="8EE2B3E92D77A838488CF31842A4C6B2">
<mods:title id="759885A651EEA3E9CB0513834DEE7F29">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="3B9A818A83FD4CB6B83A8BD7D611A1A6">
<mods:date id="23E49FFA4E517718D83E09B946C650AA">2024</mods:date>
<mods:detail id="CAB98FF9C728031E46D2BC23FEEAEE6C" type="series">
<mods:title id="978FE0554D51B6EEF654A722EA2BB59A">e 20240012</mods:title>
</mods:detail>
<mods:detail id="BE865DC46A2B9C0F999006C160886064" type="pubDate">
<mods:number id="F5389241BDCCFAE5436ECA2920DAF6F8">2024-05-27</mods:number>
</mods:detail>
<mods:detail id="E6F1B5639CB3451D37AE8748E1F327C5" type="volume">
<mods:number id="24A8E895D0A9DD10DC1F46852417BD1C">68</mods:number>
</mods:detail>
<mods:detail id="C5434D57C0A7AD3D76072D47A2C0DD12" type="issue">
<mods:number id="2AFE5EF11DF5F07263AF5D620506C1B4">2</mods:number>
</mods:detail>
<mods:extent id="6B07FC4816D46045CE3F56A7311A80EA" unit="page">
<mods:start id="A49AB9B3F95C3CE86461C733F5A24CA5">1</mods:start>
<mods:end id="2D3B660F237346878A65FE3791F14D2D">9</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="D7D2295F16FECDAD90BE2445045ED8B2">
<mods:url id="C4C646BC8B9D7573EE2BF37AEC45546F">http://dx.doi.org/10.1590/1806-9665-rbent-2024-0012</mods:url>
</mods:location>
<mods:classification id="1965567661B91F662EE5E8FA3B637D01">journal article</mods:classification>
<mods:identifier id="B52DC0856C9ABE5F468FD09CE89F2CC6" type="DOI">10.1590/1806-9665-RBENT-2024-0012</mods:identifier>
<mods:identifier id="7BBC5ACB23CB7AD436DD1AC05479F86B" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="129451B56E19A84E8915A3A415A622E9" type="ZooBank">77BAA24A-F95F-4C16-9C50-C25626E9444B</mods:identifier>
</mods:mods>
<treatment id="03A2732DE05ABF156F03EDC367F8F89C" LSID="urn:lsid:zoobank.org:act:6A286AEB-6924-49DA-B669-36AACEC9F5A3" httpUri="http://treatment.plazi.org/id/03A2732DE05ABF156F03EDC367F8F89C" lastPageNumber="4" pageId="3" pageNumber="4">
<subSubSection id="C31191B0E05ABF156F03EDC36448F976" box="[83,323,1719,1738]" pageId="3" pageNumber="4" type="nomenclature">
<paragraph id="8BB4C23BE05ABF156F03EDC36448F976" blockId="3.[83,323,1719,1738]" box="[83,323,1719,1738]" pageId="3" pageNumber="4">
<heading id="D0FC7557E05ABF156F03EDC36448F976" bold="true" box="[83,323,1719,1738]" fontSize="8" level="2" pageId="3" pageNumber="4" reason="2">
<emphasis id="B97F1E29E05ABF156F03EDC36448F976" bold="true" box="[83,323,1719,1738]" pageId="3" pageNumber="4">
<taxonomicName id="4C0BB9B8E05ABF156F03EDC36403F976" authorityName="Cavalcanti &amp; Lattke" authorityYear="2024" box="[83,264,1719,1738]" class="Insecta" family="Formicidae" genus="Leptogenys" kingdom="Animalia" order="Hymenoptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="pujoli" status="sp. nov.">Leptogenys pujoli</taxonomicName>
<taxonomicNameLabel id="A24CA352E05ABF156E5DEDC36448F976" box="[269,323,1719,1738]" pageId="3" pageNumber="4" rank="species">n. sp.</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C31191B0E05ABF156F03EDA567F8F89C" pageId="3" pageNumber="4" type="description">
<paragraph id="8BB4C23BE05ABF156F03EDA5659DF959" blockId="3.[83,150,1745,1765]" box="[83,150,1745,1765]" pageId="3" pageNumber="4">
(
<figureCitation id="1330DEBEE05ABF156F0AEDA56584F959" box="[90,143,1745,1765]" captionStart="Figure 2" captionStartId="4.[113,166,1303,1320]" captionTargetBox="[136,1481,151,1284]" captionTargetId="figure-384@4.[132,1485,151,1287]" captionTargetPageId="4" captionText="Figure 2 Leptogenys pujoli n. sp., holotype, DZUP DZUP549564: (A) body in lateral view; (B) head in full-face view; (C) petiole in dorsal view; (D) mesosoma in lateral view; (E) mesosoma in dorsal view." pageId="3" pageNumber="4">Fig. 2</figureCitation>
)
</paragraph>
<paragraph id="8BB4C23BE05ABF156F03EC7967F8F89C" blockId="3.[83,755,1805,1824]" box="[83,755,1805,1824]" pageId="3" pageNumber="4">
<uri id="FF9ACE39E05ABF156F03EC7967F8F89C" box="[83,755,1805,1824]" pageId="3" pageNumber="4">
urn:lsid:zoobank.org:act:
<uuid id="FFADF8EEE05ABF156E7DEC7967F8F89C" box="[301,755,1805,1824]" pageId="3" pageNumber="4">6A286AEB-6924-49DA-B669-36AACEC9F5A3</uuid>
</uri>
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,94 @@
<document id="75E1B58C9FFEC58C6F0487A1F539DF27" ID-DOI="10.1590/1806-9665-RBENT-2024-0012" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722640294143" checkinUser="felipe" docAuthor="Cavalcanti, Joshua Pablo &amp; Lattke, John Edwin" docDate="2024" docId="03A2732DE05BBF146F21EA2C64EEFE66" docLanguage="en" docName="RevBrasEntomol.68.2.e20240012.pdf" docOrigin="Revista Brasileira de Entomologia (e 20240012) 68 (2)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2024-0012" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Leptogenys famelica Emery 1896" docType="treatment" docVersion="1" lastPageNumber="3" masterDocId="FF9B0B55E059BF166F50EB74650BFFBC" masterDocTitle="Leptogenys pujoli, a new amazonian species, and the redescription of Leptogenys famelica Emery, 1896 (Formicidae: Ponerinae)" masterLastPageNumber="9" masterPageNumber="1" pageNumber="3" updateTime="1722683866738" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="D88885E8F2F0BA7E2D5221B8BB5FF3FB" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="1B7650CEEC85E0D12A8E06710051E989">
<mods:title id="C2852CBB3EA3F401F0428E67A4A6D1AA">Leptogenys pujoli, a new amazonian species, and the redescription of Leptogenys famelica Emery, 1896 (Formicidae: Ponerinae)</mods:title>
</mods:titleInfo>
<mods:name id="3AF512BC4B6ADC8A2A58821C0DE9F57E" type="personal">
<mods:role id="0D42056098140616ABE8EB97AA7D297A">
<mods:roleTerm id="EAD9648E63652EEDCF20A9A754B85799">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="A95015764894E4C58914746FEA423D97">Cavalcanti, Joshua Pablo</mods:namePart>
<mods:affiliation id="1CDA20EF51CB70842E4A72724AED7E41">Universidade Federal do Paraná, Departamento de Zoologia, Curitiba, PR, Brasil. urn: lsid: zoobank. org: act: 6 A 286 AEB- 6924 - 49 DA-B 669 - 36 AACEC 9 F 5 A 3</mods:affiliation>
</mods:name>
<mods:name id="6C218E0C5FA2E7A0D148943C58962E44" type="personal">
<mods:role id="E7C589B35532771D5893AC597FC9F60A">
<mods:roleTerm id="A8205F760AA7C161E5C6A048C72BBB82">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3417630AA2745556EBC31E8561EC87EE">Lattke, John Edwin</mods:namePart>
<mods:affiliation id="3C10AD157F86DA9C5E25FCEA47C30712">Universidade Federal do Paraná, Departamento de Zoologia, Curitiba, PR, Brasil. urn: lsid: zoobank. org: act: 6 A 286 AEB- 6924 - 49 DA-B 669 - 36 AACEC 9 F 5 A 3</mods:affiliation>
</mods:name>
<mods:typeOfResource id="045C7924C51B8BB7B864C1F6633B8E57">text</mods:typeOfResource>
<mods:relatedItem id="72AA0616FB1DFC84376CE2C77D4713C9" type="host">
<mods:titleInfo id="D25015432C2AF861847FEEC32B6FDDF9">
<mods:title id="4B838822949F78C73CB0394CAC08FF31">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="B9C7274CC452525434589101CA46DF82">
<mods:date id="06345107E6DA3B7712363B529A24328C">2024</mods:date>
<mods:detail id="6A5728C6C0843D43E239BA731A5DB723" type="series">
<mods:title id="08C8E44AD05E74138C16DB02910E081B">e 20240012</mods:title>
</mods:detail>
<mods:detail id="18C6FE47F1EE4307AE2F25D9C5A596E5" type="pubDate">
<mods:number id="7A6969BCCB87C294396619E5113BA1C7">2024-05-27</mods:number>
</mods:detail>
<mods:detail id="E93D5C6450513F954EE181019C8498D8" type="volume">
<mods:number id="2B58E9F69F6B159F4CE9CA2908EEEE12">68</mods:number>
</mods:detail>
<mods:detail id="8B3F750693CA0C99AC5692853097BE13" type="issue">
<mods:number id="A325EDD16AB2A6BF4C3D6E1E9F331869">2</mods:number>
</mods:detail>
<mods:extent id="0063F23C00F3799E0DCE9042E416EF88" unit="page">
<mods:start id="6E2B25CF4947C1B62E952AE3E3EEE1BC">1</mods:start>
<mods:end id="C6D4837EC86DDDC4A3973B7DDEE11DB0">9</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="0350FE7815F543E4D3EF0348F6209E73">
<mods:url id="E09182639AC9D01575EC97C29A2BDC01">http://dx.doi.org/10.1590/1806-9665-rbent-2024-0012</mods:url>
</mods:location>
<mods:classification id="DB0946AB08E800C3FDD4CFE47142D6B7">journal article</mods:classification>
<mods:identifier id="707573CF51E3D36801CF5175F3CF1548" type="DOI">10.1590/1806-9665-RBENT-2024-0012</mods:identifier>
<mods:identifier id="90A64CE23410786F3297A96232C9C60C" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="E6026A90D08B02D60CF32911FA46B5C7" type="ZooBank">77BAA24A-F95F-4C16-9C50-C25626E9444B</mods:identifier>
</mods:mods>
<treatment id="03A2732DE05BBF146F21EA2C64EEFE66" LSID="urn:lsid:plazi:treatment:03A2732DE05BBF146F21EA2C64EEFE66" httpUri="http://treatment.plazi.org/id/03A2732DE05BBF146F21EA2C64EEFE66" lastPageNumber="3" pageId="2" pageNumber="3">
<subSubSection id="C31191B0E05BBF146F21EA2C64C8FED6" box="[113,451,343,363]" pageId="2" pageNumber="3" type="nomenclature">
<paragraph id="8BB4C23BE05BBF146F21EA2C64C8FED6" blockId="2.[113,451,343,363]" box="[113,451,343,363]" pageId="2" pageNumber="3">
<heading id="D0FC7557E05BBF146F21EA2C64C8FED6" bold="true" box="[113,451,343,363]" fontSize="8" level="2" pageId="2" pageNumber="3" reason="2">
<taxonomicName id="4C0BB9B8E05BBF146F21EA2C64C8FED6" ID-CoL="6PH5V" authority="Emery, 1896" authorityName="Emery" authorityYear="1896" box="[113,451,343,363]" class="Insecta" family="Formicidae" genus="Leptogenys" kingdom="Animalia" order="Hymenoptera" pageId="2" pageNumber="3" phylum="Arthropoda" rank="species" species="famelica">
<emphasis id="B97F1E29E05BBF146F21EA2C64C8FED6" bold="true" box="[113,451,343,363]" pageId="2" pageNumber="3">Leptogenys famelica Emery, 1896</emphasis>
</taxonomicName>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C31191B0E05BBF146F21EA0565BEFE39" box="[113,181,369,389]" pageId="2" pageNumber="3" type="description">
<paragraph id="8BB4C23BE05BBF146F21EA0565BEFE39" blockId="2.[113,181,369,389]" box="[113,181,369,389]" pageId="2" pageNumber="3">
(
<figureCitation id="1330DEBEE05BBF146F28EA0565A0FE39" box="[120,171,369,389]" captionStart="Figure 1" captionStartId="2.[112,165,1947,1964]" captionTargetBox="[138,1482,794,1928]" captionTargetId="figure-322@2.[136,1482,794,1930]" captionTargetPageId="2" captionText="Figure 1 Leptogenys famelica worker, DZUP DZUP549346: (A) body in lateral view; (B) head in full-face view; (C) petiole in dorsal view; (D) mesosoma in lateral view; (E) mesosoma in dorsal view." pageId="2" pageNumber="3">Fig. 1</figureCitation>
)
</paragraph>
</subSubSection>
<subSubSection id="C31191B0E05BBF146FC7EADE64EEFE66" pageId="2" pageNumber="3" type="reference_group">
<paragraph id="8BB4C23BE05BBF146FC7EADE64EEFE66" blockId="2.[112,786,425,474]" pageId="2" pageNumber="3">
<materialsCitation id="3B63C866E05BBF146FC7EADE64EAFE66" collectingDate="1895-07" collectionCode="MCSN" collectorName="A. Alfaro" country="Costa Rica" location="Suerre" municipality="Jimenez" pageId="2" pageNumber="3" specimenCount="1">
<taxonomicName id="4C0BB9B8E05BBF146FC7EADE64E4FE01" ID-CoL="6PH5V" authority="Emery, 1896: 91" authorityName="Emery" authorityPageNumber="91" authorityYear="1896" box="[151,495,425,445]" class="Insecta" family="Formicidae" genus="Leptogenys" kingdom="Animalia" order="Hymenoptera" pageId="2" pageNumber="3" phylum="Arthropoda" rank="species" species="famelica">Leptogenys famelica Emery, 1896: 91</taxonomicName>
, fig.6a-c (w.)
<collectingCountry id="F31C82ABE05BBF146D3DEADE67C6FE00" box="[621,717,425,445]" name="Costa Rica" pageId="2" pageNumber="3">Costa Rica</collectingCountry>
,
<location id="8ED494E0E05BBF146D84EADE6619FE01" LSID="urn:lsid:plazi:treatment:03A2732DE05BBF146F21EA2C64EEFE66:8ED494E0E05BBF146D84EADE6619FE01" box="[724,786,426,445]" country="Costa Rica" municipality="Jimenez" name="Suerre" pageId="2" pageNumber="3">Suerre</location>
at
<collectingMunicipality id="6BD05841E05BBF146FD8EAB365D3FE66" box="[136,216,455,474]" pageId="2" pageNumber="3">Jiménez</collectingMunicipality>
,
<date id="FFB5E4FBE05BBF146FB1EAB36439FE66" box="[225,306,455,474]" pageId="2" pageNumber="3" value="1895-07">
<collectingDate id="EFF11D13E05BBF146FB1EAB36439FE66" box="[225,306,455,474]" pageId="2" pageNumber="3" value="1895-07">VII.1895</collectingDate>
</date>
,
<collectorName id="26FEA7EDE05BBF146E6AEAB36485FE66" box="[314,398,455,474]" pageId="2" pageNumber="3">A. Alfaro</collectorName>
[
<collectionCode id="ED1A5AFEE05BBF146EC9EAB364D7FE66" box="[409,476,455,474]" country="Italy" httpUri="http://grbio.org/cool/353t-cj9k" name="Museo Civico di Storia Naturale, Verona" pageId="2" pageNumber="3">MCSN</collectionCode>
]
</materialsCitation>
.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,178 @@
<document id="21EE481E0D393602B6EDD7386E9FE5CE" ID-DOI="10.1016/j.rbe.2016.07.001" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722639832736" checkinUser="felipe" docAuthor="Duarte, Paulo R. M. &amp; Grossi, Paschoal C." docDate="2016" docId="03A387853816F11CFFB10907071BDA5C" docLanguage="en" docName="RevBrasEntomol.60.4.290-292.pdf" docOrigin="Revista Brasileira de Entomologia 60 (4)" docSource="http://dx.doi.org/10.1016/j.rbe.2016.07.001" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Scaptophilus cribrarius Fairmaire 1878" docType="treatment" docVersion="1" lastPageNumber="292" masterDocId="FF9AFFFD3817F11EFFC308000645DC42" masterDocTitle="Rediscovery of Bothynus cribrarius (Fairmaire) (Coleoptera, Melolonthidae, Dynastinae, Pentodontini): description of the male and precise location data" masterLastPageNumber="292" masterPageNumber="290" pageNumber="291" updateTime="1722683515808" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="3499AB8F3AB2947E54D8FEC93E981F29" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="E930B26E52DF5014F3558121C867F4BB">
<mods:title id="57E58A85EFDDC524A70028C875E0ECE8">Rediscovery of Bothynus cribrarius (Fairmaire) (Coleoptera, Melolonthidae, Dynastinae, Pentodontini): description of the male and precise location data</mods:title>
</mods:titleInfo>
<mods:name id="043C42E17005CD51FC90A8F93F648188" type="personal">
<mods:role id="D4814C124B37D27EB7474AF55E251157">
<mods:roleTerm id="191C401BE5CBF22DBFB04E081BA6472B">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="EBE7A4480377024A841F9EA55B655C18">Duarte, Paulo R. M.</mods:namePart>
</mods:name>
<mods:name id="5631E527E8146CBF50C0BD6AA8A20360" type="personal">
<mods:role id="2C29E7FE4E63842969083E1D109A1045">
<mods:roleTerm id="D4CDD0757F35097F38D57DD817A40F21">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="45B20454FD93179EC7A20F01A5FF1C51">Grossi, Paschoal C.</mods:namePart>
</mods:name>
<mods:typeOfResource id="52300A816ED08EECB482E0CEDF4E3CD9">text</mods:typeOfResource>
<mods:relatedItem id="0DC69DAD9F9F689F65D1576776025DCE" type="host">
<mods:titleInfo id="69CF2E5BC9940E47C3DB60E1323BE8EE">
<mods:title id="66CC1B1886B0EFB5C9D612B111D68DF7">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="29E0193232DF165C74F4824A9DBD7997">
<mods:date id="0754A32FD57962B81D755B09CEA4B416">2016</mods:date>
<mods:detail id="1B20C5CE0F47756D11E82AA121CACB0D" type="pubDate">
<mods:number id="58E94F6BF38A0319611C7CA04C6D3AC1">2016-07-22</mods:number>
</mods:detail>
<mods:detail id="14E838F82504771C1B5FA4D35306450E" type="volume">
<mods:number id="E7A41AEC0A1256BFF80F8794A78004E1">60</mods:number>
</mods:detail>
<mods:detail id="7681A3DF6D3FCB8038A0C64757F396B5" type="issue">
<mods:number id="1B7F51B269FB1880D698759745A31F97">4</mods:number>
</mods:detail>
<mods:extent id="9EBA216F1743843C8622EA38D24655A1" unit="page">
<mods:start id="34738551FC756D25DB3A383E6FD3EDEF">290</mods:start>
<mods:end id="BAC8B397FE99D4B2EB9CB844055DFD79">292</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="C2564C0F1EDBAA071BE8450A29B5EB69">
<mods:url id="4566658514FF824B62A8EB2ECADF0CBB">http://dx.doi.org/10.1016/j.rbe.2016.07.001</mods:url>
</mods:location>
<mods:classification id="117A4F7D8B023A4130407429F79B6255">journal article</mods:classification>
<mods:identifier id="CF36B7DE814631CE56D88CD226783BE2" type="DOI">10.1016/j.rbe.2016.07.001</mods:identifier>
<mods:identifier id="45196F852CE76F6FC1CF46E08440B308" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="03A387853816F11CFFB10907071BDA5C" LSID="urn:lsid:plazi:treatment:03A387853816F11CFFB10907071BDA5C" httpUri="http://treatment.plazi.org/id/03A387853816F11CFFB10907071BDA5C" lastPageId="2" lastPageNumber="292" pageId="1" pageNumber="291">
<subSubSection id="C31065183816F11FFFB109070468DD58" box="[114,557,262,282]" pageId="1" pageNumber="291" type="nomenclature">
<paragraph id="8BB536933816F11FFFB109070468DD58" blockId="1.[114,785,262,450]" box="[114,557,262,282]" pageId="1" pageNumber="291">
<heading id="D0FD81FF3816F11FFFB109070468DD58" box="[114,557,262,282]" fontSize="8" level="2" pageId="1" pageNumber="291" reason="6">
<treatmentCitationGroup id="AB1A11BD3816F11FFFB109070468DD58" box="[114,557,262,282]" pageId="1" pageNumber="291">
<treatmentCitation id="0AAB10823816F11FFFB109070468DD58" author="Fairmaire, L." box="[114,557,262,282]" page="266" pageId="1" pageNumber="291" year="1878">
<taxonomicName id="4C0A4D103816F11FFFB109070468DD58" ID-CoL="79TYX" authority="Fairmaire, 1878: 266" authorityName="Fairmaire" authorityPageNumber="266" authorityYear="1878" box="[114,557,262,282]" class="Insecta" family="Scarabaeidae" genus="Scaptophilus" kingdom="Animalia" order="Coleoptera" pageId="1" pageNumber="291" phylum="Arthropoda" rank="species" species="cribrarius">
Scaptophilus cribrarius
<bibRefCitation id="EF9B4B623816F11FFEA109060468DD58" author="Fairmaire, L." box="[354,557,262,282]" pageId="1" pageNumber="291" pagination="260 - 270" refId="ref2060" refString="Fairmaire, L., 1878. Description de coleopteres nouveaux d'Amerique. Rev. Mag. Zoo. Pur. Appliq. (Series 3) 6, 260 - 270." type="journal article" year="1878">
<emphasis id="B97EEA813816F11FFEA109060468DD58" box="[354,557,262,282]" italics="true" pageId="1" pageNumber="291">Fairmaire, 1878: 266</emphasis>
</bibRefCitation>
</taxonomicName>
</treatmentCitation>
</treatmentCitationGroup>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C31065183816F11CFF510923071BDA5C" lastPageId="2" lastPageNumber="292" pageId="1" pageNumber="291" type="description">
<paragraph id="8BB536933816F11CFF51092306E5DF26" blockId="1.[114,785,262,450]" lastBlockId="2.[85,757,152,1064]" lastPageId="2" lastPageNumber="292" pageId="1" pageNumber="291">
<emphasis id="B97EEA813816F11FFF5109230751DD74" bold="true" box="[146,276,291,310]" pageId="1" pageNumber="291">Description:</emphasis>
Male. Total length: 20.0
<quantity id="4CF29B763816F11FFDF209230432DD75" box="[561,631,291,311]" metricMagnitude="-2" metricUnit="m" metricValue="2.1" pageId="1" pageNumber="291" unit="mm" value="21.0">21 mm</quantity>
. Width across humeri 10.511.0 mm. Color in dorsal view dark brown, opaque; ventral view darker, densely setose (
<figureCitation id="13312A163816F11FFE2A095B0406DD2C" box="[489,579,347,366]" captionStart="Figs" captionStartId="1.[114,149,1951,1965]" captionTargetBox="[249,1366,500,1918]" captionTargetId="figure-180@1.[249,1369,497,1921]" captionTargetPageId="1" captionText="Figs. 19. Bothynus cribrarius. 13, male in dorsal, lateral and ventral views respectively; 46, female in dorsal, lateral and ventral views respectively; 78, parameres and aedeagus in caudal and lateral views respectively (arrow indicates ventral tooth); 9, male anterior right claws. Scale bars (Figs.16 = 0.5cm; Figs. 79= 2 mm)." pageId="1" pageNumber="291">Figs. 13</figureCitation>
). Head: Clypeus triangular, strongly rugopunctate, apex contracted to 2 small teeth, sides slightly reflexed. Frontoclypeal suture weak, almost obsolete in smaller male. Frons transverse, moderately arched, strongly rugopunctate, and with 2 setose areas laterally. Mandibles tridentate, apical and middle teeth acuminate, basal tooth smaller, rounded. Ocular canthi slightly rounded, with scattered setae beneath. Mentum short, transverse, triangular, base concave. Pronotum: Shape transverse, about twice as wide as long, surface strongly convex. Pronotal fovea moderately concave, extending to about a third of anterior pronotal width and strongly and transversely wrinkled with some punctures on sides. Surface uniformly punctate, moderate on disk, and dense on sides, with larger, setose punctures; sides rounded, slightly raised. Apical tubercle large, conical, base transverse. Elytra: Surface opaque, moderately and uniformly punctate; punctures setose, moderate in size, some coalescent, becoming denser laterally. Striae distinctly punctate; sutural striae present, removed from suture by about 34 puncture diameters. Interstriae indistinct. Apical umbone smooth. Scutellum subtriangular, apex rounded, surface sparsely punctate. Legs: Femora densely setose, setae long, light reddish brown. Protibiae tridentate, apical tooth curved and more acute than others, middle tooth wider, basal tooth smaller. Protarsi with claws different in shape and size; inner claw strongly curved, incised, longer, incision deeply bifurcated (
<figureCitation id="13312A163815F11CFEBF099307FDDDE4" box="[380,440,403,422]" captionStart="Figs" captionStartId="1.[114,149,1951,1965]" captionTargetBox="[249,1366,500,1918]" captionTargetId="figure-180@1.[249,1369,497,1921]" captionTargetPageId="1" captionText="Figs. 19. Bothynus cribrarius. 13, male in dorsal, lateral and ventral views respectively; 46, female in dorsal, lateral and ventral views respectively; 78, parameres and aedeagus in caudal and lateral views respectively (arrow indicates ventral tooth); 9, male anterior right claws. Scale bars (Figs.16 = 0.5cm; Figs. 79= 2 mm)." pageId="2" pageNumber="292">Fig. 9</figureCitation>
), outer claws simply curved. Meso- and metatibae with 2 transverse carinae on external surface; mesotibiae distinctly shorter than metatibiae; apex of meso- and metatibiae with 2540 spinules. Venter: Surface densely setose, setae almost covering thoracic sternites; metathorax with center longitudinally concave, shallow. Abdominal sternites weakly setose on disk, denser on sides; fifth sternite with C-shaped punctures, denser than previous segments; sixth sternite emarginated at apex, surface densely punctate; punctures fine, coalescent. Propygidium completely setose except on disk where punctures coalesce and form weak ridges; stridulatory area confined to disk. Pygidium setose, slightly convex, with strong, transverse, coalescent punctures. Aedeagus: Parameres symmetrical strongly contracted to apex, apex dilated (
<figureCitation id="13312A163815F11CFE810AFE073FDF53" box="[322,378,766,785]" captionStart="Figs" captionStartId="1.[114,149,1951,1965]" captionTargetBox="[249,1366,500,1918]" captionTargetId="figure-180@1.[249,1369,497,1921]" captionTargetPageId="1" captionText="Figs. 19. Bothynus cribrarius. 13, male in dorsal, lateral and ventral views respectively; 46, female in dorsal, lateral and ventral views respectively; 78, parameres and aedeagus in caudal and lateral views respectively (arrow indicates ventral tooth); 9, male anterior right claws. Scale bars (Figs.16 = 0.5cm; Figs. 79= 2 mm)." pageId="2" pageNumber="292">Fig. 7</figureCitation>
). In lateral view with a carina. Surface weakly rugose mainly at middle; basal half with ventral tooth in lateral view; phallobase about 2 times longer than parameres (
<figureCitation id="13312A163815F11CFF9E0B5106D6DF26" box="[93,147,849,868]" captionStart="Figs" captionStartId="1.[114,149,1951,1965]" captionTargetBox="[249,1366,500,1918]" captionTargetId="figure-180@1.[249,1369,497,1921]" captionTargetPageId="1" captionText="Figs. 19. Bothynus cribrarius. 13, male in dorsal, lateral and ventral views respectively; 46, female in dorsal, lateral and ventral views respectively; 78, parameres and aedeagus in caudal and lateral views respectively (arrow indicates ventral tooth); 9, male anterior right claws. Scale bars (Figs.16 = 0.5cm; Figs. 79= 2 mm)." pageId="2" pageNumber="292">Fig. 8</figureCitation>
).
</paragraph>
<caption id="DF75661B3816F11FFFB10F9F0331DB86" pageId="1" pageNumber="291" startId="1.[114,149,1951,1965]" targetBox="[249,1366,500,1918]" targetPageId="1" targetType="figure">
<paragraph id="8BB536933816F11FFFB10F9F0331DB86" blockId="1.[114,1503,1951,1988]" pageId="1" pageNumber="291">
<emphasis id="B97EEA813816F11FFFB10F9F0685DBEF" bold="true" box="[114,192,1951,1965]" pageId="1" pageNumber="291">Figs. 19.</emphasis>
<taxonomicName id="4C0A4D103816F11FFF0A0F9F0726DBEC" baseAuthorityName="Fairmaire" baseAuthorityYear="1878" box="[201,355,1951,1966]" class="Insecta" family="Scarabaeidae" genus="Bothynus" kingdom="Animalia" order="Coleoptera" pageId="1" pageNumber="291" phylum="Arthropoda" rank="species" species="cribrarius">
<emphasis id="B97EEA813816F11FFF0A0F9F0726DBEC" box="[201,355,1951,1966]" italics="true" pageId="1" pageNumber="291">Bothynus cribrarius</emphasis>
</taxonomicName>
. 13, male in dorsal, lateral and ventral views respectively; 46, female in dorsal, lateral and ventral views respectively; 78, parameres and aedeagus in caudal and lateral views respectively (arrow indicates ventral tooth); 9, male anterior right claws. Scale bars (Figs. 16 = 0.5 cm; Figs. 79 = 2 mm).
</paragraph>
</caption>
<paragraph id="8BB536933815F11CFFB60B6D0430D86A" blockId="2.[85,757,152,1064]" pageId="2" pageNumber="292">
Female. Differs from male in the following aspects: Pronotal surface less punctate; apical tubercle about 1/2 smaller; fovea almost obsolete, flattened, and simply punctate, punctures ocellate. Legs with protarsi simple, claws similar in shape, not incised nor strongly curved.Pygidium less convex, nearly flat and more setose. Metathorax with narrower; abdominal sternites more distinctly punctate, sixth sternite parabolic, completely setose (
<figureCitation id="13312A163815F11CFDCC0C14042DD865" box="[527,616,1044,1063]" captionStart="Figs" captionStartId="1.[114,149,1951,1965]" captionTargetBox="[249,1366,500,1918]" captionTargetId="figure-180@1.[249,1369,497,1921]" captionTargetPageId="1" captionText="Figs. 19. Bothynus cribrarius. 13, male in dorsal, lateral and ventral views respectively; 46, female in dorsal, lateral and ventral views respectively; 78, parameres and aedeagus in caudal and lateral views respectively (arrow indicates ventral tooth); 9, male anterior right claws. Scale bars (Figs.16 = 0.5cm; Figs. 79= 2 mm)." pageId="2" pageNumber="292">Figs. 46</figureCitation>
).
</paragraph>
<paragraph id="8BB536933815F11CFF960C4B074ED81D" blockId="2.[85,267,1099,1119]" box="[85,267,1099,1119]" pageId="2" pageNumber="292">
<emphasis id="B97EEA813815F11CFF960C4B074ED81D" box="[85,267,1099,1119]" italics="true" pageId="2" pageNumber="292">Material examined</emphasis>
</paragraph>
<paragraph id="8BB536933815F11CFFB60C8404C4D9D1" blockId="2.[85,757,1156,1566]" pageId="2" pageNumber="292">
<typeStatus id="54B188313815F11CFFB60C840697D8D5" box="[117,210,1156,1175]" pageId="2" pageNumber="292" type="holotype">Holotype</typeStatus>
female (MNHN). Examined, labeled: “
<collectingCountry id="F31D76033815F11CFD960C8404D7D8D5" box="[597,658,1156,1175]" name="Brazil" pageId="2" pageNumber="292">Brésil</collectingCountry>
”.
<bibRefCitation id="EF9B4B623815F11CFD670C8406DDD8F1" author="Endrodi, S." pageId="2" pageNumber="292" pagination="147 - 208" refId="ref2000" refString="Endrodi, S., 1969. Monographie der Dynastinae. 4. Tribus: Pentodontini (Coleoptera, Lamellicornia). Ent. Abh. Mus. Tlerk. Dresden. 37, 147 - 208." type="journal article" year="1969">Endrödi (1969)</bibRefCitation>
designated a
<typeStatus id="54B188313815F11CFEE40CA007C3D8F1" box="[295,390,1184,1203]" pageId="2" pageNumber="292" type="lectotype">lectotype</typeStatus>
for this species, but this was incorrect because
<bibRefCitation id="EF9B4B623815F11CFF230CBC07CBD88D" author="Fairmaire, L." box="[224,398,1212,1231]" pageId="2" pageNumber="292" pagination="260 - 270" refId="ref2060" refString="Fairmaire, L., 1878. Description de coleopteres nouveaux d'Amerique. Rev. Mag. Zoo. Pur. Appliq. (Series 3) 6, 260 - 270." type="journal article" year="1878">Fairmaire (1878)</bibRefCitation>
specifically stated that there was only
<specimenCount id="9D0CFD1A3815F11CFF4E0CD80767D8A9" box="[141,290,1240,1259]" count="1" pageId="2" pageNumber="292" type="generic">one specimen</specimenCount>
. Article 74.2 (ICZN, 1999) stipulates that a unique specimen is to be regarded as a
<typeStatus id="54B188313815F11CFDEB0CF404C1D945" box="[552,644,1268,1287]" pageId="2" pageNumber="292" type="holotype">holotype</typeStatus>
. Although
<bibRefCitation id="EF9B4B623815F11CFF960D1006B7D961" author="Endrodi, S." box="[85,242,1296,1315]" pageId="2" pageNumber="292" pagination="147 - 208" refId="ref2000" refString="Endrodi, S., 1969. Monographie der Dynastinae. 4. Tribus: Pentodontini (Coleoptera, Lamellicornia). Ent. Abh. Mus. Tlerk. Dresden. 37, 147 - 208." type="journal article" year="1969">Endrödi (1969)</bibRefCitation>
just below his
<typeStatus id="54B188313815F11CFE5F0D1007BED961" box="[412,507,1296,1315]" pageId="2" pageNumber="292" type="lectotype">lectotype</typeStatus>
designation mentioned another female specimen from NHM and also as a
<typeStatus id="54B188313815F11CFD560D2B04B1D97C" box="[661,756,1323,1342]" pageId="2" pageNumber="292" type="lectotype">lectotype</typeStatus>
what was another mistake that must be disregarded. The
<typeStatus id="54B188313815F11CFD7D0D4706C7D935" pageId="2" pageNumber="292" type="holotype">holotype</typeStatus>
identification labels are available at the following site: http://coldb.mnhn.fr/catalognumber/mnhn/ec/ec7107.
</paragraph>
<paragraph id="8BB536933815F11CFFB60D9B071BDA5C" blockId="2.[85,757,1156,1566]" pageId="2" pageNumber="292">
Additional material.
<materialsCitation id="3B623CCE3815F11CFE820D9B0777D9A4" collectingDate="1933-04-20" collectingDateMax="2010-02" collectingDateMin="1933-04-20" collectionCode="MNRJ" collectorName="U. Caramaschi &amp; H. Niemeyer" country="Brazil" location="Serrinha do Alambari" municipality="Resende" pageId="2" pageNumber="292" specimenCount="2" specimenCount-male="2" stateProvince="Rio de Janeiro">
<collectingCountry id="F31D76033815F11CFE820D9B07CFD9EC" box="[321,394,1435,1454]" name="Brazil" pageId="2" pageNumber="292">BRASIL</collectingCountry>
,
<collectingRegion id="49CEF8713815F11CFE530D9B0458D9EC" box="[400,541,1435,1454]" country="Brazil" name="Rio de Janeiro" pageId="2" pageNumber="292">Rio de Janeiro</collectingRegion>
:
<collectingMunicipality id="6BD1ACE93815F11CFDE00D9B043FD9EC" box="[547,634,1435,1454]" pageId="2" pageNumber="292">Resende</collectingMunicipality>
,
<location id="8ED560483815F11CFD420D9B06F1D988" LSID="urn:lsid:plazi:treatment:03A387853816F11CFFB10907071BDA5C:8ED560483815F11CFD420D9B06F1D988" country="Brazil" municipality="Resende" name="Serrinha do Alambari" pageId="2" pageNumber="292" stateProvince="Rio de Janeiro">Serrinha do Alambari</location>
,
<date id="FFB410533815F11CFF7C0DB70743D988" box="[191,262,1463,1482]" pageId="2" pageNumber="292" value="2010-02">
<collectingDate id="EFF0E9BB3815F11CFF7C0DB70743D988" box="[191,262,1463,1482]" pageId="2" pageNumber="292" value="2010-02">ii.2010</collectingDate>
</date>
,
<collectorName id="26FF53453815F11CFED20DB707E1D988" box="[273,420,1463,1482]" pageId="2" pageNumber="292">U. Caramaschi</collectorName>
&amp;
<collectorName id="26FF53453815F11CFE010DB70406D988" box="[450,579,1463,1482]" pageId="2" pageNumber="292">H. Niemeyer</collectorName>
legs. [
<specimenCount id="9D0CFD1A3815F11CFD4A0DB704E3D988" box="[649,678,1463,1482]" count="1" pageId="2" pageNumber="292" type="male">1♂</specimenCount>
<collectionCode id="ED1BAE563815F11CFD6E0DB704A9D988" box="[685,748,1463,1482]" country="Brazil" httpUri="http://grbio.org/cool/zi1i-a0b5" name="Museu Nacional/Universidade Federal de Rio de Janeiro" pageId="2" pageNumber="292">MNRJ</collectionCode>
]. Itatiaia,
<date id="FFB410533815F11CFF690DD30751D9A4" box="[170,276,1491,1510]" pageId="2" pageNumber="292" value="1933-04-20">
<collectingDate id="EFF0E9BB3815F11CFF690DD30751D9A4" box="[170,276,1491,1510]" pageId="2" pageNumber="292" value="1933-04-20">20.iv.1933</collectingDate>
</date>
,
<specimenCount id="9D0CFD1A3815F11CFEE20DD30777D9A4" box="[289,306,1491,1510]" count="1" pageId="2" pageNumber="292" type="male"></specimenCount>
</materialsCitation>
,
<materialsCitation id="3B623CCE3815F11CFE830DD3071FDA5C" collectingDate="2012-02-27" collectingDateMax="2012-03-01" collectingDateMin="2012-02-27" collectionCode="FIOC, MNRJ" collectorName="Col. J. F. Zikan &amp; M. Cupello" country="Brazil" county="Itatiaia" location="Casa do Pesquisador" municipality="Parque Nacional do Itatiaia" pageId="2" pageNumber="292" specimenCount="2" specimenCount-female="1" specimenCount-male="1" stateProvince="Rio de Janeiro">
<collectorName id="26FF53453815F11CFE830DD30793D9A4" box="[320,470,1491,1510]" pageId="2" pageNumber="292">Col. J. F. Zikán</collectorName>
, [
<specimenCount id="9D0CFD1A3815F11CFE280DD3044DD9A4" box="[491,520,1491,1510]" count="1" pageId="2" pageNumber="292" type="male">1♂</specimenCount>
<collectionCode id="ED1BAE563815F11CFDD20DD30402D9A4" box="[529,583,1491,1510]" country="Brazil" httpUri="http://grbio.org/cool/2sxf-cwg4" name="Fundacao Instituto Oswaldo Cruz" pageId="2" pageNumber="292">FIOC</collectionCode>
];
<collectingCounty id="62D44E1F3815F11CFD9B0DD304E5D9A4" box="[600,672,1491,1510]" pageId="2" pageNumber="292">Itatiaia</collectingCounty>
,
<collectingMunicipality id="6BD1ACE93815F11CFD6E0DD30759DA40" pageId="2" pageNumber="292">Parque Nacional do Itatiaia</collectingMunicipality>
,
<location id="8ED560483815F11CFEE40DEF07B2DA40" LSID="urn:lsid:plazi:treatment:03A387853816F11CFFB10907071BDA5C:8ED560483815F11CFEE40DEF07B2DA40" box="[295,503,1519,1538]" country="Brazil" county="Itatiaia" municipality="Parque Nacional do Itatiaia" name="Casa do Pesquisador" pageId="2" pageNumber="292" stateProvince="Rio de Janeiro">Casa do Pesquisador</location>
,
<date id="FFB410533815F11CFDC20DEF04E2DA40" box="[513,679,1519,1538]" pageId="2" pageNumber="292" value="2012-02-27" valueMax="2012-03-01" valueMin="2012-02-27">
<collectingDate id="EFF0E9BB3815F11CFDC20DEF04E2DA40" box="[513,679,1519,1538]" pageId="2" pageNumber="292" value="2012-02-27" valueMax="2012-03-01" valueMin="2012-02-27">
27.ii-01.iii-
<quantity id="4CF29B763815F11CFDB30DEF04E2DA40" box="[624,679,1519,1538]" metricMagnitude="3" metricUnit="m" metricValue="2.01275" pageId="2" pageNumber="292" unit="m" value="2012.75">2012</quantity>
</collectingDate>
</date>
, 750 m,
<collectorName id="26FF53453815F11CFF960E0B0684DA5C" box="[85,193,1547,1566]" pageId="2" pageNumber="292">M. Cupello</collectorName>
leg. [
<specimenCount id="9D0CFD1A3815F11CFF3A0E0B0755DA5C" box="[249,272,1547,1566]" count="1" pageId="2" pageNumber="292" type="female">1♀</specimenCount>
<collectionCode id="ED1BAE563815F11CFED50E0B0710DA5C" box="[278,341,1547,1566]" country="Brazil" httpUri="http://grbio.org/cool/zi1i-a0b5" name="Museu Nacional/Universidade Federal de Rio de Janeiro" pageId="2" pageNumber="292">MNRJ</collectionCode>
]
</materialsCitation>
.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -1,55 +1,56 @@
<document id="13683E8D8085BE12D3D08F1C24A39294" ID-DOI="10.1590/1806-9665-RBENT-2019-0029" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722636650079" checkinUser="felipe" docAuthor="Parizotto, Daniele R. &amp; Melo, Gabriel A. R." docDate="2020" docId="03B68C5BFFDB8A10FC82F9FA9BDDF94D" docLanguage="en" docName="RevBrasEntomol.64.2.e20190029.pdf" docOrigin="Revista Brasileira de Entomologia (e 20190029) 64 (2)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Rhynostelis chrysogaster Parizotto &amp; Melo, 2020, sp. nov." docType="treatment" docUuid="501129CA-82FA-4E06-A17C-AC2CA2ACF651" docUuidSource="ZooBank" docVersion="1" lastPageNumber="5" masterDocId="FF8FF423FFD88A14FFA3FF91990AFFFA" masterDocTitle="Revision of the rare anthidiine bee genus Rhynostelis Moure &amp; Urban (Hymenoptera, Apidae)" masterLastPageNumber="7" masterPageNumber="1" pageNumber="4" updateTime="1722680913463" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0"> <document id="1DC65274E94C294C02CD42FC319C5922" ID-DOI="10.1590/1806-9665-RBENT-2019-0029" ID-ISSN="1806-9665" ID-Zenodo-Dep="13196367" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722636650079" checkinUser="felipe" docAuthor="Parizotto, Daniele R. &amp; Melo, Gabriel A. R." docDate="2020" docId="03B68C5BFFDB8A10FC82F9FA9BDDF94D" docLanguage="en" docName="RevBrasEntomol.64.2.e20190029.pdf" docOrigin="Revista Brasileira de Entomologia (e 20190029) 64 (2)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Rhynostelis chrysogaster Parizotto &amp; Melo, 2020, sp. nov." docType="treatment" docUuid="501129CA-82FA-4E06-A17C-AC2CA2ACF651" docUuidSource="ZooBank" docVersion="2" lastPageNumber="5" masterDocId="FF8FF423FFD88A14FFA3FF91990AFFFA" masterDocTitle="Revision of the rare anthidiine bee genus Rhynostelis Moure &amp; Urban (Hymenoptera, Apidae)" masterLastPageNumber="7" masterPageNumber="1" pageNumber="4" updateTime="1722684219090" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="DD36B5E60D8CCA8EB31086FA44D74A48" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="55027ACB869BF360EA2F773D0FB79B46" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="6BF15C095EBD3E104E68CA5F34C2D807"> <mods:titleInfo id="9C71B1F4FD196DDCE39F43C1BFC4B3F9">
<mods:title id="1E8622B489995609D1435441F0355225">Revision of the rare anthidiine bee genus Rhynostelis Moure &amp; Urban (Hymenoptera, Apidae)</mods:title> <mods:title id="3981B0B7FC49A1B2E980482E8402888D">Revision of the rare anthidiine bee genus Rhynostelis Moure &amp; Urban (Hymenoptera, Apidae)</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="384CBA6D91EE7FA1C1B284BACCD59764" type="personal"> <mods:name id="F78DD3D36D43619F689E6D583E804391" type="personal">
<mods:role id="14197E84EE3E5EA3DD2BA73D3C2E7A65"> <mods:role id="D8F685FD94DE93B426673516AAC77A0D">
<mods:roleTerm id="D60C26E0ED7997DBD3FD0501D9745540">Author</mods:roleTerm> <mods:roleTerm id="3E4536A638A81BD8551007B3CF8837B5">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="BB13A63870431E9DA1A56ADFB96DC69A">Parizotto, Daniele R.</mods:namePart> <mods:namePart id="F030DEF89CD21F98FD9DECFE7EBA7838">Parizotto, Daniele R.</mods:namePart>
<mods:affiliation id="359006A292904271147FE94281476AD6">Universidade Federal Rural de Pernambuco, Departamento de Agronomia, Recife, PE, Brazil</mods:affiliation> <mods:affiliation id="819019A81366312033FC164680797CF3">Universidade Federal Rural de Pernambuco, Departamento de Agronomia, Recife, PE, Brazil</mods:affiliation>
<mods:nameIdentifier id="DE9CA9A8145B9F1A33751BD8DF5E5D35" type="email">dparizotto@gmail.com</mods:nameIdentifier> <mods:nameIdentifier id="4EA4FD9CBF792C3F1DAA3DC753983FB8" type="email">dparizotto@gmail.com</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="E3C90C448AA45E7D94B476249F332E06" type="personal"> <mods:name id="F71F3E7D212B35BCAF8C275C44C2FC76" type="personal">
<mods:role id="01681276A422F1136483E933B811C443"> <mods:role id="90E7919EF9A25A772BF47D72FB846CDA">
<mods:roleTerm id="49B9E95717337EEACFBCB5F7642F5223">Author</mods:roleTerm> <mods:roleTerm id="F98FF8FA1860C106D601DC9882B4DA48">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="F17CC1D52104D86CC19A6721843F1D92">Melo, Gabriel A. R.</mods:namePart> <mods:namePart id="9CDD610CAD923DD203CF1F2240049BCD">Melo, Gabriel A. R.</mods:namePart>
<mods:affiliation id="1AC80187D8009B6768BEBC7751BB5E99">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biologia Comparada de Hymenoptera, Curitiba, PR,</mods:affiliation> <mods:affiliation id="BEE9F1D8CF3D5EEBB523E1B744B5EED3">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biologia Comparada de Hymenoptera, Curitiba, PR,</mods:affiliation>
</mods:name> </mods:name>
<mods:typeOfResource id="1F3C0A3CF5FC9610C3B3C8F4A86DDF18">text</mods:typeOfResource> <mods:typeOfResource id="D8BA8E60F96DB20A188FC8D1DFB25ABC">text</mods:typeOfResource>
<mods:relatedItem id="2AC9643128A92EF78951A444FDF35867" type="host"> <mods:relatedItem id="DE58415D73C21C7EF53446775F9AF8C4" type="host">
<mods:titleInfo id="10BEEA1A6947BE2C1DBCD753743EC4BB"> <mods:titleInfo id="55BDC101B10299FEC3A07EB881790AB2">
<mods:title id="24D3916756A8510DE8E71B105256FB69">Revista Brasileira de Entomologia</mods:title> <mods:title id="FE29C6FDEF909C9C5C6C70BD1F234441">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="8A5A8C720EF047734FE1179F94DEF863"> <mods:part id="67B2B53A9BF0954687A0B96B4E8E0C58">
<mods:date id="DBD3CF7290B19641C63C91813621207D">2020</mods:date> <mods:date id="4317E2E338AAE1A863F51BEC4997C467">2020</mods:date>
<mods:detail id="458674753D424082E966D98F439CAD6A" type="series"> <mods:detail id="623CF8A9D940794E91837BA723FDD586" type="series">
<mods:title id="2DEB15B8B078C59B5BC963BED55A2D73">e 20190029</mods:title> <mods:title id="59CBF67F9013395647701A6C8B8FDC2F">e 20190029</mods:title>
</mods:detail> </mods:detail>
<mods:detail id="4EF3F909C420D84B21F61FFE819AAC56" type="pubDate"> <mods:detail id="74DDD81B89539B1800B1BCDD8CDDCCAB" type="pubDate">
<mods:number id="B38CD2283FDBAF69983F8FC0F578ABD9">2020-06-01</mods:number> <mods:number id="33AE50FCEF5EF79137F5CE6C9CD75395">2020-06-01</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="64E8F5446842A6A2B38099ECF1B08BF1" type="volume"> <mods:detail id="DEC3C3DD1F3E3680BF34BD62F63006FF" type="volume">
<mods:number id="B35D0E0B5A6EB2B323FECE4A08AE6397">64</mods:number> <mods:number id="CFF76CAC2610ED6C9BA18ED1AF7F3620">64</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="EEEFD2E4E35061D11D9320B5216B94A9" type="issue"> <mods:detail id="F35FAF8BFA89801EF2DB1962CD5D4697" type="issue">
<mods:number id="13DDB7544C6CBE3EFC982398F0E59661">2</mods:number> <mods:number id="AA00A26B67F4C92F82A26D60FA0A97B4">2</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="67B753AB69E86E49BB3F707E522D8B53" unit="page"> <mods:extent id="A8B832432A4C2EBD5072AF7C7A52D541" unit="page">
<mods:start id="43D4135C100ADA242F513CC7A34938F8">1</mods:start> <mods:start id="A5E0B7F34D4FCC73BAC913156DBF7CC2">1</mods:start>
<mods:end id="5242BEC1F885F562547D0FCC1378E031">7</mods:end> <mods:end id="A8876C597AB7895FD9F1B017664B1939">7</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="5278A0170A3886FE7BAD2EEC1D8A4748"> <mods:location id="9447EE2785F285562A9FA7B2EA2662C3">
<mods:url id="135956FCE849703514169B613F5CFF5E">http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029</mods:url> <mods:url id="1D16F77B2DFA46DAD0B56A6F803E00B6">http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029</mods:url>
</mods:location> </mods:location>
<mods:classification id="B06AE8BBA7B27FA7E6F26CDD5DB69050">journal article</mods:classification> <mods:classification id="A69C7450C03A77BE5CFEF9827EA0260D">journal article</mods:classification>
<mods:identifier id="483B3F248CABD37E0B12EB372A03BF7C" type="DOI">10.1590/1806-9665-RBENT-2019-0029</mods:identifier> <mods:identifier id="B2E066440193CC07E4B9AC49EFE3A142" type="DOI">10.1590/1806-9665-RBENT-2019-0029</mods:identifier>
<mods:identifier id="526512D9BB8DAA8B89C208B74DBC96E8" type="ISSN">1806-9665</mods:identifier> <mods:identifier id="6C65654B84EDE3B666325A528B2941F6" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="739B3127DB0FC9A1AAAAC5C415682BC5" type="ZooBank">3D06396B-D9E4-48B7-A43E-C845D4C0A145</mods:identifier> <mods:identifier id="87FB184B60FB9588E9DBC96CE86FA7EE" type="Zenodo-Dep">13196367</mods:identifier>
<mods:identifier id="32EDB3B508FE15D88B95E694D13CA856" type="ZooBank">3D06396B-D9E4-48B7-A43E-C845D4C0A145</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="03B68C5BFFDB8A10FC82F9FA9BDDF94D" LSID="urn:lsid:zoobank.org:act:501129CA-82FA-4E06-A17C-AC2CA2ACF651" httpUri="http://treatment.plazi.org/id/03B68C5BFFDB8A10FC82F9FA9BDDF94D" lastPageId="4" lastPageNumber="5" pageId="3" pageNumber="4"> <treatment id="03B68C5BFFDB8A10FC82F9FA9BDDF94D" LSID="urn:lsid:zoobank.org:act:501129CA-82FA-4E06-A17C-AC2CA2ACF651" httpUri="http://treatment.plazi.org/id/03B68C5BFFDB8A10FC82F9FA9BDDF94D" lastPageId="4" lastPageNumber="5" pageId="3" pageNumber="4">
<subSubSection id="C3056EC6FFDB8A17FC82F9FA9D7BF985" box="[801,1137,1643,1663]" pageId="3" pageNumber="4" type="nomenclature"> <subSubSection id="C3056EC6FFDB8A17FC82F9FA9D7BF985" box="[801,1137,1643,1663]" pageId="3" pageNumber="4" type="nomenclature">
@ -65,7 +66,7 @@
<subSubSection id="C3056EC6FFDB8A17FCE4F91D9AA3F965" box="[839,937,1676,1695]" pageId="3" pageNumber="4" type="description"> <subSubSection id="C3056EC6FFDB8A17FCE4F91D9AA3F965" box="[839,937,1676,1695]" pageId="3" pageNumber="4" type="description">
<paragraph id="8BA03D4DFFDB8A17FCE4F91D9AA3F965" blockId="3.[839,937,1676,1695]" box="[839,937,1676,1695]" pageId="3" pageNumber="4"> <paragraph id="8BA03D4DFFDB8A17FCE4F91D9AA3F965" blockId="3.[839,937,1676,1695]" box="[839,937,1676,1695]" pageId="3" pageNumber="4">
( (
<figureCitation id="132421C8FFDB8A17FCECF91D9AABF965" box="[847,929,1676,1695]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="3" pageNumber="4">Figs. 1-5</figureCitation> <figureCitation id="132421C8FFDB8A17FCECF91D9AABF965" box="[847,929,1676,1695]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="3" pageNumber="4">Figs. 1-5</figureCitation>
) )
</paragraph> </paragraph>
</subSubSection> </subSubSection>
@ -73,11 +74,11 @@
<paragraph id="8BA03D4DFFDB8A17FCE4F95D9DDAF87B" blockId="3.[801,1475,1740,1985]" pageId="3" pageNumber="4"> <paragraph id="8BA03D4DFFDB8A17FCE4F95D9DDAF87B" blockId="3.[801,1475,1740,1985]" pageId="3" pageNumber="4">
<emphasis id="B96BE15FFFDB8A17FCE4F95D9ABAF925" bold="true" box="[839,944,1740,1759]" pageId="3" pageNumber="4">Diagnosis.</emphasis> <emphasis id="B96BE15FFFDB8A17FCE4F95D9ABAF925" bold="true" box="[839,944,1740,1759]" pageId="3" pageNumber="4">Diagnosis.</emphasis>
Clypeus and supraclypeal area protuberant, ending in a short medial tubercle on upper margin of clypeus; base of the mandible with broad and strongly-raised laminar projection ( Clypeus and supraclypeal area protuberant, ending in a short medial tubercle on upper margin of clypeus; base of the mandible with broad and strongly-raised laminar projection (
<figureCitation id="132421C8FFDB8A17FA93F89C9CB8F8DA" box="[1328,1458,1805,1824]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="3" pageNumber="4">Figs. 1 and 2</figureCitation> <figureCitation id="132421C8FFDB8A17FA93F89C9CB8F8DA" box="[1328,1458,1805,1824]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="3" pageNumber="4">Figs. 1 and 2</figureCitation>
); axillae projecting posteriorly, somewhat triangular; scutellum distinctly projected posteriorly and forming a strong medial emargination ( ); axillae projecting posteriorly, somewhat triangular; scutellum distinctly projected posteriorly and forming a strong medial emargination (
<figureCitation id="132421C8FFDB8A17FA20F8DC9CB9F89A" box="[1411,1459,1869,1888]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="3" pageNumber="4">Fig.3</figureCitation> <figureCitation id="132421C8FFDB8A17FA20F8DC9CB9F89A" box="[1411,1459,1869,1888]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="3" pageNumber="4">Fig.3</figureCitation>
); tergal pilosity yellowish ferruginous ( ); tergal pilosity yellowish ferruginous (
<figureCitation id="132421C8FFDB8A17FB33F8FC9DC9F87B" box="[1168,1219,1901,1921]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="3" pageNumber="4">Fig. 4</figureCitation> <figureCitation id="132421C8FFDB8A17FB33F8FC9DC9F87B" box="[1168,1219,1901,1921]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="3" pageNumber="4">Fig. 4</figureCitation>
). ).
</paragraph> </paragraph>
</subSubSection> </subSubSection>
@ -99,29 +100,29 @@ female. Approximate body length
<paragraph id="8BA03D4DFFDC8A10FFD2FF0B9A19FD18" blockId="4.[113,787,154,1720]" pageId="4" pageNumber="5"> <paragraph id="8BA03D4DFFDC8A10FFD2FF0B9A19FD18" blockId="4.[113,787,154,1720]" pageId="4" pageNumber="5">
<emphasis id="B96BE15FFFDC8A10FFD2FF0B99A2FF57" bold="true" box="[113,168,154,173]" pageId="4" pageNumber="5">Color</emphasis> <emphasis id="B96BE15FFFDC8A10FFD2FF0B99A2FF57" bold="true" box="[113,168,154,173]" pageId="4" pageNumber="5">Color</emphasis>
. Head integument yellow except: distal margin of mandible and apical tooth blackish; irregular black band above clypeus extending upwards, including ocelli, and connecting with black spot on vertex above compound eyes. Antenna light brown with dorsal surface of scape yellow; apex of pedicel and first flagellomere ferruginous ( . Head integument yellow except: distal margin of mandible and apical tooth blackish; irregular black band above clypeus extending upwards, including ocelli, and connecting with black spot on vertex above compound eyes. Antenna light brown with dorsal surface of scape yellow; apex of pedicel and first flagellomere ferruginous (
<figureCitation id="132421C8FFDC8A10FD37FE809A0CFEDE" box="[660,774,273,292]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="4" pageNumber="5">Figs.1 and 2</figureCitation> <figureCitation id="132421C8FFDC8A10FD37FE809A0CFEDE" box="[660,774,273,292]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="4" pageNumber="5">Figs.1 and 2</figureCitation>
). Pronotal lobe with a large yellow macula; scutum black with large reverse U-shaped yellow maculae; scutellum with two yellow bands on apex; axilla yellow; metanotum black; propodeum yellow except for the black propodeal spiracle ( ). Pronotal lobe with a large yellow macula; scutum black with large reverse U-shaped yellow maculae; scutellum with two yellow bands on apex; axilla yellow; metanotum black; propodeum yellow except for the black propodeal spiracle (
<figureCitation id="132421C8FFDC8A10FE0AFE1998D0FE61" box="[425,474,392,411]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="4" pageNumber="5">Fig.3</figureCitation> <figureCitation id="132421C8FFDC8A10FE0AFE1998D0FE61" box="[425,474,392,411]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="4" pageNumber="5">Fig.3</figureCitation>
). Mesepisternum mostly yellow, only with three irregular black maculae. Metepisternum largely yellow on its dorsal half and black ventrally. Tegula amber and fore wing membrane brown infumated, especially along costal margin ( ). Mesepisternum mostly yellow, only with three irregular black maculae. Metepisternum largely yellow on its dorsal half and black ventrally. Tegula amber and fore wing membrane brown infumated, especially along costal margin (
<figureCitation id="132421C8FFDC8A10FD72FE709A0FFE0E" box="[721,773,481,500]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="4" pageNumber="5">Fig. 3</figureCitation> <figureCitation id="132421C8FFDC8A10FD72FE709A0FFE0E" box="[721,773,481,500]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="4" pageNumber="5">Fig. 3</figureCitation>
). Legs almost totally yellow; fore coxae with half basal brown; fore and mid tibiae with darkish area on inner surface; hind legs with irregular darkish maculae on inner surface of femur and outer surface of tibia. Terga black with yellow maculae; yellow band on T1 broad, slightly narrower at middle; T2-T5 with even broader yellow band, T2 with two small brown spots medially; T4-T5 with larger translucent ferruginous margin; distal tergum yellow with a median subapical blackish spot ( ). Legs almost totally yellow; fore coxae with half basal brown; fore and mid tibiae with darkish area on inner surface; hind legs with irregular darkish maculae on inner surface of femur and outer surface of tibia. Terga black with yellow maculae; yellow band on T1 broad, slightly narrower at middle; T2-T5 with even broader yellow band, T2 with two small brown spots medially; T4-T5 with larger translucent ferruginous margin; distal tergum yellow with a median subapical blackish spot (
<figureCitation id="132421C8FFDC8A10FFDAFD5E99FAFD18" box="[121,240,719,738]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="4" pageNumber="5">Figs. 3 and 4</figureCitation> <figureCitation id="132421C8FFDC8A10FFDAFD5E99FAFD18" box="[121,240,719,738]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="4" pageNumber="5">Figs. 3 and 4</figureCitation>
). Sterna yellow, with large translucent margin on S1-S5. ). Sterna yellow, with large translucent margin on S1-S5.
</paragraph> </paragraph>
<paragraph id="8BA03D4DFFDC8A10FFD2FD7C9B22FA30" blockId="4.[113,787,154,1720]" pageId="4" pageNumber="5"> <paragraph id="8BA03D4DFFDC8A10FFD2FD7C9B22FA30" blockId="4.[113,787,154,1720]" pageId="4" pageNumber="5">
<emphasis id="B96BE15FFFDC8A10FFD2FD7C99E3FCFA" bold="true" box="[113,233,749,768]" pageId="4" pageNumber="5">Pubescence</emphasis> <emphasis id="B96BE15FFFDC8A10FFD2FD7C99E3FCFA" bold="true" box="[113,233,749,768]" pageId="4" pageNumber="5">Pubescence</emphasis>
. Yellowish with long hairs (longer than ocellus diameter). Pilosity longer and denser between ocelli, above antennal sockets and on clypeus ( . Yellowish with long hairs (longer than ocellus diameter). Pilosity longer and denser between ocelli, above antennal sockets and on clypeus (
<figureCitation id="132421C8FFDC8A10FEB2FCB9984EFCC1" box="[273,324,808,827]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="4" pageNumber="5">Fig. 2</figureCitation> <figureCitation id="132421C8FFDC8A10FEB2FCB9984EFCC1" box="[273,324,808,827]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="4" pageNumber="5">Fig. 2</figureCitation>
). Hairs on mesepisternum and legs longer than those on mesoscutum, slightly curved on pronotal lobe and apex of scutellum. Fore and mid legs with coxae and trochanter covered by denser pilosity. Terga covered by dense yellowish ferruginous pilosity ( ). Hairs on mesepisternum and legs longer than those on mesoscutum, slightly curved on pronotal lobe and apex of scutellum. Fore and mid legs with coxae and trochanter covered by denser pilosity. Terga covered by dense yellowish ferruginous pilosity (
<figureCitation id="132421C8FFDC8A10FFDAFC0E99A7FC48" box="[121,173,927,946]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="4" pageNumber="5">Fig. 4</figureCitation> <figureCitation id="132421C8FFDC8A10FFDAFC0E99A7FC48" box="[121,173,927,946]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="4" pageNumber="5">Fig. 4</figureCitation>
). S1-S5 with sparse light yellow hairs along posterior margin; S6 with light yellow hairs covering entire tergum. ). S1-S5 with sparse light yellow hairs along posterior margin; S6 with light yellow hairs covering entire tergum.
<emphasis id="B96BE15FFFDC8A10FD9BFC2C9BA0FC2A" bold="true" box="[568,682,957,976]" pageId="4" pageNumber="5">Sculpturing</emphasis> <emphasis id="B96BE15FFFDC8A10FD9BFC2C9BA0FC2A" bold="true" box="[568,682,957,976]" pageId="4" pageNumber="5">Sculpturing</emphasis>
. Head with shallow punctures, sparser on clypeal protuberance and supraclypeal area. Mesosoma with integument microreticulated, mesoscutum with punctures deep and confluent, separated only by their crests, slightly sparser on yellow areas; mesespisternum with larger and sparser punctures, distance between punctures at least one-half of puncture diameter. Scutellum with punctures sparser than those on mesoscutum; with large punctures intercalated with small punctures, separated by least a puncture diameter. Terga microreticulated; punctures on disc of T1-T5 fine and shallow; punctures on yellow bands larger and sparser than those on black areas; distal tergum with deeper and larger punctures. . Head with shallow punctures, sparser on clypeal protuberance and supraclypeal area. Mesosoma with integument microreticulated, mesoscutum with punctures deep and confluent, separated only by their crests, slightly sparser on yellow areas; mesespisternum with larger and sparser punctures, distance between punctures at least one-half of puncture diameter. Scutellum with punctures sparser than those on mesoscutum; with large punctures intercalated with small punctures, separated by least a puncture diameter. Terga microreticulated; punctures on disc of T1-T5 fine and shallow; punctures on yellow bands larger and sparser than those on black areas; distal tergum with deeper and larger punctures.
<emphasis id="B96BE15FFFDC8A10FF74FA959838FAED" bold="true" box="[215,306,1284,1303]" pageId="4" pageNumber="5">Structure</emphasis> <emphasis id="B96BE15FFFDC8A10FF74FA959838FAED" bold="true" box="[215,306,1284,1303]" pageId="4" pageNumber="5">Structure</emphasis>
. Mandible with condylar carina simple; antero-basal protuberance, near anterior articulation, broad and strongly raised, spatulate. Supraclypeal area with protuberant medial carina continuing onto clypeus, ending as a short medial protuberance on upper margin of clypeus ( . Mandible with condylar carina simple; antero-basal protuberance, near anterior articulation, broad and strongly raised, spatulate. Supraclypeal area with protuberant medial carina continuing onto clypeus, ending as a short medial protuberance on upper margin of clypeus (
<figureCitation id="132421C8FFDC8A10FF43FAEA9860FA74" box="[224,362,1403,1422]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="4" pageNumber="5">Figs. 1, 2 and 5</figureCitation> <figureCitation id="132421C8FFDC8A10FF43FAEA9860FA74" box="[224,362,1403,1422]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="4" pageNumber="5">Figs. 1, 2 and 5</figureCitation>
). Axilla somewhat triangular and separated from scutellum by deep emargination; scutellum with strong medial emargination along posterior margin ( ). Axilla somewhat triangular and separated from scutellum by deep emargination; scutellum with strong medial emargination along posterior margin (
<figureCitation id="132421C8FFDC8A10FE4BFA279B11FA30" box="[488,539,1462,1482]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." pageId="4" pageNumber="5">Fig. 3</figureCitation> <figureCitation id="132421C8FFDC8A10FE4BFA279B11FA30" box="[488,539,1462,1482]" captionStart="Figures 1-5" captionStartId="1.[83,144,1947,1964]" captionTargetBox="[358,1199,597,1922]" captionTargetId="figure-205@1.[358,1199,597,1923]" captionTargetPageId="1" captionText="Figures 1-5. Rhynostelis chrysogaster sp. nov., holotype female. 1, head, frontal view; 2, head, posterodorsal view; 3, habitus, dorsal view; 4, metasoma, dorsal view; 5, habitus, lateral view. Scale line = 2.0 mm (Figs. 1, 2 and 4). Scale line = 5.0 mm (Figs.3, 5)." figureDoi="http://doi.org/10.5281/zenodo.13196369" httpUri="https://zenodo.org/record/13196369/files/figure.png" pageId="4" pageNumber="5">Fig. 3</figureCitation>
). ).
</paragraph> </paragraph>
<paragraph id="8BA03D4DFFDC8A10FF34FA45983BFA1D" blockId="4.[113,787,154,1720]" box="[151,305,1492,1511]" pageId="4" pageNumber="5">Male unknown.</paragraph> <paragraph id="8BA03D4DFFDC8A10FF34FA45983BFA1D" blockId="4.[113,787,154,1720]" box="[151,305,1492,1511]" pageId="4" pageNumber="5">Male unknown.</paragraph>

View file

@ -1,57 +1,58 @@
<document id="E0E5B2E94113328C01940D2DD206A851" ID-DOI="10.1590/1806-9665-RBENT-2019-0029" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722636650079" checkinUser="felipe" docAuthor="Parizotto, Daniele R. &amp; Melo, Gabriel A. R." docDate="2020" docId="03B68C5BFFDC8A11FFD2F9629864FEA4" docLanguage="en" docName="RevBrasEntomol.64.2.e20190029.pdf" docOrigin="Revista Brasileira de Entomologia (e 20190029) 64 (2)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Rhynostelis plesiognatha Parizotto &amp; Melo, 2020, sp. nov." docType="treatment" docUuid="D4C22210-0A39-49CF-BEFC-0F9E111EACC0" docUuidSource="ZooBank" docVersion="1" lastPageNumber="6" masterDocId="FF8FF423FFD88A14FFA3FF91990AFFFA" masterDocTitle="Revision of the rare anthidiine bee genus Rhynostelis Moure &amp; Urban (Hymenoptera, Apidae)" masterLastPageNumber="7" masterPageNumber="1" pageNumber="5" updateTime="1722680913463" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0"> <document id="AB0A02D1CE3FCC8CB9714248BA6063C2" ID-DOI="10.1590/1806-9665-RBENT-2019-0029" ID-ISSN="1806-9665" ID-Zenodo-Dep="13196367" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722636650079" checkinUser="felipe" docAuthor="Parizotto, Daniele R. &amp; Melo, Gabriel A. R." docDate="2020" docId="03B68C5BFFDC8A11FFD2F9629864FEA4" docLanguage="en" docName="RevBrasEntomol.64.2.e20190029.pdf" docOrigin="Revista Brasileira de Entomologia (e 20190029) 64 (2)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Rhynostelis plesiognatha Parizotto &amp; Melo, 2020, sp. nov." docType="treatment" docUuid="D4C22210-0A39-49CF-BEFC-0F9E111EACC0" docUuidSource="ZooBank" docVersion="3" lastPageNumber="6" masterDocId="FF8FF423FFD88A14FFA3FF91990AFFFA" masterDocTitle="Revision of the rare anthidiine bee genus Rhynostelis Moure &amp; Urban (Hymenoptera, Apidae)" masterLastPageNumber="7" masterPageNumber="1" pageNumber="5" updateTime="1722684219090" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="BDAC61CC15843F572D137531192F9C07" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="A5EDD5DD58F01F18FCB40DF43A1B17EF" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="190DDEF2782375DE2FB3E6A0FAC5A8C3"> <mods:titleInfo id="126193A921E3C661EAF2CD18F852C3BB">
<mods:title id="B7369AEE1FD8A88B6CC4E58BF70E839D">Revision of the rare anthidiine bee genus Rhynostelis Moure &amp; Urban (Hymenoptera, Apidae)</mods:title> <mods:title id="0732E1D38D8243020B1E9BB4CA5A1FD3">Revision of the rare anthidiine bee genus Rhynostelis Moure &amp; Urban (Hymenoptera, Apidae)</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="D354EAF4AA19F80F2A80BCD2518D6698" type="personal"> <mods:name id="94FF32F10F3976919DA688266A845781" type="personal">
<mods:role id="0DB1FA6D10CFAD96142A14C8A5EA4533"> <mods:role id="5807FED693997E6984A6266531C4CACC">
<mods:roleTerm id="F33E66127A41C21CA1AD75C80D472EDB">Author</mods:roleTerm> <mods:roleTerm id="54A5697B8C83176454E7CBEED8F3AAD4">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="D5A79F2F2D514AB63AD5D60AA284989F">Parizotto, Daniele R.</mods:namePart> <mods:namePart id="FBD3406B9A0ECD5FB029B0DD046CA8F1">Parizotto, Daniele R.</mods:namePart>
<mods:affiliation id="BB36A1089ECE7EB8C0A33134C22B58C1">Universidade Federal Rural de Pernambuco, Departamento de Agronomia, Recife, PE, Brazil</mods:affiliation> <mods:affiliation id="CD4789E3BD02DEC8E5637A0E330CAA7C">Universidade Federal Rural de Pernambuco, Departamento de Agronomia, Recife, PE, Brazil</mods:affiliation>
<mods:nameIdentifier id="06201571BEA1F2004366AF85790817F4" type="email">dparizotto@gmail.com</mods:nameIdentifier> <mods:nameIdentifier id="6CF35C13FA05C9BFF7EC9F4107CC1447" type="email">dparizotto@gmail.com</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="130FC124E603EAD41095118E32B7DD6C" type="personal"> <mods:name id="2A04561656E8ED739AC6B790CB84CA42" type="personal">
<mods:role id="76ECF3590A207018EF8CECD5DFA42411"> <mods:role id="E5B1DFAC25AD87BA616EF5C9728B70BB">
<mods:roleTerm id="B451BFAF20C4C9C858ABC4E4783A9878">Author</mods:roleTerm> <mods:roleTerm id="005E47C1A32A9C2763F005636848D63A">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="3925FC77F6F1B302AE883389F9523876">Melo, Gabriel A. R.</mods:namePart> <mods:namePart id="7400F53C096AFF05D8350831E0DFADFA">Melo, Gabriel A. R.</mods:namePart>
<mods:affiliation id="353C5AD0138D6A09051D2261B40E0E63">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biologia Comparada de Hymenoptera, Curitiba, PR,</mods:affiliation> <mods:affiliation id="8AB620BF5835D405AEA5AC077795EC63">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biologia Comparada de Hymenoptera, Curitiba, PR,</mods:affiliation>
</mods:name> </mods:name>
<mods:typeOfResource id="63037146A27A2003CF308EE211BD2B76">text</mods:typeOfResource> <mods:typeOfResource id="B0FCF93840574D8E14AE2EE56E98281B">text</mods:typeOfResource>
<mods:relatedItem id="2B9C3CDACEC90772DE5D7184BA6FD5C1" type="host"> <mods:relatedItem id="BB0AA877D08C5EEBDBC9AF74FB375B95" type="host">
<mods:titleInfo id="A7E76F9464D665947E7A27C3635017B8"> <mods:titleInfo id="95256835BD3960D1280256D9A7D0441A">
<mods:title id="E05ADF190F8F982B1944300C67FD004E">Revista Brasileira de Entomologia</mods:title> <mods:title id="BEFFBB285E465CF77521C02BFAE664CF">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="55B188E30620F670BB891DDBB863EC10"> <mods:part id="2270E91CC8CCD2BCF5FC811B413A6529">
<mods:date id="4CCFED0989C7D116093F6B9992DA20CC">2020</mods:date> <mods:date id="CE261034BC6E4C0F8D8FDE868ECC1BCC">2020</mods:date>
<mods:detail id="905AF3C125A59AAFAA3E36FDF891DEA7" type="series"> <mods:detail id="DD0B78C1767C072125E38718C91C17D5" type="series">
<mods:title id="5AE62D073CA96EDAFD8603FFC874CAB8">e 20190029</mods:title> <mods:title id="5B885C54DF504E84F4DAA530D32AE3F6">e 20190029</mods:title>
</mods:detail> </mods:detail>
<mods:detail id="E4CEFD101401C3FAED4F59ACF32F407D" type="pubDate"> <mods:detail id="4BEBFBFBF07AD6C9536DB897C1E58FFF" type="pubDate">
<mods:number id="A0F4337632AB107C124F6B5148EBA8D3">2020-06-01</mods:number> <mods:number id="037BB4CCA4A19DC827F96FDD562846A4">2020-06-01</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="8C119E43A11291CEF0E107E3F7EA6E38" type="volume"> <mods:detail id="FA23BD2D3C3C551088A1285DD76CD6A9" type="volume">
<mods:number id="125C65514DCB3095FF0FB898F1238780">64</mods:number> <mods:number id="CEAE5885248B563A26DED32ED0C41FB7">64</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="F79C5D919EDFB2D74EA24F060E83DB4E" type="issue"> <mods:detail id="B1F79A3A585D7D1949CCBC971FD64496" type="issue">
<mods:number id="5DF80F3F01420A0E2AB4224B0472EFF2">2</mods:number> <mods:number id="A38D4428A4A5090098C91AC93BE45D7E">2</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="8010DD181A559060B46EE211DEB9747E" unit="page"> <mods:extent id="EAB8E7FCD4E0D396BC7257E7991626C0" unit="page">
<mods:start id="F34196081999757D8EED356D06FB3134">1</mods:start> <mods:start id="FED336236DC8C0FBE81DC2AC9291D0FC">1</mods:start>
<mods:end id="4F17BDF68AF170D1F67552F1994BD6A1">7</mods:end> <mods:end id="A263502546DF4A26B249B032541CA9A0">7</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="E7400592F41F0C0F336F5E6719A1F402"> <mods:location id="4C7107AC05CB67CD3EBA20ACD250CB73">
<mods:url id="DD9EBC5B7A4B7E4735E0A01A732816CA">http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029</mods:url> <mods:url id="1C012E933891F13FA12FA816FE9F684B">http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029</mods:url>
</mods:location> </mods:location>
<mods:classification id="323D8340C6CB1D094A42989788AEB66F">journal article</mods:classification> <mods:classification id="79B07FAB8E1FB7F28BDCB32B0AA58651">journal article</mods:classification>
<mods:identifier id="9F4529836483DE4045048B4E83BD18BF" type="DOI">10.1590/1806-9665-RBENT-2019-0029</mods:identifier> <mods:identifier id="3BD2331F76BF45BBD12E4021BC933C62" type="DOI">10.1590/1806-9665-RBENT-2019-0029</mods:identifier>
<mods:identifier id="FF3A68D3D97A42D9360F598A7E0FCC71" type="ISSN">1806-9665</mods:identifier> <mods:identifier id="999C04A4485728EFFC78CA068CB3926A" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="B41828B4D2964753B2116E93176CB0C1" type="ZooBank">3D06396B-D9E4-48B7-A43E-C845D4C0A145</mods:identifier> <mods:identifier id="7A334CDCDC9A26E5497F74B2823D2BD9" type="Zenodo-Dep">13196367</mods:identifier>
<mods:identifier id="B4ABD292818A82918F267EAE8C0BCB83" type="ZooBank">3D06396B-D9E4-48B7-A43E-C845D4C0A145</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="03B68C5BFFDC8A11FFD2F9629864FEA4" LSID="urn:lsid:zoobank.org:act:D4C22210-0A39-49CF-BEFC-0F9E111EACC0" httpUri="http://treatment.plazi.org/id/03B68C5BFFDC8A11FFD2F9629864FEA4" lastPageId="5" lastPageNumber="6" pageId="4" pageNumber="5"> <treatment id="03B68C5BFFDC8A11FFD2F9629864FEA4" ID-DOI="http://doi.org/10.5281/zenodo.13195119" ID-Zenodo-Dep="13195119" LSID="urn:lsid:zoobank.org:act:D4C22210-0A39-49CF-BEFC-0F9E111EACC0" httpUri="http://treatment.plazi.org/id/03B68C5BFFDC8A11FFD2F9629864FEA4" lastPageId="5" lastPageNumber="6" pageId="4" pageNumber="5">
<subSubSection id="C3056EC6FFDC8A10FFD2F96298CEF8FD" box="[113,452,1779,1799]" pageId="4" pageNumber="5" type="nomenclature"> <subSubSection id="C3056EC6FFDC8A10FFD2F96298CEF8FD" box="[113,452,1779,1799]" pageId="4" pageNumber="5" type="nomenclature">
<paragraph id="8BA03D4DFFDC8A10FFD2F96298CEF8FD" blockId="4.[113,452,1779,1799]" box="[113,452,1779,1799]" pageId="4" pageNumber="5"> <paragraph id="8BA03D4DFFDC8A10FFD2F96298CEF8FD" blockId="4.[113,452,1779,1799]" box="[113,452,1779,1799]" pageId="4" pageNumber="5">
<heading id="D0E88A21FFDC8A10FFD2F96298CEF8FD" bold="true" box="[113,452,1779,1799]" fontSize="8" level="2" pageId="4" pageNumber="5" reason="2"> <heading id="D0E88A21FFDC8A10FFD2F96298CEF8FD" bold="true" box="[113,452,1779,1799]" fontSize="8" level="2" pageId="4" pageNumber="5" reason="2">
@ -65,7 +66,7 @@
<subSubSection id="C3056EC6FFDC8A10FF34F8809A19F892" pageId="4" pageNumber="5" type="description"> <subSubSection id="C3056EC6FFDC8A10FF34F8809A19F892" pageId="4" pageNumber="5" type="description">
<paragraph id="8BA03D4DFFDC8A10FF34F880980EF8DE" blockId="4.[151,260,1809,1828]" box="[151,260,1809,1828]" pageId="4" pageNumber="5"> <paragraph id="8BA03D4DFFDC8A10FF34F880980EF8DE" blockId="4.[151,260,1809,1828]" box="[151,260,1809,1828]" pageId="4" pageNumber="5">
( (
<figureCitation id="132421C8FFDC8A10FF3CF88099F6F8DE" box="[159,252,1809,1828]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." pageId="4" pageNumber="5">Figs. 6-10</figureCitation> <figureCitation id="132421C8FFDC8A10FF3CF88099F6F8DE" box="[159,252,1809,1828]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." figureDoi="http://doi.org/10.5281/zenodo.13196371" httpUri="https://zenodo.org/record/13196371/files/figure.png" pageId="4" pageNumber="5">Figs. 6-10</figureCitation>
) )
</paragraph> </paragraph>
<paragraph id="8BA03D4DFFDC8A10FF34F8C49A19F892" blockId="4.[113,787,1877,1985]" box="[151,787,1877,1896]" pageId="4" pageNumber="5"> <paragraph id="8BA03D4DFFDC8A10FF34F8C49A19F892" blockId="4.[113,787,1877,1985]" box="[151,787,1877,1896]" pageId="4" pageNumber="5">
@ -114,18 +115,18 @@ as
This new species is more similar to This new species is more similar to
<taxonomicName id="4C1F46CEFFDC8A10FABBFEFB9CA8FE86" baseAuthorityName="Smith" baseAuthorityYear="1879" box="[1304,1442,361,381]" class="Insecta" family="Megachilidae" genus="Rhynostelis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="multiplicata">R. multiplicata</taxonomicName> <taxonomicName id="4C1F46CEFFDC8A10FABBFEFB9CA8FE86" baseAuthorityName="Smith" baseAuthorityYear="1879" box="[1304,1442,361,381]" class="Insecta" family="Megachilidae" genus="Rhynostelis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="multiplicata">R. multiplicata</taxonomicName>
by the color pattern; the axillae rounded; scutellum with shallow posterior emargination ( by the color pattern; the axillae rounded; scutellum with shallow posterior emargination (
<figureCitation id="132421C8FFDC8A10FC6DFE349AF5FE42" box="[974,1023,421,440]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." pageId="4" pageNumber="5">Fig.8</figureCitation> <figureCitation id="132421C8FFDC8A10FC6DFE349AF5FE42" box="[974,1023,421,440]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." figureDoi="http://doi.org/10.5281/zenodo.13196371" httpUri="https://zenodo.org/record/13196371/files/figure.png" pageId="4" pageNumber="5">Fig.8</figureCitation>
) and tergal pilosity brown to black ( ) and tergal pilosity brown to black (
<figureCitation id="132421C8FFDC8A10FAF6FE349C9AFE42" box="[1365,1424,421,440]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." pageId="4" pageNumber="5">Figs. 9</figureCitation> <figureCitation id="132421C8FFDC8A10FAF6FE349C9AFE42" box="[1365,1424,421,440]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." figureDoi="http://doi.org/10.5281/zenodo.13196371" httpUri="https://zenodo.org/record/13196371/files/figure.png" pageId="4" pageNumber="5">Figs. 9</figureCitation>
and and
<figureCitation id="132421C8FFDC8A10FA1FFE349CD9FE42" box="[1468,1491,421,440]" captionStart="Figures 11-15" captionStartId="3.[83,144,1544,1561]" captionTargetBox="[330,1227,151,1520]" captionTargetId="figure-215@3.[330,1227,151,1520]" captionTargetPageId="3" captionText="Figures 11-15. Rhynostelis multiplicata, female specimen from Suriname. 11, head, anteroventral view; 12, head, posterodorsal view; 13, habitus, dorsal view; 14, metasoma, dorsal view; 15, habitus, lateral view. Scale line = 2.0 mm (Figs. 11, 12 and 14). Scale line = 5.0 mm (Figs.13 and 15)." pageId="4" pageNumber="5">14</figureCitation> <figureCitation id="132421C8FFDC8A10FA1FFE349CD9FE42" box="[1468,1491,421,440]" captionStart="Figures 11-15" captionStartId="3.[83,144,1544,1561]" captionTargetBox="[330,1227,151,1520]" captionTargetId="figure-215@3.[330,1227,151,1520]" captionTargetPageId="3" captionText="Figures 11-15. Rhynostelis multiplicata, female specimen from Suriname. 11, head, anteroventral view; 12, head, posterodorsal view; 13, habitus, dorsal view; 14, metasoma, dorsal view; 15, habitus, lateral view. Scale line = 2.0 mm (Figs. 11, 12 and 14). Scale line = 5.0 mm (Figs.13 and 15)." figureDoi="http://doi.org/10.5281/zenodo.13196373" httpUri="https://zenodo.org/record/13196373/files/figure.png" pageId="4" pageNumber="5">14</figureCitation>
). The females of ). The females of
<taxonomicName id="4C1F46CEFFDC8A10FC70FE529D63FE2C" authorityName="Parizotto &amp; Melo" authorityYear="2020" box="[979,1129,451,470]" class="Insecta" family="Megachilidae" genus="Rhynostelis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="plesiognatha" status="sp. nov.">R. plesiognatha</taxonomicName> <taxonomicName id="4C1F46CEFFDC8A10FC70FE529D63FE2C" authorityName="Parizotto &amp; Melo" authorityYear="2020" box="[979,1129,451,470]" class="Insecta" family="Megachilidae" genus="Rhynostelis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="plesiognatha" status="sp. nov.">R. plesiognatha</taxonomicName>
<taxonomicNameLabel id="A2585C24FFDC8A10FBCDFE529DB2FE2C" box="[1134,1208,451,470]" pageId="4" pageNumber="5" rank="species">sp. nov.</taxonomicNameLabel> <taxonomicNameLabel id="A2585C24FFDC8A10FBCDFE529DB2FE2C" box="[1134,1208,451,470]" pageId="4" pageNumber="5" rank="species">sp. nov.</taxonomicNameLabel>
can be easily distinguished by their less modified clypeus, provided only with a short tubercle on the upper margin and lacking the strongly raised beak-like projection of can be easily distinguished by their less modified clypeus, provided only with a short tubercle on the upper margin and lacking the strongly raised beak-like projection of
<taxonomicName id="4C1F46CEFFDC8A10FCFAFD8D9AE2FDD5" baseAuthorityName="Smith" baseAuthorityYear="1879" box="[857,1000,540,559]" class="Insecta" family="Megachilidae" genus="Rhynostelis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="multiplicata">R. multiplicata</taxonomicName> <taxonomicName id="4C1F46CEFFDC8A10FCFAFD8D9AE2FDD5" baseAuthorityName="Smith" baseAuthorityYear="1879" box="[857,1000,540,559]" class="Insecta" family="Megachilidae" genus="Rhynostelis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="multiplicata">R. multiplicata</taxonomicName>
, and by its simpler mandible, with a short truncate projection near the anterior articulation ( , and by its simpler mandible, with a short truncate projection near the anterior articulation (
<figureCitation id="132421C8FFDC8A10FB77FDA89C46FDB7" box="[1236,1356,569,589]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." pageId="4" pageNumber="5">Figs. 6 and 7</figureCitation> <figureCitation id="132421C8FFDC8A10FB77FDA89C46FDB7" box="[1236,1356,569,589]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." figureDoi="http://doi.org/10.5281/zenodo.13196371" httpUri="https://zenodo.org/record/13196371/files/figure.png" pageId="4" pageNumber="5">Figs. 6 and 7</figureCitation>
). ).
</paragraph> </paragraph>
</subSubSection> </subSubSection>
@ -146,27 +147,27 @@ female. Approximate body length
<paragraph id="8BA03D4DFFDC8A10FC9CFD039CEBFACE" blockId="4.[831,1506,153,1985]" pageId="4" pageNumber="5"> <paragraph id="8BA03D4DFFDC8A10FC9CFD039CEBFACE" blockId="4.[831,1506,153,1985]" pageId="4" pageNumber="5">
<emphasis id="B96BE15FFFDC8A10FC9CFD039A71FD5F" bold="true" box="[831,891,658,677]" pageId="4" pageNumber="5">Color.</emphasis> <emphasis id="B96BE15FFFDC8A10FC9CFD039A71FD5F" bold="true" box="[831,891,658,677]" pageId="4" pageNumber="5">Color.</emphasis>
Head integument yellow except: distal margin of mandible and apical tooth blackish; black band on supraclyeal area extending upward to vertex ( Head integument yellow except: distal margin of mandible and apical tooth blackish; black band on supraclyeal area extending upward to vertex (
<figureCitation id="132421C8FFDC8A10FC08FD5F9D27FD1B" box="[939,1069,718,737]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." pageId="4" pageNumber="5">Figs. 6 and 7</figureCitation> <figureCitation id="132421C8FFDC8A10FC08FD5F9D27FD1B" box="[939,1069,718,737]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." figureDoi="http://doi.org/10.5281/zenodo.13196371" httpUri="https://zenodo.org/record/13196371/files/figure.png" pageId="4" pageNumber="5">Figs. 6 and 7</figureCitation>
). Pronotal lobe yellow; scutum black with reverse U-shaped yellow maculae almost reaching the scutoscutellar suture; scutellum with two large subapical yellow bands; axilla yellow. Mesepisternum yellow, with a little black spot medially. Tegula reddish brown, with a yellow spot anteriorly; fore wing membrane brown infumated throughout. Legs predominantly yellow ( ). Pronotal lobe yellow; scutum black with reverse U-shaped yellow maculae almost reaching the scutoscutellar suture; scutellum with two large subapical yellow bands; axilla yellow. Mesepisternum yellow, with a little black spot medially. Tegula reddish brown, with a yellow spot anteriorly; fore wing membrane brown infumated throughout. Legs predominantly yellow (
<figureCitation id="132421C8FFDC8A10FAEBFCF29CD9FC8C" box="[1352,1491,867,886]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." pageId="4" pageNumber="5">Figs. 8 and 10</figureCitation> <figureCitation id="132421C8FFDC8A10FAEBFCF29CD9FC8C" box="[1352,1491,867,886]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." figureDoi="http://doi.org/10.5281/zenodo.13196371" httpUri="https://zenodo.org/record/13196371/files/figure.png" pageId="4" pageNumber="5">Figs. 8 and 10</figureCitation>
). Terga black with yellow maculae; yellow band on T1 angled at middle; yellow band on T2-T5 wider and slightly interrupted medially; T6 with two large yellow spots ( ). Terga black with yellow maculae; yellow band on T1 angled at middle; yellow band on T2-T5 wider and slightly interrupted medially; T6 with two large yellow spots (
<figureCitation id="132421C8FFDC8A10FB8EFC2D9D6BFC35" box="[1069,1121,956,975]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." pageId="4" pageNumber="5">Fig. 9</figureCitation> <figureCitation id="132421C8FFDC8A10FB8EFC2D9D6BFC35" box="[1069,1121,956,975]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." figureDoi="http://doi.org/10.5281/zenodo.13196371" httpUri="https://zenodo.org/record/13196371/files/figure.png" pageId="4" pageNumber="5">Fig. 9</figureCitation>
). Three basal sterna yellow, with large translucent margin; S4 yellow with dark infuscated area medially; S6 black with two lateral yellow spots. ). Three basal sterna yellow, with large translucent margin; S4 yellow with dark infuscated area medially; S6 black with two lateral yellow spots.
<emphasis id="B96BE15FFFDC8A10FB00FC669C1CFBF0" bold="true" box="[1187,1302,1015,1034]" pageId="4" pageNumber="5">Pubescence</emphasis> <emphasis id="B96BE15FFFDC8A10FB00FC669C1CFBF0" bold="true" box="[1187,1302,1015,1034]" pageId="4" pageNumber="5">Pubescence</emphasis>
. Head and mesosoma with mostly light yellowish ferruginous pilosity, shorter than ocellar diameter.Pubescence longer and denser between ocelli, above antennal sockets and lower margin of clypeus. Hairs of mesepisternum slightly longer and denser than those on mesoscutum ( . Head and mesosoma with mostly light yellowish ferruginous pilosity, shorter than ocellar diameter.Pubescence longer and denser between ocelli, above antennal sockets and lower margin of clypeus. Hairs of mesepisternum slightly longer and denser than those on mesoscutum (
<figureCitation id="132421C8FFDC8A10FAA6FBFF9C32FB7B" box="[1285,1336,1134,1153]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." pageId="4" pageNumber="5">Fig. 8</figureCitation> <figureCitation id="132421C8FFDC8A10FAA6FBFF9C32FB7B" box="[1285,1336,1134,1153]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." figureDoi="http://doi.org/10.5281/zenodo.13196371" httpUri="https://zenodo.org/record/13196371/files/figure.png" pageId="4" pageNumber="5">Fig. 8</figureCitation>
). Pilosity of terga as in ). Pilosity of terga as in
<taxonomicName id="4C1F46CEFFDC8A10FCD0FB1D9D08FB65" baseAuthorityName="Smith" baseAuthorityYear="1879" box="[883,1026,1164,1183]" class="Insecta" family="Megachilidae" genus="Rhynostelis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="multiplicata">R. multiplicata</taxonomicName> <taxonomicName id="4C1F46CEFFDC8A10FCD0FB1D9D08FB65" baseAuthorityName="Smith" baseAuthorityYear="1879" box="[883,1026,1164,1183]" class="Insecta" family="Megachilidae" genus="Rhynostelis" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="multiplicata">R. multiplicata</taxonomicName>
. .
<emphasis id="B96BE15FFFDC8A10FBAEFB1A9D8FFB64" bold="true" box="[1037,1157,1163,1182]" pageId="4" pageNumber="5">Sculpturing</emphasis> <emphasis id="B96BE15FFFDC8A10FBAEFB1A9D8FFB64" bold="true" box="[1037,1157,1163,1182]" pageId="4" pageNumber="5">Sculpturing</emphasis>
. Head with shallow and coalescent punctures; smaller and fine on disc of clypeus. Mesoscutum with deeper and smaller punctures than those on head. Gibbous area of mesepisternum with punctures sparser than on mesoscutum. Punctures of terga fine and shallow; punctures on yellow bands larger and sparser than those on black areas ( . Head with shallow and coalescent punctures; smaller and fine on disc of clypeus. Mesoscutum with deeper and smaller punctures than those on head. Gibbous area of mesepisternum with punctures sparser than on mesoscutum. Punctures of terga fine and shallow; punctures on yellow bands larger and sparser than those on black areas (
<figureCitation id="132421C8FFDC8A10FB9DFAB19D7AFAC9" box="[1086,1136,1312,1331]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." pageId="4" pageNumber="5">Fig. 9</figureCitation> <figureCitation id="132421C8FFDC8A10FB9DFAB19D7AFAC9" box="[1086,1136,1312,1331]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." figureDoi="http://doi.org/10.5281/zenodo.13196371" httpUri="https://zenodo.org/record/13196371/files/figure.png" pageId="4" pageNumber="5">Fig. 9</figureCitation>
); distal tergum with larger punctures. ); distal tergum with larger punctures.
</paragraph> </paragraph>
<paragraph id="8BA03D4DFFDC8A10FC9CFAAF9D13FA50" blockId="4.[831,1506,153,1985]" pageId="4" pageNumber="5"> <paragraph id="8BA03D4DFFDC8A10FC9CFAAF9D13FA50" blockId="4.[831,1506,153,1985]" pageId="4" pageNumber="5">
<emphasis id="B96BE15FFFDC8A10FC9CFAAF9AABFAAB" bold="true" box="[831,929,1342,1361]" pageId="4" pageNumber="5">Structure</emphasis> <emphasis id="B96BE15FFFDC8A10FC9CFAAF9AABFAAB" bold="true" box="[831,929,1342,1361]" pageId="4" pageNumber="5">Structure</emphasis>
. Mandible with bifurcated condylar carina, antero-basal projection short and truncate; supraclypeal area not raised, except for the medial carina; clypeus with a small medial tubercle on its upper margin ( . Mandible with bifurcated condylar carina, antero-basal projection short and truncate; supraclypeal area not raised, except for the medial carina; clypeus with a small medial tubercle on its upper margin (
<figureCitation id="132421C8FFDC8A10FC30FA069D01FA51" box="[915,1035,1431,1451]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." pageId="4" pageNumber="5">Figs. 6 and 7</figureCitation> <figureCitation id="132421C8FFDC8A10FC30FA069D01FA51" box="[915,1035,1431,1451]" captionStart="Figures 6-10" captionStartId="2.[113,174,1947,1964]" captionTargetBox="[393,1224,696,1921]" captionTargetId="figure-353@2.[393,1224,696,1921]" captionTargetPageId="2" captionText="Figures 6-10. Rhynostelis plesiognatha sp. nov., holotype female. 6, head, frontal view; 7, head and mesosoma, lateral view; 8, head and mesosoma, dorsal view; 9, metasoma, dorsal view; 10, habitus, lateral view. Scale line = 2.0 mm." figureDoi="http://doi.org/10.5281/zenodo.13196371" httpUri="https://zenodo.org/record/13196371/files/figure.png" pageId="4" pageNumber="5">Figs. 6 and 7</figureCitation>
). ).
</paragraph> </paragraph>
<paragraph id="8BA03D4DFFDC8A10FCC6FA249C81F8F5" blockId="4.[831,1506,153,1985]" pageId="4" pageNumber="5"> <paragraph id="8BA03D4DFFDC8A10FCC6FA249C81F8F5" blockId="4.[831,1506,153,1985]" pageId="4" pageNumber="5">

View file

@ -0,0 +1,111 @@
<document id="804327FD562C8E52596C8230A8BFB28C" ID-DOI="10.1016/j.rbe.2018.08.005" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722640225358" checkinUser="felipe" docAuthor="Froza, Joyce A., Cavichioli, Rodney R., Costa, Luiz A. A. &amp; Mejdalani, Gabriel" docDate="2018" docId="03C8878DFF8F132CFFC1ABEAFD6739CA" docLanguage="en" docName="RevBrasEntomol.62.4.315-318.pdf" docOrigin="Revista Brasileira de Entomologia (Rev. Bras. Entomol.) 62 (4)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.08.005" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Hanshumba setifera Froza, Cavichioli, Costa &amp; Mejdalani, 2018, sp. nov." docType="treatment" docUuid="E12B46B0-51A1-4F32-B96D-CF07AD7385F7" docUuidSource="ZooBank" docVersion="1" lastPageNumber="316" masterDocId="FFF1FFF5FF8E132DFFB4AF6AFFD43C29" masterDocTitle="Two new species of Hanshumba from Southeastern Brazil and a key to males of the genus (Insecta: Hemiptera: Cicadellidae: Cicadellini)" masterLastPageNumber="318" masterPageNumber="315" pageNumber="316" updateTime="1722683786525" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="90695044B61EA334967A6A69C7446D80" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="67D0FF365238F92D6E4DEC313CC5E3B3">
<mods:title id="CF9E45F48DCC3C9FA62C3A0094AB5ED2">Two new species of Hanshumba from Southeastern Brazil and a key to males of the genus (Insecta: Hemiptera: Cicadellidae: Cicadellini)</mods:title>
</mods:titleInfo>
<mods:name id="F086A411B6B70056103F42AF280E25DA" type="personal">
<mods:role id="D01815824193AC5E2DFB3B95B7B5E4BD">
<mods:roleTerm id="A7DE72AD1F276ECBE7B9EB0444245599">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="420377035843F2083066A44AC0FD6C9C">Froza, Joyce A.</mods:namePart>
<mods:affiliation id="6FB825D4DF63D14B987D3D6DE72D90F4">Universidade de São Paulo, Escola Superior de Agricultura “ Luiz de Queiroz ”, Departamento de Entomologia e Acarologia, Piracicaba, SP, Brazil</mods:affiliation>
</mods:name>
<mods:name id="5D88D03C51BC613B47C5463F97B89E5A" type="personal">
<mods:role id="0243B26133A0680291766F77F710841D">
<mods:roleTerm id="2542F9610E42CD315ACA5FFEA74C57BD">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="812A069BB75A1F4ED81B2D9A4DB99A7E">Cavichioli, Rodney R.</mods:namePart>
<mods:affiliation id="5866F049F53509EBB90C4D91DE85427A">Universidade Federal do Paraná, Setor de Ciências Biológicas, Departamento de Zoologia, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:name id="69049280A41C7C91B862190FFF89D11F" type="personal">
<mods:role id="8DB4FF157C324FF3A892F04D31786223">
<mods:roleTerm id="8208BE05992EAC1E82239ED354E72758">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="30361B4BEF8F4FAFAD62E2518F0436E8">Costa, Luiz A. A.</mods:namePart>
<mods:affiliation id="A708B251ED2C1D35BD11DCE387EEEAE2">Universidade Federal do Rio de Janeiro, Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brazil</mods:affiliation>
</mods:name>
<mods:name id="56B282659D4501491412CAC07AF7522C" type="personal">
<mods:role id="7BAC1ADFCA7859137C2B8AAB974D5C31">
<mods:roleTerm id="AEEBD8D5C3347E2A886667A3BDD779ED">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="6AF1C3A09799021DB9B819A6BF3B682A">Mejdalani, Gabriel</mods:namePart>
<mods:affiliation id="F5A7507DE1D6710BC0E3228ADB54B805">Universidade Federal do Rio de Janeiro, Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="86F1390D6C792816E4C38338699E7426">text</mods:typeOfResource>
<mods:relatedItem id="B4709B975449E998887844D84056F231" type="host">
<mods:titleInfo id="22E7CF2995885E6B092078B3A64D7952">
<mods:title id="3E25B1194ECAA0A7AF1920CD59B6E802">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="4082B47C65C0419D3AEDEA997C73EC5A">
<mods:date id="2342A786A48DFA07AA6CC4370495B38D">2018</mods:date>
<mods:detail id="296EF600D89858AB2E9D1C11A6242E6C" type="series">
<mods:title id="96F62B34F5F650DCEF7309E5095E29FC">Rev. Bras. Entomol.</mods:title>
</mods:detail>
<mods:detail id="CE2F9903C4C97FA62687B7858705848F" type="pubDate">
<mods:number id="7DFB5509283F5B944E3A1EC59264B8EB">2018-09-10</mods:number>
</mods:detail>
<mods:detail id="C3362FFBA10948499EF899846F25D252" type="volume">
<mods:number id="202DE6AA477AB471D88ECFB5CF2B9DA2">62</mods:number>
</mods:detail>
<mods:detail id="F53F8F511B9EFDAF61C546CD7AF494C3" type="issue">
<mods:number id="B5EB311F33FCD3A21CB135113551931A">4</mods:number>
</mods:detail>
<mods:extent id="6DF0871D05DB3814EA684292A15EDAC8" unit="page">
<mods:start id="4A392AE8BC2A07F4BD1790EA101B53DC">315</mods:start>
<mods:end id="C1BFC6D8547D2DB2439DB9EFC10A37C5">318</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="AAA57A8C03A73B16AE2774FD4FA98CAF">
<mods:url id="001C500135F02DAFC7813992BDC2ED94">http://dx.doi.org/10.1016/j.rbe.2018.08.005</mods:url>
</mods:location>
<mods:classification id="5DF47A9558ED8E70A2FD854FC8CD1D21">journal article</mods:classification>
<mods:identifier id="3ED91CB57F76F21D6B3B629CFEF7CAD5" type="DOI">10.1016/j.rbe.2018.08.005</mods:identifier>
<mods:identifier id="DA917C04DA441D9072306C8A567FC2DC" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="19DEDF40F22FB6107F25D3B0E0717A94" type="ZooBank">1BBF8CCE-AD22-4A02-8551-D9B24D4BAFB3</mods:identifier>
</mods:mods>
<treatment id="03C8878DFF8F132CFFC1ABEAFD6739CA" LSID="urn:lsid:zoobank.org:act:E12B46B0-51A1-4F32-B96D-CF07AD7385F7" httpUri="http://treatment.plazi.org/id/03C8878DFF8F132CFFC1ABEAFD6739CA" lastPageNumber="316" pageId="1" pageNumber="316">
<subSubSection id="C37B6510FF8F132CFFC1ABEAFE5F38BD" box="[117,395,1152,1172]" pageId="1" pageNumber="316" type="nomenclature">
<paragraph id="8BDE369BFF8F132CFFC1ABEAFE5F38BD" blockId="1.[117,395,1152,1172]" box="[117,395,1152,1172]" pageId="1" pageNumber="316">
<heading id="D09681F7FF8F132CFFC1ABEAFE5F38BD" box="[117,395,1152,1172]" fontSize="8" level="2" pageId="1" pageNumber="316" reason="7">
<taxonomicName id="4C614D18FF8F132CFFC1ABEAFEEC38BD" ID-CoL="9GBD3" authorityName="Froza &amp; Cavichioli &amp; Costa &amp; Mejdalani" authorityYear="2018" box="[117,312,1152,1172]" class="Insecta" family="Cicadellidae" genus="Hanshumba" kingdom="Animalia" order="Hemiptera" pageId="1" pageNumber="316" phylum="Arthropoda" rank="species" species="setifera" status="sp. nov.">
<emphasis id="B915EA89FF8F132CFFC1ABEAFEEC38BD" box="[117,312,1152,1172]" italics="true" pageId="1" pageNumber="316">Hanshumba setifera</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A22657F2FF8F132CFE89ABEBFE5F38BD" box="[317,395,1153,1172]" pageId="1" pageNumber="316" rank="species">sp. nov.</taxonomicNameLabel>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C37B6510FF8F132CFFC1ABF7FD6739CA" pageId="1" pageNumber="316" type="description">
<paragraph id="8BDE369BFF8F132CFFC1ABF7FF0A3899" blockId="1.[85,756,1181,1507]" box="[117,222,1181,1200]" pageId="1" pageNumber="316">
(
<figureCitation id="135A2A1EFF8F132CFFC9ABF7FF023899" box="[125,214,1181,1200]" captionStart="Figs" captionStartId="1.[85,120,907,921]" captionTargetBox="[128,712,152,872]" captionTargetId="figure-14@1.[127,690,152,876]" captionTargetPageId="1" captionText="Figs. 15. Hanshumba setifera sp. nov., male. 1, body, dorsal view, length 5.6mm (antennae and legs not depicted). Terminalia:2, pygofer lobes, lateral view; 3, subgenital plates, connective, styles,and paraphyses, dorsal view; 4, aedeagus and anal tube, lateroventral view; 5, aedeagus and anal tube, ventral view. APR, anterior ramus of paraphyses; EJB, ejaculatory bulb; LPR, lateral process of aedeagus; PPR, posterior ramus of paraphyses; SPR, setose process." pageId="1" pageNumber="316">Figs. 15</figureCitation>
)
</paragraph>
<paragraph id="8BDE369BFF8F132CFFC1ABD3FD6739EE" blockId="1.[85,756,1181,1507]" pageId="1" pageNumber="316">
Diagnosis.
<taxonomicName id="4C614D18FF8F132CFF52ABD2FE7938E5" authorityName="Froza &amp; Cavichioli &amp; Costa &amp; Mejdalani" authorityYear="2018" box="[230,429,1208,1228]" class="Insecta" family="Cicadellidae" genus="Hanshumba" kingdom="Animalia" order="Hemiptera" pageId="1" pageNumber="316" phylum="Arthropoda" rank="species" species="setifera" status="sp. nov.">
<emphasis id="B915EA89FF8F132CFF52ABD2FE7938E5" box="[230,429,1208,1228]" italics="true" pageId="1" pageNumber="316">Hanshumba setifera</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A22657F2FF8F132CFE03ABD3FDDD38E5" box="[439,521,1209,1228]" pageId="1" pageNumber="316" rank="species">sp. nov.</taxonomicNameLabel>
can be readily distinguished from the other four known species of the genus by the following combination of features: (1) apical portions of male pygofer (
<figureCitation id="135A2A1EFF8F132CFF04AA66FF313909" box="[176,229,1292,1312]" captionStart="Figs" captionStartId="1.[85,120,907,921]" captionTargetBox="[128,712,152,872]" captionTargetId="figure-14@1.[127,690,152,876]" captionTargetPageId="1" captionText="Figs. 15. Hanshumba setifera sp. nov., male. 1, body, dorsal view, length 5.6mm (antennae and legs not depicted). Terminalia:2, pygofer lobes, lateral view; 3, subgenital plates, connective, styles,and paraphyses, dorsal view; 4, aedeagus and anal tube, lateroventral view; 5, aedeagus and anal tube, ventral view. APR, anterior ramus of paraphyses; EJB, ejaculatory bulb; LPR, lateral process of aedeagus; PPR, posterior ramus of paraphyses; SPR, setose process." pageId="1" pageNumber="316">Fig. 2</figureCitation>
) and segment X (anal tube) (
<figureCitation id="135A2A1EFF8F132CFDB3AA66FD893936" box="[519,605,1292,1312]" captionStart="Figs" captionStartId="1.[85,120,907,921]" captionTargetBox="[128,712,152,872]" captionTargetId="figure-14@1.[127,690,152,876]" captionTargetPageId="1" captionText="Figs. 15. Hanshumba setifera sp. nov., male. 1, body, dorsal view, length 5.6mm (antennae and legs not depicted). Terminalia:2, pygofer lobes, lateral view; 3, subgenital plates, connective, styles,and paraphyses, dorsal view; 4, aedeagus and anal tube, lateroventral view; 5, aedeagus and anal tube, ventral view. APR, anterior ramus of paraphyses; EJB, ejaculatory bulb; LPR, lateral process of aedeagus; PPR, posterior ramus of paraphyses; SPR, setose process." pageId="1" pageNumber="316">Figs. 4, 5</figureCitation>
) with conspicuous process bearing numerous setae; (2) style (
<figureCitation id="135A2A1EFF8F132CFDFCAA42FDAB3915" box="[584,639,1320,1340]" captionStart="Figs" captionStartId="1.[85,120,907,921]" captionTargetBox="[128,712,152,872]" captionTargetId="figure-14@1.[127,690,152,876]" captionTargetPageId="1" captionText="Figs. 15. Hanshumba setifera sp. nov., male. 1, body, dorsal view, length 5.6mm (antennae and legs not depicted). Terminalia:2, pygofer lobes, lateral view; 3, subgenital plates, connective, styles,and paraphyses, dorsal view; 4, aedeagus and anal tube, lateroventral view; 5, aedeagus and anal tube, ventral view. APR, anterior ramus of paraphyses; EJB, ejaculatory bulb; LPR, lateral process of aedeagus; PPR, posterior ramus of paraphyses; SPR, setose process." pageId="1" pageNumber="316">Fig. 3</figureCitation>
) with apex obliquely truncate, foot-shaped; (3) aedeagal shaft (
<figureCitation id="135A2A1EFF8F132CFDD5AA2EFD6C397E" box="[609,696,1348,1367]" captionStart="Figs" captionStartId="1.[85,120,907,921]" captionTargetBox="[128,712,152,872]" captionTargetId="figure-14@1.[127,690,152,876]" captionTargetPageId="1" captionText="Figs. 15. Hanshumba setifera sp. nov., male. 1, body, dorsal view, length 5.6mm (antennae and legs not depicted). Terminalia:2, pygofer lobes, lateral view; 3, subgenital plates, connective, styles,and paraphyses, dorsal view; 4, aedeagus and anal tube, lateroventral view; 5, aedeagus and anal tube, ventral view. APR, anterior ramus of paraphyses; EJB, ejaculatory bulb; LPR, lateral process of aedeagus; PPR, posterior ramus of paraphyses; SPR, setose process." pageId="1" pageNumber="316">Figs. 4, 5</figureCitation>
) with distal half curved dorsally and with pair of dentiform processes on median portion; (4) paraphyses (
<figureCitation id="135A2A1EFF8F132CFE72AA16FE2839A6" box="[454,508,1404,1423]" captionStart="Figs" captionStartId="1.[85,120,907,921]" captionTargetBox="[128,712,152,872]" captionTargetId="figure-14@1.[127,690,152,876]" captionTargetPageId="1" captionText="Figs. 15. Hanshumba setifera sp. nov., male. 1, body, dorsal view, length 5.6mm (antennae and legs not depicted). Terminalia:2, pygofer lobes, lateral view; 3, subgenital plates, connective, styles,and paraphyses, dorsal view; 4, aedeagus and anal tube, lateroventral view; 5, aedeagus and anal tube, ventral view. APR, anterior ramus of paraphyses; EJB, ejaculatory bulb; LPR, lateral process of aedeagus; PPR, posterior ramus of paraphyses; SPR, setose process." pageId="1" pageNumber="316">Fig. 3</figureCitation>
) with two pairs of rami, anterior one directed anterad, thick, and obtuse apically, whereas posterior one directed posterad, slender, and acute apically.
</paragraph>
<paragraph id="8BDE369BFF8F132CFFC1AABAFD6739CA" blockId="1.[85,756,1181,1507]" box="[117,691,1488,1507]" pageId="1" pageNumber="316">
Length of male
<typeStatus id="54DA8839FF8F132CFEA5AABAFEBF39CA" box="[273,363,1488,1507]" pageId="1" pageNumber="316" type="holotype">holotype</typeStatus>
5.6 mm; male
<typeStatus id="54DA8839FF8F132CFDB5AABAFD8F39CA" box="[513,603,1488,1507]" pageId="1" pageNumber="316" type="paratype">paratype</typeStatus>
5.1 mm.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,117 @@
<document id="56902CCD037430D3FF48F1CCD1C758C0" ID-DOI="10.1016/j.rbe.2018.08.005" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722640225358" checkinUser="felipe" docAuthor="Froza, Joyce A., Cavichioli, Rodney R., Costa, Luiz A. A. &amp; Mejdalani, Gabriel" docDate="2018" docId="03C8878DFF8F132FFCF0A9C8FD0438EE" docLanguage="en" docName="RevBrasEntomol.62.4.315-318.pdf" docOrigin="Revista Brasileira de Entomologia (Rev. Bras. Entomol.) 62 (4)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.08.005" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Hanshumba teresa Froza, Cavichioli, Costa &amp; Mejdalani, 2018, sp. nov." docType="treatment" docUuid="908BBA0F-C114-4E9B-A8CD-536DC7A0445D" docUuidSource="ZooBank" docVersion="1" lastPageNumber="317" masterDocId="FFF1FFF5FF8E132DFFB4AF6AFFD43C29" masterDocTitle="Two new species of Hanshumba from Southeastern Brazil and a key to males of the genus (Insecta: Hemiptera: Cicadellidae: Cicadellini)" masterLastPageNumber="318" masterPageNumber="315" pageNumber="316" updateTime="1722683786525" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="55DDF4AADE78C61B48ED8A5D9E3FF07B" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="E7C231D34A83056D1D5530E382813CA3">
<mods:title id="EDAA57351A0A18863FE78BB1F8A95C4F">Two new species of Hanshumba from Southeastern Brazil and a key to males of the genus (Insecta: Hemiptera: Cicadellidae: Cicadellini)</mods:title>
</mods:titleInfo>
<mods:name id="8D1ED0AAA58D507A461163B5A63819DE" type="personal">
<mods:role id="68932320C9849CF454928330D4AB6625">
<mods:roleTerm id="412EDC966EA8EF91C7E1725A1DF20517">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="66C523E75F24F64FF017B677577C4C6B">Froza, Joyce A.</mods:namePart>
<mods:affiliation id="F3BE0B811D9F3D4AE5127F329CEB8E2D">Universidade de São Paulo, Escola Superior de Agricultura “ Luiz de Queiroz ”, Departamento de Entomologia e Acarologia, Piracicaba, SP, Brazil</mods:affiliation>
</mods:name>
<mods:name id="3290457B6D45D5429BC19D38B99D6A48" type="personal">
<mods:role id="B3097AB53C1B11A5D1CC346E16A5CB6A">
<mods:roleTerm id="859851DCAB5FCE10190CDB3DC0DBC4D9">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="CB39269503B8F08B4880BFC9111CE012">Cavichioli, Rodney R.</mods:namePart>
<mods:affiliation id="48D48C267D6D8AF7DCB8FB18FEF1AA4C">Universidade Federal do Paraná, Setor de Ciências Biológicas, Departamento de Zoologia, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:name id="F51DFA47E6FD135E5DE071742C1E7B3E" type="personal">
<mods:role id="884A6E195EB6A831B5E37E9045DB7FBF">
<mods:roleTerm id="ED2F5C4F86383A9D7D56333D6EC60C12">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="13940D0ED0FAC67FAA1F19B902BA1B07">Costa, Luiz A. A.</mods:namePart>
<mods:affiliation id="0BD55D20D13B74A2B7034CE02C1EA841">Universidade Federal do Rio de Janeiro, Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brazil</mods:affiliation>
</mods:name>
<mods:name id="8422EB62B101A1524F982DC8706C453B" type="personal">
<mods:role id="B7EAECA45700466DC8412A968FE4E1EA">
<mods:roleTerm id="A24A3B551194357E2E34D894D2C24318">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="CC8CBBB4042EE38687A91AD1246C09C7">Mejdalani, Gabriel</mods:namePart>
<mods:affiliation id="6212D860FDD24588F0BB2DD22B588040">Universidade Federal do Rio de Janeiro, Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="4B2DAE84D18961F49D99382DE2B59AAB">text</mods:typeOfResource>
<mods:relatedItem id="F0C77BF7C3F0C8876F036EFD1913BA3E" type="host">
<mods:titleInfo id="F2E40506233C1745B246F49A9D90CB62">
<mods:title id="8C50F2CBA9591094DA2056FBD3454870">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="960A9E40DA0D8BAD7A4BFAB3D8FC83D3">
<mods:date id="1D4857752933B5D89396CE6D71715DB4">2018</mods:date>
<mods:detail id="4713FB925779B0394AC15A4F5E983283" type="series">
<mods:title id="CCE197981E47932078929DBAF0B760F6">Rev. Bras. Entomol.</mods:title>
</mods:detail>
<mods:detail id="B5B1E8F8F5A745121DD3354020443F66" type="pubDate">
<mods:number id="0F82C87E79526113AA25F1CAA7E0B98B">2018-09-10</mods:number>
</mods:detail>
<mods:detail id="5537EF35B44D9CD930E4614C39DB190A" type="volume">
<mods:number id="DD31101E64AFBCF41B85C8781B12AC60">62</mods:number>
</mods:detail>
<mods:detail id="2543F4FF1B722A15A529B457231F190B" type="issue">
<mods:number id="10BB279DF675A7F96F4D99B460262702">4</mods:number>
</mods:detail>
<mods:extent id="35A8B415951383B1CBD2EFC062BABCE7" unit="page">
<mods:start id="26A2BC42D1E8CC37ECC8D25D849F9576">315</mods:start>
<mods:end id="3EA4E74CBEB0CD9806B37FF4536CF021">318</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="D4D533DD595B1423963BF5CCA64C1FE4">
<mods:url id="E64C569273BBB25A66738537CC5F64B4">http://dx.doi.org/10.1016/j.rbe.2018.08.005</mods:url>
</mods:location>
<mods:classification id="341E99A3516F61A4A9357B17AF88ED1A">journal article</mods:classification>
<mods:identifier id="8C4D25E091EA5AEC6F3ADA97BD9636E0" type="DOI">10.1016/j.rbe.2018.08.005</mods:identifier>
<mods:identifier id="7465B87916B971BC11E3BB01E82146DE" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="B4E30C29B86E1178ACEB102311875949" type="ZooBank">1BBF8CCE-AD22-4A02-8551-D9B24D4BAFB3</mods:identifier>
</mods:mods>
<treatment id="03C8878DFF8F132FFCF0A9C8FD0438EE" LSID="urn:lsid:zoobank.org:act:908BBA0F-C114-4E9B-A8CD-536DC7A0445D" httpUri="http://treatment.plazi.org/id/03C8878DFF8F132FFCF0A9C8FD0438EE" lastPageId="2" lastPageNumber="317" pageId="1" pageNumber="316">
<subSubSection id="C37B6510FF8F132CFCF0A9C8FB993A9E" box="[836,1101,1698,1719]" pageId="1" pageNumber="316" type="nomenclature">
<paragraph id="8BDE369BFF8F132CFCF0A9C8FB993A9E" blockId="1.[836,1101,1698,1719]" box="[836,1101,1698,1719]" pageId="1" pageNumber="316">
<heading id="D09681F7FF8F132CFCF0A9C8FB993A9E" box="[836,1101,1698,1719]" fontSize="8" level="2" pageId="1" pageNumber="316" reason="7">
<taxonomicName id="4C614D18FF8F132CFCF0A9C8FC2E3A9F" ID-CoL="9GBD4" authorityName="Froza &amp; Cavichioli &amp; Costa &amp; Mejdalani" authorityYear="2018" box="[836,1018,1698,1718]" class="Insecta" family="Cicadellidae" genus="Hanshumba" kingdom="Animalia" order="Hemiptera" pageId="1" pageNumber="316" phylum="Arthropoda" rank="species" species="teresa" status="sp. nov.">
<emphasis id="B915EA89FF8F132CFCF0A9C8FC2E3A9F" box="[836,1018,1698,1718]" italics="true" pageId="1" pageNumber="316">Hanshumba teresa</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A22657F2FF8F132CFC4BA9CEFB993A9E" box="[1023,1101,1700,1719]" pageId="1" pageNumber="316" rank="species">sp. nov.</taxonomicNameLabel>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C37B6510FF8F132FFCF0A9D5FD0438EE" lastPageId="2" lastPageNumber="317" pageId="1" pageNumber="316" type="description">
<paragraph id="8BDE369BFF8F132CFCF0A9D5FC6D3AFB" blockId="1.[804,1475,1727,1970]" box="[836,953,1727,1746]" pageId="1" pageNumber="316">
(
<figureCitation id="135A2A1EFF8F132CFCF8A9D5FC663AFB" box="[844,946,1727,1746]" captionStart-0="Figs" captionStart-1="Figs" captionStartId-0="2.[114,149,915,929]" captionStartId-1="2.[171,206,1969,1983]" captionTargetBox-0="[161,736,152,882]" captionTargetBox-1="[409,1209,1583,1917]" captionTargetId-0="figure-14@2.[161,737,160,884]" captionTargetId-1="figure-703@2.[409,1209,1582,1918]" captionTargetPageId-0="2" captionTargetPageId-1="2" captionText-0="Figs. 610. Hanshumba teresa sp. nov., male. 6, body, dorsal view, length 5.9mm (antennae and legs not depicted). Terminalia: 7, pygofer lobe, lateral view (inner setose process illustrated in Fig. 7a); 8, subgenital plates, connective, styles, and paraphyses, dorsal view; 9, aedeagus and anal tube, lateral view; 10, aedeagus and anal tube, ventral view (red arrows indicate the aedeagal shaft).APR,anteriorramus of paraphyses;EJB,ejaculatory bulb;PPR,posterior ramus of paraphyses;SPR,setose process." captionText-1="Figs. 1112. Hanshumba teresa sp. nov., aedeagus and anal tube. 11, lateral view. 12, ventral view.DFL, dorsal flange; MFL, median flange; VFL, ventral flange." pageId="1" pageNumber="316">Figs. 612</figureCitation>
)
</paragraph>
<paragraph id="8BDE369BFF8F132CFCF0A9B1FA173B98" blockId="1.[804,1475,1727,1970]" pageId="1" pageNumber="316">
Diagnosis. This new species can be recognized by the following combination of features: (1) apical portion of male pygofer (
<figureCitation id="135A2A1EFF8F132CFC98A879FC5B3B0F" box="[812,911,1811,1830]" captionStart="Figs" captionStartId="2.[114,149,915,929]" captionTargetBox="[161,736,152,882]" captionTargetId="figure-14@2.[161,737,160,884]" captionTargetPageId="2" captionText="Figs. 610. Hanshumba teresa sp. nov., male. 6, body, dorsal view, length 5.9mm (antennae and legs not depicted). Terminalia: 7, pygofer lobe, lateral view (inner setose process illustrated in Fig. 7a); 8, subgenital plates, connective, styles, and paraphyses, dorsal view; 9, aedeagus and anal tube, lateral view; 10, aedeagus and anal tube, ventral view (red arrows indicate the aedeagal shaft).APR,anteriorramus of paraphyses;EJB,ejaculatory bulb;PPR,posterior ramus of paraphyses;SPR,setose process." pageId="1" pageNumber="316">Figs. 7, 7a</figureCitation>
) with small inner process bearing apical setae and segment X (anal tube) (
<figureCitation id="135A2A1EFF8F132CFC4BA845FBBE3B6B" box="[1023,1130,1839,1858]" captionStart="Figs" captionStartId="2.[114,149,915,929]" captionTargetBox="[161,736,152,882]" captionTargetId="figure-14@2.[161,737,160,884]" captionTargetPageId="2" captionText="Figs. 610. Hanshumba teresa sp. nov., male. 6, body, dorsal view, length 5.9mm (antennae and legs not depicted). Terminalia: 7, pygofer lobe, lateral view (inner setose process illustrated in Fig. 7a); 8, subgenital plates, connective, styles, and paraphyses, dorsal view; 9, aedeagus and anal tube, lateral view; 10, aedeagus and anal tube, ventral view (red arrows indicate the aedeagal shaft).APR,anteriorramus of paraphyses;EJB,ejaculatory bulb;PPR,posterior ramus of paraphyses;SPR,setose process." pageId="1" pageNumber="316">Figs. 9, 10</figureCitation>
) without such process; (2) style (
<figureCitation id="135A2A1EFF8F132CFC98A821FCB43B77" box="[812,864,1867,1886]" captionStart="Figs" captionStartId="2.[114,149,915,929]" captionTargetBox="[161,736,152,882]" captionTargetId="figure-14@2.[161,737,160,884]" captionTargetPageId="2" captionText="Figs. 610. Hanshumba teresa sp. nov., male. 6, body, dorsal view, length 5.9mm (antennae and legs not depicted). Terminalia: 7, pygofer lobe, lateral view (inner setose process illustrated in Fig. 7a); 8, subgenital plates, connective, styles, and paraphyses, dorsal view; 9, aedeagus and anal tube, lateral view; 10, aedeagus and anal tube, ventral view (red arrows indicate the aedeagal shaft).APR,anteriorramus of paraphyses;EJB,ejaculatory bulb;PPR,posterior ramus of paraphyses;SPR,setose process." pageId="1" pageNumber="316">Fig. 8</figureCitation>
) with apex transversely truncate, not foot-shaped; (3) aedeagal shaft (
<figureCitation id="135A2A1EFF8F132CFC31A80DFC3D3B53" box="[901,1001,1895,1914]" captionStart-0="Figs" captionStart-1="Figs" captionStartId-0="2.[114,149,915,929]" captionStartId-1="2.[171,206,1969,1983]" captionTargetBox-0="[161,736,152,882]" captionTargetBox-1="[409,1209,1583,1917]" captionTargetId-0="figure-14@2.[161,737,160,884]" captionTargetId-1="figure-703@2.[409,1209,1582,1918]" captionTargetPageId-0="2" captionTargetPageId-1="2" captionText-0="Figs. 610. Hanshumba teresa sp. nov., male. 6, body, dorsal view, length 5.9mm (antennae and legs not depicted). Terminalia: 7, pygofer lobe, lateral view (inner setose process illustrated in Fig. 7a); 8, subgenital plates, connective, styles, and paraphyses, dorsal view; 9, aedeagus and anal tube, lateral view; 10, aedeagus and anal tube, ventral view (red arrows indicate the aedeagal shaft).APR,anteriorramus of paraphyses;EJB,ejaculatory bulb;PPR,posterior ramus of paraphyses;SPR,setose process." captionText-1="Figs. 1112. Hanshumba teresa sp. nov., aedeagus and anal tube. 11, lateral view. 12, ventral view.DFL, dorsal flange; MFL, median flange; VFL, ventral flange." pageId="1" pageNumber="316">Figs. 912</figureCitation>
) with three pairs of longitudinal flanges, two of them elongate and forming spiniform processes at apex; (4) paraphyses (
<figureCitation id="135A2A1EFF8F132CFCC2A8F4FC7D3B9B" box="[886,937,1950,1970]" captionStart="Figs" captionStartId="2.[114,149,915,929]" captionTargetBox="[161,736,152,882]" captionTargetId="figure-14@2.[161,737,160,884]" captionTargetPageId="2" captionText="Figs. 610. Hanshumba teresa sp. nov., male. 6, body, dorsal view, length 5.9mm (antennae and legs not depicted). Terminalia: 7, pygofer lobe, lateral view (inner setose process illustrated in Fig. 7a); 8, subgenital plates, connective, styles, and paraphyses, dorsal view; 9, aedeagus and anal tube, lateral view; 10, aedeagus and anal tube, ventral view (red arrows indicate the aedeagal shaft).APR,anteriorramus of paraphyses;EJB,ejaculatory bulb;PPR,posterior ramus of paraphyses;SPR,setose process." pageId="1" pageNumber="316">Fig.8</figureCitation>
) with two pairs of rami, anterior one directed anterad,
</paragraph>
<caption id="DF1E6613FF8C132FFFC6ACF9FF613803" pageId="2" pageNumber="317" startId="2.[114,149,915,929]" targetBox="[161,736,152,882]" targetPageId="2" targetType="figure">
<paragraph id="8BDE369BFF8C132FFFC6ACF9FF613803" blockId="2.[114,785,914,1066]" pageId="2" pageNumber="317">
<emphasis id="B915EA89FF8C132FFFC6ACF9FF183F88" bold="true" box="[114,204,915,929]" pageId="2" pageNumber="317">Figs. 610.</emphasis>
<taxonomicName id="4C614D18FF8C132FFF61ACF8FEBC3F88" authorityName="Froza &amp; Cavichioli &amp; Costa &amp; Mejdalani" authorityYear="2018" box="[213,360,914,929]" class="Insecta" family="Cicadellidae" genus="Hanshumba" kingdom="Animalia" order="Hemiptera" pageId="2" pageNumber="317" phylum="Arthropoda" rank="species" species="teresa" status="sp. nov.">
<emphasis id="B915EA89FF8C132FFF61ACF8FEBC3F88" box="[213,360,914,929]" italics="true" pageId="2" pageNumber="317">Hanshumba teresa</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A22657F2FF8C132FFEDAACF9FE7B3F88" box="[366,431,915,929]" pageId="2" pageNumber="317" rank="species">sp. nov.</taxonomicNameLabel>
, male. 6, body, dorsal view, length 5.9 mm (antennae and legs not depicted). Terminalia: 7, pygofer lobe, lateral view (inner setose process illustrated in Fig. 7a); 8, subgenital plates, connective, styles, and paraphyses, dorsal view; 9, aedeagus and anal tube, lateral view; 10, aedeagus and anal tube, ventral view (red arrows indicate the aedeagal shaft).APR, anterior ramus of paraphyses; EJB,ejaculatory bulb; PPR, posterior ramus of paraphyses; SPR, setose process.
</paragraph>
</caption>
<paragraph id="8BDE369BFF8C132FFFC6AB0AFEF33885" blockId="2.[114,785,1120,1223]" pageId="2" pageNumber="317">elongate, slender, and with subacute apex, whereas posterior one directed posterad, fused to each other for most of their length, and with obtuse apex.</paragraph>
<paragraph id="8BDE369BFF8C132FFF26ABDEFD0438EE" blockId="2.[114,785,1120,1223]" box="[146,720,1204,1223]" pageId="2" pageNumber="317">
Length of male
<typeStatus id="54DA8839FF8C132FFE9AABDEFE5C38EE" box="[302,392,1204,1223]" pageId="2" pageNumber="317" type="holotype">holotype</typeStatus>
5.9 mm; male
<typeStatus id="54DA8839FF8C132FFDAAABDEFDAC38EE" box="[542,632,1204,1223]" pageId="2" pageNumber="317" type="paratype">paratype</typeStatus>
5.8 mm.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -1,59 +1,60 @@
<document id="86804E040428C391EBA10F3DDE109F56" ID-DOI="10.1016/j.rbe.2018.09.005" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635906846" checkinUser="felipe" docAuthor="Ferreira, André Luis Diniz, Lozada, Pedro W. &amp; Takiya, Daniela Maeda" docDate="2018" docId="03C887EA0611FFD09925F931FBB1F96C" docLanguage="en" docName="RevBrasEntomol.62.4.324-327.pdf" docOrigin="Revista Brasileira de Entomologia 62 (4)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.09.005" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Onega musa Ferreira, Lozada &amp; Takiya, 2018, sp. nov." docType="treatment" docVersion="1" lastPageNumber="326" masterDocId="FFF1FF920610FFD29957FFA7FFACFFAE" masterDocTitle="A new species of the sharpshooter genus Onega Distant, 1908 (Hemiptera: Cicadellidae: Cicadellini) from Ecuador and Peru" masterLastPageNumber="327" masterPageNumber="324" pageNumber="325" updateTime="1722680369215" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0"> <document id="A67121932EE09A203B4581F1694B59CD" ID-DOI="10.1016/j.rbe.2018.09.005" ID-ISSN="1806-9665" ID-Zenodo-Dep="13195986" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635906846" checkinUser="felipe" docAuthor="Ferreira, André Luis Diniz, Lozada, Pedro W. &amp; Takiya, Daniela Maeda" docDate="2018" docId="03C887EA0611FFD09925F931FBB1F96C" docLanguage="en" docName="RevBrasEntomol.62.4.324-327.pdf" docOrigin="Revista Brasileira de Entomologia 62 (4)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.09.005" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Onega musa Ferreira, Lozada &amp; Takiya, 2018, sp. nov." docType="treatment" docVersion="3" lastPageNumber="326" masterDocId="FFF1FF920610FFD29957FFA7FFACFFAE" masterDocTitle="A new species of the sharpshooter genus Onega Distant, 1908 (Hemiptera: Cicadellidae: Cicadellini) from Ecuador and Peru" masterLastPageNumber="327" masterPageNumber="324" pageNumber="325" updateTime="1722683407100" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="E8471FDA32349CBBB60D795E1598B9A4" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="30EE9561C5902266EAB08815BDA1130C" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="6BC651D89D96A92D5B3A35BBA888EFC0"> <mods:titleInfo id="595C23ADC997E24C215019097A3EABC1">
<mods:title id="168620FEF7BAD3920722CD1F07B448BF">A new species of the sharpshooter genus Onega Distant, 1908 (Hemiptera: Cicadellidae: Cicadellini) from Ecuador and Peru</mods:title> <mods:title id="0E4F774C4B86102483D7174477588F59">A new species of the sharpshooter genus Onega Distant, 1908 (Hemiptera: Cicadellidae: Cicadellini) from Ecuador and Peru</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="5B2FACAF559BEA2202A397426FA79C1E" type="personal"> <mods:name id="BE308DDA6F04A9CCB7339D68C488A90C" type="personal">
<mods:role id="6561F4C7C64F31DF095AB53891B37998"> <mods:role id="2A5148461EB02CB1196635E6A2B1912E">
<mods:roleTerm id="3548B3D2C55865F9A4D2639D61CFABFF">Author</mods:roleTerm> <mods:roleTerm id="F0176260FCA39FBAD1E855F3B54F69E8">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="0F1E187502667966C46DAC143B12D2C0">Ferreira, André Luis Diniz</mods:namePart> <mods:namePart id="2029E1D5C8C1CE81FC8188CFD4798887">Ferreira, André Luis Diniz</mods:namePart>
<mods:affiliation id="3B481414CA6175E085BE24DC42B9A6D4">Universidade Federal do Rio de Janeiro, Instituto de Biologia, Departamento de Zoologia, Rio de Janeiro, RJ, Brazil</mods:affiliation> <mods:affiliation id="A3A9F03CB82F4AA85DD28FB90F14D1AF">Universidade Federal do Rio de Janeiro, Instituto de Biologia, Departamento de Zoologia, Rio de Janeiro, RJ, Brazil</mods:affiliation>
</mods:name> </mods:name>
<mods:name id="53C9D03037EA40BE2545BC7F30148157" type="personal"> <mods:name id="5FC41F298392E53404F73A061B016010" type="personal">
<mods:role id="6436DF2833A5E36E5BC386F665BDA2FF"> <mods:role id="003948654405D72E7A01E037A735A675">
<mods:roleTerm id="F161E83936FE327E008B20BA96FE8D26">Author</mods:roleTerm> <mods:roleTerm id="119997BD90D4BE0C9D263C0CC218BF4C">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="9662E1F5B63D5377A59383970A417636">Lozada, Pedro W.</mods:namePart> <mods:namePart id="9C60CF0BB26FE58A26F5CEDFCC9304F7">Lozada, Pedro W.</mods:namePart>
<mods:affiliation id="44CA69941118AEFF062D184AE7F4848C">Universidad Nacional Mayor de San Marcos, Museo de Historia Natural, Departamento de Entomología, Lima, Peru</mods:affiliation> <mods:affiliation id="C231806C292D15FECDE026D840A35F8F">Universidad Nacional Mayor de San Marcos, Museo de Historia Natural, Departamento de Entomología, Lima, Peru</mods:affiliation>
</mods:name> </mods:name>
<mods:name id="5E1068CFEB1851F98D9B672BEB44043C" type="personal"> <mods:name id="F6CACDC038C9435971E91AC1E864EDDF" type="personal">
<mods:role id="CC870722D7809DABEEF1097A387D3D3D"> <mods:role id="4E7F37F3A3B1064E5357837E00DED0C9">
<mods:roleTerm id="FA79D6B2568D6C14C3F964121316E8E7">Author</mods:roleTerm> <mods:roleTerm id="04502B9A4394BE5E45A0117A2A1BE958">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="0630482F3C377AEC6D07438BABA486D6">Takiya, Daniela Maeda</mods:namePart> <mods:namePart id="C9F143F2B6C798C0040E9B92F4394B28">Takiya, Daniela Maeda</mods:namePart>
<mods:affiliation id="DA02B469BAD40520F7F2A9164432FA85">Universidade Federal do Rio de Janeiro, Instituto de Biologia, Departamento de Zoologia, Rio de Janeiro, RJ, Brazil</mods:affiliation> <mods:affiliation id="AC4CB049EC687D6049B7AC474F85FDFB">Universidade Federal do Rio de Janeiro, Instituto de Biologia, Departamento de Zoologia, Rio de Janeiro, RJ, Brazil</mods:affiliation>
</mods:name> </mods:name>
<mods:typeOfResource id="DFB4B579763FEFA0A8A2F6A177CAEC4C">text</mods:typeOfResource> <mods:typeOfResource id="5752C358F369106812CE213D23E36A8D">text</mods:typeOfResource>
<mods:relatedItem id="DEC01CAE3663D3D4D9E830078832618A" type="host"> <mods:relatedItem id="4C38772112CC8C1E79796859D9FA780E" type="host">
<mods:titleInfo id="35598DA40A4C7F2D5190365B330CE121"> <mods:titleInfo id="2D619B49DBD333FEF49A4502AEF2F0D2">
<mods:title id="0439AA36EF27347DCEDCB994B5F84297">Revista Brasileira de Entomologia</mods:title> <mods:title id="9B90771598EE87555B3C0F5341BB3E15">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="1587C62658CC19268EE01C27575BF779"> <mods:part id="4038E370368D26D3F3AA0E3FE72EEBEB">
<mods:date id="3F724CBB4BAFBD4ABE6DAB56FFEC37D9">2018</mods:date> <mods:date id="88F144AA854695D4013BE503F874AFBA">2018</mods:date>
<mods:detail id="C34C5DA712689B7E557F5E442F2DFBFF" type="pubDate"> <mods:detail id="487056D27EDB9D50B8710B5A7D8BDCD3" type="pubDate">
<mods:number id="B235A9F5FB2AC1B4A45DC50CDB6716B2">2018-10-06</mods:number> <mods:number id="E98872DE0A161BB23CF9EF4D4BDE4C08">2018-10-06</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="B0AF44D5F3D1925BEEE3F0799BDC149D" type="volume"> <mods:detail id="2110CE0693937A135198AEA5EF37BC55" type="volume">
<mods:number id="8AA7EF844D5CB1EECE9DE20FD23FBEC2">62</mods:number> <mods:number id="13BC37FCB3D5D48BAE264D4579889BFB">62</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="E9C462A86A09C26DB8B5838766A23F07" type="issue"> <mods:detail id="B53707ED05582098840EECF9A458FAA1" type="issue">
<mods:number id="28193AD69B648373F0D83BF90F75EF39">4</mods:number> <mods:number id="BE1B3B703F7341D5960AD28684C31E5E">4</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="A97C7923FFF84AEB6684F8440D3ACC20" unit="page"> <mods:extent id="F68E45D7A5340A776C0BF3007169D6BA" unit="page">
<mods:start id="5E22FBF7C2758F9F7686E37DB80C5F83">324</mods:start> <mods:start id="BB96B182D9929A4D98725BB59FB13209">324</mods:start>
<mods:end id="1147EF7CB67C6C124E741B6F3B26B52A">327</mods:end> <mods:end id="95838021349C6C3DB82706356C3DAAB7">327</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="EEFDF85FF16B9566BC81647660FD9847"> <mods:location id="6DF32A12C78EA774D321913F387B3B63">
<mods:url id="3C6EC6C7A7CA3F4889F73F3D609CE7D2">http://dx.doi.org/10.1016/j.rbe.2018.09.005</mods:url> <mods:url id="7442384157D3F6CE076AE69D45A509D9">http://dx.doi.org/10.1016/j.rbe.2018.09.005</mods:url>
</mods:location> </mods:location>
<mods:classification id="9626D2AE4A44CB171B21CA2C335949BC">journal article</mods:classification> <mods:classification id="078CB739BB7D3E1FF4C40D42FBA7824B">journal article</mods:classification>
<mods:identifier id="28373E079740EDC7F38B87911812E60D" type="DOI">10.1016/j.rbe.2018.09.005</mods:identifier> <mods:identifier id="0D712D492BB202673362462798B8CD70" type="DOI">10.1016/j.rbe.2018.09.005</mods:identifier>
<mods:identifier id="3C433C5A18862D36E9D378C78F831C4C" type="ISSN">1806-9665</mods:identifier> <mods:identifier id="F55150EE54063F1F3C6F19B65C978543" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="47B477E41FD9B0268F442AD1E0C36D9F" type="Zenodo-Dep">13195986</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="03C887EA0611FFD09925F931FBB1F96C" LSID="urn:lsid:plazi:treatment:03C887EA0611FFD09925F931FBB1F96C" httpUri="http://treatment.plazi.org/id/03C887EA0611FFD09925F931FBB1F96C" lastPageId="2" lastPageNumber="326" pageId="1" pageNumber="325"> <treatment id="03C887EA0611FFD09925F931FBB1F96C" ID-DOI="http://doi.org/10.5281/zenodo.13194763" ID-Zenodo-Dep="13194763" LSID="urn:lsid:plazi:treatment:03C887EA0611FFD09925F931FBB1F96C" httpUri="http://treatment.plazi.org/id/03C887EA0611FFD09925F931FBB1F96C" lastPageId="2" lastPageNumber="326" pageId="1" pageNumber="325">
<subSubSection id="C37B65770611FFD39925F931FD3AF94F" pageId="1" pageNumber="325" type="nomenclature"> <subSubSection id="C37B65770611FFD39925F931FD3AF94F" pageId="1" pageNumber="325" type="nomenclature">
<paragraph id="8BDE36FC0611FFD39925F931FD75F907" blockId="1.[114,729,1686,1705]" box="[114,729,1686,1705]" pageId="1" pageNumber="325"> <paragraph id="8BDE36FC0611FFD39925F931FD75F907" blockId="1.[114,729,1686,1705]" box="[114,729,1686,1705]" pageId="1" pageNumber="325">
<heading id="D09681900611FFD39925F931FD75F907" bold="true" box="[114,729,1686,1705]" fontSize="8" level="2" pageId="1" pageNumber="325" reason="2"> <heading id="D09681900611FFD39925F931FD75F907" bold="true" box="[114,729,1686,1705]" fontSize="8" level="2" pageId="1" pageNumber="325" reason="2">
@ -63,7 +64,7 @@
</taxonomicName> </taxonomicName>
<taxonomicNameLabel id="A22657950611FFD399AFF931FEE4F907" box="[248,328,1686,1705]" pageId="1" pageNumber="325" rank="species">sp. nov.</taxonomicNameLabel> <taxonomicNameLabel id="A22657950611FFD399AFF931FEE4F907" box="[248,328,1686,1705]" pageId="1" pageNumber="325" rank="species">sp. nov.</taxonomicNameLabel>
Ferreira, Lozada &amp; Takiya ( Ferreira, Lozada &amp; Takiya (
<figureCitation id="135A2A790611FFD39B3FF931FD7DF907" box="[616,721,1686,1705]" captionStart-0="Figs" captionStart-1="Figs" captionStartId-0="1.[114,149,739,753]" captionStartId-1="2.[85,120,1285,1299]" captionTargetBox-0="[327,1288,151,706]" captionTargetBox-1="[307,1258,151,1253]" captionTargetId-0="figure-13@1.[326,1290,149,708]" captionTargetId-1="figure-13@2.[297,1261,148,1255]" captionTargetPageId-0="1" captionTargetPageId-1="2" captionText-0="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." captionText-1="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Figs. 112</figureCitation> <figureCitation id="135A2A790611FFD39B3FF931FD7DF907" box="[616,721,1686,1705]" captionStart-0="Figs" captionStart-1="Figs" captionStartId-0="1.[114,149,739,753]" captionStartId-1="2.[85,120,1285,1299]" captionTargetBox-0="[327,1288,151,706]" captionTargetBox-1="[307,1258,151,1253]" captionTargetId-0="figure-13@1.[326,1290,149,708]" captionTargetId-1="figure-13@2.[297,1261,148,1255]" captionTargetPageId-0="1" captionTargetPageId-1="2" captionText-0="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." captionText-1="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi-0="http://doi.org/10.5281/zenodo.13195988" figureDoi-1="http://doi.org/10.5281/zenodo.13195990" httpUri-0="https://zenodo.org/record/13195988/files/figure.png" httpUri-1="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Figs. 112</figureCitation>
) )
</emphasis> </emphasis>
</heading> </heading>
@ -83,37 +84,37 @@ Ferreira, Lozada &amp; Takiya (
<paragraph id="8BDE36FC0611FFD39925F837FBB0FBEF" blockId="1.[114,785,1741,1985]" lastBlockId="1.[833,1504,819,1982]" pageId="1" pageNumber="325"> <paragraph id="8BDE36FC0611FFD39925F837FBB0FBEF" blockId="1.[114,785,1741,1985]" lastBlockId="1.[833,1504,819,1982]" pageId="1" pageNumber="325">
<emphasis id="B915EAEE0611FFD39925F837FF74F80A" box="[114,216,1936,1956]" italics="true" pageId="1" pageNumber="325">Coloration</emphasis> <emphasis id="B915EAEE0611FFD39925F837FF74F80A" box="[114,216,1936,1956]" italics="true" pageId="1" pageNumber="325">Coloration</emphasis>
: Crown yellow; margins besides eyes dark brown; median macula dark-brown ( : Crown yellow; margins besides eyes dark brown; median macula dark-brown (
<figureCitation id="135A2A790611FFD398F4F80AFE77F86E" box="[419,475,1965,1984]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Fig. 1</figureCitation> <figureCitation id="135A2A790611FFD398F4F80AFE77F86E" box="[419,475,1965,1984]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Fig. 1</figureCitation>
). Face yellow, except pairs of maculae on frons at bases of antennae and on genae, light brown ( ). Face yellow, except pairs of maculae on frons at bases of antennae and on genae, light brown (
<figureCitation id="135A2A790611FFD39A1EFCE8FC2DFCCC" box="[841,897,847,866]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Fig. 2</figureCitation> <figureCitation id="135A2A790611FFD39A1EFCE8FC2DFCCC" box="[841,897,847,866]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Fig. 2</figureCitation>
). Pronotum reddish-brown ( ). Pronotum reddish-brown (
<figureCitation id="135A2A790611FFD39DF9FCE8FB4AFCCC" box="[1198,1254,847,866]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Fig. 1</figureCitation> <figureCitation id="135A2A790611FFD39DF9FCE8FB4AFCCC" box="[1198,1254,847,866]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Fig. 1</figureCitation>
) with five spots mostly confluent arranged as a “V” on disc and two semi-circular maculae on posterior margin, bright yellow ( ) with five spots mostly confluent arranged as a “V” on disc and two semi-circular maculae on posterior margin, bright yellow (
<figureCitation id="135A2A790611FFD39DFBFC21FB4DFC34" box="[1196,1249,902,922]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Fig. 1</figureCitation> <figureCitation id="135A2A790611FFD39DFBFC21FB4DFC34" box="[1196,1249,902,922]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Fig. 1</figureCitation>
). Mesonotum bright yellow; lateral basal angles and apical spot, reddish-brown ( ). Mesonotum bright yellow; lateral basal angles and apical spot, reddish-brown (
<figureCitation id="135A2A790611FFD39C2DFC05FA7EFC18" box="[1402,1490,930,950]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Figs. 13</figureCitation> <figureCitation id="135A2A790611FFD39C2DFC05FA7EFC18" box="[1402,1490,930,950]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Figs. 13</figureCitation>
). Forewing mostly bright yellow, with several irregular reddish-brown ( ). Forewing mostly bright yellow, with several irregular reddish-brown (
<figureCitation id="135A2A790611FFD39AC2FC7DFB8CFC43" box="[917,1056,986,1005]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Figs. 1 and 2</figureCitation> <figureCitation id="135A2A790611FFD39AC2FC7DFB8CFC43" box="[917,1056,986,1005]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Figs. 1 and 2</figureCitation>
) areas; apex translucent ( ) areas; apex translucent (
<figureCitation id="135A2A790611FFD39C6EFC7DFA3BFC43" box="[1337,1431,986,1005]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Figs. 13</figureCitation> <figureCitation id="135A2A790611FFD39C6EFC7DFA3BFC43" box="[1337,1431,986,1005]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Figs. 13</figureCitation>
). Hind wing translucent white ( ). Hind wing translucent white (
<figureCitation id="135A2A790611FFD39D6AFC51FB3BFBA7" box="[1085,1175,1014,1033]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Figs. 14</figureCitation> <figureCitation id="135A2A790611FFD39D6AFC51FB3BFBA7" box="[1085,1175,1014,1033]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Figs. 14</figureCitation>
). Thoracic pleura mostly yellow with few light brown maculae. Legs mostly dark brown ( ). Thoracic pleura mostly yellow with few light brown maculae. Legs mostly dark brown (
<figureCitation id="135A2A790611FFD39C2DFBB5FA7EFB8B" box="[1402,1490,1042,1061]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Figs. 24</figureCitation> <figureCitation id="135A2A790611FFD39C2DFBB5FA7EFB8B" box="[1402,1490,1042,1061]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Figs. 24</figureCitation>
). Abdomen mostly red. ). Abdomen mostly red.
</paragraph> </paragraph>
<paragraph id="8BDE36FC0611FFD39A16FBEEFC79FADA" blockId="1.[833,1504,819,1982]" pageId="1" pageNumber="325"> <paragraph id="8BDE36FC0611FFD39A16FBEEFC79FADA" blockId="1.[833,1504,819,1982]" pageId="1" pageNumber="325">
<emphasis id="B915EAEE0611FFD39A16FBEEFBA3FBF3" box="[833,1039,1097,1117]" italics="true" pageId="1" pageNumber="325">External morphology</emphasis> <emphasis id="B915EAEE0611FFD39A16FBEEFBA3FBF3" box="[833,1039,1097,1117]" italics="true" pageId="1" pageNumber="325">External morphology</emphasis>
: Crown with median length 3/5 interocular and slightly less than 2/5 transocular width; apical and lateral concave areas on crown not confluent ( : Crown with median length 3/5 interocular and slightly less than 2/5 transocular width; apical and lateral concave areas on crown not confluent (
<figureCitation id="135A2A790611FFD39D8CFB25FABFFB3B" box="[1243,1299,1154,1173]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Fig. 1</figureCitation> <figureCitation id="135A2A790611FFD39D8CFB25FABFFB3B" box="[1243,1299,1154,1173]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Fig. 1</figureCitation>
). Frons mostly flattened, concave only on superior fourth ( ). Frons mostly flattened, concave only on superior fourth (
<figureCitation id="135A2A790611FFD39DA7FB3AFA86FB1F" box="[1264,1322,1181,1201]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Fig. 2</figureCitation> <figureCitation id="135A2A790611FFD39DA7FB3AFA86FB1F" box="[1264,1322,1181,1201]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Fig. 2</figureCitation>
). Pronotum with posterior margin slightly concave ( ). Pronotum with posterior margin slightly concave (
<figureCitation id="135A2A790611FFD39DE8FB1EFB57FB62" box="[1215,1275,1209,1228]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Fig. 1</figureCitation> <figureCitation id="135A2A790611FFD39DE8FB1EFB57FB62" box="[1215,1275,1209,1228]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Fig. 1</figureCitation>
) or straight ( ) or straight (
<figureCitation id="135A2A790611FFD39CC1FB1EFA7EFB62" box="[1430,1490,1209,1228]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Fig. 3</figureCitation> <figureCitation id="135A2A790611FFD39CC1FB1EFA7EFB62" box="[1430,1490,1209,1228]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Fig. 3</figureCitation>
). Forewing with most of corium with plexus of veins, absent on apical, brachial, and costal cells; clavus with crossveins between claval veins ( ). Forewing with most of corium with plexus of veins, absent on apical, brachial, and costal cells; clavus with crossveins between claval veins (
<figureCitation id="135A2A790611FFD39AD5FAAAFC54FA8E" box="[898,1016,1293,1312]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="1" pageNumber="325">Figs.1 and 2</figureCitation> <figureCitation id="135A2A790611FFD39AD5FAAAFC54FA8E" box="[898,1016,1293,1312]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="1" pageNumber="325">Figs.1 and 2</figureCitation>
). Hind legs with femoral setal formula 2:1:1; first tarsomeres with length approximately equal to combined length of distal ones. Other external characters as in generic description ( ). Hind legs with femoral setal formula 2:1:1; first tarsomeres with length approximately equal to combined length of distal ones. Other external characters as in generic description (
<bibRefCitation id="EFF04B0D0611FFD39A1EFAC6FC6BFADA" author="Young, D. A." box="[841,967,1377,1396]" pageId="1" pageNumber="325" pagination="1 - 1135" refId="ref3382" refString="Young, D. A., 1977. Taxonomic study of the Cicadellinae (Homoptera: Cicadellidae). Part 2, New World Cicadellini and the genus Cicadella. Bull. North Carolina Agric. Exp. Station 239, 1 - 1135." type="journal article" year="1977">Young, 1977</bibRefCitation> <bibRefCitation id="EFF04B0D0611FFD39A1EFAC6FC6BFADA" author="Young, D. A." box="[841,967,1377,1396]" pageId="1" pageNumber="325" pagination="1 - 1135" refId="ref3382" refString="Young, D. A., 1977. Taxonomic study of the Cicadellinae (Homoptera: Cicadellidae). Part 2, New World Cicadellini and the genus Cicadella. Bull. North Carolina Agric. Exp. Station 239, 1 - 1135." type="journal article" year="1977">Young, 1977</bibRefCitation>
). ).
@ -121,36 +122,36 @@ Ferreira, Lozada &amp; Takiya (
<paragraph id="8BDE36FC0611FFD39A16FADBFB2AF971" blockId="1.[833,1504,819,1982]" pageId="1" pageNumber="325"> <paragraph id="8BDE36FC0611FFD39A16FADBFB2AF971" blockId="1.[833,1504,819,1982]" pageId="1" pageNumber="325">
<emphasis id="B915EAEE0611FFD39A16FADBFC7DFA3E" box="[833,977,1404,1424]" italics="true" pageId="1" pageNumber="325">Male genitalia</emphasis> <emphasis id="B915EAEE0611FFD39A16FADBFC7DFA3E" box="[833,977,1404,1424]" italics="true" pageId="1" pageNumber="325">Male genitalia</emphasis>
: Pygofer moderately produced; posterior margin rounded and serrate; without processes; macrosetae dispersed throughout posterior 2/3; long microsetae restricted to basiventral margin ( : Pygofer moderately produced; posterior margin rounded and serrate; without processes; macrosetae dispersed throughout posterior 2/3; long microsetae restricted to basiventral margin (
<figureCitation id="135A2A790611FFD39A92FA77FC51FA4D" box="[965,1021,1488,1507]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Fig. 5</figureCitation> <figureCitation id="135A2A790611FFD39A92FA77FC51FA4D" box="[965,1021,1488,1507]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Fig. 5</figureCitation>
). Subgenital plate extending slightly posterior to midlength of pygofer; fused basally; with uniseriate macrosetae and fine setae basiventrally ( ). Subgenital plate extending slightly posterior to midlength of pygofer; fused basally; with uniseriate macrosetae and fine setae basiventrally (
<figureCitation id="135A2A790611FFD39D3EF9AFFB0CF9B5" box="[1129,1184,1544,1563]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Fig. 6</figureCitation> <figureCitation id="135A2A790611FFD39D3EF9AFFB0CF9B5" box="[1129,1184,1544,1563]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Fig. 6</figureCitation>
). Connective approximately Vshaped; dorsal keel strongly sclerotized and elongate, extending anteriorly. Style extending posteriorly beyond apex of connective; apex broad and foot-shaped ( ). Connective approximately Vshaped; dorsal keel strongly sclerotized and elongate, extending anteriorly. Style extending posteriorly beyond apex of connective; apex broad and foot-shaped (
<figureCitation id="135A2A790611FFD39DF8F9FBFB44F9C1" box="[1199,1256,1628,1647]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Fig. 7</figureCitation> <figureCitation id="135A2A790611FFD39DF8F9FBFB44F9C1" box="[1199,1256,1628,1647]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Fig. 7</figureCitation>
). Aedeagus with dorsal apodemes robust; shaft elongate and bisinuate, in lateral view, with a non-bifurcated dorsoapical process above the gonopore ( ). Aedeagus with dorsal apodemes robust; shaft elongate and bisinuate, in lateral view, with a non-bifurcated dorsoapical process above the gonopore (
<figureCitation id="135A2A790611FFD39CCEF933FA7CF909" box="[1433,1488,1684,1703]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Fig. 8</figureCitation> <figureCitation id="135A2A790611FFD39CCEF933FA7CF909" box="[1433,1488,1684,1703]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Fig. 8</figureCitation>
); apex with apical acute sinuous process extending beyond gonopore. Paraphyses absent ( ); apex with apical acute sinuous process extending beyond gonopore. Paraphyses absent (
<figureCitation id="135A2A790611FFD39D14F96CFBD4F971" box="[1091,1144,1739,1759]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Fig. 8</figureCitation> <figureCitation id="135A2A790611FFD39D14F96CFBD4F971" box="[1091,1144,1739,1759]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Fig. 8</figureCitation>
). ).
</paragraph> </paragraph>
<paragraph id="8BDE36FC0611FFD09A16F941FE91FA4D" blockId="1.[833,1504,819,1982]" lastBlockId="2.[85,757,1459,1981]" lastPageId="2" lastPageNumber="326" pageId="1" pageNumber="325"> <paragraph id="8BDE36FC0611FFD09A16F941FE91FA4D" blockId="1.[833,1504,819,1982]" lastBlockId="2.[85,757,1459,1981]" lastPageId="2" lastPageNumber="326" pageId="1" pageNumber="325">
<emphasis id="B915EAEE0611FFD39A16F941FC4EF954" box="[833,994,1766,1786]" italics="true" pageId="1" pageNumber="325">Female genitalia</emphasis> <emphasis id="B915EAEE0611FFD39A16F941FC4EF954" box="[833,994,1766,1786]" italics="true" pageId="1" pageNumber="325">Female genitalia</emphasis>
: Sternite VII with posterior margin with shallow median emargination; transverse striations on disc ( : Sternite VII with posterior margin with shallow median emargination; transverse striations on disc (
<figureCitation id="135A2A790611FFD39C06F8A4FA3FF8B8" box="[1361,1427,1795,1814]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Fig. 10</figureCitation> <figureCitation id="135A2A790611FFD39C06F8A4FA3FF8B8" box="[1361,1427,1795,1814]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Fig. 10</figureCitation>
). Internal abdominal sternite VIII forming simple membranous plate. Pygofer with few macrosetae distributed dorsally on apical third ( ). Internal abdominal sternite VIII forming simple membranous plate. Pygofer with few macrosetae distributed dorsally on apical third (
<figureCitation id="135A2A790611FFD39A1EF8F0FC3CF8C4" box="[841,912,1879,1898]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Fig. 11</figureCitation> <figureCitation id="135A2A790611FFD39A1EF8F0FC3CF8C4" box="[841,912,1879,1898]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Fig. 11</figureCitation>
). First valvula, in ventral view, with base truncate and lateral preapical concavities ( ). First valvula, in ventral view, with base truncate and lateral preapical concavities (
<figureCitation id="135A2A790611FFD39D25F8D4FB14F828" box="[1138,1208,1907,1926]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Fig. 12</figureCitation> <figureCitation id="135A2A790611FFD39D25F8D4FB14F828" box="[1138,1208,1907,1926]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Fig. 12</figureCitation>
). Second valvula bearing 38 non-contiguous teeth ( ). Second valvula bearing 38 non-contiguous teeth (
<figureCitation id="135A2A790611FFD39D65F828FBD5F80C" box="[1074,1145,1935,1954]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Fig. 14</figureCitation> <figureCitation id="135A2A790611FFD39D65F828FBD5F80C" box="[1074,1145,1935,1954]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Fig. 14</figureCitation>
); teeth with denticles distributed on anterior and posterior margin ( ); teeth with denticles distributed on anterior and posterior margin (
<figureCitation id="135A2A790611FFD39DF4F80CFB4BF810" box="[1187,1255,1963,1982]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="1" pageNumber="325">Fig. 13</figureCitation> <figureCitation id="135A2A790611FFD39DF4F80CFB4BF810" box="[1187,1255,1963,1982]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="1" pageNumber="325">Fig. 13</figureCitation>
); apex broadly rounded ( ); apex broadly rounded (
<figureCitation id="135A2A790612FFD0990AFA13FF0DFA68" box="[93,161,1459,1479]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="2" pageNumber="326">Fig. 15</figureCitation> <figureCitation id="135A2A790612FFD0990AFA13FF0DFA68" box="[93,161,1459,1479]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="2" pageNumber="326">Fig. 15</figureCitation>
). Gonoplac with apex narrowly round; few microsetae on apical margin ( ). Gonoplac with apex narrowly round; few microsetae on apical margin (
<figureCitation id="135A2A790612FFD099BAFA68FE9CFA4D" box="[237,304,1487,1507]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="2" pageNumber="326">Fig. 11</figureCitation> <figureCitation id="135A2A790612FFD099BAFA68FE9CFA4D" box="[237,304,1487,1507]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="2" pageNumber="326">Fig. 11</figureCitation>
). ).
</paragraph> </paragraph>
<caption id="DF1E66740612FFD09902FAA2FF77FAC1" pageId="2" pageNumber="326" startId="2.[85,120,1285,1299]" targetBox="[307,1258,151,1253]" targetPageId="2" targetType="figure"> <caption id="DF1E66740612FFD09902FAA2FF77FAC1" ID-DOI="http://doi.org/10.5281/zenodo.13195990" ID-Zenodo-Dep="13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="2" pageNumber="326" startId="2.[85,120,1285,1299]" targetBox="[307,1258,151,1253]" targetPageId="2" targetType="figure">
<paragraph id="8BDE36FC0612FFD09902FAA2FF77FAC1" blockId="2.[85,1475,1284,1391]" pageId="2" pageNumber="326"> <paragraph id="8BDE36FC0612FFD09902FAA2FF77FAC1" blockId="2.[85,1475,1284,1391]" pageId="2" pageNumber="326">
<emphasis id="B915EAEE0612FFD09902FAA2FF03FABD" bold="true" box="[85,175,1285,1299]" pageId="2" pageNumber="326">Figs. 515.</emphasis> <emphasis id="B915EAEE0612FFD09902FAA2FF03FABD" bold="true" box="[85,175,1285,1299]" pageId="2" pageNumber="326">Figs. 515.</emphasis>
<taxonomicName id="4C614D7F0612FFD099EFFAA3FEB6FABA" authorityName="Ferreira &amp; Lozada &amp; Takiya" authorityYear="2018" box="[184,282,1284,1300]" class="Insecta" family="Cicadellidae" genus="Onega" kingdom="Animalia" order="Hemiptera" pageId="2" pageNumber="326" phylum="Arthropoda" rank="species" species="musa" status="sp. nov."> <taxonomicName id="4C614D7F0612FFD099EFFAA3FEB6FABA" authorityName="Ferreira &amp; Lozada &amp; Takiya" authorityYear="2018" box="[184,282,1284,1300]" class="Insecta" family="Cicadellidae" genus="Onega" kingdom="Animalia" order="Hemiptera" pageId="2" pageNumber="326" phylum="Arthropoda" rank="species" species="musa" status="sp. nov.">
@ -168,11 +169,11 @@ Variation of
: The general coloration of the Ecuadorian : The general coloration of the Ecuadorian
<typeStatus id="54DA885E0612FFD09902F9AFFF03F9B5" box="[85,175,1544,1563]" pageId="2" pageNumber="326" type="paratype">paratype</typeStatus> <typeStatus id="54DA885E0612FFD09902F9AFFF03F9B5" box="[85,175,1544,1563]" pageId="2" pageNumber="326" type="paratype">paratype</typeStatus>
varies in having the yellow tone much brighter; dorsal areas darker brown; median crown macula reddish-brown; frons completely yellow; and pronotum discal spots not confluent ( varies in having the yellow tone much brighter; dorsal areas darker brown; median crown macula reddish-brown; frons completely yellow; and pronotum discal spots not confluent (
<figureCitation id="135A2A790612FFD099D2F9FCFEAAF9C0" box="[133,262,1627,1646]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." pageId="2" pageNumber="326">Figs. 3 and 4</figureCitation> <figureCitation id="135A2A790612FFD099D2F9FCFEAAF9C0" box="[133,262,1627,1646]" captionStart="Figs" captionStartId="1.[114,149,739,753]" captionTargetBox="[327,1288,151,706]" captionTargetId="figure-13@1.[326,1290,149,708]" captionTargetPageId="1" captionText="Figs. 14. Onega musa sp. nov.: (12) holotype; (1) dorsal habitus; (2) lateral habitus; (34) paratype from Ecuador; (3) dorsal habitus; (4) lateral habitus. Scale bars =2 mm." figureDoi="http://doi.org/10.5281/zenodo.13195988" httpUri="https://zenodo.org/record/13195988/files/figure.png" pageId="2" pageNumber="326">Figs. 3 and 4</figureCitation>
). In the male genitalia, the Ecuadorian ). In the male genitalia, the Ecuadorian
<typeStatus id="54DA885E0612FFD09BCDF9FCFD58F9C0" box="[666,756,1627,1646]" pageId="2" pageNumber="326" type="paratype">paratype</typeStatus> <typeStatus id="54DA885E0612FFD09BCDF9FCFD58F9C0" box="[666,756,1627,1646]" pageId="2" pageNumber="326" type="paratype">paratype</typeStatus>
have subgenital plates with lateral macrosetae absent at basal third and aedeagus with dorsoapical process bifurcate and shorter apical process ( have subgenital plates with lateral macrosetae absent at basal third and aedeagus with dorsoapical process bifurcate and shorter apical process (
<figureCitation id="135A2A790612FFD0998EF908FEBEF96C" box="[217,274,1711,1730]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." pageId="2" pageNumber="326">Fig. 9</figureCitation> <figureCitation id="135A2A790612FFD0998EF908FEBEF96C" box="[217,274,1711,1730]" captionStart="Figs" captionStartId="2.[85,120,1285,1299]" captionTargetBox="[307,1258,151,1253]" captionTargetId="figure-13@2.[297,1261,148,1255]" captionTargetPageId="2" captionText="Figs. 515. Onega musa sp. nov.: (59) male genitalia; (5) pygofer, valve, and subgenital plate, lateral view; (6) valve and subgenital plates, ventral view; (7) style and connective, ventral view; (8) aedeagus holotype, lateral view; (9) aedeagus of paratype from Ecuador, lateral view; (1016) female genitalia; (10) sternite VII, ventral view; (11) sternite VII, pygofer, and gonoplac, lateral view; (12) bases of first valvulae of ovipositor, ventral view; (13) denticles from median portion of shaft of second valvula of ovipositor, lateral view; (14) second valvula of ovipositor, lateral view; (15) apex of second valvula of ovipositor, lateral view. Scale bars: 0.5mm (512); 0.2 mm (14); 0.1 mm (1315)." figureDoi="http://doi.org/10.5281/zenodo.13195990" httpUri="https://zenodo.org/record/13195990/files/figure.png" pageId="2" pageNumber="326">Fig. 9</figureCitation>
). Peruvian ). Peruvian
<typeStatus id="54DA885E0612FFD098DCF908FE43F96C" box="[395,495,1711,1730]" pageId="2" pageNumber="326" type="paratype">paratypes</typeStatus> <typeStatus id="54DA885E0612FFD098DCF908FE43F96C" box="[395,495,1711,1730]" pageId="2" pageNumber="326" type="paratype">paratypes</typeStatus>
may also have bifurcate dorsoapical process. Furthermore, the Ecuadorian may also have bifurcate dorsoapical process. Furthermore, the Ecuadorian

View file

@ -1,56 +1,57 @@
<document id="DE62AACB48E27AF49F14ECDBB6BC2A42" ID-DOI="10.1016/j.rbe.2018.12.002" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635825694" checkinUser="felipe" docAuthor="Vasconcelos, Ana Caroline O., Wendt, Lisiane D. &amp; de Carvalho, Claudio J. B." docDate="2019" docId="063A87885E67F54D9958BF29FE853CED" docLanguage="en" docName="RevBrasEntomol.63.1.80-90.pdf" docOrigin="Revista Brasileira de Entomologia 63 (1)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.12.002" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Plagiocephalus intermedius Kameneva 2004" docType="treatment" docVersion="1" lastPageNumber="89" masterDocId="FA03FFF05E6FF5449A1CBA35FFD03F55" masterDocTitle="Taxonomic revision of the Neotropical stalk-eyed fly Plagiocephalus Wiedemann (Diptera, Ulidiidae, Ulidiinae)" masterLastPageNumber="90" masterPageNumber="80" pageNumber="88" updateTime="1722680378316" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0"> <document id="9E5808A1F25B0A2F2B8110F28AB16B1C" ID-DOI="10.1016/j.rbe.2018.12.002" ID-ISSN="1806-9665" ID-Zenodo-Dep="13196000" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635825694" checkinUser="felipe" docAuthor="Vasconcelos, Ana Caroline O., Wendt, Lisiane D. &amp; de Carvalho, Claudio J. B." docDate="2019" docId="063A87885E67F54D9958BF29FE853CED" docLanguage="en" docName="RevBrasEntomol.63.1.80-90.pdf" docOrigin="Revista Brasileira de Entomologia 63 (1)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.12.002" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Plagiocephalus intermedius Kameneva 2004" docType="treatment" docVersion="3" lastPageNumber="89" masterDocId="FA03FFF05E6FF5449A1CBA35FFD03F55" masterDocTitle="Taxonomic revision of the Neotropical stalk-eyed fly Plagiocephalus Wiedemann (Diptera, Ulidiidae, Ulidiinae)" masterLastPageNumber="90" masterPageNumber="80" pageNumber="88" updateTime="1722683459333" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="99E5EB4CF4FED3E50B1D9FE5F3E004B4" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="777CAB11430EFEBA7E86521031E189BA" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="54104F870D8DAEAFF80965DB829A3394"> <mods:titleInfo id="8B2D96492AE4E17FFBF0ADCEBB458D85">
<mods:title id="A791990B0B630BD56843E0FD881F6E98">Taxonomic revision of the Neotropical stalk-eyed fly Plagiocephalus Wiedemann (Diptera, Ulidiidae, Ulidiinae)</mods:title> <mods:title id="2DA09BC94D3C5551B8B29F07620E1392">Taxonomic revision of the Neotropical stalk-eyed fly Plagiocephalus Wiedemann (Diptera, Ulidiidae, Ulidiinae)</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="0084DF587076E34C87B8BCC79E07893E" type="personal"> <mods:name id="BCDDAFDF084DDD7910D33073F3FD1A3D" type="personal">
<mods:role id="955416E5466C92CF07DEB113AE5FF1DC"> <mods:role id="F77BD375591F322ACCF8BE2F0094F653">
<mods:roleTerm id="C85A339133BE565E93A757B684F15132">Author</mods:roleTerm> <mods:roleTerm id="FB030DEBE5189F92BB542612C0FC2E79">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="8199986B242AE7E34DC37B1EFA71FD09">Vasconcelos, Ana Caroline O.</mods:namePart> <mods:namePart id="8EEEAEE03F4C4A906F75937E4A515027">Vasconcelos, Ana Caroline O.</mods:namePart>
</mods:name> </mods:name>
<mods:name id="E81A19FAB340483267EF0BC1B497E9D9" type="personal"> <mods:name id="33C8ECE52873AD4E478EE488956BBA15" type="personal">
<mods:role id="82C7937AC23B00E5463A19671472A867"> <mods:role id="0E48B1AEC2A6EB2B3A48D56C854C3937">
<mods:roleTerm id="30C8F2A0E488E3C94D7A04941265C5DA">Author</mods:roleTerm> <mods:roleTerm id="2E7D4751F44650BF9C38F6B23BC41EA2">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="99C8A8EB989369D6705A9B9E759D95CD">Wendt, Lisiane D.</mods:namePart> <mods:namePart id="E34CA5867FAD71E70072F17ABA0C25F0">Wendt, Lisiane D.</mods:namePart>
</mods:name> </mods:name>
<mods:name id="AEA2A49994C058ECCAC0FE3D0AFC0735" type="personal"> <mods:name id="C2E5510DA791DD1793F0C4BA01541D02" type="personal">
<mods:role id="93514EAFCAB944D71F6DF19A3DBEA649"> <mods:role id="D0FA1AB29230486ED7B97582A58DBF33">
<mods:roleTerm id="D3338EC1256DD546D814C628BA5656AF">Author</mods:roleTerm> <mods:roleTerm id="B3C08E81FFB6724569FC238D0AE89F5C">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="10F28063705C77B83C590FD3924DA296">de Carvalho, Claudio J. B.</mods:namePart> <mods:namePart id="39218F31526CAC31A29292A354D94D45">de Carvalho, Claudio J. B.</mods:namePart>
</mods:name> </mods:name>
<mods:typeOfResource id="7BA259654921499EF0673850AE17B497">text</mods:typeOfResource> <mods:typeOfResource id="859B6CD259A72CB02395009863941C57">text</mods:typeOfResource>
<mods:relatedItem id="32EBFB5776509418700C628F3830336B" type="host"> <mods:relatedItem id="26AEC141CA85D10823098EF81B4812A4" type="host">
<mods:titleInfo id="6C47CDE3810A282127982DA912F83FDF"> <mods:titleInfo id="EAE58000D3EEEDFC1EB49EA696A690B6">
<mods:title id="9BBCCB09F8F24713FFE7A4C15916C699">Revista Brasileira de Entomologia</mods:title> <mods:title id="D1C6F257C5672B67DFB43AF1D460339F">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="1A8219435C6088BEAF4810B75E5F3082"> <mods:part id="9E49CBFD52A72BEA2F6418FDE5BA4C42">
<mods:date id="C6882B1738EA5D94E53A6F9FA5853E01">2019</mods:date> <mods:date id="969D1F92980CEF2663A4BF6BA25C07D3">2019</mods:date>
<mods:detail id="DDD81EBABABF609A732B0D5EC5158247" type="pubDate"> <mods:detail id="C44ABDB8A652724AF49621AD6BF20F07" type="pubDate">
<mods:number id="E92C039F8B55AA26E8B117E7447C855F">2018-12-31</mods:number> <mods:number id="9816749906270FDBA25D59759A57F26E">2018-12-31</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="E154BF319265B992B5E510E410210CCF" type="volume"> <mods:detail id="2D22B916569285014D7D3014BF5033EA" type="volume">
<mods:number id="DB288517E652596CCADAADDF41C86BE4">63</mods:number> <mods:number id="87287DF9E32F4FCB88D5D8D30F171E4F">63</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="6E2E3AACFB4D16D9D7660F27A0CD0603" type="issue"> <mods:detail id="0FE760E7D1C84F22186A948FE138E58C" type="issue">
<mods:number id="BA3FA89AEAF38221C29D35056BF25EA7">1</mods:number> <mods:number id="4801DFEA50CE2A6E046CF6246B83BAF5">1</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="68AF10B7803173A4ADCB4207B4C42BC9" unit="page"> <mods:extent id="17F5FDCA029C0C1BA42E266A8F159A88" unit="page">
<mods:start id="45E699A58D94FDAFDAC3686FD2D7E0EC">80</mods:start> <mods:start id="6DF29695BBB9A78608F9D5D2CDB79745">80</mods:start>
<mods:end id="186004BBF67688EC19C758063B5E1212">90</mods:end> <mods:end id="DD9BA9078C5C57FA7CFF80F9441E55FE">90</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="2A744E4CBD91D660F77BA0EA57DFDF3B"> <mods:location id="C71D04BEF7EB63CD5ECA4CA0D3BE3723">
<mods:url id="947A2B4D5DF44743BF88C718CD095244">http://dx.doi.org/10.1016/j.rbe.2018.12.002</mods:url> <mods:url id="2309205A2F4E13C07DE404F07D45697D">http://dx.doi.org/10.1016/j.rbe.2018.12.002</mods:url>
</mods:location> </mods:location>
<mods:classification id="B50FD2E3AD65D8168CEBB1C100E13A4D">journal article</mods:classification> <mods:classification id="70E955F71D3C5C3141B2BAFE4AF0C0DE">journal article</mods:classification>
<mods:identifier id="6D9D256F89A5B1BF0D27B8AB95DD98E9" type="DOI">10.1016/j.rbe.2018.12.002</mods:identifier> <mods:identifier id="6E8567B615DD4ACA4F9F12E61045B530" type="DOI">10.1016/j.rbe.2018.12.002</mods:identifier>
<mods:identifier id="A9680E139C2910A54FBAD13EFE9E26CC" type="ISSN">1806-9665</mods:identifier> <mods:identifier id="2E38F930056848AB1A1C9403B2F45F70" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="DAE69DFD0BA88652BE1F340DA6D8A372" type="Zenodo-Dep">13196000</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="063A87885E67F54D9958BF29FE853CED" LSID="urn:lsid:plazi:treatment:063A87885E67F54D9958BF29FE853CED" httpUri="http://treatment.plazi.org/id/063A87885E67F54D9958BF29FE853CED" lastPageId="9" lastPageNumber="89" pageId="8" pageNumber="88"> <treatment id="063A87885E67F54D9958BF29FE853CED" ID-DOI="http://doi.org/10.5281/zenodo.13194794" ID-Zenodo-Dep="13194794" LSID="urn:lsid:plazi:treatment:063A87885E67F54D9958BF29FE853CED" httpUri="http://treatment.plazi.org/id/063A87885E67F54D9958BF29FE853CED" lastPageId="9" lastPageNumber="89" pageId="8" pageNumber="88">
<subSubSection id="C68965155E67F54C9958BF29FAC43A65" box="[836,1300,1308,1328]" pageId="8" pageNumber="88" type="nomenclature"> <subSubSection id="C68965155E67F54C9958BF29FAC43A65" box="[836,1300,1308,1328]" pageId="8" pageNumber="88" type="nomenclature">
<paragraph id="8E2C369E5E67F54C9958BF29FAC43A65" blockId="8.[836,1300,1308,1328]" box="[836,1300,1308,1328]" pageId="8" pageNumber="88"> <paragraph id="8E2C369E5E67F54C9958BF29FAC43A65" blockId="8.[836,1300,1308,1328]" box="[836,1300,1308,1328]" pageId="8" pageNumber="88">
<heading id="D56481F25E67F54C9958BF29FAC43A65" box="[836,1300,1308,1328]" fontSize="8" level="2" pageId="8" pageNumber="88" reason="7"> <heading id="D56481F25E67F54C9958BF29FAC43A65" box="[836,1300,1308,1328]" fontSize="8" level="2" pageId="8" pageNumber="88" reason="7">
@ -66,9 +67,9 @@
<heading id="D56481F25E67F54C9958BF57FC263A20" bold="true" box="[836,1014,1378,1397]" fontSize="8" level="2" pageId="8" pageNumber="88" reason="2"> <heading id="D56481F25E67F54C9958BF57FC263A20" bold="true" box="[836,1014,1378,1397]" fontSize="8" level="2" pageId="8" pageNumber="88" reason="2">
<emphasis id="BCE7EA8C5E67F54C9958BF57FC263A20" bold="true" box="[836,1014,1378,1397]" pageId="8" pageNumber="88"> <emphasis id="BCE7EA8C5E67F54C9958BF57FC263A20" bold="true" box="[836,1014,1378,1397]" pageId="8" pageNumber="88">
( (
<figureCitation id="16A82A1B5E67F54C9950BF57FC623A20" box="[844,946,1378,1397]" captionStart="Fig" captionStartId="2.[85,112,1035,1049]" captionTargetBox="[371,1196,149,998]" captionTargetId="figure-14@2.[364,1197,148,1004]" captionTargetPageId="2" captionText="Fig. 2. AC. Plagiocephalus lobularis, female: A. Head in frontal view; B. Body in dorsal view; C. Body in lateral view. DF. Plagiocephalus latifrons, female: D. Head in frontal view; E. Body in dorsal view; F. Body in lateral view. GI. Plagiocephalus intermedius, female: G. Head in frontal view; H. Body in dorsal view; I. Body in lateral view." pageId="8" pageNumber="88">Figs. 2GI</figureCitation> <figureCitation id="16A82A1B5E67F54C9950BF57FC623A20" box="[844,946,1378,1397]" captionStart="Fig" captionStartId="2.[85,112,1035,1049]" captionTargetBox="[371,1196,149,998]" captionTargetId="figure-14@2.[364,1197,148,1004]" captionTargetPageId="2" captionText="Fig. 2. AC. Plagiocephalus lobularis, female: A. Head in frontal view; B. Body in dorsal view; C. Body in lateral view. DF. Plagiocephalus latifrons, female: D. Head in frontal view; E. Body in dorsal view; F. Body in lateral view. GI. Plagiocephalus intermedius, female: G. Head in frontal view; H. Body in dorsal view; I. Body in lateral view." figureDoi="http://doi.org/10.5281/zenodo.13196004" httpUri="https://zenodo.org/record/13196004/files/figure.png" pageId="8" pageNumber="88">Figs. 2GI</figureCitation>
, ,
<figureCitation id="16A82A1B5E67F54C99A0BF57FC3E3A20" box="[956,1006,1378,1397]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." pageId="8" pageNumber="88">3E, F</figureCitation> <figureCitation id="16A82A1B5E67F54C99A0BF57FC3E3A20" box="[956,1006,1378,1397]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." figureDoi="http://doi.org/10.5281/zenodo.13196006" httpUri="https://zenodo.org/record/13196006/files/figure.png" pageId="8" pageNumber="88">3E, F</figureCitation>
) )
</emphasis> </emphasis>
</heading> </heading>
@ -350,19 +351,19 @@ and shorter than in
<emphasis id="BCE7EA8C5E66F54D9A6EBB33FF0D3E4F" box="[114,221,262,282]" italics="true" pageId="9" pageNumber="89">P. latifrons</emphasis> <emphasis id="BCE7EA8C5E66F54D9A6EBB33FF0D3E4F" box="[114,221,262,282]" italics="true" pageId="9" pageNumber="89">P. latifrons</emphasis>
</taxonomicName> </taxonomicName>
(3.007.00 mm); female parafacialia yellow ( (3.007.00 mm); female parafacialia yellow (
<figureCitation id="16A82A1B5E66F54D98A5BB32FCD53E4E" box="[697,773,263,283]" captionStart="Fig" captionStartId="2.[85,112,1035,1049]" captionTargetBox="[371,1196,149,998]" captionTargetId="figure-14@2.[364,1197,148,1004]" captionTargetPageId="2" captionText="Fig. 2. AC. Plagiocephalus lobularis, female: A. Head in frontal view; B. Body in dorsal view; C. Body in lateral view. DF. Plagiocephalus latifrons, female: D. Head in frontal view; E. Body in dorsal view; F. Body in lateral view. GI. Plagiocephalus intermedius, female: G. Head in frontal view; H. Body in dorsal view; I. Body in lateral view." pageId="9" pageNumber="89">Fig. 2G</figureCitation> <figureCitation id="16A82A1B5E66F54D98A5BB32FCD53E4E" box="[697,773,263,283]" captionStart="Fig" captionStartId="2.[85,112,1035,1049]" captionTargetBox="[371,1196,149,998]" captionTargetId="figure-14@2.[364,1197,148,1004]" captionTargetPageId="2" captionText="Fig. 2. AC. Plagiocephalus lobularis, female: A. Head in frontal view; B. Body in dorsal view; C. Body in lateral view. DF. Plagiocephalus latifrons, female: D. Head in frontal view; E. Body in dorsal view; F. Body in lateral view. GI. Plagiocephalus intermedius, female: G. Head in frontal view; H. Body in dorsal view; I. Body in lateral view." figureDoi="http://doi.org/10.5281/zenodo.13196004" httpUri="https://zenodo.org/record/13196004/files/figure.png" pageId="9" pageNumber="89">Fig. 2G</figureCitation>
); radial-medial band with base wider than apex, at most barely touching the discal band ( ); radial-medial band with base wider than apex, at most barely touching the discal band (
<figureCitation id="16A82A1B5E66F54D9B6BBB0AFE023E07" box="[375,466,319,339]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." pageId="9" pageNumber="89">Fig. 3E, F</figureCitation> <figureCitation id="16A82A1B5E66F54D9B6BBB0AFE023E07" box="[375,466,319,339]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." figureDoi="http://doi.org/10.5281/zenodo.13196006" httpUri="https://zenodo.org/record/13196006/files/figure.png" pageId="9" pageNumber="89">Fig. 3E, F</figureCitation>
). The species can also be distinguished by male face yellowish white; male scape, pedicel and first flagellomere entirely yellow, and female scape, pedicel and first flagellomere gold with apex darker ( ). The species can also be distinguished by male face yellowish white; male scape, pedicel and first flagellomere entirely yellow, and female scape, pedicel and first flagellomere gold with apex darker (
<figureCitation id="16A82A1B5E66F54D9BF6BBA6FDE53EF3" box="[490,565,403,422]" captionStart="Fig" captionStartId="2.[85,112,1035,1049]" captionTargetBox="[371,1196,149,998]" captionTargetId="figure-14@2.[364,1197,148,1004]" captionTargetPageId="2" captionText="Fig. 2. AC. Plagiocephalus lobularis, female: A. Head in frontal view; B. Body in dorsal view; C. Body in lateral view. DF. Plagiocephalus latifrons, female: D. Head in frontal view; E. Body in dorsal view; F. Body in lateral view. GI. Plagiocephalus intermedius, female: G. Head in frontal view; H. Body in dorsal view; I. Body in lateral view." pageId="9" pageNumber="89">Fig. 2G</figureCitation> <figureCitation id="16A82A1B5E66F54D9BF6BBA6FDE53EF3" box="[490,565,403,422]" captionStart="Fig" captionStartId="2.[85,112,1035,1049]" captionTargetBox="[371,1196,149,998]" captionTargetId="figure-14@2.[364,1197,148,1004]" captionTargetPageId="2" captionText="Fig. 2. AC. Plagiocephalus lobularis, female: A. Head in frontal view; B. Body in dorsal view; C. Body in lateral view. DF. Plagiocephalus latifrons, female: D. Head in frontal view; E. Body in dorsal view; F. Body in lateral view. GI. Plagiocephalus intermedius, female: G. Head in frontal view; H. Body in dorsal view; I. Body in lateral view." figureDoi="http://doi.org/10.5281/zenodo.13196004" httpUri="https://zenodo.org/record/13196004/files/figure.png" pageId="9" pageNumber="89">Fig. 2G</figureCitation>
); palpus yellow; proboscis reddish yellow, with brown and yellow setulae. Male wing of normal outline, without posterior lobes ( ); palpus yellow; proboscis reddish yellow, with brown and yellow setulae. Male wing of normal outline, without posterior lobes (
<figureCitation id="16A82A1B5E66F54D9830BBFEFDA33E8B" box="[556,627,459,478]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." pageId="9" pageNumber="89">Fig. 3E</figureCitation> <figureCitation id="16A82A1B5E66F54D9830BBFEFDA33E8B" box="[556,627,459,478]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." figureDoi="http://doi.org/10.5281/zenodo.13196006" httpUri="https://zenodo.org/record/13196006/files/figure.png" pageId="9" pageNumber="89">Fig. 3E</figureCitation>
); crossvein r-m located distinctly before the apex of vein R ); crossvein r-m located distinctly before the apex of vein R
<subScript id="121734DB5E66F54D9839BBDBFDFF3EA9" attach="left" box="[549,559,494,508]" fontSize="6" pageId="9" pageNumber="89">1</subScript> <subScript id="121734DB5E66F54D9839BBDBFDFF3EA9" attach="left" box="[549,559,494,508]" fontSize="6" pageId="9" pageNumber="89">1</subScript>
( (
<figureCitation id="16A82A1B5E66F54D9822BBD2FD4B3EAF" box="[574,667,487,506]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." pageId="9" pageNumber="89">Fig. 3E, F</figureCitation> <figureCitation id="16A82A1B5E66F54D9822BBD2FD4B3EAF" box="[574,667,487,506]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." figureDoi="http://doi.org/10.5281/zenodo.13196006" httpUri="https://zenodo.org/record/13196006/files/figure.png" pageId="9" pageNumber="89">Fig. 3E, F</figureCitation>
); male subapical band curved and narrower when touching the apical band ( ); male subapical band curved and narrower when touching the apical band (
<figureCitation id="16A82A1B5E66F54D9A66B82BFF103D67" box="[122,192,542,562]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." pageId="9" pageNumber="89">Fig. 3E</figureCitation> <figureCitation id="16A82A1B5E66F54D9A66B82BFF103D67" box="[122,192,542,562]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." figureDoi="http://doi.org/10.5281/zenodo.13196006" httpUri="https://zenodo.org/record/13196006/files/figure.png" pageId="9" pageNumber="89">Fig. 3E</figureCitation>
); male apical band wider than in ); male apical band wider than in
<taxonomicName id="49934D1D5E66F54D9813B828FDAA3D64" box="[527,634,541,561]" class="Insecta" family="Ulidiidae" genus="Plagiocephalus" kingdom="Animalia" order="Diptera" pageId="9" pageNumber="89" phylum="Arthropoda" rank="species" species="lobularis"> <taxonomicName id="49934D1D5E66F54D9813B828FDAA3D64" box="[527,634,541,561]" class="Insecta" family="Ulidiidae" genus="Plagiocephalus" kingdom="Animalia" order="Diptera" pageId="9" pageNumber="89" phylum="Arthropoda" rank="species" species="lobularis">
<emphasis id="BCE7EA8C5E66F54D9813B828FDAA3D64" box="[527,634,541,561]" italics="true" pageId="9" pageNumber="89">P. lobularis</emphasis> <emphasis id="BCE7EA8C5E66F54D9813B828FDAA3D64" box="[527,634,541,561]" italics="true" pageId="9" pageNumber="89">P. lobularis</emphasis>
@ -372,9 +373,9 @@ and
<emphasis id="BCE7EA8C5E66F54D98B6B828FCC13D64" box="[682,785,541,561]" italics="true" pageId="9" pageNumber="89">P. latifrons</emphasis> <emphasis id="BCE7EA8C5E66F54D98B6B828FCC13D64" box="[682,785,541,561]" italics="true" pageId="9" pageNumber="89">P. latifrons</emphasis>
</taxonomicName> </taxonomicName>
( (
<figureCitation id="16A82A1B5E66F54D9A66B80FFF103D18" box="[122,192,570,589]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." pageId="9" pageNumber="89">Fig. 3E</figureCitation> <figureCitation id="16A82A1B5E66F54D9A66B80FFF103D18" box="[122,192,570,589]" captionStart="Fig" captionStartId="2.[85,112,1727,1741]" captionTargetBox="[364,1195,1133,1676]" captionTargetId="figure-105@2.[364,1197,1131,1685]" captionTargetPageId="2" captionText="Fig. 3. AB.Plagiocephalus lobularis: A.Male wing; B. Female wing. CD.Plagiocephalus latifrons: C.Male wing; D. Female wing. EF.Plagiocephalus intermedius: E.Male wing; F. Female wing. Abbreviations: ab: apical band; db: discal band; sab: subapical band; rmb: radial-medial band." figureDoi="http://doi.org/10.5281/zenodo.13196006" httpUri="https://zenodo.org/record/13196006/files/figure.png" pageId="9" pageNumber="89">Fig. 3E</figureCitation>
). Male fore and mid legs entirely yellow, and hind leg yellow to gold; female legs brown with tarsi lighter, and fore femur yellowish on the apex ( ). Male fore and mid legs entirely yellow, and hind leg yellow to gold; female legs brown with tarsi lighter, and fore femur yellowish on the apex (
<figureCitation id="16A82A1B5E66F54D9B42B847FE4D3DD0" box="[350,413,626,645]" captionStart="Fig" captionStartId="2.[85,112,1035,1049]" captionTargetBox="[371,1196,149,998]" captionTargetId="figure-14@2.[364,1197,148,1004]" captionTargetPageId="2" captionText="Fig. 2. AC. Plagiocephalus lobularis, female: A. Head in frontal view; B. Body in dorsal view; C. Body in lateral view. DF. Plagiocephalus latifrons, female: D. Head in frontal view; E. Body in dorsal view; F. Body in lateral view. GI. Plagiocephalus intermedius, female: G. Head in frontal view; H. Body in dorsal view; I. Body in lateral view." pageId="9" pageNumber="89">Fig. 2I</figureCitation> <figureCitation id="16A82A1B5E66F54D9B42B847FE4D3DD0" box="[350,413,626,645]" captionStart="Fig" captionStartId="2.[85,112,1035,1049]" captionTargetBox="[371,1196,149,998]" captionTargetId="figure-14@2.[364,1197,148,1004]" captionTargetPageId="2" captionText="Fig. 2. AC. Plagiocephalus lobularis, female: A. Head in frontal view; B. Body in dorsal view; C. Body in lateral view. DF. Plagiocephalus latifrons, female: D. Head in frontal view; E. Body in dorsal view; F. Body in lateral view. GI. Plagiocephalus intermedius, female: G. Head in frontal view; H. Body in dorsal view; I. Body in lateral view." figureDoi="http://doi.org/10.5281/zenodo.13196004" httpUri="https://zenodo.org/record/13196004/files/figure.png" pageId="9" pageNumber="89">Fig. 2I</figureCitation>
). ).
</paragraph> </paragraph>
<paragraph id="8E2C369E5E66F54D9A8EB8B8FE4F3DE8" blockId="9.[114,786,152,952]" pageId="9" pageNumber="89"> <paragraph id="8E2C369E5E66F54D9A8EB8B8FE4F3DE8" blockId="9.[114,786,152,952]" pageId="9" pageNumber="89">
@ -420,7 +421,7 @@ and
<emphasis id="BCE7EA8C5E66F54D9A8EB92CFECA3C79" bold="true" box="[146,282,793,812]" pageId="9" pageNumber="89">Distribution.</emphasis> <emphasis id="BCE7EA8C5E66F54D9A8EB92CFECA3C79" bold="true" box="[146,282,793,812]" pageId="9" pageNumber="89">Distribution.</emphasis>
<collectingCountry id="F684760E5E66F54D9B3CB92FFE573C79" box="[288,391,793,813]" name="Costa Rica" pageId="9" pageNumber="89">Costa Rica</collectingCountry> <collectingCountry id="F684760E5E66F54D9B3CB92FFE573C79" box="[288,391,793,813]" name="Costa Rica" pageId="9" pageNumber="89">Costa Rica</collectingCountry>
( (
<figureCitation id="16A82A1B5E66F54D9B89B92CFE1A3C79" box="[405,458,793,812]" captionStart="Fig" captionStartId="6.[85,112,1085,1099]" captionTargetBox="[170,1387,152,1054]" captionTargetId="figure-13@6.[169,1388,150,1055]" captionTargetPageId="6" captionText="Fig. 6. Distribution map of Plagiocephalus with Costa Rica detached. Circles show distribution records from the literature. Stars show new distribution records. Yellow: P. intermedius; Red: P.latifrons; Light blue: P.lobularis." pageId="9" pageNumber="89">Fig. 6</figureCitation> <figureCitation id="16A82A1B5E66F54D9B89B92CFE1A3C79" box="[405,458,793,812]" captionStart="Fig" captionStartId="6.[85,112,1085,1099]" captionTargetBox="[170,1387,152,1054]" captionTargetId="figure-13@6.[169,1388,150,1055]" captionTargetPageId="6" captionText="Fig. 6. Distribution map of Plagiocephalus with Costa Rica detached. Circles show distribution records from the literature. Stars show new distribution records. Yellow: P. intermedius; Red: P.latifrons; Light blue: P.lobularis." figureDoi="http://doi.org/10.5281/zenodo.13196012" httpUri="https://zenodo.org/record/13196012/files/figure.png" pageId="9" pageNumber="89">Fig. 6</figureCitation>
). ).
</paragraph> </paragraph>
</subSubSection> </subSubSection>

View file

@ -0,0 +1,266 @@
<document id="BE6AD309FF0CB7886DC7CD7FFFF52E6B" ID-DOI="10.1590/1806-9665-RBENT-2024-0008" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722639920604" checkinUser="felipe" docAuthor="Mejdalani, Gabriel, Silva, Adriane Pereira, Froza, Joyce Adriana, Carvalho, Stéphanie Riehl, Pecly, Nathalia Hiluy &amp; Quintas, Victor Cordeiro" docDate="2024" docId="090287EBFF83BF04FCF806EAC325FE68" docLanguage="en" docName="RevBrasEntomol.68.2.e20240008.pdf" docOrigin="Revista Brasileira de Entomologia (e 20240008) 68 (2)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2024-0008" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Balacha caledonia Mejdalani, Silva, Froza, Carvalho, Pecly &amp; Quintas, 2024, sp. nov." docType="treatment" docVersion="1" lastPageNumber="5" masterDocId="F53BFF93FF82BF00FFBF045BC02AFFBF" masterDocTitle="A new species of the sharpshooter genus Balacha from an alpine field in southeastern Brazil (Insecta: Hemiptera: Cicadellidae: Cicadellini)" masterLastPageNumber="7" masterPageNumber="1" pageNumber="2" updateTime="1722683587285" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="0A938EAD54CAD38C7809379A4A3E2308" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="5BABDBF5985345C4F329A8728FD6D8F9">
<mods:title id="4E54A47382CAA464B25BF8D4EDE7183A">A new species of the sharpshooter genus Balacha from an alpine field in southeastern Brazil (Insecta: Hemiptera: Cicadellidae: Cicadellini)</mods:title>
</mods:titleInfo>
<mods:name id="5ADE56BF66A57A21174C07F230EE7309" type="personal">
<mods:role id="CFE340FCE401EC607A1F553DD514A2A5">
<mods:roleTerm id="9FD676BB62D6A3484C1438B36488C55E">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="EC0E4E543CDA94E4B6871E7E99E9B8D0">Mejdalani, Gabriel</mods:namePart>
<mods:affiliation id="38201D1F1B5581DE3C4F39D4AAEE8C61">Universidade Federal do Rio de Janeiro (UFRJ), Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brasil.</mods:affiliation>
</mods:name>
<mods:name id="F8A59D41AF2E877BEF96DA85A5DFB163" type="personal">
<mods:role id="C0A652EB93D727E422AAEFA0DA971F6B">
<mods:roleTerm id="A95E5A3EE0088EE4167C490BDE181CBC">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="B00D423AA15DA6A70DAED912D5F0BBE1">Silva, Adriane Pereira</mods:namePart>
<mods:affiliation id="ADF7FC68423CC52757778E425EE868CE">Universidade Federal do Rio de Janeiro (UFRJ), Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brasil.</mods:affiliation>
</mods:name>
<mods:name id="3EE27415A3AB584259BD5D0190D51123" type="personal">
<mods:role id="62A0136A86EFFBC25E2BB7C957728C65">
<mods:roleTerm id="E67E57AABD1DD1B6EA19040396A0EA55">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="ABA5995374FCCAF1B59390C4567436AF">Froza, Joyce Adriana</mods:namePart>
<mods:affiliation id="AFBA5806E9DBCA97E9E7340B81E912F5">Universidade de São Paulo (USP), Escola Superior de Agricultura “ Luiz de Queiroz ”, Departamento de Entomologia e Acarologia,</mods:affiliation>
</mods:name>
<mods:name id="5561AD63A83D34FC2C62FA319930401F" type="personal">
<mods:role id="CA5D053A977C874A1E4142AE16DFD347">
<mods:roleTerm id="9173DCCDF9C10AA766F53C6A2D8159A8">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="265715F69E0392DC123FF32BF14EA197">Carvalho, Stéphanie Riehl</mods:namePart>
<mods:affiliation id="6A355E6E91D77DAD07C206E9F8083741">Universidade Federal do Rio de Janeiro (UFRJ), Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brasil.</mods:affiliation>
</mods:name>
<mods:name id="07B64697BB47D566A60FB518F742E54F" type="personal">
<mods:role id="4578E671E50A8E51174F1329EF8CB2CB">
<mods:roleTerm id="CE6A5AACF1BA540CCA0A38D00153E8DE">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="CF86F6F41CFA410594AD9FD61E6EA440">Pecly, Nathalia Hiluy</mods:namePart>
<mods:affiliation id="6AC6C5F06B9727896ED22E8C69955777">Universidade Federal do Rio de Janeiro (UFRJ), Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brasil.</mods:affiliation>
</mods:name>
<mods:name id="E767D293AE1DC925577239183B516C3A" type="personal">
<mods:role id="37C4C1AEC3717658F37045347224E39D">
<mods:roleTerm id="656775EF1B5E15C4AC3D8323E9D96DCD">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3413D3A9D32C7F689A76BDE5B45FF38E">Quintas, Victor Cordeiro</mods:namePart>
<mods:affiliation id="D4E63D2928AB6D8C54BBFBF6F491F4BA">Universidade Federal do Rio de Janeiro (UFRJ), Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brasil.</mods:affiliation>
</mods:name>
<mods:typeOfResource id="D2E20B676A540268CF2A292709C27077">text</mods:typeOfResource>
<mods:relatedItem id="7A661A4EFD5906B5D431E94B110044EA" type="host">
<mods:titleInfo id="DD777AFF8CD792A843AF22D99F611585">
<mods:title id="3EE081B9F776C8103189E7BBFECED050">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="1E81B0511B2DA18E313621D6250EDBC2">
<mods:date id="595E716730FDA02597E4D0201321D008">2024</mods:date>
<mods:detail id="D03833B604D54D9B4331B044491B5FCB" type="series">
<mods:title id="CFD53840F7EC1F617EADE81C810FBDDD">e 20240008</mods:title>
</mods:detail>
<mods:detail id="0634512366474306F68AA19CF1C65E59" type="pubDate">
<mods:number id="2849E258BA3F4260423892DDF0406B1B">2024-04-26</mods:number>
</mods:detail>
<mods:detail id="8C16B0C033373AF275DF1B6CE54AA4A0" type="volume">
<mods:number id="E32E6F1C26CF994655DBF71632A7B1B5">68</mods:number>
</mods:detail>
<mods:detail id="F1EE83F54E4FE62C3BC285C3D18A117D" type="issue">
<mods:number id="9812367A8416392A78914F272A6BFCBD">2</mods:number>
</mods:detail>
<mods:extent id="BF614BE72F3E508303FEB855E46E8479" unit="page">
<mods:start id="CD8C21F97DD3249C951FD87B30EE2539">1</mods:start>
<mods:end id="069C7E6F783609B7D4D9F95565DAD7A7">7</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="E5689EC5EA9C183836BF971C8FFA6041">
<mods:url id="D0058E7C1BC4A0F62966A301044C414F">http://dx.doi.org/10.1590/1806-9665-rbent-2024-0008</mods:url>
</mods:location>
<mods:classification id="B61F6DB54A43E850BB4C6278DE0C3B75">journal article</mods:classification>
<mods:identifier id="17B21CF2F4133FF385D284E2C51CBA6C" type="DOI">10.1590/1806-9665-RBENT-2024-0008</mods:identifier>
<mods:identifier id="AA8EB63AFE34DCAAABF5F05C4ED1E4CE" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="090287EBFF83BF04FCF806EAC325FE68" LSID="urn:lsid:plazi:treatment:090287EBFF83BF04FCF806EAC325FE68" httpUri="http://treatment.plazi.org/id/090287EBFF83BF04FCF806EAC325FE68" lastPageId="4" lastPageNumber="5" pageId="1" pageNumber="2">
<subSubSection id="C9B16576FF83BF01FCF806EAC5E8FD5E" pageId="1" pageNumber="2" type="nomenclature">
<paragraph id="811436FDFF83BF01FCF806EAC491FD7B" blockId="1.[839,1211,689,708]" box="[839,1211,689,708]" pageId="1" pageNumber="2">
<heading id="DA5C8191FF83BF01FCF806EAC491FD7B" bold="true" box="[839,1211,689,708]" fontSize="8" level="2" pageId="1" pageNumber="2" reason="2">
<emphasis id="B3DFEAEFFF83BF01FCF806EAC491FD7B" bold="true" box="[839,1211,689,708]" pageId="1" pageNumber="2">
<taxonomicName id="46AB4D7EFF83BF01FCF806EAC42AFD7B" ID-CoL="CCMJM" authorityName="Mejdalani &amp; Silva &amp; Froza &amp; Carvalho &amp; Pecly &amp; Quintas" authorityYear="2024" box="[839,1024,689,708]" class="Insecta" family="Cicadellidae" genus="Balacha" kingdom="Animalia" order="Hemiptera" pageId="1" pageNumber="2" phylum="Arthropoda" rank="species" species="caledonia" status="sp. nov.">Balacha caledonia</taxonomicName>
<taxonomicNameLabel id="A8EC5794FF83BF01FBBA06EAC47BFD7B" box="[1029,1105,689,708]" pageId="1" pageNumber="2" rank="species">sp. nov.</taxonomicNameLabel>
(
<figureCitation id="19902A78FF83BF01FBE206EAC499FD7B" box="[1117,1203,689,708]" captionStart-0="Figure 1" captionStart-1="Figure 2" captionStart-2="Figure 3" captionStartId-0="2.[113,166,1503,1520]" captionStartId-1="3.[83,136,1926,1943]" captionStartId-2="4.[113,166,1947,1964]" captionTargetBox-0="[250,1381,162,1470]" captionTargetBox-1="[309,1255,786,1899]" captionTargetBox-2="[425,1198,1039,1925]" captionTargetId-0="figure-326@2.[225,1392,148,1489]" captionTargetId-1="figure-433@3.[283,1274,773,1913]" captionTargetId-2="figure-622@4.[409,1208,1028,1933]" captionTargetPageId-0="2" captionTargetPageId-1="3" captionTargetPageId-2="4" captionText-0="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." captionText-1="Figure 2 Balacha caledonia sp.nov.Female terminalia: (a) sternite VII,ventral view;(b) “internal” sternite VIII,dorsal view; (c) pygofer,lateral view (scale bar = 1mm); (d) valvifer I, lateral view; (e) valvula I, lateral view; (f) apical portion of ramus and dorsal sculptured area of valvula I, lateral view; (g) valvula II,lateral view; (h) teeth, denticles, and ducts of valvulae II, lateral view (sections of two blades shown in photograph)." captionText-2="Figure 3 Balacha caledonia sp. nov. photographed at the type locality, an alpine field in Nova Friburgo,state of Rio de Janeiro,southeastern Brazil,on its host plant (Eryngium sp., Apiaceae).(a) Dorsal view; (b) lateral view.Photos taken by André Almeida Alves." pageId="1" pageNumber="2">Figs. 1-3</figureCitation>
)
</emphasis>
</heading>
</paragraph>
<paragraph id="811436FDFF83BF01FCF80695C5E8FD5E" blockId="1.[800,1476,718,1985]" box="[839,1474,718,737]" pageId="1" pageNumber="2">
<uri id="F53A3AFFFF83BF01FCF80695C5E8FD5E" box="[839,1474,718,737]" pageId="1" pageNumber="2">
urn:lsid:zoobank.org:act:
<uuid id="F50D0C28FF83BF01FBA20695C5E8FD5E" box="[1053,1474,718,737]" pageId="1" pageNumber="2">76E543D0-06E6-42B4-AEFB-7FF2335424FF</uuid>
</uri>
</paragraph>
</subSubSection>
<subSubSection id="C9B16576FF83BF04FCF806B7C325FE68" lastPageId="4" lastPageNumber="5" pageId="1" pageNumber="2" type="description">
<paragraph id="811436FDFF83BF01FCF806B7C34FFCA2" blockId="1.[800,1476,718,1985]" pageId="1" pageNumber="2">
Total length. Male
<typeStatus id="5E10885FFF83BF01FC4806B7C464FD40" box="[1015,1102,748,767]" pageId="1" pageNumber="2" type="holotype">holotype</typeStatus>
<quantity id="46539B18FF83BF01FBED06B7C4B5FCBF" box="[1106,1183,748,768]" metricMagnitude="-3" metricUnit="m" metricValue="8.2" pageId="1" pageNumber="2" unit="mm" value="8.2">8.2 mm</quantity>
; female
<typeStatus id="5E10885FFF83BF01FB5106B6C564FCBF" box="[1262,1358,749,768]" pageId="1" pageNumber="2" type="paratype">paratypes</typeStatus>
<quantity id="46539B18FF83BF01FAED06B7C5E8FCBF" box="[1362,1474,748,768]" metricMagnitude="-3" metricUnit="m" metricValue="8.65" metricValueMax="8.8" metricValueMin="8.5" pageId="1" pageNumber="2" unit="mm" value="8.65" valueMax="8.8" valueMin="8.5">8.5-8.8 mm</quantity>
(n = 3).
</paragraph>
<paragraph id="811436FDFF83BF01FCF80773C577FB02" blockId="1.[800,1476,718,1985]" pageId="1" pageNumber="2">
Head (
<figureCitation id="19902A78FF83BF01FC380773C394FC84" box="[903,958,808,827]" captionStart="Figure 1" captionStartId="2.[113,166,1503,1520]" captionTargetBox="[250,1381,162,1470]" captionTargetId="figure-326@2.[225,1392,148,1489]" captionTargetPageId="2" captionText="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." pageId="1" pageNumber="2">Figs. 1</figureCitation>
a-c). Crown, in dorsal view, well produced anteriorly, its median length approximately 6/10 of interocular width and 4/10 of transocular width; surface smooth, glabrous, with transverse concavity at interocellar area; anterior margin rounded; without carina at transition from crown to face. Ocelli located on imaginary transverse line between anterior angles of compound eyes, each ocellus equidistant from median line of crown and adjacent anterior eye angle. Coronal suture distinct. Frontogenal suture distinct, extending onto crown to near ocellus. Temporal suture indistinct. Antennal ledge, in dorsal view, slightly protuberant; in lateral view, not carinate dorsally and with anterior margin oblique and convex. Face with frons flattened medially; texture of disc finely granular; muscle impressions distinct. Epistomal suture obsolete. Clypeus robust, contour of its inferior portion, in lateral view, forming distinct angle with superior portion; apex convex.
</paragraph>
<paragraph id="811436FDFF83BF01FCF8009CC584F980" blockId="1.[800,1476,718,1985]" pageId="1" pageNumber="2">
Thorax (
<figureCitation id="19902A78FF83BF01FC27009CC3DDFB65" box="[920,1015,1223,1243]" captionStart="Figure 1" captionStartId="2.[113,166,1503,1520]" captionTargetBox="[250,1381,162,1470]" captionTargetId="figure-326@2.[225,1392,148,1489]" captionTargetPageId="2" captionText="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." pageId="1" pageNumber="2">Figs. 1a, b</figureCitation>
). Pronotum, in dorsal view, with width slightly smaller than transocular width of head; lateral margins parallel; posterior margin distinctly concave medially; dorsolateral carina complete, rectilinear, slightly declivous anterad; disc glabrous, its posterior half distinctly rugose medially. Mesonotum, in dorsal view, with scutellum finely transversely striated. Forewing without well-defined apical membrane;texture coriaceous and smooth;venation elevated and mostly distinct; without anteapical plexus of veins; with three closed anteapical cells, their bases located more proximally than claval apex; with four apical cells, base of fourth more proximal than base of third. Hind wing with vein R2+3 incomplete. Hind leg with femoral apical setal formula 2:1:1; first tarsomere longer than combined length of two more distal tarsomeres, its plantar surface with two parallel rows of small setae.
</paragraph>
<paragraph id="811436FDFF83BF01FCF80211C5EBF87E" blockId="1.[800,1476,718,1985]" pageId="1" pageNumber="2">
Coloration (
<figureCitation id="19902A78FF83BF01FC060211C3DAF9E2" box="[953,1008,1610,1629]" captionStart="Figure 1" captionStartId="2.[113,166,1503,1520]" captionTargetBox="[250,1381,162,1470]" captionTargetId="figure-326@2.[225,1392,148,1489]" captionTargetPageId="2" captionText="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." pageId="1" pageNumber="2">Figs. 1</figureCitation>
a-c, 3a, b). Ground color of anterior dorsum dark brown to black.Crown with four orange maculae along posterior margin; antennal ledge tinged with orange. Pronotum with distinct, medially constricted orange transverse stripe. Forewing dark brown to black; with four contrasting yellow markings: (1) basalmost one forming slightly curved stripe over base of corium and clavus, (2) second one from claval sulcus to outer margin of first discal cell, oblique, directed anteriorly, (3) third one forming transcommissural stripe originating at apex of clavus and almost reaching costal margin, (4) fourth one a spot located close to base of fourth apical cell, distinctly smaller than the others. Ground color of face and lateral and ventral areas of thorax dark brown to black; frons with orange stripe along frontogenal suture; clypeus with pair of large lateral orange areas connected to frontal stripe;
</paragraph>
<caption id="D5D46675FF80BF02FFCE0184C161F9A6" pageId="2" pageNumber="3" startId="2.[113,166,1503,1520]" targetBox="[250,1381,162,1470]" targetPageId="2" targetType="figure">
<paragraph id="811436FDFF80BF02FFCE0184C161F9A6" blockId="2.[113,1505,1503,1561]" pageId="2" pageNumber="3">
<emphasis id="B3DFEAEFFF80BF02FFCE0184C09CFA4F" bold="true" box="[113,182,1503,1520]" pageId="2" pageNumber="3">Figure 1</emphasis>
<taxonomicName id="46AB4D7EFF80BF02FF030184C166FA4F" authorityName="Mejdalani &amp; Silva &amp; Froza &amp; Carvalho &amp; Pecly &amp; Quintas" authorityYear="2024" box="[188,332,1503,1520]" class="Insecta" family="Cicadellidae" genus="Balacha" kingdom="Animalia" order="Hemiptera" pageId="2" pageNumber="3" phylum="Arthropoda" rank="species" species="caledonia" status="sp. nov.">Balacha caledonia</taxonomicName>
<taxonomicNameLabel id="A8EC5794FF80BF02FEED0184C1BAFA4F" box="[338,400,1503,1520]" pageId="2" pageNumber="3" rank="species">sp. nov.</taxonomicNameLabel>
(a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view.
</paragraph>
</caption>
<paragraph id="811436FDFF80BF02FFCE0230C2BCF94B" blockId="2.[112,787,1643,1985]" pageId="2" pageNumber="3">lorum orange; gena with few small orange or brown markings; labium dark brown to black; additional small irregular orange spots may also be present on face. Legs dark brown to black; setal rows of hind tibia (AD, PD, AV, PV) contrasting brown. Abdomen dark brown to black; posterior portions of sternites and laterotergites orange.</paragraph>
<paragraph id="811436FDFF80BF03FF2802A5C256FF57" blockId="2.[112,787,1643,1985]" lastBlockId="3.[81,758,153,642]" lastPageId="3" lastPageNumber="4" pageId="2" pageNumber="3">
Male terminalia. Pygofer (
<figureCitation id="19902A78FF80BF02FE3202A5C1C3F8AE" box="[397,489,1790,1809]" captionStart="Figure 1" captionStartId="2.[113,166,1503,1520]" captionTargetBox="[250,1381,162,1470]" captionTargetId="figure-326@2.[225,1392,148,1489]" captionTargetPageId="2" captionText="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." pageId="2" pageNumber="3">Figs. 1d, e</figureCitation>
), in lateral view, well produced posteriorly; without processes; posterior margin mostly truncate; surface with macrosetae distributed mainly on posterior half; in ventral view, ventral margin with distinct emargination on median portion. Valve (
<figureCitation id="19902A78FF80BF02FEB80328C16BF839" box="[263,321,1907,1926]" captionStart="Figure 1" captionStartId="2.[113,166,1503,1520]" captionTargetBox="[250,1381,162,1470]" captionTargetId="figure-326@2.[225,1392,148,1489]" captionTargetPageId="2" captionText="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." pageId="2" pageNumber="3">Fig. 1f</figureCitation>
), in ventral view, subrectangular, short, slightly constricted medially. Subgenital plate (
<figureCitation id="19902A78FF80BF02FE6603CAC225F81B" box="[473,527,1937,1956]" captionStart="Figure 1" captionStartId="2.[113,166,1503,1520]" captionTargetBox="[250,1381,162,1470]" captionTargetId="figure-326@2.[225,1392,148,1489]" captionTargetPageId="2" captionText="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." pageId="2" pageNumber="3">Fig.1f</figureCitation>
), in ventral view, triangular, narrowing gradually toward apex; with few macrosetae located close to outer margin; microsetae also present; plates linked basally to each other and to valve by large membranous area; in lateral view, plate extending almost as far posteriorly as pygofer apex. Connective (
<figureCitation id="19902A78FF80BF02FCF70298C3A3F969" box="[840,905,1731,1750]" captionStart="Figure 1" captionStartId="2.[113,166,1503,1520]" captionTargetBox="[250,1381,162,1470]" captionTargetId="figure-326@2.[225,1392,148,1489]" captionTargetPageId="2" captionText="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." pageId="2" pageNumber="3">
Fig.
<quantity id="46539B18FF80BF02FCCF0298C3A3F969" box="[880,905,1731,1750]" metricMagnitude="-3" metricUnit="kg" metricValue="1.0" pageId="2" pageNumber="3" unit="g" value="1.0">1g</quantity>
</figureCitation>
), in dorsal view, T-shaped; stem narrow and elongate, with median keel. Style (
<figureCitation id="19902A78FF80BF02FBBD02BAC469F94B" box="[1026,1091,1761,1780]" captionStart="Figure 1" captionStartId="2.[113,166,1503,1520]" captionTargetBox="[250,1381,162,1470]" captionTargetId="figure-326@2.[225,1392,148,1489]" captionTargetPageId="2" captionText="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." pageId="2" pageNumber="3">
Fig.
<quantity id="46539B18FF80BF02FB9502BAC469F94B" box="[1066,1091,1761,1780]" metricMagnitude="-3" metricUnit="kg" metricValue="1.0" pageId="2" pageNumber="3" unit="g" value="1.0">1g</quantity>
</figureCitation>
), in dorsal view, very elongate, extending much farther posteriorly than connective; without preapical lobe; apical portion digitiform, curved outward; apex obtuse. Aedeagus (
<figureCitation id="19902A78FF80BF02FCF70362C3ADF8F3" box="[840,903,1849,1868]" captionStart="Figure 1" captionStartId="2.[113,166,1503,1520]" captionTargetBox="[250,1381,162,1470]" captionTargetId="figure-326@2.[225,1392,148,1489]" captionTargetPageId="2" captionText="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." pageId="2" pageNumber="3">Fig. 1h</figureCitation>
) symmetrical; shaft, in lateral view, elongate, tubular, arcuate dorsally, not curved at its base; without processes; basal half with dorsal lobe; apical portion without ventral lobe; gonopore located apically; ejaculatory bulb strongly developed in comparison with size of shaft. Paraphyses (
<figureCitation id="19902A78FF80BF02FB8303F5C45DF87E" box="[1084,1143,1966,1985]" captionStart="Figure 1" captionStartId="2.[113,166,1503,1520]" captionTargetBox="[250,1381,162,1470]" captionTargetId="figure-326@2.[225,1392,148,1489]" captionTargetPageId="2" captionText="Figure 1 Balacha caledonia sp. nov. (a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view." pageId="2" pageNumber="3">Fig. 1i</figureCitation>
), in dorsal view, with stalk elongate, triangular, connected to stem of connective; rami very elongate, slightly convergent apically; each ramus with basal portion directed anteriorly, then with sharp turn posteriorly, apex acute.
</paragraph>
<paragraph id="811436FDFF81BF03FFC604AAC3D0FD3D" blockId="3.[81,758,153,642]" lastBlockId="3.[800,1476,153,642]" pageId="3" pageNumber="4">
Female terminalia.Sternite VII (
<figureCitation id="19902A78FF81BF03FE2604AAC1F8FEBA" box="[409,466,241,261]" captionStart="Figure 2" captionStartId="3.[83,136,1926,1943]" captionTargetBox="[309,1255,786,1899]" captionTargetId="figure-433@3.[283,1274,773,1913]" captionTargetPageId="3" captionText="Figure 2 Balacha caledonia sp.nov.Female terminalia: (a) sternite VII,ventral view;(b) “internal” sternite VIII,dorsal view; (c) pygofer,lateral view (scale bar = 1mm); (d) valvifer I, lateral view; (e) valvula I, lateral view; (f) apical portion of ramus and dorsal sculptured area of valvula I, lateral view; (g) valvula II,lateral view; (h) teeth, denticles, and ducts of valvulae II, lateral view (sections of two blades shown in photograph)." pageId="3" pageNumber="4">Fig.2a</figureCitation>
), in ventral view, with posterior margin sinuous, including deep median emargination. “Internal” sternite VIII (
<figureCitation id="19902A78FF81BF03FFC00577C090FE80" box="[127,186,300,319]" captionStart="Figure 2" captionStartId="3.[83,136,1926,1943]" captionTargetBox="[309,1255,786,1899]" captionTargetId="figure-433@3.[283,1274,773,1913]" captionTargetPageId="3" captionText="Figure 2 Balacha caledonia sp.nov.Female terminalia: (a) sternite VII,ventral view;(b) “internal” sternite VIII,dorsal view; (c) pygofer,lateral view (scale bar = 1mm); (d) valvifer I, lateral view; (e) valvula I, lateral view; (f) apical portion of ramus and dorsal sculptured area of valvula I, lateral view; (g) valvula II,lateral view; (h) teeth, denticles, and ducts of valvulae II, lateral view (sections of two blades shown in photograph)." pageId="3" pageNumber="4">Fig.2b</figureCitation>
), in dorsal view, with pair of distinct ovoid sclerites connected to each other by transverse bar.Pygofer (
<figureCitation id="19902A78FF81BF03FE020512C1DFFEE2" box="[445,501,329,349]" captionStart="Figure 2" captionStartId="3.[83,136,1926,1943]" captionTargetBox="[309,1255,786,1899]" captionTargetId="figure-433@3.[283,1274,773,1913]" captionTargetPageId="3" captionText="Figure 2 Balacha caledonia sp.nov.Female terminalia: (a) sternite VII,ventral view;(b) “internal” sternite VIII,dorsal view; (c) pygofer,lateral view (scale bar = 1mm); (d) valvifer I, lateral view; (e) valvula I, lateral view; (f) apical portion of ramus and dorsal sculptured area of valvula I, lateral view; (g) valvula II,lateral view; (h) teeth, denticles, and ducts of valvulae II, lateral view (sections of two blades shown in photograph)." pageId="3" pageNumber="4">Fig.2c</figureCitation>
), in lateral view, moderately produced posteriorly; posterior margin triangularly produced; apex obtuse; macrosetae distributed mostly on posterior half and extending anteriorly along ventral margin.Valvifer I (
<figureCitation id="19902A78FF81BF03FE7305FAC22CFE0B" box="[460,518,417,436]" captionStart="Figure 2" captionStartId="3.[83,136,1926,1943]" captionTargetBox="[309,1255,786,1899]" captionTargetId="figure-433@3.[283,1274,773,1913]" captionTargetPageId="3" captionText="Figure 2 Balacha caledonia sp.nov.Female terminalia: (a) sternite VII,ventral view;(b) “internal” sternite VIII,dorsal view; (c) pygofer,lateral view (scale bar = 1mm); (d) valvifer I, lateral view; (e) valvula I, lateral view; (f) apical portion of ramus and dorsal sculptured area of valvula I, lateral view; (g) valvula II,lateral view; (h) teeth, denticles, and ducts of valvulae II, lateral view (sections of two blades shown in photograph)." pageId="3" pageNumber="4">Fig.2d</figureCitation>
), in lateral view,expanded posteriorly; posterior margin with small dentiform projection. Valvula I (
<figureCitation id="19902A78FF81BF03FFD70587C0E8FE50" box="[104,194,476,495]" captionStart="Figure 2" captionStartId="3.[83,136,1926,1943]" captionTargetBox="[309,1255,786,1899]" captionTargetId="figure-433@3.[283,1274,773,1913]" captionTargetPageId="3" captionText="Figure 2 Balacha caledonia sp.nov.Female terminalia: (a) sternite VII,ventral view;(b) “internal” sternite VIII,dorsal view; (c) pygofer,lateral view (scale bar = 1mm); (d) valvifer I, lateral view; (e) valvula I, lateral view; (f) apical portion of ramus and dorsal sculptured area of valvula I, lateral view; (g) valvula II,lateral view; (h) teeth, denticles, and ducts of valvulae II, lateral view (sections of two blades shown in photograph)." pageId="3" pageNumber="4">Figs. 2e, f</figureCitation>
), in ventral view, with basal portion broadened; blade, in lateral view, approximately rectilinear beyond basal curvature; apical portion with ventral and dorsal margins serrated; apex acute; ventral interlocking device located on basiventral half of blade; dorsal sculptured area extending from basal portion to apex of blade, formed mostly by scale-like processes arranged in oblique lines; ventral sculptured area restricted to apical portion, formed by scale-like processes; basal portion of valvula with scattered setae/pores also extending posteriorly along area below ramus. Valvula II (
<figureCitation id="19902A78FF81BF03FBF2048FC498FF58" box="[1101,1202,212,231]" captionStart="Figure 2" captionStartId="3.[83,136,1926,1943]" captionTargetBox="[309,1255,786,1899]" captionTargetId="figure-433@3.[283,1274,773,1913]" captionTargetPageId="3" captionText="Figure 2 Balacha caledonia sp.nov.Female terminalia: (a) sternite VII,ventral view;(b) “internal” sternite VIII,dorsal view; (c) pygofer,lateral view (scale bar = 1mm); (d) valvifer I, lateral view; (e) valvula I, lateral view; (f) apical portion of ramus and dorsal sculptured area of valvula I, lateral view; (g) valvula II,lateral view; (h) teeth, denticles, and ducts of valvulae II, lateral view (sections of two blades shown in photograph)." pageId="3" pageNumber="4">
Figs.
<quantity id="46539B18FF81BF03FB3F048FC4B3FF58" box="[1152,1177,212,231]" metricMagnitude="-3" metricUnit="kg" metricValue="2.0" pageId="3" pageNumber="4" unit="g" value="2.0">2g</quantity>
, h
</figureCitation>
), in lateral view, expanded beyond basal curvature; dorsal margin regularly convex; blade with about 25 continuous, sclerotized subtriangular teeth, those at ascending basal portion small, followed by about eight elongate ones (with flat, low posterior area) and then becoming smaller, at descending portion, toward apex; denticles distributed on teeth and on dorsal and ventral apical portions of valvula, except on apex (dorsal and ventral dentate apical areas with similar sizes); ventral margin of blade approximately rectilinear; basidorsal hyaline area distinct; preapical prominence small but distinct; apex obtuse; blade with ducts extending toward teeth and apex. Gonoplac extending slightly beyond pygofer apex; in lateral view, with basal half narrow and apical half distinctly expanded; apex obtuse; surface with denticuli and few setae distributed on apical portion and extending anteriorly along ventral margin (apical setae distinctly larger than more basal ones).
</paragraph>
<caption id="D5D46675FF81BF03FFEC03DDC2B9F87E" pageId="3" pageNumber="4" startId="3.[83,136,1926,1943]" targetBox="[309,1255,786,1899]" targetPageId="3" targetType="figure">
<paragraph id="811436FDFF81BF03FFEC03DDC2B9F87E" blockId="3.[82,1473,1926,1985]" pageId="3" pageNumber="4">
<emphasis id="B3DFEAEFFF81BF03FFEC03DDC0BCF828" bold="true" box="[83,150,1926,1943]" pageId="3" pageNumber="4">Figure 2</emphasis>
<taxonomicName id="46AB4D7EFF81BF03FF2503DDC10DF828" authorityName="Mejdalani &amp; Silva &amp; Froza &amp; Carvalho &amp; Pecly &amp; Quintas" authorityYear="2024" box="[154,295,1926,1943]" class="Insecta" family="Cicadellidae" genus="Balacha" kingdom="Animalia" order="Hemiptera" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="caledonia" status="sp. nov.">Balacha caledonia</taxonomicName>
<taxonomicNameLabel id="A8EC5794FF81BF03FE9403DDC14DF828" box="[299,359,1926,1943]" pageId="3" pageNumber="4" rank="species">sp.nov.</taxonomicNameLabel>
Female terminalia: (a) sternite VII,ventral view;(b) “internal” sternite VIII,dorsal view; (c) pygofer,lateral view (scale bar = 1mm); (d) valvifer I, lateral view; (e) valvula I, lateral view; (f) apical portion of ramus and dorsal sculptured area of valvula I, lateral view; (g) valvula II,lateral view; (h) teeth, denticles, and ducts of valvulae II, lateral view (sections of two blades shown in photograph).
</paragraph>
</caption>
<paragraph id="811436FDFF86BF04FF2804C2C33FFF57" blockId="4.[112,789,153,471]" pageId="4" pageNumber="5">
Etymology.The specific epithet,
<taxonomicName id="46AB4D7EFF86BF04FE7C04C2C235FF13" authorityName="Mejdalani &amp; Silva &amp; Froza &amp; Carvalho &amp; Pecly &amp; Quintas" authorityYear="2024" box="[451,543,153,172]" class="Insecta" family="Cicadellidae" genus="Balacha" kingdom="Animalia" order="Hemiptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="caledonia">caledonia</taxonomicName>
, refers to the
<typeStatus id="5E10885FFF86BF04FD2104C1C2E2FF12" box="[670,712,154,173]" pageId="4" pageNumber="5">type</typeStatus>
locality of the new taxon (Pico do Caledônia, municipality of Nova Friburgo, state of
<collectingRegion id="436FF81FFF86BF04FF7F048EC16DFF57" box="[192,327,213,232]" country="Brazil" name="Rio de Janeiro" pageId="4" pageNumber="5">Rio de Janeiro</collectingRegion>
, southeastern
<collectingCountry id="F9BC766DFF86BF04FE6B048EC225FF57" box="[468,527,213,232]" name="Brazil" pageId="4" pageNumber="5">Brazil</collectingCountry>
). It is a noun in apposition.
</paragraph>
<paragraph id="811436FDFF86BF04FF2804AFC26FFEB9" blockId="4.[112,789,153,471]" box="[151,581,243,263]" pageId="4" pageNumber="5">
Known host plant:
<taxonomicName id="46AB4D7EFF86BF04FEEE04A8C1F9FEB8" box="[337,467,243,263]" class="Magnoliopsida" family="Apiaceae" genus="Eryngium" kingdom="Plantae" order="Apiales" pageId="4" pageNumber="5" phylum="Tracheophyta" rank="species" species="undetermined">Eryngium sp.</taxonomicName>
(
<taxonomicName id="46AB4D7EFF86BF04FE6104A8C211FEB9" box="[478,571,243,262]" class="Magnoliopsida" family="Apiaceae" kingdom="Plantae" order="Apiales" pageId="4" pageNumber="5" phylum="Tracheophyta" rank="family">Apiaceae</taxonomicName>
).
</paragraph>
<paragraph id="811436FDFF86BF04FF28054AC325FE68" blockId="4.[112,789,153,471]" pageId="4" pageNumber="5">
Type material.
<materialsCitation id="31C33CA0FF86BF04FE92054AC09EFE68" collectingDate="2022-05-22" collectionCode="DZUP, VI" collectorName="RJ Nova Friburgo" country="Brazil" county="Southeastern" elevation="2257" location="Pico do Caledonia" municipality="Male" pageId="4" pageNumber="5" specimenCode="MNRJ-ENT3-2394, MELQ-ESALQENT001775, MNRJ-ENT3-2393, 2396" specimenCount="5" specimenCount-female="5" stateProvince="Rio de Janeiro" typeStatus="holotype">
<collectingCounty id="68754E71FF86BF04FE92054AC184FE9B" box="[301,430,273,292]" pageId="4" pageNumber="5">Southeastern</collectingCounty>
<collectingCountry id="F9BC766DFF86BF04FE0A054AC1C4FE9B" box="[437,494,273,292]" name="Brazil" pageId="4" pageNumber="5">Brazil</collectingCountry>
, state of
<collectingRegion id="436FF81FFF86BF04FDF5054AC2F2FE9B" box="[586,728,273,292]" country="Brazil" name="Rio de Janeiro" pageId="4" pageNumber="5">Rio de Janeiro</collectingRegion>
.
<collectingMunicipality id="6170AC87FF86BF04FD5D054AC339FE9B" box="[738,787,273,292]" pageId="4" pageNumber="5">Male</collectingMunicipality>
<typeStatus id="5E10885FFF86BF04FFCE0574C0E6FEFD" box="[113,204,303,322]" pageId="4" pageNumber="5" type="holotype">holotype</typeStatus>
: “RJ [state of
<collectingRegion id="436FF81FFF86BF04FEF00574C1F0FEFD" box="[335,474,303,322]" country="Brazil" name="Rio de Janeiro" pageId="4" pageNumber="5">Rio de Janeiro</collectingRegion>
] Nova Friburgo \ Arredores [do] Pico [do] Caledônia [
<elevation id="0A86D1CEFF86BF04FEFE0516C1EAFEDF" box="[321,448,333,352]" metricMagnitude="3" metricUnit="m" metricValue="2.257" pageId="4" pageNumber="5" unit="m" value="2257.0">
<quantity id="46539B18FF86BF04FEFE0516C1A7FEDF" box="[321,397,333,352]" metricMagnitude="3" metricUnit="m" metricValue="2.257" pageId="4" pageNumber="5" unit="m" value="2257.0">2,257m</quantity>
a.s.l.
</elevation>
] \
<date id="F515103DFF86BF04FE610516C26FFEDF" box="[478,581,333,352]" pageId="4" pageNumber="5" value="2022-05-22">
<collectingDate id="E551E9D5FF86BF04FE610516C26FFEDF" box="[478,581,333,352]" pageId="4" pageNumber="5" value="2022-05-22">22/V/2022</collectingDate>
</date>
\ Mejdalani, Pecly, \ Quintas, Oliveira, Alves” (
<specimenCode id="D10D9E86FF86BF04FEDA0530C230FEC1" box="[357,538,363,382]" collectionCode="MNRJ-ENT" pageId="4" pageNumber="5">MNRJ-ENT3-2394</specimenCode>
).
<typeStatus id="5E10885FFF86BF04FD970530C2A6FEC1" box="[552,652,363,382]" pageId="4" pageNumber="5" type="paratype">Paratypes</typeStatus>
:
<specimenCount id="97ADFD74FF86BF04FD2C0530C325FEC1" box="[659,783,363,382]" count="4" pageId="4" pageNumber="5" type="female">four females</specimenCount>
, same data as the holotype (
<collectionCode id="E7BAAE38FF86BF04FE3405D2C1EEFE23" box="[395,452,393,412]" country="Brazil" httpUri="http://grbio.org/cool/5xp9-edpx" name="Universidade Federal do Parana, Colecao de Entomologia Pe. Jesus Santiago Moure" pageId="4" pageNumber="5" type="University or college">DZUP</collectionCode>
,
<specimenCode id="D10D9E86FF86BF04FE6F05D3C2ECFE24" box="[464,710,392,411]" collectionCode="MELQ-ESALQENT" pageId="4" pageNumber="5">MELQ-ESALQENT001775</specimenCode>
,
<specimenCode id="D10D9E86FF86BF04FD6E05D2C0CBFE06" collectionCode="MNRJ-ENT" pageId="4" pageNumber="5">MNRJ-ENT3-2393</specimenCode>
,
<specimenCode id="D10D9E86FF86BF04FF5505FDC10AFE06" box="[234,288,422,441]" collectionCode="MNRJ-ENT" pageId="4" pageNumber="5">2396</specimenCode>
);
<specimenCount id="97ADFD74FF86BF04FE8F05FCC18AFE06" box="[304,416,422,442]" count="1" pageId="4" pageNumber="5" type="female">one female</specimenCount>
: “
<collectorName id="2C5E532BFF86BF04FE1005FDC27EFE06" box="[431,596,422,442]" pageId="4" pageNumber="5">RJ Nova Friburgo</collectorName>
\
<location id="84746026FF86BF04FDDA05FDC338FE06" LSID="urn:lsid:plazi:treatment:090287EBFF83BF04FCF806EAC325FE68:84746026FF86BF04FDDA05FDC338FE06" box="[613,786,422,441]" country="Brazil" county="Southeastern" municipality="Male" name="Pico do Caledonia" pageId="4" pageNumber="5" stateProvince="Rio de Janeiro">Pico do Caledônia</location>
\
<date id="F515103DFF86BF04FFC1059FC09EFE68" box="[126,180,452,471]" pageId="4" pageNumber="5" value="2019-06-22">
22/
<collectionCode id="E7BAAE38FF86BF04FF23059FC09EFE68" box="[156,180,452,471]" country="Norway" name="Mykotektet, National Veterinary Institute" pageId="4" pageNumber="5">VI</collectionCode>
</date>
</materialsCitation>
<materialsCitation id="31C33CA0FF86BF04FF0B059FC321FE68" box="[180,779,452,471]" country="Brazil" county="Mejdalani" location="Quintas" municipality="Pecly" pageId="4" pageNumber="5" specimenCode="MNRJ-ENT3-1860" specimenCount="1" stateProvince="Rio de Janeiro" typeStatus="holotype">
/2019 \
<collectingCounty id="68754E71FF86BF04FF43059FC14AFE68" box="[252,352,452,471]" pageId="4" pageNumber="5">Mejdalani</collectingCounty>
,
<collectingMunicipality id="6170AC87FF86BF04FED7059FC1B6FE68" box="[360,412,452,471]" pageId="4" pageNumber="5">Pecly</collectingMunicipality>
,
<location id="84746026FF86BF04FE1A059FC1D8FE68" LSID="urn:lsid:plazi:treatment:090287EBFF83BF04FCF806EAC325FE68:84746026FF86BF04FE1A059FC1D8FE68" box="[421,498,452,471]" country="Brazil" county="Mejdalani" municipality="Pecly" name="Quintas" pageId="4" pageNumber="5" stateProvince="Rio de Janeiro">Quintas</location>
,
<location id="84746026FF86BF04FE44059FC26DFE68" LSID="urn:lsid:plazi:treatment:090287EBFF83BF04FCF806EAC325FE68:84746026FF86BF04FE44059FC26DFE68" box="[507,583,452,471]" country="Brazil" county="Mejdalani" municipality="Pecly" name="Ferreira" pageId="4" pageNumber="5" stateProvince="Rio de Janeiro">Ferreira</location>
(
<specimenCode id="D10D9E86FF86BF04FDEC059FC32FFE68" box="[595,773,452,471]" collectionCode="MNRJ-ENT" pageId="4" pageNumber="5">MNRJ-ENT3-1860</specimenCode>
)
</materialsCitation>
.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,503 @@
<document id="4FB45C2408938061028A730542C79F25" ID-DOI="10.1016/j.rbe.2018.01.002" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722640665602" checkinUser="felipe" docAuthor="Kohlmann, Bert &amp; Vaz-de-Mello, Fernando Z." docDate="2018" docId="327E87E1D879FFEDFCC0FAEFFF44B0C5" docLanguage="en" docName="RevBrasEntomol.62.2.131-134.pdf" docOrigin="Revista Brasileira de Entomologia 62 (2)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.01.002" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Ateuchus tuza Kohlmann and Vaz de Mello 2018, sp. nov." docType="treatment" docVersion="1" lastPageNumber="133" masterDocId="CE47FF99D878FFEEFFE4FFE8FFE1B002" masterDocTitle="A new key for the species of Ateuchus Weber (Coleoptera: Scarabaeidae: Scarabaeinae) occurring in Mexico, with a description of the first North American inquiline species from a rodent burrow (Rodentia: Geomydae) and new distribution records" masterLastPageNumber="134" masterPageNumber="131" pageNumber="132" updateTime="1722684135551" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="578147B764B5C3AE9D306E4068B3E582" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="0EC11374BC687420AC6E8C2AF8535323">
<mods:title id="10EB576EB191D7C82B993B6AA956666A">A new key for the species of Ateuchus Weber (Coleoptera: Scarabaeidae: Scarabaeinae) occurring in Mexico, with a description of the first North American inquiline species from a rodent burrow (Rodentia: Geomydae) and new distribution records</mods:title>
</mods:titleInfo>
<mods:name id="5E1E83E58572A15C41E454B4B0B3623C" type="personal">
<mods:role id="ACCBC9FB76120C66ADF467D0E892D610">
<mods:roleTerm id="A9C3A0FB593772F2C3F5FD4CDDBB302A">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="FE02B2C0DDD4AD1058D7FCD1FBA460E9">Kohlmann, Bert</mods:namePart>
<mods:affiliation id="700BA985F08BC401021C1DAB7531D973">EARTH University, San José, Costa Rica</mods:affiliation>
</mods:name>
<mods:name id="178B18201CEC071381566A59490C4455" type="personal">
<mods:role id="6DC1F0A4E35AC1E7CB131A7430C2A9F9">
<mods:roleTerm id="52D72AD433E678E12181D04FCCE0F7D3">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="866F51669BD72A2E754D8D09FB7D4108">Vaz-de-Mello, Fernando Z.</mods:namePart>
<mods:affiliation id="A48F7275E4E06FD190F20F81DC945AF8">Universidade Federal de Mato Grosso, Instituto de Biociências, Departamento de Biologia e Zoologia, Cuiabá, MT, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="FAA0D6D71E75C5E285ADEF5A732338B7">text</mods:typeOfResource>
<mods:relatedItem id="5FF3942270C27A9061121D4C8AB7E237" type="host">
<mods:titleInfo id="11E2230824C78FD3651F72B65D86B456">
<mods:title id="C908B74C1932DC8B794FC8BA98D08BFF">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="EA71700CFF6164F7A7595DF8C5FDE167">
<mods:date id="31613C8FEB3C10A30E58CFEE829BC396">2018</mods:date>
<mods:detail id="DDF36472A51DC3C2E96C86FCDD92FA3F" type="pubDate">
<mods:number id="52C730E861B5821D8EA2A64B1A6ED736">2018-02-13</mods:number>
</mods:detail>
<mods:detail id="98A5D87E46C5C38FF2F3EF8C0DF65DE2" type="volume">
<mods:number id="4800759D87DBBF732510D79C2B8F852B">62</mods:number>
</mods:detail>
<mods:detail id="DC4D4CBD6B91FA8C74E16DF7097826DE" type="issue">
<mods:number id="2C11E578F0863D13FD1F06DBA8DA7E39">2</mods:number>
</mods:detail>
<mods:extent id="0DEF9C51BB1397A0A1ECBDE205A38834" unit="page">
<mods:start id="5429211A07A3AADD31BB49E17A85C50F">131</mods:start>
<mods:end id="EBA508BB825D6D5622CE061319EFAB8F">134</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="7C076E84A1993304DA32973A09AB6A58">
<mods:url id="4EE2563D2C5973FB5B3B17F2DBFB11C5">http://dx.doi.org/10.1016/j.rbe.2018.01.002</mods:url>
</mods:location>
<mods:classification id="FB64F90BFF01197353AE51539076C4BA">journal article</mods:classification>
<mods:identifier id="6FE8426D53952F1ABB98EE0762CDD8D8" type="DOI">10.1016/j.rbe.2018.01.002</mods:identifier>
<mods:identifier id="7D2F6B81FD47F2E8AA1A1313F0C07C66" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="327E87E1D879FFEDFCC0FAEFFF44B0C5" LSID="urn:lsid:plazi:treatment:327E87E1D879FFEDFCC0FAEFFF44B0C5" httpUri="http://treatment.plazi.org/id/327E87E1D879FFEDFCC0FAEFFF44B0C5" lastPageId="3" lastPageNumber="133" pageId="1" pageNumber="132">
<subSubSection id="F2CD657CD879FFEFFCC0FAEFFAA5B518" box="[804,1348,1287,1306]" pageId="1" pageNumber="132" type="nomenclature">
<paragraph id="BA6836F7D879FFEFFCC0FAEFFAA5B518" blockId="1.[804,1348,1287,1306]" box="[804,1348,1287,1306]" pageId="1" pageNumber="132">
<heading id="E120819BD879FFEFFCC0FAEFFAA5B518" bold="true" box="[804,1348,1287,1306]" fontSize="8" level="2" pageId="1" pageNumber="132" reason="2">
<emphasis id="88A3EAE5D879FFEFFCC0FAEFFAA5B518" bold="true" box="[804,1348,1287,1306]" pageId="1" pageNumber="132">
<taxonomicName id="7DD74D74D879FFEFFCC0FAEFFB08B518" ID-CoL="7ZLZY" authority="Kohlmann and Vaz de Mello" authorityName="Kohlmann and Vaz de Mello" authorityYear="2018" box="[804,1257,1287,1306]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="1" pageNumber="132" phylum="Arthropoda" rank="species" species="tuza" status="sp. nov.">
<emphasis id="88A3EAE5D879FFEFFCC0FAEFFC56B518" bold="true" box="[804,951,1287,1306]" italics="true" pageId="1" pageNumber="132">Ateuchus tuza</emphasis>
Kohlmann and Vaz de Mello
</taxonomicName>
,
<taxonomicNameLabel id="9390579ED879FFEFFB17FAEFFAA5B518" box="[1267,1348,1287,1306]" pageId="1" pageNumber="132" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="F2CD657CD879FFEFFCC0FACBFC6CB534" box="[804,909,1315,1334]" pageId="1" pageNumber="132" type="description">
<paragraph id="BA6836F7D879FFEFFCC0FACBFC6CB534" blockId="1.[804,1475,1315,1809]" box="[804,909,1315,1334]" pageId="1" pageNumber="132">
(
<figureCitation id="22EC2A72D879FFEFFCC8FACBFC64B534" box="[812,901,1315,1334]" captionStart-0="Figures 13" captionStart-1="Figures 45" captionStartId-0="1.[804,867,1208,1222]" captionStartId-1="2.[833,896,1056,1070]" captionTargetBox-0="[839,1442,150,1177]" captionTargetBox-1="[867,1471,150,1024]" captionTargetId-0="figure-1443@1.[835,1443,150,1177]" captionTargetId-1="figure-619@2.[864,1472,149,1026]" captionTargetPageId-0="1" captionTargetPageId-1="2" captionText-0="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." captionText-1="Figures 45. A. tuza sp. nov.; 4, drawing of the internal sac, line equals 1 mm; 5, A. hornai (Balthasar, 1939), dorsal habitus of the female holotype." pageId="1" pageNumber="132">Figs. 14</figureCitation>
)
</paragraph>
</subSubSection>
<subSubSection id="F2CD657CD879FFEFFCC0FAD7FB27B56C" pageId="1" pageNumber="132" type="materials_examined">
<paragraph id="BA6836F7D879FFEFFCC0FAD7FB27B56C" blockId="1.[804,1475,1315,1809]" pageId="1" pageNumber="132">
<emphasis id="88A3EAE5D879FFEFFCC0FAD7FC53B550" bold="true" box="[804,946,1343,1362]" pageId="1" pageNumber="132">Type locality:</emphasis>
<materialsCitation id="0ABF3CAAD879FFEFFC5DFAD7FBF2B567" collectorName="Dos Amates &amp; Catemaco" country="Mexico" elevation="450" location="VERACRUZ" pageId="1" pageNumber="132" specimenCount="1" stateProvince="Veracruz de Ignacio de la Llave">
<collectingCountry id="C2C07667D879FFEFFC5DFAD7FBF3B550" box="[953,1042,1343,1362]" name="Mexico" pageId="1" pageNumber="132">MEXICO</collectingCountry>
:
<collectingRegion id="7813F815D879FFEFFBFFFAD7FB6DB550" box="[1051,1164,1343,1362]" country="Mexico" name="Veracruz de Ignacio de la Llave" pageId="1" pageNumber="132">VERACRUZ</collectingRegion>
,
<collectorName id="17225321D879FFEFFB71FAD7FAECB550" box="[1173,1293,1343,1362]" pageId="1" pageNumber="132">Dos Amates</collectorName>
(
<collectorName id="17225321D879FFEFFAFFFAD7FA62B550" box="[1307,1411,1343,1362]" pageId="1" pageNumber="132">Catemaco</collectorName>
), elev.
<quantity id="7D2F9B12D879FFEFFCC0FAB3FC74B56C" box="[804,917,1371,1390]" metricMagnitude="2" metricUnit="m" metricValue="4.5" metricValueMax="6.0" metricValueMin="3.0" pageId="1" pageNumber="132" unit="m" value="450.0" valueMax="600.0" valueMin="300.0">
<elevation id="31FAD1C4D879FFEFFCC0FAB3FC74B56C" box="[804,917,1371,1390]" metricMagnitude="2" metricUnit="m" metricValue="4.5" metricValueMax="6.0" metricValueMin="3.0" pageId="1" pageNumber="132" unit="m" value="450.0" valueMax="600.0" valueMin="300.0">300600 m</elevation>
</quantity>
(18
<emphasis id="88A3EAE5D879FFEFFC58FABFFC25B567" bold="true" box="[956,964,1367,1381]" pageId="1" pageNumber="132">
<superScript id="4DA29BBFD879FFEFFC58FABFFC25B567" attach="left" box="[956,964,1367,1381]" fontSize="6" pageId="1" pageNumber="132"></superScript>
</emphasis>
29
<emphasis id="88A3EAE5D879FFEFFC01FABFFC08B567" bold="true" box="[997,1001,1367,1381]" pageId="1" pageNumber="132">
<superScript id="4DA29BBFD879FFEFFC01FABFFC08B567" attach="left" box="[997,1001,1367,1381]" fontSize="6" pageId="1" pageNumber="132">Ɩ</superScript>
</emphasis>
21
<emphasis id="88A3EAE5D879FFEFFBEEFABFFBF2B567" bold="true" box="[1034,1043,1367,1381]" pageId="1" pageNumber="132">
<superScript id="4DA29BBFD879FFEFFBEEFABFFBF2B567" attach="left" box="[1034,1043,1367,1381]" fontSize="6" pageId="1" pageNumber="132">ƖƖ</superScript>
</emphasis>
</materialsCitation>
<collectingRegion id="7813F815D879FFEFFBF3FAB3FBC8B56C" box="[1047,1065,1371,1390]" country="Mexico" name="N" pageId="1" pageNumber="132">N</collectingRegion>
, 95
<emphasis id="88A3EAE5D879FFEFFBA8FABFFBB5B567" bold="true" box="[1100,1108,1367,1381]" pageId="1" pageNumber="132">
<superScript id="4DA29BBFD879FFEFFBA8FABFFBB5B567" attach="left" box="[1100,1108,1367,1381]" fontSize="6" pageId="1" pageNumber="132"></superScript>
</emphasis>
03
<emphasis id="88A3EAE5D879FFEFFB90FABFFB99B567" bold="true" box="[1140,1144,1367,1381]" pageId="1" pageNumber="132">
<superScript id="4DA29BBFD879FFEFFB90FABFFB99B567" attach="left" box="[1140,1144,1367,1381]" fontSize="6" pageId="1" pageNumber="132">Ɩ</superScript>
</emphasis>
35
<emphasis id="88A3EAE5D879FFEFFB7DFABFFB43B567" bold="true" box="[1177,1186,1367,1381]" pageId="1" pageNumber="132">
<superScript id="4DA29BBFD879FFEFFB7DFABFFB43B567" attach="left" box="[1177,1186,1367,1381]" fontSize="6" pageId="1" pageNumber="132">ƖƖ</superScript>
</emphasis>
W)
</paragraph>
</subSubSection>
<subSubSection id="F2CD657CD879FFEFFCC0FA9EFC2CB66B" pageId="1" pageNumber="132" type="diagnosis">
<paragraph id="BA6836F7D879FFEFFCC0FA9EFC2CB66B" blockId="1.[804,1475,1315,1809]" pageId="1" pageNumber="132">
<emphasis id="88A3EAE5D879FFEFFCC0FA9EFC71B58B" bold="true" box="[804,912,1398,1417]" pageId="1" pageNumber="132">Diagnosis.</emphasis>
This species is distinguished from other
<taxonomicName id="7DD74D74D879FFEFFAF9FA9EFA23B588" box="[1309,1474,1398,1418]" pageId="1" pageNumber="132">
<emphasis id="88A3EAE5D879FFEFFAF9FA9EFA97B588" box="[1309,1398,1398,1418]" italics="true" pageId="1" pageNumber="132">Ateuchus</emphasis>
species
</taxonomicName>
by the following combination of characters: Long and slender body; dorsum glossy; clypeus bidentate; head simply convex, lacking carina or tubercle; base of the head with a small wrinkled area in the center; anterior border of pronotum continuous, posterior border of pronotum with an area of dense and coarse punctures medially; elytral lateral portion rounded; sternellum forming a carina in the middle; pygidium slightly convex, lightly shagreen, and inconspicuously punctate.
</paragraph>
</subSubSection>
<subSubSection id="F2CD657CD879FFECFCC0F99AFF0CB673" lastPageId="2" lastPageNumber="133" pageId="1" pageNumber="132" type="description">
<paragraph id="BA6836F7D879FFECFCC0F99AFEB8B40E" blockId="1.[804,1475,1315,1809]" lastBlockId="2.[114,786,152,1985]" lastPageId="2" lastPageNumber="133" pageId="1" pageNumber="132">
<emphasis id="88A3EAE5D879FFEFFCC0F99AFC44B687" bold="true" box="[804,933,1650,1669]" pageId="1" pageNumber="132">Description.</emphasis>
<typeStatus id="656C8855D879FFEFFC4EF99AFBE6B687" box="[938,1031,1650,1669]" pageId="1" pageNumber="132" type="holotype">Holotype</typeStatus>
male (
<figureCitation id="22EC2A72D879FFEFFBA8F99AFB45B687" box="[1100,1188,1650,1669]" captionStart-0="Figures 13" captionStart-1="Figures 45" captionStartId-0="1.[804,867,1208,1222]" captionStartId-1="2.[833,896,1056,1070]" captionTargetBox-0="[839,1442,150,1177]" captionTargetBox-1="[867,1471,150,1024]" captionTargetId-0="figure-1443@1.[835,1443,150,1177]" captionTargetId-1="figure-619@2.[864,1472,149,1026]" captionTargetPageId-0="1" captionTargetPageId-1="2" captionText-0="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." captionText-1="Figures 45. A. tuza sp. nov.; 4, drawing of the internal sac, line equals 1 mm; 5, A. hornai (Balthasar, 1939), dorsal habitus of the female holotype." pageId="1" pageNumber="132">Figs. 14</figureCitation>
).
<emphasis id="88A3EAE5D879FFEFFB53F99AFB13B687" bold="true" box="[1207,1266,1650,1669]" pageId="1" pageNumber="132">Body.</emphasis>
Elongate (
<figureCitation id="22EC2A72D879FFEFFAB9F99AFA54B687" box="[1373,1461,1650,1669]" captionStart="Figures 13" captionStartId="1.[804,867,1208,1222]" captionTargetBox="[839,1442,150,1177]" captionTargetId="figure-1443@1.[835,1443,150,1177]" captionTargetPageId="1" captionText="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." pageId="1" pageNumber="132">Figs. 12</figureCitation>
), convex dorsally (
<figureCitation id="22EC2A72D879FFEFFC3FF966FBF7B6A3" box="[987,1046,1678,1697]" captionStart="Figures 13" captionStartId="1.[804,867,1208,1222]" captionTargetBox="[839,1442,150,1177]" captionTargetId="figure-1443@1.[835,1443,150,1177]" captionTargetPageId="1" captionText="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." pageId="1" pageNumber="132">Fig. 1</figureCitation>
).
<emphasis id="88A3EAE5D879FFEFFBCAF965FBBCB6A2" bold="true" box="[1070,1117,1677,1696]" pageId="1" pageNumber="132">Size.</emphasis>
Total length 10.0 mm. Maximum width 5.5 mm.
<emphasis id="88A3EAE5D879FFEFFC59F941FC1AB6BE" bold="true" box="[957,1019,1705,1724]" pageId="1" pageNumber="132">Color.</emphasis>
Dark reddish brown to black, lacking metallic sheen.
<emphasis id="88A3EAE5D879FFEFFC7DF92EFC34B6DB" bold="true" box="[921,981,1734,1753]" pageId="1" pageNumber="132">Head.</emphasis>
Clypeal margin anteriorly broadly V-shaped (
<figureCitation id="22EC2A72D879FFEFFCC8F909FC6AB6F6" box="[812,907,1761,1780]" captionStart="Figures 13" captionStartId="1.[804,867,1208,1222]" captionTargetBox="[839,1442,150,1177]" captionTargetId="figure-1443@1.[835,1443,150,1177]" captionTargetPageId="1" captionText="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." pageId="1" pageNumber="132">Figs. 12</figureCitation>
); anterior margin slightly upturned, gena and frons coarsely wrinkled, vertex coarsely punctate, base of head with a small wrinkled area in the center (
<figureCitation id="22EC2A72D87AFFECFE35FF70FDE6B0A9" box="[465,519,152,171]" captionStart="Figures 13" captionStartId="1.[804,867,1208,1222]" captionTargetBox="[839,1442,150,1177]" captionTargetId="figure-1443@1.[835,1443,150,1177]" captionTargetPageId="1" captionText="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." pageId="2" pageNumber="133">Fig. 3</figureCitation>
), eyes viewed from above six times longer than wide.
<emphasis id="88A3EAE5D87AFFECFE77FF5CFDE7B0C5" bold="true" box="[403,518,180,199]" pageId="2" pageNumber="133">Pronotum.</emphasis>
Transverse, strongly convex, surface glossy; anterior pronotal margin complete; midline weakly impressed at base; pronotal surface punctate throughout, a group of coarse punctures at the center of the pronotal base (
<figureCitation id="22EC2A72D87AFFECFF4AFECBFF02B134" box="[174,227,291,310]" captionStart="Figures 13" captionStartId="1.[804,867,1208,1222]" captionTargetBox="[839,1442,150,1177]" captionTargetId="figure-1443@1.[835,1443,150,1177]" captionTargetPageId="1" captionText="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." pageId="2" pageNumber="133">Fig. 1</figureCitation>
); lateral pronotal fossae shallow.
<emphasis id="88A3EAE5D87AFFECFDDFFECBFD61B134" bold="true" box="[571,640,291,310]" pageId="2" pageNumber="133">Elytra.</emphasis>
(
<figureCitation id="22EC2A72D87AFFECFD6AFECBFD22B134" box="[654,707,291,310]" captionStart="Figures 13" captionStartId="1.[804,867,1208,1222]" captionTargetBox="[839,1442,150,1177]" captionTargetId="figure-1443@1.[835,1443,150,1177]" captionTargetPageId="1" captionText="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." pageId="2" pageNumber="133">Fig. 1</figureCitation>
). Striae fine, shallowly impressed on disk, becoming well defined and deeply impressed on apical declivity; strial punctures elongatecrenulate, slightly wider than stria, separated by 23 diameters on disk and apical declivity. Interstriae slightly convex on disk, surface minutely punctate throughout.
<emphasis id="88A3EAE5D87AFFECFDE9FE47FD5BB1C0" bold="true" box="[525,698,431,450]" pageId="2" pageNumber="133">Thoracic sterna.</emphasis>
(
<figureCitation id="22EC2A72D87AFFECFD2FFE47FCE5B1C0" box="[715,772,431,450]" captionStart="Figures 13" captionStartId="1.[804,867,1208,1222]" captionTargetBox="[839,1442,150,1177]" captionTargetId="figure-1443@1.[835,1443,150,1177]" captionTargetPageId="1" captionText="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." pageId="2" pageNumber="133">Fig. 2</figureCitation>
). Proepisternum excavate anteriorly, surface of excavated portion granulate, with fine and rather long setae, bordered posteriorly by a well-defined keel. Proepimeron finely wrinkled. Sternellum glabrous and forming a keel at its center. Mesometasternal suture arched medially, marginal bead fine. Mesosternum coarsely punctured forming rugulae. Mesepisternum flat, surface-forming rugulae. Metasternum evenly convex, disk evidently punctate, surface glossy between punctures, lateral lobes forming rugulae; midline clearly impressed along three fourths of its length.
<emphasis id="88A3EAE5D87AFFECFD39FD42FCF0B2BF" bold="true" box="[733,785,682,701]" pageId="2" pageNumber="133">Legs.</emphasis>
(
<figureCitation id="22EC2A72D87AFFECFF9EFD2EFF33B2DB" box="[122,210,710,729]" captionStart="Figures 13" captionStartId="1.[804,867,1208,1222]" captionTargetBox="[839,1442,150,1177]" captionTargetId="figure-1443@1.[835,1443,150,1177]" captionTargetPageId="1" captionText="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." pageId="2" pageNumber="133">Figs. 12</figureCitation>
). Foretibia with four teeth on outer margin, the basal one weakly developed; foretibial spur expanded and truncate apically; foretibiae and forefemora long and slender; forefemur smooth, finely punctate throughout. Metatibiae obliquely truncate apically; apical spur spiniform.
<emphasis id="88A3EAE5D87AFFECFEB6FCDDFE5EB34A" bold="true" box="[338,447,821,840]" pageId="2" pageNumber="133">Abdomen.</emphasis>
(
<figureCitation id="22EC2A72D87AFFECFE29FCDDFDE3B34B" box="[461,514,821,841]" captionStart="Figures 13" captionStartId="1.[804,867,1208,1222]" captionTargetBox="[839,1442,150,1177]" captionTargetId="figure-1443@1.[835,1443,150,1177]" captionTargetPageId="1" captionText="Figures 13. Ateuchus tuza sp. nov.; 1, dorsal habitus of holotype; 2, ventral habitus of holotype; 3, wrinkled area at the base of the head of a male." pageId="2" pageNumber="133">Fig. 2</figureCitation>
). Sternites 37 crenulately punctate along their anterior borders. Last abdominal segment slender. Pygidium slightly convex and lightly shagreen with indistinct punctuation; basal sulcus fine and deep throughout; marginal bead continuous.
<emphasis id="88A3EAE5D87AFFECFEC8FC4DFE2DB3BA" bold="true" box="[300,460,933,952]" pageId="2" pageNumber="133">Male genitalia.</emphasis>
Parameres simple, tapering to apex in lateral view, apical portion rounded in dorsal view. The internal sac of the aedeagus with three hooks, two spine-like and one spoon-like (
<figureCitation id="22EC2A72D87AFFECFEF3FC11FEADB40E" box="[279,332,1017,1036]" captionStart="Figures 45" captionStartId="2.[833,896,1056,1070]" captionTargetBox="[867,1471,150,1024]" captionTargetId="figure-619@2.[864,1472,149,1026]" captionTargetPageId="2" captionText="Figures 45. A. tuza sp. nov.; 4, drawing of the internal sac, line equals 1 mm; 5, A. hornai (Balthasar, 1939), dorsal habitus of the female holotype." pageId="2" pageNumber="133">Fig. 4</figureCitation>
).
</paragraph>
<paragraph id="BA6836F7D87AFFECFF96FBFCFE99B4B1" blockId="2.[114,786,152,1985]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFF96FBFCFF30B425" bold="true" box="[114,209,1044,1063]" pageId="2" pageNumber="133">
<typeStatus id="656C8855D87AFFECFF96FBFCFF2FB425" box="[114,206,1044,1063]" pageId="2" pageNumber="133" type="allotype">Allotype</typeStatus>
:
</emphasis>
Female. Total length 9.5 mm. Maximum width 5.0 mm. Same as male with the following sexual differences: clypeal margin anteriorly, not so broadly V-shaped; lateral pronotal margin not arched; last abdominal segment broader medially; foretibiae and forefemora shorter and foretibial spurs slender and slightly bent at tip; pygidium not as long.
</paragraph>
<caption id="EEA8667FD87AFFECFCA5FBC8FAA1B447" pageId="2" pageNumber="133" startId="2.[833,896,1056,1070]" targetBox="[867,1471,150,1024]" targetPageId="2" targetType="figure">
<paragraph id="BA6836F7D87AFFECFCA5FBC8FAA1B447" blockId="2.[833,1505,1055,1093]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFCA5FBC8FC46B42C" bold="true" box="[833,935,1056,1070]" pageId="2" pageNumber="133">Figures 45.</emphasis>
<taxonomicName id="7DD74D74D87AFFECFC54FBF7FC07B42C" authorityName="Kohlmann &amp; Vaz-de-Mello" authorityYear="2018" box="[944,998,1055,1070]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="tuza" status="sp. nov.">
<emphasis id="88A3EAE5D87AFFECFC54FBF7FC07B42C" box="[944,998,1055,1070]" italics="true" pageId="2" pageNumber="133">A. tuza</emphasis>
</taxonomicName>
<taxonomicNameLabel id="9390579ED87AFFECFC0EFBC8FBCDB42C" box="[1002,1068,1056,1070]" pageId="2" pageNumber="133" rank="species">sp. nov.</taxonomicNameLabel>
; 4, drawing of the internal sac, line equals 1 mm; 5,
<taxonomicName id="7DD74D74D87AFFECFA35FBF7FBE2B447" authority="(Balthasar, 1939)" authorityName="Either" baseAuthorityName="Balthasar" baseAuthorityYear="1939" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="hornai">
<emphasis id="88A3EAE5D87AFFECFA35FBF7FC95B447" italics="true" pageId="2" pageNumber="133">A. hornai</emphasis>
(
<bibRefCitation id="DE464B06D87AFFECFC9BFBDFFC1DB447" author="Balthasar, V." box="[895,1020,1079,1093]" pageId="2" pageNumber="133" pagination="44 - 66" refId="ref4261" refString="Balthasar, V., 1939. Neue Choeridium - Arten (Ins Col.). Senckenbergiana 21, 44 - 66." type="journal article" year="1939">Balthasar, 1939</bibRefCitation>
)
</taxonomicName>
, dorsal habitus of the female holotype.
</paragraph>
</caption>
<paragraph id="BA6836F7D87AFFECFF96FB54FF0CB673" blockId="2.[114,786,152,1985]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFF96FB54FF3CB4CD" bold="true" box="[114,221,1212,1231]" pageId="2" pageNumber="133">Variation:</emphasis>
<materialsCitation id="0ABF3CAAD87AFFECFF06FB54FE22B505" collectorName="Total &amp; Maximum &amp; Material &amp; Dos Amates" country="Mexico" county="Male" location="Catemaco" municipality="Dos Amates" pageId="2" pageNumber="133" specimenCount="34" stateProvince="Veracruz de Ignacio de la Llave" typeStatus="holotype">
<collectorName id="17225321D87AFFECFF06FB54FEF4B4CD" box="[226,277,1212,1231]" pageId="2" pageNumber="133">Total</collectorName>
length 9.5
<quantity id="7D2F9B12D87AFFECFE6BFB54FE37B4CD" box="[399,470,1212,1231]" metricMagnitude="-2" metricUnit="m" metricValue="1.0" pageId="2" pageNumber="133" unit="mm" value="10.0">10 mm</quantity>
.
<collectorName id="17225321D87AFFECFE3AFB54FDA6B4CD" box="[478,583,1212,1231]" pageId="2" pageNumber="133">Maximum</collectorName>
width 5.05.5 mm.
<emphasis id="88A3EAE5D87AFFECFF96FB30FED8B4E9" bold="true" box="[114,313,1240,1259]" pageId="2" pageNumber="133">
<collectorName id="17225321D87AFFECFF96FB30FF2DB4E9" box="[114,204,1240,1259]" pageId="2" pageNumber="133">Material</collectorName>
examined
</emphasis>
(
<specimenCount id="ACD1FD7ED87AFFECFEA2FB30FE37B4E9" box="[326,470,1240,1259]" count="34" pageId="2" pageNumber="133" type="generic">34 specimens</specimenCount>
):
<emphasis id="88A3EAE5D87AFFECFE00FB30FDAAB4E9" bold="true" box="[484,587,1240,1259]" pageId="2" pageNumber="133">
<typeStatus id="656C8855D87AFFECFE00FB30FDA7B4E9" box="[484,582,1240,1259]" pageId="2" pageNumber="133" type="holotype">Holotype</typeStatus>
.
</emphasis>
<collectingCounty id="53094E7BD87AFFECFDABFB30FD67B4E9" box="[591,646,1240,1259]" pageId="2" pageNumber="133">Male</collectingCounty>
:
<collectingCountry id="C2C07667D87AFFECFD6AFB30FD3CB4E9" box="[654,733,1240,1259]" name="Mexico" pageId="2" pageNumber="133">México</collectingCountry>
:
<collectingRegion id="7813F815D87AFFECFD00FB30FF4FB505" country="Mexico" name="Veracruz de Ignacio de la Llave" pageId="2" pageNumber="133">Veracruz</collectingRegion>
:
<collectorName id="17225321D87AFFECFF51FB1CFECBB505" box="[181,298,1268,1287]" pageId="2" pageNumber="133">
<collectingMunicipality id="5A0CAC8DD87AFFECFF51FB1CFECBB505" box="[181,298,1268,1287]" pageId="2" pageNumber="133">Dos Amates</collectingMunicipality>
</collectorName>
(
<location id="BF08602CD87AFFECFED1FB1CFE7CB505" LSID="urn:lsid:plazi:treatment:327E87E1D879FFEDFCC0FAEFFF44B0C5:BF08602CD87AFFECFED1FB1CFE7CB505" box="[309,413,1268,1287]" country="Mexico" county="Male" municipality="Dos Amates" name="Catemaco" pageId="2" pageNumber="133" stateProvince="Veracruz de Ignacio de la Llave">Catemaco</location>
),
<date id="CE691037D87AFFECFE4FFB1CFE22B505" box="[427,451,1268,1287]" pageId="2" pageNumber="133" value="1968-05-08">8</date>
</materialsCitation>
V1968,
<materialsCitation id="0ABF3CAAD87AFFECFDF8FB1CFEFEB5C8" collectionCode="CEMT" collectorName="P. Reyes &amp; M. Cabrera &amp; Nido &amp; Camara &amp; Female" country="Mexico" county="Gonzalo Halffter" location="Bert Kohlmann" municipality="Coatepec" pageId="2" pageNumber="133" specimenCount="21" specimenCount-female="9" specimenCount-male="12" typeStatus="allotype">
<collectorName id="17225321D87AFFECFDF8FB1CFD8CB505" box="[540,621,1268,1287]" pageId="2" pageNumber="133">P. Reyes</collectorName>
,
<collectorName id="17225321D87AFFECFD90FB1CFD00B505" box="[628,737,1268,1287]" pageId="2" pageNumber="133">M. Cabrera</collectorName>
cols.
<collectorName id="17225321D87AFFECFF96FAF8FF42B521" box="[114,163,1296,1315]" pageId="2" pageNumber="133">Nido</collectorName>
de tuza.
<collectorName id="17225321D87AFFECFEE6FAF8FEAEB521" box="[258,335,1296,1315]" pageId="2" pageNumber="133">Cámara</collectorName>
de desechos (
<collectionCode id="DCC6AE32D87AFFECFE04FAF8FDC0B521" box="[480,545,1296,1315]" pageId="2" pageNumber="133">CEMT</collectionCode>
).
<emphasis id="88A3EAE5D87AFFECFDD5FAE7FD71B520" bold="true" box="[561,656,1295,1314]" pageId="2" pageNumber="133">
<typeStatus id="656C8855D87AFFECFDD5FAE7FD6AB520" box="[561,651,1295,1314]" pageId="2" pageNumber="133" type="allotype">Allotype</typeStatus>
.
</emphasis>
<collectorName id="17225321D87AFFECFD73FAF8FD04B521" box="[663,741,1296,1315]" pageId="2" pageNumber="133">Female</collectorName>
:
<emphasis id="88A3EAE5D87AFFECFD0BFAE7FF7DB53C" italics="true" pageId="2" pageNumber="133">ibidem</emphasis>
,
<specimenCount id="ACD1FD7ED87AFFECFF43FAC4FEF8B53C" box="[167,281,1323,1343]" count="1" pageId="2" pageNumber="133" type="female">one female</specimenCount>
.
<emphasis id="88A3EAE5D87AFFECFEC6FAC4FE71B53D" bold="true" box="[290,400,1324,1343]" pageId="2" pageNumber="133">
<typeStatus id="656C8855D87AFFECFEC6FAC4FE6DB53D" box="[290,396,1324,1343]" pageId="2" pageNumber="133" type="paratype">Paratypes</typeStatus>
.
</emphasis>
<emphasis id="88A3EAE5D87AFFECFE73FAC2FE3BB53C" box="[407,474,1322,1342]" italics="true" pageId="2" pageNumber="133">ibidem</emphasis>
,
<specimenCount id="ACD1FD7ED87AFFECFE00FAC3FDA5B53C" box="[484,580,1323,1342]" count="6" pageId="2" pageNumber="133" type="male">six males</specimenCount>
,
<specimenCount id="ACD1FD7ED87AFFECFDAAFAC3FD2CB53C" box="[590,717,1323,1342]" count="4" pageId="2" pageNumber="133" type="female">four females</specimenCount>
(
<specimenCount id="ACD1FD7ED87AFFECFD3EFAC3FF4FB558" count="3" pageId="2" pageNumber="133" type="male">three males</specimenCount>
and
<specimenCount id="ACD1FD7ED87AFFECFF3BFAAFFE8BB558" box="[223,362,1351,1370]" count="3" pageId="2" pageNumber="133" type="female">three females</specimenCount>
at
<collectionCode id="DCC6AE32D87AFFECFE6DFAA0FE29B559" box="[393,456,1352,1371]" pageId="2" pageNumber="133">CEMT</collectionCode>
;
<specimenCount id="ACD1FD7ED87AFFECFE35FAA0FDD1B558" box="[465,560,1351,1371]" count="1" pageId="2" pageNumber="133" type="male">one male</specimenCount>
,
<collectingCounty id="53094E7BD87AFFECFDDDFAAFFD01B558" box="[569,736,1351,1370]" pageId="2" pageNumber="133">Gonzalo Halffter</collectingCounty>
personal collection,
<collectingMunicipality id="5A0CAC8DD87AFFECFEFCFA8BFE97B574" box="[280,374,1379,1398]" pageId="2" pageNumber="133">Coatepec</collectingMunicipality>
,
<collectingCountry id="C2C07667D87AFFECFE9AFA8BFE2DB574" box="[382,460,1379,1398]" name="Mexico" pageId="2" pageNumber="133">Mexico</collectingCountry>
;
<specimenCount id="ACD1FD7ED87AFFECFE37FA8CFDCEB574" box="[467,559,1379,1399]" count="1" pageId="2" pageNumber="133" type="male">one male</specimenCount>
and
<specimenCount id="ACD1FD7ED87AFFECFDB9FA8CFD2AB574" box="[605,715,1379,1399]" count="1" pageId="2" pageNumber="133" type="female">one female</specimenCount>
at
<location id="BF08602CD87AFFECFD02FA8CFF3DB590" LSID="urn:lsid:plazi:treatment:327E87E1D879FFEDFCC0FAEFFF44B0C5:BF08602CD87AFFECFD02FA8CFF3DB590" country="Mexico" county="Gonzalo Halffter" municipality="Coatepec" name="Bert Kohlmann" pageId="2" pageNumber="133">Bert Kohlmann</location>
personal collection,
<location id="BF08602CD87AFFECFE5CFA68FD2DB590" LSID="urn:lsid:plazi:treatment:327E87E1D879FFEDFCC0FAEFFF44B0C5:BF08602CD87AFFECFE5CFA68FD2DB590" box="[440,716,1407,1427]" country="Mexico" county="Gonzalo Halffter" municipality="Coatepec" name="Las Mercedes de Guacimo" pageId="2" pageNumber="133">Las Mercedes de Guácimo</location>
,
<collectingCountry id="C2C07667D87AFFECFD3DFA97FF40B5AC" name="Costa Rica" pageId="2" pageNumber="133">Costa Rica</collectingCountry>
;
<specimenCount id="ACD1FD7ED87AFFECFF49FA73FEEFB5AC" box="[173,270,1435,1454]" count="1" pageId="2" pageNumber="133" type="male">one male</specimenCount>
to be deposited at
<location id="BF08602CD87AFFECFE3BFA73FCECB5AC" LSID="urn:lsid:plazi:treatment:327E87E1D879FFEDFCC0FAEFFF44B0C5:BF08602CD87AFFECFE3BFA73FCECB5AC" box="[479,781,1435,1454]" country="Mexico" county="Gonzalo Halffter" municipality="Coatepec" name="Canadian Museum of Nature" pageId="2" pageNumber="133">Canadian Museum of Nature</location>
,
<location id="BF08602CD87AFFECFF96FA5FFF5FB5C8" LSID="urn:lsid:plazi:treatment:327E87E1D879FFEDFCC0FAEFFF44B0C5:BF08602CD87AFFECFF96FA5FFF5FB5C8" box="[114,190,1463,1482]" country="Mexico" county="Gonzalo Halffter" municipality="Coatepec" name="Ottawa" pageId="2" pageNumber="133">Ottawa</location>
,
<collectingCountry id="C2C07667D87AFFECFF2CFA5FFEF6B5C8" box="[200,279,1463,1482]" name="Canada" pageId="2" pageNumber="133">Canada</collectingCountry>
)
</materialsCitation>
;
<materialsCitation id="0ABF3CAAD87AFFECFECDFA5FFDE2B600" collectingDate="2015-06-12" collectionCode="IEXA" collectorName="Entomological Collection &amp; Xalapa" country="Mexico" location="Sta. Maria Chimalapas" municipality="Institute of Ecology" pageId="2" pageNumber="133" specimenCount="2" specimenCount-female="1" specimenCount-male="1" stateProvince="Oaxaca" typeStatus="allotype">
<specimenCount id="ACD1FD7ED87AFFECFECDFA5FFE6BB5C8" box="[297,394,1463,1482]" count="1" pageId="2" pageNumber="133" type="male">one male</specimenCount>
,
<specimenCount id="ACD1FD7ED87AFFECFE70FA5FFDE6B5C8" box="[404,519,1463,1482]" count="1" pageId="2" pageNumber="133" type="female">one female</specimenCount>
,
<collectorName id="17225321D87AFFECFDF6FA5FFCF0B5C8" box="[530,785,1463,1482]" pageId="2" pageNumber="133">Entomological Collection</collectorName>
at the
<collectingMunicipality id="5A0CAC8DD87AFFECFF5CFA3BFE64B5E4" box="[184,389,1491,1510]" pageId="2" pageNumber="133">Institute of Ecology</collectingMunicipality>
,
<collectorName id="17225321D87AFFECFE75FA3BFE39B5E4" box="[401,472,1491,1510]" pageId="2" pageNumber="133">Xalapa</collectorName>
,
<collectingCountry id="C2C07667D87AFFECFE00FA3BFDCFB5E4" box="[484,558,1491,1510]" name="Mexico" pageId="2" pageNumber="133">Mexico</collectingCountry>
(
<collectionCode id="DCC6AE32D87AFFECFDD8FA3BFD92B5E4" box="[572,627,1491,1510]" pageId="2" pageNumber="133">IEXA</collectionCode>
),
<collectingCountry id="C2C07667D87AFFECFD61FA3BFD35B5E4" box="[645,724,1491,1510]" name="Mexico" pageId="2" pageNumber="133">México</collectingCountry>
:
<collectingRegion id="7813F815D87AFFECFD04FA3BFF74B600" country="Mexico" name="Oaxaca" pageId="2" pageNumber="133">Oaxaca</collectingRegion>
,
<location id="BF08602CD87AFFECFF7BFA07FE62B600" LSID="urn:lsid:plazi:treatment:327E87E1D879FFEDFCC0FAEFFF44B0C5:BF08602CD87AFFECFF7BFA07FE62B600" box="[159,387,1519,1538]" country="Mexico" municipality="Institute of Ecology" name="Sta. Maria Chimalapas" pageId="2" pageNumber="133" stateProvince="Oaxaca">Sta. María Chimalapas</location>
,
<date id="CE691037D87AFFECFE69FA07FDE2B600" box="[397,515,1519,1538]" pageId="2" pageNumber="133" value="2015-06-12">
<collectingDate id="DE2DE9DFD87AFFECFE69FA07FDE2B600" box="[397,515,1519,1538]" pageId="2" pageNumber="133" value="2015-06-12">12-VI-2015</collectingDate>
</date>
</materialsCitation>
, colecta directa, dentro de madriguera de
<taxonomicName id="7DD74D74D87AFFECFEEEF9E3FE3BB61C" authority=", J. Luis S. Huerta" box="[266,474,1547,1566]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="tuza">tuza, J. Luis S. Huerta</taxonomicName>
col.;
<specimenCount id="ACD1FD7ED87AFFECFDEAF9E3FD94B61C" box="[526,629,1547,1566]" count="5" pageId="2" pageNumber="133" type="male">five males</specimenCount>
,
<specimenCount id="ACD1FD7ED87AFFECFD99F9E3FCEFB61C" box="[637,782,1547,1566]" count="7" pageId="2" pageNumber="133" type="female">seven females</specimenCount>
, ibidem,
<date id="CE691037D87AFFECFF20F9CEFEDDB63B" box="[196,316,1574,1593]" pageId="2" pageNumber="133" value="2015-06-16">16-VI-2015</date>
;
<specimenCount id="ACD1FD7ED87AFFECFEA2F9CFFE50B638" box="[326,433,1575,1594]" count="2" pageId="2" pageNumber="133" type="male">two males</specimenCount>
,
<specimenCount id="ACD1FD7ED87AFFECFE5FF9CFFDD8B638" box="[443,569,1575,1594]" count="2" pageId="2" pageNumber="133" type="female">two females</specimenCount>
, ibidem,
<date id="CE691037D87AFFECFD71F9CEFCEDB63B" box="[661,780,1574,1593]" pageId="2" pageNumber="133" value="2015-06-18">18-VI-2015</date>
;
<specimenCount id="ACD1FD7ED87AFFECFF96F9ABFF35B657" box="[114,212,1602,1622]" count="1" pageId="2" pageNumber="133" type="male">one male</specimenCount>
,
<specimenCount id="ACD1FD7ED87AFFECFF3BF9ABFEB5B657" box="[223,340,1602,1622]" count="1" pageId="2" pageNumber="133" type="female">one female</specimenCount>
, ibidem,
<date id="CE691037D87AFFECFE50F9AAFDCDB657" box="[436,556,1602,1621]" pageId="2" pageNumber="133" value="2015-06-19">19-VI-2015</date>
;
<specimenCount id="ACD1FD7ED87AFFECFDDCF9ABFD58B657" box="[568,697,1602,1622]" count="2" pageId="2" pageNumber="133" type="female">two females</specimenCount>
, ibidem,
<date id="CE691037D87AFFECFF96F9B6FF09B673" box="[114,232,1630,1649]" pageId="2" pageNumber="133" value="2015-06-22">22-VI-2015</date>
.
</paragraph>
</subSubSection>
<subSubSection id="F2CD657CD87AFFECFF96F992FDB2B6AB" pageId="2" pageNumber="133" type="discussion">
<paragraph id="BA6836F7D87AFFECFF96F992FDB2B6AB" blockId="2.[114,786,152,1985]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFF96F992FF36B68F" bold="true" box="[114,215,1658,1677]" pageId="2" pageNumber="133">Remarks:</emphasis>
This is the first North American inquiline
<taxonomicName id="7DD74D74D87AFFECFD5CF991FF5AB6AB" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFD5CF991FCF0B68F" box="[696,785,1657,1677]" italics="true" pageId="2" pageNumber="133">Ateuchus</emphasis>
species
</taxonomicName>
collected from a pocket gopher burrow.
</paragraph>
</subSubSection>
<subSubSection id="F2CD657CD87AFFEDFF96F95AFF44B0C5" lastPageId="3" lastPageNumber="134" pageId="2" pageNumber="133" type="etymology">
<paragraph id="BA6836F7D87AFFECFF96F95AFED0B71B" blockId="2.[114,786,152,1985]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFF96F95AFF0AB6C7" bold="true" box="[114,235,1714,1733]" pageId="2" pageNumber="133">Etymology:</emphasis>
The name
<taxonomicName id="7DD74D74D87AFFECFEB3F959FE60B6C7" box="[343,385,1713,1733]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="tuza">
<emphasis id="88A3EAE5D87AFFECFEB3F959FE60B6C7" box="[343,385,1713,1733]" italics="true" pageId="2" pageNumber="133">tuza</emphasis>
</taxonomicName>
, a name in apposition, is the hispanized common name of the indigenous nahuatl word tozan, given to the beaver-looking subterranean rodent, where the new
<taxonomicName id="7DD74D74D87AFFECFD5CF901FF5AB71B" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFD5CF901FCF0B6FF" box="[696,785,1769,1789]" italics="true" pageId="2" pageNumber="133">Ateuchus</emphasis>
species
</taxonomicName>
was found.
</paragraph>
<paragraph id="BA6836F7D87AFFECFF96F8C9FD30B76E" blockId="2.[114,786,152,1985]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFF96F8C9FE6DB736" bold="true" box="[114,396,1825,1844]" pageId="2" pageNumber="133">Geographical distribution:</emphasis>
<materialsCitation id="0ABF3CAAD87AFFECFE77F8CAFCECB753" collectorName="Dos Amates" location="Veracruz" pageId="2" pageNumber="133" specimenCount="1" stateProvince="Veracruz de Ignacio de la Llave">
The new species is so far only known from the locality of
<collectorName id="17225321D87AFFECFED2F8D6FE4FB753" box="[310,430,1854,1873]" pageId="2" pageNumber="133">Dos Amates</collectorName>
, Catemaco, in the state of
<collectingRegion id="7813F815D87AFFECFD55F8D6FCECB753" box="[689,781,1854,1873]" country="Mexico" name="Veracruz de Ignacio de la Llave" pageId="2" pageNumber="133">Veracruz</collectingRegion>
</materialsCitation>
,
<materialsCitation id="0ABF3CAAD87AFFECFF96F8B1FD2FB76E" box="[114,718,1881,1901]" country="Mexico" location="Oaxaca" pageId="2" pageNumber="133" specimenCount="1" stateProvince="Oaxaca">
and the locality of Santa María Chimalapas,
<collectingRegion id="7813F815D87AFFECFDC9F8B2FD99B76F" box="[557,632,1882,1901]" country="Mexico" name="Oaxaca" pageId="2" pageNumber="133">Oaxaca</collectingRegion>
,
<collectingCountry id="C2C07667D87AFFECFD65F8B1FD2FB76E" box="[641,718,1881,1900]" name="Mexico" pageId="2" pageNumber="133">Mexico</collectingCountry>
</materialsCitation>
.
</paragraph>
<paragraph id="BA6836F7D87AFFECFF96F89DFA61B4B1" blockId="2.[114,786,152,1985]" lastBlockId="2.[833,1504,1156,1985]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFF96F89DFF29B78A" bold="true" box="[114,200,1909,1928]" pageId="2" pageNumber="133">Habitat:</emphasis>
The new species was collected in the waste chamber of a pocket gopher (
<taxonomicName id="7DD74D74D87AFFECFEC0F879FE64B7A6" authorityName="Bowdich" authorityYear="1821" box="[292,389,1937,1956]" class="Mammalia" kingdom="Animalia" order="Rodentia" pageId="2" pageNumber="133" phylum="Chordata" rank="order">Rodentia</taxonomicName>
: Geomydae) burrow during the month of May. Although the rodent of the original collection site was not identified at the time, it is most likely that the specimens were found inside the nest of
<taxonomicName id="7DD74D74D87AFFECFBD2FB77FA9DB4B1" authority="(Le Conte)" baseAuthorityName="Le Conte" baseAuthorityYear="1852" box="[1078,1404,1183,1203]" class="Mammalia" family="Geomyidae" genus="Orthogeomys" kingdom="Animalia" order="Rodentia" pageId="2" pageNumber="133" phylum="Chordata" rank="species" species="hispidus">
<emphasis id="88A3EAE5D87AFFECFBD2FB77FAEDB4B1" box="[1078,1292,1183,1203]" italics="true" pageId="2" pageNumber="133">Orthogeomys hispidus</emphasis>
(Le Conte)
</taxonomicName>
.
</paragraph>
<paragraph id="BA6836F7D87AFFECFCA5FB54FAAEB558" blockId="2.[833,1504,1156,1985]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFCA5FB54FBD3B4CD" bold="true" box="[833,1074,1212,1231]" pageId="2" pageNumber="133">Chorological affinities:</emphasis>
Interestingly, this new
<taxonomicName id="7DD74D74D87AFFECFAC6FB53FA28B4CD" box="[1314,1481,1211,1231]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFAC6FB53FA9AB4CD" box="[1314,1403,1211,1231]" italics="true" pageId="2" pageNumber="133">Ateuchus</emphasis>
species
</taxonomicName>
is found under similar ecological conditions, a lowland tropical area, as
<taxonomicName id="7DD74D74D87AFFECFCB8FB1BFBACB505" authority="Genier" authorityName="Genier" authorityYear="2015" box="[860,1101,1267,1287]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="cujuchi">
<emphasis id="88A3EAE5D87AFFECFCB8FB1BFBE3B505" box="[860,1026,1267,1287]" italics="true" pageId="2" pageNumber="133">Ateuchus cujuchi</emphasis>
Génier
</taxonomicName>
, the other known inquiline rodent burrow
<taxonomicName id="7DD74D74D87AFFECFC95FAE7FBFAB521" box="[881,1051,1295,1315]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFC95FAE7FC2BB521" box="[881,970,1295,1315]" italics="true" pageId="2" pageNumber="133">Ateuchus</emphasis>
species
</taxonomicName>
from
<collectingCountry id="C2C07667D87AFFECFBBAFAF8FB42B521" box="[1118,1187,1296,1315]" name="Bolivia" pageId="2" pageNumber="133">Bolivia</collectingCountry>
(
<bibRefCitation id="DE464B06D87AFFECFB57FAF8FAD9B520" author="Genier, F." box="[1203,1336,1295,1315]" pageId="2" pageNumber="133" pagination="146 - 148" refId="ref4382" refString="Genier, F., 2015. Ateuchus cujuchi n. sp., a new inquiline species from Scarabaeinae (Coleoptera: Scarabaeidae) from tuco-tuco burrows from Bolivia. Zootaxa 3946, 146 - 148." type="journal article" year="2015">Génier, 2015</bibRefCitation>
).
<taxonomicName id="7DD74D74D87AFFECFAA9FAE7FA4EB521" authorityName="Genier" authorityYear="2015" box="[1357,1455,1295,1315]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="cujuchi">
<emphasis id="88A3EAE5D87AFFECFAA9FAE7FA4EB521" box="[1357,1455,1295,1315]" italics="true" pageId="2" pageNumber="133">A. cujuchi</emphasis>
</taxonomicName>
was collected in a
<taxonomicName id="7DD74D74D87AFFECFC35FAC2FBD1B53C" authorityName="Blainville" authorityYear="1826" box="[977,1072,1322,1342]" class="Mammalia" family="Ctenomyidae" genus="Ctenomys" kingdom="Animalia" order="Rodentia" pageId="2" pageNumber="133" phylum="Chordata" rank="genus">
<emphasis id="88A3EAE5D87AFFECFC35FAC2FBD1B53C" box="[977,1072,1322,1342]" italics="true" pageId="2" pageNumber="133">Ctenomys</emphasis>
</taxonomicName>
burrow, a rodent belonging to a different family, Ctenomydae, as the one collected in
<collectingCountry id="C2C07667D87AFFECFB1AFAAFFAAAB558" box="[1278,1355,1351,1370]" name="Mexico" pageId="2" pageNumber="133">Mexico</collectingCountry>
.
</paragraph>
<paragraph id="BA6836F7D87AFFECFCA5FA8BFC60B6FF" blockId="2.[833,1504,1156,1985]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFCA5FA8BFBB3B574" bold="true" box="[833,1106,1379,1398]" pageId="2" pageNumber="133">Taxonomic relationships:</emphasis>
The shape of the body of this species resembles the South American species
<taxonomicName id="7DD74D74D87AFFECFB06FA96FA3EB590" authority="(Harold, 1867)" baseAuthorityName="Harold" baseAuthorityYear="1867" box="[1250,1503,1406,1426]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="apicatum">
<emphasis id="88A3EAE5D87AFFECFB06FA96FADFB590" box="[1250,1342,1406,1426]" italics="true" pageId="2" pageNumber="133">apicatum</emphasis>
(Harold, 1867)
</taxonomicName>
and is clearly not related to the known body shape of the North or Central American
<taxonomicName id="7DD74D74D87AFFECFBF9FA5EFB2FB5C8" box="[1053,1230,1462,1482]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="undetermined">
<emphasis id="88A3EAE5D87AFFECFBF9FA5EFB97B5C8" box="[1053,1142,1462,1482]" italics="true" pageId="2" pageNumber="133">Ateuchus</emphasis>
species.
</taxonomicName>
The new species will key to couplet 23/24 (
<taxonomicName id="7DD74D74D87AFFECFBE5FA3AFBBCB5E4" baseAuthorityName="Harold" baseAuthorityYear="1867" box="[1025,1117,1490,1510]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="apicatum">
<emphasis id="88A3EAE5D87AFFECFBE5FA3AFBBCB5E4" box="[1025,1117,1490,1510]" italics="true" pageId="2" pageNumber="133">apicatum</emphasis>
</taxonomicName>
) in
<bibRefCitation id="DE464B06D87AFFECFB6FFA3BFAA7B5E4" author="Balthasar, V." box="[1163,1350,1491,1510]" pageId="2" pageNumber="133" pagination="44 - 66" refId="ref4261" refString="Balthasar, V., 1939. Neue Choeridium - Arten (Ins Col.). Senckenbergiana 21, 44 - 66." type="journal article" year="1939">Balthasars (1939)</bibRefCitation>
key. It can be easily separated from
<taxonomicName id="7DD74D74D87AFFECFBC2FA06FB7DB600" baseAuthorityName="Harold" baseAuthorityYear="1867" box="[1062,1180,1518,1538]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="apicatum">
<emphasis id="88A3EAE5D87AFFECFBC2FA06FB7DB600" box="[1062,1180,1518,1538]" italics="true" pageId="2" pageNumber="133">A. apicatum</emphasis>
</taxonomicName>
because of the presence of the small rugose area at the center of the base of the head and the presence of coarse punctures at the middle of the pronotal base. This taxonomic relationship would suggest that
<taxonomicName id="7DD74D74D87AFFECFAD2F9A9FA3EB657" box="[1334,1503,1601,1621]" pageId="2" pageNumber="133">
<emphasis id="88A3EAE5D87AFFECFAD2F9A9FA6EB657" box="[1334,1423,1601,1621]" italics="true" pageId="2" pageNumber="133">Ateuchus</emphasis>
species
</taxonomicName>
derived of South American lines have adapted to and colonized lowland gopher nests in North America; whereas, in the mountainous areas of North America it is species of the genus
<taxonomicName id="7DD74D74D87AFFECFA92F97DFC83B6C7" authorityName="Latreille" authorityYear="1802" class="Insecta" family="Scarabaeidae" genus="Onthophagus" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="genus">
<emphasis id="88A3EAE5D87AFFECFA92F97DFC83B6C7" italics="true" pageId="2" pageNumber="133">Onthophagus</emphasis>
</taxonomicName>
, which has adapted to colonizing gopher nests (
<bibRefCitation id="DE464B06D87AFFECFA62F95AFBE1B6E3" author="Anduaga, S. &amp; Halffter, G." pageId="2" pageNumber="133" pagination="185 - 197" refId="ref4224" refString="Anduaga, S., Halffter, G., 1991. Escarabajos asociados a madrigueras de roedores (Coleoptera: Scarabaeidae: Scarabaeinae). Folia Entomol. Mex. 81, 185 - 197." type="journal article" year="1991">Anduaga and Halffter, 1991</bibRefCitation>
;
<bibRefCitation id="DE464B06D87AFFECFBE8F926FAE5B6E3" author="Lobo, J. M. &amp; Halffter, G." box="[1036,1284,1742,1761]" pageId="2" pageNumber="133" pagination="1 - 9" refId="ref4673" refString="Lobo, J. M., Halffter, G., 1994. Relaciones entre escarabajos (Coleoptera: Scarabaeidae) y nidos de tuza (Rodentia: Geomydae): Implicaciones biologicas y biogeograficas. Acta Zool. Mex. 62, 1 - 9." type="journal article" year="1994">Lobo and Halffter, 1994</bibRefCitation>
;
<bibRefCitation id="DE464B06D87AFFECFAEBF926FC95B6FF" author="Zunino, M. &amp; Halffter, G." pageId="2" pageNumber="133" pagination="17 - 55" refId="ref4802" refString="Zunino, M., Halffter, G., 2007. The association of Onthophagus Latreille, 1802 beetles (Coleoptera: Scarabaeinae) with vertebrate burrows and caves. Elytron 2, 17 - 55." type="journal article" year="2007">Zunino and Halffter, 2007</bibRefCitation>
).
</paragraph>
<paragraph id="BA6836F7D87AFFEDFCA5F8EEFF44B0C5" blockId="2.[833,1504,1156,1985]" lastBlockId="3.[85,756,152,199]" lastPageId="3" lastPageNumber="134" pageId="2" pageNumber="133">
This new species shows adaptations to living in an environment devoid of light, like the subterranean gopher nest. First, the dorsal eye area is very small. Second, the aforementioned rugose area at the base of the head is a stridulation mechanism, similar to those found at the base of the head of
<taxonomicName id="7DD74D74D87AFFECFB6CF89CFB2AB78A" authorityName="Westwood" authorityYear="1842" box="[1160,1227,1908,1928]" class="Insecta" family="Scarabaeidae" genus="Uroxys" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="genus">
<emphasis id="88A3EAE5D87AFFECFB6CF89CFB2AB78A" box="[1160,1227,1908,1928]" italics="true" pageId="2" pageNumber="133">Uroxys</emphasis>
</taxonomicName>
, as found in
<taxonomicName id="7DD74D74D87AFFECFAA9F89CFBEAB7A7" authority="Howden and Young" authorityName="Howden and Young" class="Insecta" family="Scarabaeidae" genus="Uroxys" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="microcularis">
<emphasis id="88A3EAE5D87AFFECFAA9F89CFA01B78A" box="[1357,1504,1908,1928]" italics="true" pageId="2" pageNumber="133">U. microcularis</emphasis>
Howden and Young
</taxonomicName>
,
<taxonomicName id="7DD74D74D87AFFECFBF0F878FB4DB7A7" authority="Bates" authorityName="Bates" authorityYear="1887" box="[1044,1196,1936,1957]" class="Insecta" family="Scarabaeidae" genus="Uroxys" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="micros">
<emphasis id="88A3EAE5D87AFFECFBF0F878FB8EB7A6" box="[1044,1135,1936,1956]" italics="true" pageId="2" pageNumber="133">U. micros</emphasis>
Bates
</taxonomicName>
and
<taxonomicName id="7DD74D74D87AFFECFB39F878FC63B7C3" authority="Howden and Young" authorityName="Howden and Young" class="Insecta" family="Scarabaeidae" genus="Uroxys" kingdom="Animalia" order="Coleoptera" pageId="2" pageNumber="133" phylum="Arthropoda" rank="species" species="platypyga">
<emphasis id="88A3EAE5D87AFFECFB39F878FAB9B7A6" box="[1245,1368,1936,1956]" italics="true" pageId="2" pageNumber="133">U. platypyga</emphasis>
Howden and Young
</taxonomicName>
(
<bibRefCitation id="DE464B06D87AFFECFC6BF845FB21B7C2" author="Delgado, L. &amp; Kohlmann, B." box="[911,1216,1965,1984]" pageId="2" pageNumber="133" pagination="1 - 36" refId="ref4339" refString="Delgado, L., Kohlmann, B., 2007. Revision de lase species del genero Uroxys Westwood de Mexico y Guatemala (Coleoptera: Scarabaeidae: Scarabaeinae). Folia Entomol. Mex. 46, 1 - 36." type="journal article" year="2007">Delgado and Kohlmann, 2007</bibRefCitation>
;
<bibRefCitation id="DE464B06D87AFFECFB2EF845FA33B7C2" author="Solis, A. &amp; Kohlmann, B." box="[1226,1490,1965,1984]" pageId="2" pageNumber="133" pagination="289 - 340" refId="ref4721" refString="Solis, A., Kohlmann, B., 2013. El genero Uroxys (Coleoptera: Scarabaeidae) en Costa Rica. G. It. Ent. 13, 289 - 340." type="journal article" year="2013">Solís and Kohlmann, 2013</bibRefCitation>
), and most probably helps in the communication process of this species.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,166 @@
<document id="CC46DF1E4A99BFABEEB09C3EA6AA58D4" ID-DOI="10.1016/j.rbe.2018.01.002" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722640665602" checkinUser="felipe" docAuthor="Kohlmann, Bert &amp; Vaz-de-Mello, Fernando Z." docDate="2018" docId="327E87E1D87BFFEDFFB1FED9FD66B338" docLanguage="en" docName="RevBrasEntomol.62.2.131-134.pdf" docOrigin="Revista Brasileira de Entomologia 62 (2)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.01.002" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Ateuchus guatemalensis 1887" docType="treatment" docVersion="1" lastPageNumber="134" masterDocId="CE47FF99D878FFEEFFE4FFE8FFE1B002" masterDocTitle="A new key for the species of Ateuchus Weber (Coleoptera: Scarabaeidae: Scarabaeinae) occurring in Mexico, with a description of the first North American inquiline species from a rodent burrow (Rodentia: Geomydae) and new distribution records" masterLastPageNumber="134" masterPageNumber="131" pageNumber="134" updateTime="1722684135551" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="470B3B6C0F2D71E44E88D93C1B2D3665" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="A8A613FE83C7D046B6BD3653127BB048">
<mods:title id="4C52C097FDB0439F8BF9E4D5279E6C61">A new key for the species of Ateuchus Weber (Coleoptera: Scarabaeidae: Scarabaeinae) occurring in Mexico, with a description of the first North American inquiline species from a rodent burrow (Rodentia: Geomydae) and new distribution records</mods:title>
</mods:titleInfo>
<mods:name id="E3BD86AB5DC87AD9F15CBD0AD72CD84B" type="personal">
<mods:role id="2AAD2A95BF351DA4A12DB19DFA1192F8">
<mods:roleTerm id="4167B5A77E0284F7F3F6DD63834804EA">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="F63FE7F4734B63555181E71B564A76C0">Kohlmann, Bert</mods:namePart>
<mods:affiliation id="3ECD000A96CACC2783629DD742338ECB">EARTH University, San José, Costa Rica</mods:affiliation>
</mods:name>
<mods:name id="E1A6DDFE9008F685E5058035EBE39FE6" type="personal">
<mods:role id="D9AF0A7523696D47396D5795B7929CDB">
<mods:roleTerm id="4C46D595D1DF1B4403202FED90A9D4E7">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="03F695077406C80196E1BBF7C4D5D753">Vaz-de-Mello, Fernando Z.</mods:namePart>
<mods:affiliation id="415E037813DE2644C63DA4CA0599FD19">Universidade Federal de Mato Grosso, Instituto de Biociências, Departamento de Biologia e Zoologia, Cuiabá, MT, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="5C89E739CA7A8B54EB115B2609E9210D">text</mods:typeOfResource>
<mods:relatedItem id="20DF70FAF150C2C8517CBFFB37810010" type="host">
<mods:titleInfo id="066536B388FF383679F060F6320B9430">
<mods:title id="6B054A3951BFDD2D716015272C477ED1">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="B6FAAE1BB3C8C73F89A17CF45DC23F2F">
<mods:date id="E7B656BB40617F06109047FB0DD583DD">2018</mods:date>
<mods:detail id="54C9F8CA467A5E7440942AA53AF75F18" type="pubDate">
<mods:number id="A2A62188AFE329CD89881C6303A18708">2018-02-13</mods:number>
</mods:detail>
<mods:detail id="BF4D78851E9244207D21CF039C3B1442" type="volume">
<mods:number id="753A95B60B997D241E614E7BCBE76233">62</mods:number>
</mods:detail>
<mods:detail id="991F8A1E7B9F7BC00FAC6020A023CE41" type="issue">
<mods:number id="17391465B71535B01F8F8731457A13C6">2</mods:number>
</mods:detail>
<mods:extent id="2D667E0E5670BA07004A8C0CB9DAEC37" unit="page">
<mods:start id="EF334936DD20D1838AAE02A25B3F6C13">131</mods:start>
<mods:end id="C9872A03101A9CF2C8E993DF2BC44E7A">134</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="1BB842302F16671B2A46BD23024B027C">
<mods:url id="2417386139EC54F2ACFF5006C553D685">http://dx.doi.org/10.1016/j.rbe.2018.01.002</mods:url>
</mods:location>
<mods:classification id="6E4E901F75A87BF97FA33C013BA60F76">journal article</mods:classification>
<mods:identifier id="AA189AB7773E2C2B97BC12B9F4FA1249" type="DOI">10.1016/j.rbe.2018.01.002</mods:identifier>
<mods:identifier id="512C745B13FEE7C6FFA246F94AB0085F" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="327E87E1D87BFFEDFFB1FED9FD66B338" LSID="urn:lsid:plazi:treatment:327E87E1D87BFFEDFFB1FED9FD66B338" httpUri="http://treatment.plazi.org/id/327E87E1D87BFFEDFFB1FED9FD66B338" lastPageNumber="134" pageId="3" pageNumber="134">
<subSubSection id="F2CD657CD87BFFEDFFB1FED9FD46B179" pageId="3" pageNumber="134" type="nomenclature">
<paragraph id="BA6836F7D87BFFEDFFB1FED9FE3FB146" blockId="3.[85,757,304,826]" box="[85,478,304,324]" pageId="3" pageNumber="134">
<heading id="E120819BD87BFFEDFFB1FED9FE3FB146" bold="true" box="[85,478,304,324]" fontSize="8" level="2" pageId="3" pageNumber="134" reason="2">
<taxonomicName id="7DD74D74D87BFFEDFFB1FED9FE3FB146" ID-CoL="7ZLXZ" authority="(Bates), 1887" authorityName="" authorityYear="1887" baseAuthorityName="Bates" baseAuthorityYear="1887" box="[85,478,304,324]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="3" pageNumber="134" phylum="Arthropoda" rank="species" species="guatemalensis">
<emphasis id="88A3EAE5D87BFFEDFFB1FED9FE3FB146" bold="true" box="[85,478,304,324]" pageId="3" pageNumber="134">
<emphasis id="88A3EAE5D87BFFEDFFB1FED9FEB0B146" bold="true" box="[85,337,305,324]" italics="true" pageId="3" pageNumber="134">Ateuchus guatemalensis</emphasis>
(Bates), 1887
</emphasis>
</taxonomicName>
</heading>
</paragraph>
<paragraph id="BA6836F7D87BFFEDFFB1FEA5FD46B179" blockId="3.[85,757,304,826]" pageId="3" pageNumber="134">
This species has been recorded from Chiapas,
<collectingCountry id="C2C07667D87BFFEDFDC6FEA5FD71B162" box="[546,656,333,352]" name="Guatemala" pageId="3" pageNumber="134">Guatemala</collectingCountry>
and
<collectingCountry id="C2C07667D87BFFEDFD24FEA5FF71B179" name="Honduras" pageId="3" pageNumber="134">Honduras</collectingCountry>
. It is here recorded for the first time from
<collectingCountry id="C2C07667D87BFFEDFDDEFE80FD43B179" box="[570,674,360,379]" name="Nicaragua" pageId="3" pageNumber="134">Nicaragua</collectingCountry>
.
</paragraph>
</subSubSection>
<subSubSection id="F2CD657CD87BFFEDFFB1FE6CFDFDB1E9" pageId="3" pageNumber="134" type="description">
<paragraph id="BA6836F7D87BFFEDFFB1FE6CFDFDB1E9" blockId="3.[85,757,304,826]" pageId="3" pageNumber="134">
<materialsCitation id="0ABF3CAAD87BFFEDFFB1FE6CFD4DB1D2" collectingDate="2001-04-30" collectionCode="CEMT" collectorName="J. Sunyer &amp; B. Hernandez" country="Nicaragua" county="Cerro Kilambe" elevation="1200" location="Las Torres" municipality="Camp" pageId="3" pageNumber="134" specimenCount="5" stateProvince="Jinotega">
<collectingCountry id="C2C07667D87BFFEDFFB1FE6CFF21B195" box="[85,192,388,407]" name="Nicaragua" pageId="3" pageNumber="134">Nicaragua</collectingCountry>
:
<collectingRegion id="7813F815D87BFFEDFF3CFE6CFED1B195" box="[216,304,388,407]" country="Nicaragua" name="Jinotega" pageId="3" pageNumber="134">Jinotega</collectingRegion>
:
<collectingCounty id="53094E7BD87BFFEDFEACFE6CFE0BB195" box="[328,490,388,407]" pageId="3" pageNumber="134">Cerro Kilambe</collectingCounty>
,
<collectingMunicipality id="5A0CAC8DD87BFFEDFDE6FE6CFDDDB195" box="[514,572,388,407]" pageId="3" pageNumber="134">Camp</collectingMunicipality>
5,
<location id="BF08602CD87BFFEDFD9DFE6DFD11B19A" LSID="urn:lsid:plazi:treatment:327E87E1D87BFFEDFFB1FED9FD66B338:BF08602CD87BFFEDFD9DFE6DFD11B19A" box="[633,752,389,408]" country="Nicaragua" county="Cerro Kilambe" municipality="Camp" name="Las Torres" pageId="3" pageNumber="134" stateProvince="Jinotega">Las Torres</location>
, UTM16P15002830639500,
<quantity id="7D2F9B12D87BFFEDFE7AFE48FE0AB1B6" box="[414,491,416,436]" metricMagnitude="3" metricUnit="m" metricValue="1.2" pageId="3" pageNumber="134" unit="m" value="1200.0">
<elevation id="31FAD1C4D87BFFEDFE7AFE48FE0AB1B6" box="[414,491,416,436]" metricMagnitude="3" metricUnit="m" metricValue="1.2" pageId="3" pageNumber="134" unit="m" value="1200.0">1200 m</elevation>
</quantity>
, 23/
<date id="CE691037D87BFFEDFDC7FE48FD7BB1B1" box="[547,666,416,435]" pageId="3" pageNumber="134" value="2001-04-30">
<collectingDate id="DE2DE9DFD87BFFEDFDC7FE48FD7BB1B1" box="[547,666,416,435]" pageId="3" pageNumber="134" value="2001-04-30">30-IV-2001</collectingDate>
</date>
, col.
<collectorName id="17225321D87BFFEDFD0CFE49FF7DB1CD" pageId="3" pageNumber="134">J. Sunyer</collectorName>
y
<collectorName id="17225321D87BFFEDFF57FE55FED8B1CD" box="[179,313,444,464]" pageId="3" pageNumber="134">B. Hernández</collectorName>
(
<specimenCount id="ACD1FD7ED87BFFEDFEA3FE54FE25B1CD" box="[327,452,444,463]" count="5" pageId="3" pageNumber="134" type="generic">5 specimens</specimenCount>
at
<collectionCode id="DCC6AE32D87BFFEDFE06FE54FDC2B1CD" box="[482,547,444,463]" pageId="3" pageNumber="134">CEMT</collectionCode>
);
<collectingRegion id="7813F815D87BFFEDFDD6FE55FD65B1D2" box="[562,644,445,464]" country="Nicaragua" name="Masaya" pageId="3" pageNumber="134">Masaya</collectingRegion>
: Las
</materialsCitation>
<materialsCitation id="0ABF3CAAD87BFFEDFD56FE54FDF9B1E9" collectingDate="1998-07" collectionCode="CEMT" collectorName="J. Tellez" country="Indonesia" location="Flores" pageId="3" pageNumber="134" specimenCount="1">
<collectingCountry id="C2C07667D87BFFEDFD56FE54FD10B1CD" box="[690,753,444,463]" name="Indonesia" pageId="3" pageNumber="134">Flores</collectingCountry>
,
<date id="CE691037D87BFFEDFFB1FE30FF52B1E9" box="[85,179,472,491]" bridgedPair="-" pageId="3" pageNumber="134" value="1998-07">
<collectingDate id="DE2DE9DFD87BFFEDFFB1FE30FF52B1E9" box="[85,179,472,491]" bridgedPair="-" pageId="3" pageNumber="134" value="1998-07">VII1998</collectingDate>
</date>
, col.
<collectorName id="17225321D87BFFEDFF01FE30FED3B1E9" box="[229,306,472,491]" pageId="3" pageNumber="134">J. Téllez</collectorName>
(
<specimenCount id="ACD1FD7ED87BFFEDFEA6FE30FE52B1E9" box="[322,435,472,491]" count="1" pageId="3" pageNumber="134" type="generic">1 specimen</specimenCount>
at
<collectionCode id="DCC6AE32D87BFFEDFE36FE30FDF3B1E9" box="[466,530,472,491]" pageId="3" pageNumber="134">CEMT</collectionCode>
)
</materialsCitation>
.
</paragraph>
</subSubSection>
<subSubSection id="F2CD657CD87BFFEDFFB1FE1CFF7AB23D" pageId="3" pageNumber="134" type="reference_group">
<paragraph id="BA6836F7D87BFFEDFFB1FE1CFF46B221" blockId="3.[85,757,304,826]" pageId="3" pageNumber="134">
<taxonomicName id="7DD74D74D87BFFEDFFB1FE1CFE30B205" ID-CoL="7ZLY8" authority="(Balthasar, 1939)" authorityName="Kohlmann &amp; Vaz-de-Mello" authorityYear="2018" baseAuthorityName="Balthasar" baseAuthorityYear="1939" box="[85,465,500,519]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="3" pageNumber="134" phylum="Arthropoda" rank="species" species="hornai" status="comb. nov.">
<emphasis id="88A3EAE5D87BFFEDFFB1FE1CFEEBB205" bold="true" box="[85,266,500,519]" italics="true" pageId="3" pageNumber="134">Ateuchus hornai</emphasis>
(
<bibRefCitation id="DE464B06D87BFFEDFEC6FE1CFE29B205" author="Balthasar, V." box="[290,456,500,519]" pageId="3" pageNumber="134" pagination="44 - 66" refId="ref4261" refString="Balthasar, V., 1939. Neue Choeridium - Arten (Ins Col.). Senckenbergiana 21, 44 - 66." type="journal article" year="1939">Balthasar, 1939</bibRefCitation>
)
</taxonomicName>
,
<emphasis id="88A3EAE5D87BFFEDFE01FE1CFD4AB205" bold="true" box="[485,683,500,519]" pageId="3" pageNumber="134">
<taxonomicNameLabel id="9390579ED87BFFEDFE01FE1CFD4AB205" box="[485,683,500,519]" pageId="3" pageNumber="134" rank="species">new combination</taxonomicNameLabel>
</emphasis>
(valid species)
</paragraph>
<paragraph id="BA6836F7D87BFFEDFFB1FDC4FF7AB23D" blockId="3.[85,757,304,826]" box="[85,155,556,575]" pageId="3" pageNumber="134">
(
<figureCitation id="22EC2A72D87BFFEDFFB9FDC4FF72B23D" box="[93,147,556,575]" captionStart="Figures 45" captionStartId="2.[833,896,1056,1070]" captionTargetBox="[867,1471,150,1024]" captionTargetId="figure-619@2.[864,1472,149,1026]" captionTargetPageId="2" captionText="Figures 45. A. tuza sp. nov.; 4, drawing of the internal sac, line equals 1 mm; 5, A. hornai (Balthasar, 1939), dorsal habitus of the female holotype." pageId="3" pageNumber="134">Fig. 5</figureCitation>
)
</paragraph>
</subSubSection>
<subSubSection id="F2CD657CD87BFFEDFFB1FDA0FD66B338" pageId="3" pageNumber="134" type="description">
<paragraph id="BA6836F7D87BFFEDFFB1FDA0FD66B338" blockId="3.[85,757,304,826]" pageId="3" pageNumber="134">
This species was previously considered a synonym of
<taxonomicName id="7DD74D74D87BFFEDFD6CFDAFFD15B259" baseAuthorityName="Harold" baseAuthorityYear="1868" box="[648,756,583,603]" class="Insecta" family="Scarabaeidae" genus="Ateuchus" kingdom="Animalia" order="Coleoptera" pageId="3" pageNumber="134" phylum="Arthropoda" rank="species" species="illaesum">
<emphasis id="88A3EAE5D87BFFEDFD6CFDAFFD15B259" box="[648,756,583,603]" italics="true" pageId="3" pageNumber="134">A. illaesum</emphasis>
</taxonomicName>
based on the original description, since the
<typeStatus id="656C8855D87BFFEDFDECFD8BFD83B274" box="[520,610,611,630]" pageId="3" pageNumber="134" type="holotype">holotype</typeStatus>
was not available for study at the time (
<bibRefCitation id="DE464B06D87BFFEDFEBCFD97FE1CB291" author="Kohlmann, B." box="[344,509,639,659]" pageId="3" pageNumber="134" pagination="3 - 81" refId="ref4450" refString="Kohlmann, B., 1984. Biosistematica de las especies norteamericanas del genero Ateuchus (Coleoptera: Scarabaeidae: Scarabaeinae). Folia Entomol. Mex. 60, 3 - 81." type="journal article" year="1984">Kohlmann, 1984</bibRefCitation>
). The examination of the female
<typeStatus id="656C8855D87BFFEDFF45FD73FF1AB2AC" box="[161,251,667,686]" pageId="3" pageNumber="134" type="holotype">holotype</typeStatus>
found in the Natural History Museum in
<collectingRegion id="7813F815D87BFFEDFD4DFD74FD11B2AD" box="[681,752,668,687]" country="Czech Republic" name="Praha" pageId="3" pageNumber="134">Prague</collectingRegion>
,
<collectingCountry id="C2C07667D87BFFEDFFB1FD5FFF0DB2C8" box="[85,236,695,714]" name="Czech Republic" pageId="3" pageNumber="134">Czech Republic</collectingCountry>
(
<bibRefCitation id="DE464B06D87BFFEDFF1CFD5FFE05B2C8" author="Bezdek, A. &amp; Hajek, J." box="[248,484,695,714]" pageId="3" pageNumber="134" pagination="349 - 378" refId="ref4285" refString="Bezdek, A., Hajek, J., 2011. Catalogue of type specimens of beetles (Coleoptera) deposited in the National Museum, Prague Czech Republic: Scarabaeidae: Scarabaeinae: Ateuchini and Canthonini. Acta Ent. Mus. Nat. Prag. 51, 349 - 378." type="journal article" year="2011">Bezdek and Hajek, 2011</bibRefCitation>
), allowed us to consider it a valid species, distinguishable by the characters in the key presented herein. We suspect the type locality (Necaxa,
<collectingRegion id="7813F815D87BFFEDFDF9FD07FD82B300" box="[541,611,751,770]" country="Mexico" name="Puebla" pageId="3" pageNumber="134">Puebla</collectingRegion>
,
<collectingCountry id="C2C07667D87BFFEDFD8FFD07FD56B300" box="[619,695,751,770]" name="Mexico" pageId="3" pageNumber="134">México</collectingCountry>
) to be wrong, and we hope that a male will be collected in order to prepare a more thorough description of this interesting species.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,507 @@
<document id="CE752FBA39EB672681066E40BA99989C" ID-DOI="10.1016/j.rbe.2018.08.004" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722639927852" checkinUser="felipe" docAuthor="Araújo, Maíra Xavier, Aragão, Marcos, Cordeiro, Danilo, Bravo, Freddy, Carvalho, Claudio José Barros de &amp; Andena, Sergio R." docDate="2018" docId="372C8782FFF0FFCBFC81FB316C4CF997" docLanguage="en" docName="RevBrasEntomol.62.4.283-287.pdf" docOrigin="Revista Brasileira de Entomologia 62 (4)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.08.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Trichomyia pseudoannae Araujo &amp; Bravo 2018, sp. nov." docType="treatment" docVersion="1" lastPageNumber="285" masterDocId="CB15FFFAFFF1FFC9FFC5FFD96805FFC2" masterDocTitle="Male and female association in Trichomyia Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil" masterLastPageNumber="287" masterPageNumber="283" pageNumber="284" updateTime="1722683598029" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="F58155F369971E2E12D9DD1F494C7F2F" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="57B4A9F5429B54B72D8752AAA09CA1ED">
<mods:title id="A749EECE787F9DD7E9D240E1F7DA38F5">Male and female association in Trichomyia Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil</mods:title>
</mods:titleInfo>
<mods:name id="9D543B51B3524D49BE0306015019E50A" type="personal">
<mods:role id="7E18DCCEEE8257D50140831FA105B9D4">
<mods:roleTerm id="E176AFF2ABCAA0474366C84CDB8D0D4E">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="E543B647B153366FEA44593E89BB2F64">Araújo, Maíra Xavier</mods:namePart>
<mods:affiliation id="179E51FC0C7682E7F17624CCB924B637">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="57895CD71CB7378A5E4F88C74BC17C88" type="personal">
<mods:role id="A26D42877CD821EEF582A2FBC12EC930">
<mods:roleTerm id="454861B7BA33AA4A047ABF5C089357C3">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="309E3A8CECB2DE7F9C9CEAB7F1B423AD">Aragão, Marcos</mods:namePart>
<mods:affiliation id="3E815C816C0C665372D9905D61F3E867">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="124398BE1127A300B24F90A7883942A4" type="personal">
<mods:role id="D999B963ACBE899A74DA6D47E9173F8A">
<mods:roleTerm id="9F4FE15E9EB77D1440DEFFCC4295F04E">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="0FDCC3CEC3C289C3DFA2ADC2F57849DB">Cordeiro, Danilo</mods:namePart>
<mods:affiliation id="885A15004123E9AD1C063554D7FB3146">Instituto Nacional de Pesquisa da Amazônia, Coordenação de Biodiversidade, Manaus, AM, Brazil</mods:affiliation>
</mods:name>
<mods:name id="08CDF29210CEA61C7D72FC6914491747" type="personal">
<mods:role id="2AB0834392348026DF43438FFB23EDF4">
<mods:roleTerm id="8D31BA75CE65072BD910BD3C81939570">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="409FFE7F9065E9814899D12876931554">Bravo, Freddy</mods:namePart>
<mods:affiliation id="9AE36C37ECDB18CAF22E42D55BF319FC">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="87119567567550AB18E20988340F3609" type="personal">
<mods:role id="D26AE30FE6B0EBDE23DFE74083F959B3">
<mods:roleTerm id="315D379F14D5B8DCE2A2B3724033CAC9">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="B754089AAF5BAC9BC6065D955830A975">Carvalho, Claudio José Barros de</mods:namePart>
<mods:affiliation id="446AEA418E05E70A705762CF1B21B71F">Universidade Federal do Paraná, Departamento de Zoologia, Programa de Pós-graduação em Entomologia, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:name id="FC53733D1D6E7A6352D1D13DBEC9A606" type="personal">
<mods:role id="320C716196CBCB6CAB57FAB4E766B178">
<mods:roleTerm id="5423A40171262E371933A7F02DE79FA6">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="4DAB93785B5398162C2DF49447F6978E">Andena, Sergio R.</mods:namePart>
<mods:affiliation id="802CA8D6D85BDCB5C561FB66A3946682">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="F3275BCE6A32F1A5DD7B21AFFE50EA24">text</mods:typeOfResource>
<mods:relatedItem id="95F2285C10D720B7485D1FB7BE5354FF" type="host">
<mods:titleInfo id="790D00CFC64EE7045A5BDBAC99C7ED0E">
<mods:title id="B43D1C0E8A0A7B79E775CB7A675DB4CA">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="46FC535D80A99D3EF14FD96DC8EE289B">
<mods:date id="A111BDEFA72D575C7CD4B68CBF80DBCB">2018</mods:date>
<mods:detail id="A965DC0E9B0EDC6B74AC1D161E28494A" type="pubDate">
<mods:number id="09646EA202C07A39320FC4923F9C9DE6">2018-09-05</mods:number>
</mods:detail>
<mods:detail id="3B7C0B6234A6EAAB4189B047585C9AD2" type="volume">
<mods:number id="5B9498FBD470F4493DBA102D3DD1F08B">62</mods:number>
</mods:detail>
<mods:detail id="007821ED4170623A2637238A80CD9B84" type="issue">
<mods:number id="75ABD800DA5FD89F6CFF6BE54840DD23">4</mods:number>
</mods:detail>
<mods:extent id="8511B5754D98EF93113D05F66F1464FB" unit="page">
<mods:start id="A05FE46666D14C3C823B2DC006801F4A">283</mods:start>
<mods:end id="A248F7FF0DBC24B0B1CFCA028446E726">287</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="8FD80E74733EB8AEB19A5A9892AE0BE4">
<mods:url id="BA6D25DCBD09CE5072D8CC94AE3132A2">http://dx.doi.org/10.1016/j.rbe.2018.08.004</mods:url>
</mods:location>
<mods:classification id="633E496AD9C92F4BC4BD861A7B219DFD">journal article</mods:classification>
<mods:identifier id="896CBF9A8A46785E7977733F03C94F64" type="DOI">10.1016/j.rbe.2018.08.004</mods:identifier>
<mods:identifier id="DC020D4E161549FCAE62FC84DDC8C685" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="372C8782FFF0FFCBFC81FB316C4CF997" LSID="urn:lsid:plazi:treatment:372C8782FFF0FFCBFC81FB316C4CF997" httpUri="http://treatment.plazi.org/id/372C8782FFF0FFCBFC81FB316C4CF997" lastPageId="2" lastPageNumber="285" pageId="1" pageNumber="284">
<subSubSection id="F79F651FFFF0FFC8FC81FB316D2CFB3E" box="[836,1321,1256,1276]" pageId="1" pageNumber="284" type="nomenclature">
<paragraph id="BF3A3694FFF0FFC8FC81FB316D2CFB3E" blockId="1.[836,1321,1256,1276]" box="[836,1321,1256,1276]" pageId="1" pageNumber="284">
<heading id="E47281F8FFF0FFC8FC81FB316D2CFB3E" box="[836,1321,1256,1276]" fontSize="8" level="2" pageId="1" pageNumber="284" reason="7">
<taxonomicName id="78854D17FFF0FFC8FC81FB316CD0FB3E" ID-CoL="9HKNY" authority="Araujo &amp; Bravo" authorityName="Araujo &amp; Bravo" authorityYear="2018" box="[836,1237,1256,1276]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="284" phylum="Arthropoda" rank="species" species="pseudoannae" status="sp. nov.">
<emphasis id="8DF1EA86FFF0FFC8FC81FB316C32FB3E" box="[836,1079,1256,1276]" italics="true" pageId="1" pageNumber="284">Trichomyia pseudoannae</emphasis>
Araújo &amp; Bravo
</taxonomicName>
<taxonomicNameLabel id="96C257FDFFF0FFC8FB1EFB306D2CFB3E" box="[1243,1321,1257,1276]" pageId="1" pageNumber="284" rank="species">sp. nov.</taxonomicNameLabel>
</heading>
</paragraph>
</subSubSection>
<paragraph id="BF3A3694FFF0FFC8FFA0FADF6ADAFABE" pageId="1" pageNumber="284">
<table id="CD85C434FFF00036FFA0FADA6AE1FABE" box="[101,740,1283,1404]" gridcols="3" gridrows="5" pageId="1" pageNumber="284">
<tr id="01B534D6FFF00036FFA0FADA6AE1FAD6" box="[101,740,1283,1300]" gridrow="0" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0FADA68B7FAD6" box="[101,178,1283,1300]" gridcol="0" gridrow="0" pageId="1" pageNumber="284">Primer</th>
<th id="42645DAAFFF00036FF2FFADA6A0BFAD6" box="[234,526,1283,1300]" gridcol="1" gridrow="0" pageId="1" pageNumber="284">Sequence (5l → 3l)</th>
<th id="42645DAAFFF00036FD80FADA6AE1FAD6" box="[581,740,1283,1300]" gridcol="2" gridrow="0" pageId="1" pageNumber="284">References</th>
</tr>
<tr id="01B534D6FFF00036FFA0FAF06AE1FAF5" box="[101,740,1321,1335]" gridrow="1" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0FAF068B7FAF5" box="[101,178,1321,1335]" gridcol="0" gridrow="1" pageId="1" pageNumber="284">LCO1490</th>
<td id="42645DAAFFF00036FF2FFAF06A0BFAF5" box="[234,526,1321,1335]" gridcol="1" gridrow="1" pageId="1" pageNumber="284">GGTCAACAAATCATAAAGATATTGG</td>
<td id="42645DAAFFF00036FD80FAF06AE1FAF5" box="[581,740,1321,1335]" gridcol="2" gridrow="1" pageId="1" pageNumber="284">
<bibRefCitation id="DB144B65FFF0FFC8FD80FAF06AE1FAF5" author="Folmer, O. &amp; Black, M. &amp; Hoeh, W. &amp; Lutz, R. &amp; Vrijenhoek, R." box="[581,740,1321,1335]" pageId="1" pageNumber="284" pagination="294 - 299" refId="ref4042" refString="Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294 - 299." type="journal article" year="1994">Folmer et al. (1994)</bibRefCitation>
</td>
</tr>
<tr id="01B534D6FFF00036FFA0FA996AE1FA8C" box="[101,740,1344,1358]" gridrow="2" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0FA9968B7FA8C" box="[101,178,1344,1358]" gridcol="0" gridrow="2" pageId="1" pageNumber="284">HCO2198</th>
<td id="42645DAAFFF00036FF2FFA996A0BFA8C" box="[234,526,1344,1358]" gridcol="1" gridrow="2" pageId="1" pageNumber="284">TAAACTTCAGGGTGACCAAAAAATCA</td>
<td id="42645DAAFFF00036FD80FA996AE1FA8C" box="[581,740,1344,1358]" gridcol="2" gridrow="2" pageId="1" pageNumber="284">
<bibRefCitation id="DB144B65FFF0FFC8FD80FA996AE1FA8C" author="Folmer, O. &amp; Black, M. &amp; Hoeh, W. &amp; Lutz, R. &amp; Vrijenhoek, R." box="[581,740,1344,1358]" pageId="1" pageNumber="284" pagination="294 - 299" refId="ref4042" refString="Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294 - 299." type="journal article" year="1994">Folmer et al. (1994)</bibRefCitation>
</td>
</tr>
<tr id="01B534D6FFF00036FFA0FA8E6AE1FAA7" box="[101,740,1367,1381]" gridrow="3" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0FA8E68B7FAA7" box="[101,178,1367,1381]" gridcol="0" gridrow="3" pageId="1" pageNumber="284">MtD6</th>
<td id="42645DAAFFF00036FF2FFA8E6A0BFAA7" box="[234,526,1367,1381]" gridcol="1" gridrow="3" pageId="1" pageNumber="284">GGAGGATTTGGAAATTGATTAGTTCC</td>
<td id="42645DAAFFF00036FD80FA8E6AE1FAA7" box="[581,740,1367,1381]" gridcol="2" gridrow="3" pageId="1" pageNumber="284">
<bibRefCitation id="DB144B65FFF0FFC8FD80FA8E6ADAFAA7" author="Simon, C. &amp; Frati, F. &amp; Becknbach, A. &amp; Crespi, B. &amp; Liu, H. &amp; Flook, P." box="[581,735,1367,1381]" pageId="1" pageNumber="284" pagination="651 - 701" refId="ref4866" refString="Simon, C., Frati, F., Becknbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87, 651 - 701." type="journal article" year="1994">Simon et al. (1994)</bibRefCitation>
</td>
</tr>
<tr id="01B534D6FFF00036FFA0FAB76AE1FABE" box="[101,740,1390,1404]" gridrow="4" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0FAB768B7FABE" box="[101,178,1390,1404]" gridcol="0" gridrow="4" pageId="1" pageNumber="284">MtD9</th>
<td id="42645DAAFFF00036FF2FFAB76A0BFABE" box="[234,526,1390,1404]" gridcol="1" gridrow="4" pageId="1" pageNumber="284">CCCGGTAAAATTAAAATATAAACTTC</td>
<td id="42645DAAFFF00036FD80FAB76AE1FABE" box="[581,740,1390,1404]" gridcol="2" gridrow="4" pageId="1" pageNumber="284">
<bibRefCitation id="DB144B65FFF0FFC8FD80FAB76ADAFABE" author="Simon, C. &amp; Frati, F. &amp; Becknbach, A. &amp; Crespi, B. &amp; Liu, H. &amp; Flook, P." box="[581,735,1390,1404]" pageId="1" pageNumber="284" pagination="651 - 701" refId="ref4866" refString="Simon, C., Frati, F., Becknbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87, 651 - 701." type="journal article" year="1994">Simon et al. (1994)</bibRefCitation>
</td>
</tr>
</table>
</paragraph>
<subSubSection id="F79F651FFFF0FFCBFC81FADC6C4CF997" lastPageId="2" lastPageNumber="285" pageId="1" pageNumber="284" type="description">
<paragraph id="BF3A3694FFF0FFC8FC81FADC6C2DFADA" blockId="1.[804,1475,1285,1416]" box="[836,1064,1285,1304]" pageId="1" pageNumber="284">
(
<figureCitation id="27BE2A11FFF0FFC8FC89FADC6B99FADA" box="[844,924,1285,1304]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="1" pageNumber="284">Figs. 1.1</figureCitation>
9 and 2.13)
</paragraph>
<paragraph id="BF3A3694FFF0FFCBFC81FAF86A00F907" blockId="1.[804,1475,1285,1416]" lastBlockId="2.[114,785,1686,1984]" lastPageId="2" lastPageNumber="285" pageId="1" pageNumber="284">Diagnosis.Head with one row of supraocular alveoli and one row of occipital alveoli. Palpus with three segments. Male terminalia with hypandrium fused to gonocoxites and expanded posteriorly as a apically slightly bifucate plate covering the aedeagus, gonocoxite with two pairs of arms.Female with the subgenital plate trapezoidal and bifurcated apically, cerci elongated.</paragraph>
<caption id="EBFA661CFFF0FFC8FF90FA6C6892FA32" pageId="1" pageNumber="284" startId="1.[85,131,1461,1475]" targetType="table">
<paragraph id="BF3A3694FFF0FFC8FF90FA6C6894FA01" blockId="1.[85,1474,1461,1520]" box="[85,145,1461,1475]" pageId="1" pageNumber="284">
<emphasis id="8DF1EA86FFF0FFC8FF90FA6C6894FA01" bold="true" box="[85,145,1461,1475]" pageId="1" pageNumber="284">Table 2</emphasis>
</paragraph>
<paragraph id="BF3A3694FFF0FFC8FF90FA126892FA32" blockId="1.[85,1474,1461,1520]" pageId="1" pageNumber="284">Specimens analyzed in this work, including the species names; BR, Brazil; gender (M, male; F, female); code, primer, pair base sequence, GenBank accession numbers and locality.</paragraph>
</caption>
<paragraph id="BF3A3694FFF0FFC8FFA0F9D06C1AF853" pageId="1" pageNumber="284">
<table id="CD85C434FFF00036FFA0F9D06D9CF853" box="[101,1433,1545,1937]" gridcols="7" gridrows="17" pageId="1" pageNumber="284">
<tr id="01B534D6FFF00036FFA0F9D06D9CF9D5" box="[101,1433,1545,1559]" gridrow="0" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0F9D06924F9D5" box="[101,289,1545,1559]" gridcol="0" gridrow="0" pageId="1" pageNumber="284">Species</th>
<th id="42645DAAFFF00036FEFDF9D06971F9D5" box="[312,372,1545,1559]" gridcol="1" gridrow="0" pageId="1" pageNumber="284">Gender</th>
<th id="42645DAAFFF00036FE4DF9D06A00F9D5" box="[392,517,1545,1559]" gridcol="2" gridrow="0" pageId="1" pageNumber="284">DNA extraction</th>
<th id="42645DAAFFF00036FDD9F9D06A7CF9D5" box="[540,633,1545,1559]" gridcol="3" gridrow="0" pageId="1" pageNumber="284">Primer</th>
<th id="42645DAAFFF00036FD48F9D06ADFF9D5" box="[653,730,1545,1559]" gridcol="4" gridrow="0" pageId="1" pageNumber="284">Sequence</th>
<th id="42645DAAFFF00036FCC4F9D06B9EF9D5" box="[769,923,1545,1559]" gridcol="5" gridrow="0" pageId="1" pageNumber="284">GenBank accession</th>
<th id="42645DAAFFF00036FC70F9D06D9CF9D5" box="[949,1433,1545,1559]" gridcol="6" gridrow="0" pageId="1" pageNumber="284">Locality</th>
</tr>
<tr id="01B534D6FFF00036FFA0F9F96D9CF9EC" box="[101,1433,1568,1582]" gridrow="1" pageId="1" pageNumber="284" rowspan-0="1" rowspan-1="1" rowspan-3="1" rowspan-6="1">
<td id="42645DAAFFF00036FE4DF9F96A00F9EC" box="[392,517,1568,1582]" gridcol="2" gridrow="1" pageId="1" pageNumber="284">code</td>
<td id="42645DAAFFF00036FD48F9F96ADFF9EC" box="[653,730,1568,1582]" gridcol="4" gridrow="1" pageId="1" pageNumber="284">(pb)</td>
<td id="42645DAAFFF00036FCC4F9F96B9EF9EC" box="[769,923,1568,1582]" gridcol="5" gridrow="1" pageId="1" pageNumber="284">numbers</td>
</tr>
<tr id="01B534D6FFF00036FFA0F99B6D9CF993" box="[101,1433,1602,1617]" gridrow="2" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0F99B6924F993" box="[101,289,1602,1617]" gridcol="0" gridrow="2" pageId="1" pageNumber="284">
<taxonomicName id="78854D17FFF0FFC8FFA0F99B68E9F993" authority="Araujo" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[101,236,1602,1617]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="284" phylum="Arthropoda" rank="species" species="cerdosa">
<emphasis id="8DF1EA86FFF0FFC8FFA0F99B68B7F993" box="[101,178,1602,1617]" italics="true" pageId="1" pageNumber="284">T. cerdosa</emphasis>
Araújo
</taxonomicName>
&amp;
</th>
<td id="42645DAAFFF00036FEFDF99B6971F993" box="[312,372,1602,1617]" gridcol="1" gridrow="2" pageId="1" pageNumber="284">M</td>
<td id="42645DAAFFF00036FE4DF99B6A00F993" box="[392,517,1602,1617]" gridcol="2" gridrow="2" pageId="1" pageNumber="284">T15</td>
<td id="42645DAAFFF00036FDD9F99B6A7CF993" box="[540,633,1602,1617]" gridcol="3" gridrow="2" pageId="1" pageNumber="284">lco/hco</td>
<td id="42645DAAFFF00036FD48F99B6ADFF993" box="[653,730,1602,1617]" gridcol="4" gridrow="2" pageId="1" pageNumber="284">657</td>
<td id="42645DAAFFF00036FCC4F99B6B9EF993" box="[769,923,1602,1617]" gridcol="5" gridrow="2" pageId="1" pageNumber="284">MH042537</td>
<td id="42645DAAFFF00036FC70F99B6D9CF993" box="[949,1433,1602,1617]" gridcol="6" gridrow="2" pageId="1" pageNumber="284">BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada</td>
</tr>
<tr id="01B534D6FFF00036FFA0F9836D9CF9AA" box="[101,1433,1626,1640]" gridrow="3" pageId="1" pageNumber="284" rowspan-1="1" rowspan-2="1" rowspan-3="1" rowspan-4="1" rowspan-5="1">
<th id="42645DAAFFF00036FFA0F9836924F9AA" box="[101,289,1626,1640]" gridcol="0" gridrow="3" pageId="1" pageNumber="284">Bravo, 2016</th>
<td id="42645DAAFFF00036FC70F9836D9CF9AA" box="[949,1433,1626,1640]" gridcol="6" gridrow="3" pageId="1" pageNumber="284">Grande, 15.VI.2013 (light trap), M. Aragão &amp; E. Menezes leg.</td>
</tr>
<tr id="01B534D6FFF00036FFA0F9A96D9CF9BD" box="[101,1433,1648,1663]" gridrow="4" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0F9A96924F9BD" box="[101,289,1648,1663]" gridcol="0" gridrow="4" pageId="1" pageNumber="284">
<taxonomicName id="78854D17FFF0FFC8FFA0F9A968E9F9BD" authority="Araujo" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[101,236,1648,1663]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="284" phylum="Arthropoda" rank="species" species="cerdosa">
<emphasis id="8DF1EA86FFF0FFC8FFA0F9A968B7F9BD" box="[101,178,1648,1663]" italics="true" pageId="1" pageNumber="284">T. cerdosa</emphasis>
Araújo
</taxonomicName>
&amp;
</th>
<td id="42645DAAFFF00036FEFDF9A96971F9BD" box="[312,372,1648,1663]" gridcol="1" gridrow="4" pageId="1" pageNumber="284">M</td>
<td id="42645DAAFFF00036FE4DF9A96A00F9BD" box="[392,517,1648,1663]" gridcol="2" gridrow="4" pageId="1" pageNumber="284">P4</td>
<td id="42645DAAFFF00036FDD9F9A96A7CF9BD" box="[540,633,1648,1663]" gridcol="3" gridrow="4" pageId="1" pageNumber="284">mtd6/mtd9</td>
<td id="42645DAAFFF00036FD48F9A96ADFF9BD" box="[653,730,1648,1663]" gridcol="4" gridrow="4" pageId="1" pageNumber="284">480</td>
<td id="42645DAAFFF00036FCC4F9A96B9EF9BD" box="[769,923,1648,1663]" gridcol="5" gridrow="4" pageId="1" pageNumber="284">MH042535</td>
<td id="42645DAAFFF00036FC70F9A96D9CF9BD" box="[949,1433,1648,1663]" gridcol="6" gridrow="4" pageId="1" pageNumber="284">BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada</td>
</tr>
<tr id="01B534D6FFF00036FFA0F95E6D9CF954" box="[101,1433,1671,1686]" gridrow="5" pageId="1" pageNumber="284" rowspan-1="1" rowspan-2="1" rowspan-3="1" rowspan-4="1" rowspan-5="1">
<th id="42645DAAFFF00036FFA0F95E6924F954" box="[101,289,1671,1686]" gridcol="0" gridrow="5" pageId="1" pageNumber="284">Bravo, 2016</th>
<td id="42645DAAFFF00036FC70F95E6D9CF954" box="[949,1433,1671,1686]" gridcol="6" gridrow="5" pageId="1" pageNumber="284">Grande, 15.VI.2013 (light trap), M. Aragão &amp; E. Menezes leg.</td>
</tr>
<tr id="01B534D6FFF00036FFA0F9476D9CF96F" box="[101,1433,1694,1709]" gridrow="6" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0F9476924F96F" box="[101,289,1694,1709]" gridcol="0" gridrow="6" pageId="1" pageNumber="284">
<taxonomicName id="78854D17FFF0FFC8FFA0F94768DBF96F" authorityName="Araújo &amp; Aragão &amp; Cordeiro &amp; Bravo &amp; Carvalho &amp; Andena" authorityYear="2018" box="[101,222,1694,1709]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="284" phylum="Arthropoda" rank="species" species="pseudoannae" status="sp. nov.">
<emphasis id="8DF1EA86FFF0FFC8FFA0F94768DBF96F" box="[101,222,1694,1709]" italics="true" pageId="1" pageNumber="284">T. pseudoannae</emphasis>
</taxonomicName>
<taxonomicNameLabel id="96C257FDFFF0FFC8FF27F9466924F96F" box="[226,289,1695,1709]" pageId="1" pageNumber="284" rank="species">sp. nov.</taxonomicNameLabel>
</th>
<td id="42645DAAFFF00036FEFDF9476971F96F" box="[312,372,1694,1709]" gridcol="1" gridrow="6" pageId="1" pageNumber="284">M</td>
<td id="42645DAAFFF00036FE4DF9476A00F96F" box="[392,517,1694,1709]" gridcol="2" gridrow="6" pageId="1" pageNumber="284">P28</td>
<td id="42645DAAFFF00036FDD9F9476A7CF96F" box="[540,633,1694,1709]" gridcol="3" gridrow="6" pageId="1" pageNumber="284">lco/hco</td>
<td id="42645DAAFFF00036FD48F9476ADFF96F" box="[653,730,1694,1709]" gridcol="4" gridrow="6" pageId="1" pageNumber="284">468</td>
<td id="42645DAAFFF00036FCC4F9476B9EF96F" box="[769,923,1694,1709]" gridcol="5" gridrow="6" pageId="1" pageNumber="284">MH042538</td>
<td id="42645DAAFFF00036FC70F9476D9CF96F" box="[949,1433,1694,1709]" gridcol="6" gridrow="6" pageId="1" pageNumber="284">BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada</td>
</tr>
<tr id="01B534D6FFF00036FFA0F96C6D9CF901" box="[101,1433,1717,1731]" gridrow="7" pageId="1" pageNumber="284" rowspan-0="1" rowspan-1="1" rowspan-2="1" rowspan-3="1" rowspan-4="1" rowspan-5="1">
<td id="42645DAAFFF00036FC70F96C6D9CF901" box="[949,1433,1717,1731]" gridcol="6" gridrow="7" pageId="1" pageNumber="284">Grande, 18.V.2013 (light trap), M. Aragão &amp; E. Menezes leg.</td>
</tr>
<tr id="01B534D6FFF00036FFA0F9126D9CF918" box="[101,1433,1739,1754]" gridrow="8" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0F9126924F918" box="[101,289,1739,1754]" gridcol="0" gridrow="8" pageId="1" pageNumber="284">
<taxonomicName id="78854D17FFF0FFC8FFA0F9126903F918" authority="Araujo" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[101,262,1739,1754]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="284" phylum="Arthropoda" rank="species" species="ituberensis">
<emphasis id="8DF1EA86FFF0FFC8FFA0F91268C9F918" box="[101,204,1739,1754]" italics="true" pageId="1" pageNumber="284">T. ituberensis</emphasis>
Araújo
</taxonomicName>
&amp;
</th>
<td id="42645DAAFFF00036FEFDF9126971F918" box="[312,372,1739,1754]" gridcol="1" gridrow="8" pageId="1" pageNumber="284">M</td>
<td id="42645DAAFFF00036FE4DF9126A00F918" box="[392,517,1739,1754]" gridcol="2" gridrow="8" pageId="1" pageNumber="284">P21</td>
<td id="42645DAAFFF00036FDD9F9126A7CF918" box="[540,633,1739,1754]" gridcol="3" gridrow="8" pageId="1" pageNumber="284">mtd6/mtd9</td>
<td id="42645DAAFFF00036FD48F9126ADFF918" box="[653,730,1739,1754]" gridcol="4" gridrow="8" pageId="1" pageNumber="284">480</td>
<td id="42645DAAFFF00036FCC4F9126B9EF918" box="[769,923,1739,1754]" gridcol="5" gridrow="8" pageId="1" pageNumber="284">MH042540</td>
<td id="42645DAAFFF00036FC70F9126D9CF918" box="[949,1433,1739,1754]" gridcol="6" gridrow="8" pageId="1" pageNumber="284">BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Vila 5,</td>
</tr>
<tr id="01B534D6FFF00036FFA0F93A6D9CF933" box="[101,1433,1763,1777]" gridrow="9" pageId="1" pageNumber="284" rowspan-1="1" rowspan-2="1" rowspan-3="1" rowspan-4="1" rowspan-5="1">
<th id="42645DAAFFF00036FFA0F93A6924F933" box="[101,289,1763,1777]" gridcol="0" gridrow="9" pageId="1" pageNumber="284">Bravo, 2016</th>
<td id="42645DAAFFF00036FC70F93A6D9CF933" box="[949,1433,1763,1777]" gridcol="6" gridrow="9" pageId="1" pageNumber="284">28.IV19.V.2013 (Malaise), M. Aragão &amp; E. Menezes leg.</td>
</tr>
<tr id="01B534D6FFF00036FFA0F9206D9CF8CA" box="[101,1433,1785,1800]" gridrow="10" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0F9206924F8CA" box="[101,289,1785,1800]" gridcol="0" gridrow="10" pageId="1" pageNumber="284">
<taxonomicName id="78854D17FFF0FFC8FFA0F92068DBF8CA" authorityName="Araújo &amp; Aragão &amp; Cordeiro &amp; Bravo &amp; Carvalho &amp; Andena" authorityYear="2018" box="[101,222,1785,1800]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="284" phylum="Arthropoda" rank="species" species="pseudoannae" status="sp. nov.">
<emphasis id="8DF1EA86FFF0FFC8FFA0F92068DBF8CA" box="[101,222,1785,1800]" italics="true" pageId="1" pageNumber="284">T. pseudoannae</emphasis>
</taxonomicName>
<taxonomicNameLabel id="96C257FDFFF0FFC8FF27F9236924F8CA" box="[226,289,1786,1800]" pageId="1" pageNumber="284" rank="species">sp. nov.</taxonomicNameLabel>
</th>
<td id="42645DAAFFF00036FEFDF9206971F8CA" box="[312,372,1785,1800]" gridcol="1" gridrow="10" pageId="1" pageNumber="284">F</td>
<td id="42645DAAFFF00036FE4DF9206A00F8CA" box="[392,517,1785,1800]" gridcol="2" gridrow="10" pageId="1" pageNumber="284">P46</td>
<td id="42645DAAFFF00036FDD9F9206A7CF8CA" box="[540,633,1785,1800]" gridcol="3" gridrow="10" pageId="1" pageNumber="284">lco/hco</td>
<td id="42645DAAFFF00036FD48F9206ADFF8CA" box="[653,730,1785,1800]" gridcol="4" gridrow="10" pageId="1" pageNumber="284">657</td>
<td id="42645DAAFFF00036FCC4F9206B9EF8CA" box="[769,923,1785,1800]" gridcol="5" gridrow="10" pageId="1" pageNumber="284">MH042536</td>
<td id="42645DAAFFF00036FC70F9206D9CF8CA" box="[949,1433,1785,1800]" gridcol="6" gridrow="10" pageId="1" pageNumber="284">BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada</td>
</tr>
<tr id="01B534D6FFF00036FFA0F8C86D9CF8DD" box="[101,1433,1809,1823]" gridrow="11" pageId="1" pageNumber="284" rowspan-0="1" rowspan-1="1" rowspan-2="1" rowspan-3="1" rowspan-4="1" rowspan-5="1">
<td id="42645DAAFFF00036FC70F8C86D9CF8DD" box="[949,1433,1809,1823]" gridcol="6" gridrow="11" pageId="1" pageNumber="284">Grande, 22.IX.2012 (light trap), M. Aragão &amp; E. Menezes leg.</td>
</tr>
<tr id="01B534D6FFF00036FFA0F8FE6D9CF8F4" box="[101,1433,1831,1846]" gridrow="12" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0F8FE6924F8F4" box="[101,289,1831,1846]" gridcol="0" gridrow="12" pageId="1" pageNumber="284">
<taxonomicName id="78854D17FFF0FFC8FFA0F8FE68D8F8F7" box="[101,221,1831,1846]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="284" phylum="Arthropoda" rank="species" species="undefined-1">
<emphasis id="8DF1EA86FFF0FFC8FFA0F8FE68B8F8F4" box="[101,189,1831,1846]" italics="true" pageId="1" pageNumber="284">Trichomyia</emphasis>
sp1
</taxonomicName>
</th>
<td id="42645DAAFFF00036FEFDF8FE6971F8F4" box="[312,372,1831,1846]" gridcol="1" gridrow="12" pageId="1" pageNumber="284">F</td>
<td id="42645DAAFFF00036FE4DF8FE6A00F8F4" box="[392,517,1831,1846]" gridcol="2" gridrow="12" pageId="1" pageNumber="284">P29</td>
<td id="42645DAAFFF00036FDD9F8FE6A7CF8F4" box="[540,633,1831,1846]" gridcol="3" gridrow="12" pageId="1" pageNumber="284">mtd6/mtd9</td>
<td id="42645DAAFFF00036FD48F8FE6ADFF8F4" box="[653,730,1831,1846]" gridcol="4" gridrow="12" pageId="1" pageNumber="284">467</td>
<td id="42645DAAFFF00036FCC4F8FE6B9EF8F4" box="[769,923,1831,1846]" gridcol="5" gridrow="12" pageId="1" pageNumber="284">MH042539</td>
<td id="42645DAAFFF00036FC70F8FE6D9CF8F4" box="[949,1433,1831,1846]" gridcol="6" gridrow="12" pageId="1" pageNumber="284">BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada</td>
</tr>
<tr id="01B534D6FFF00036FFA0F8E76D9CF88F" box="[101,1433,1854,1869]" gridrow="13" pageId="1" pageNumber="284" rowspan-0="1" rowspan-1="1" rowspan-2="1" rowspan-3="1" rowspan-4="1" rowspan-5="1">
<td id="42645DAAFFF00036FC70F8E76D9CF88F" box="[949,1433,1854,1869]" gridcol="6" gridrow="13" pageId="1" pageNumber="284">Grande, 18.V.2013 (light trap), M. Aragão &amp; E. Menezes leg.</td>
</tr>
<tr id="01B534D6FFF00036FFA0F88D6D9CF8A1" box="[101,1433,1876,1891]" gridrow="14" pageId="1" pageNumber="284">
<th id="42645DAAFFF00036FFA0F88D6924F8A1" box="[101,289,1876,1891]" gridcol="0" gridrow="14" pageId="1" pageNumber="284">
<taxonomicName id="78854D17FFF0FFC8FFA0F88D68DBF8A1" box="[101,222,1876,1891]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="284" phylum="Arthropoda" rank="species" species="undefined-2">
<emphasis id="8DF1EA86FFF0FFC8FFA0F88D68B8F8A1" box="[101,189,1876,1891]" italics="true" pageId="1" pageNumber="284">Trichomyia</emphasis>
sp2
</taxonomicName>
</th>
<td id="42645DAAFFF00036FEFDF88D6971F8A1" box="[312,372,1876,1891]" gridcol="1" gridrow="14" pageId="1" pageNumber="284">F</td>
<td id="42645DAAFFF00036FE4DF88D6A00F8A1" box="[392,517,1876,1891]" gridcol="2" gridrow="14" pageId="1" pageNumber="284">P44</td>
<td id="42645DAAFFF00036FDD9F88D6A7CF8A1" box="[540,633,1876,1891]" gridcol="3" gridrow="14" pageId="1" pageNumber="284">lco/hco</td>
<td id="42645DAAFFF00036FD48F88D6ADFF8A1" box="[653,730,1876,1891]" gridcol="4" gridrow="14" pageId="1" pageNumber="284">633</td>
<td id="42645DAAFFF00036FCC4F88D6B9EF8A1" box="[769,923,1876,1891]" gridcol="5" gridrow="14" pageId="1" pageNumber="284">MH042541</td>
<td id="42645DAAFFF00036FC70F88D6D9CF8A1" box="[949,1433,1876,1891]" gridcol="6" gridrow="14" pageId="1" pageNumber="284">BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada</td>
</tr>
<tr id="01B534D6FFF00036FFA0F8B56D9CF8B8" box="[101,1433,1900,1914]" gridrow="15" pageId="1" pageNumber="284" rowspan-0="1" rowspan-1="1" rowspan-2="1" rowspan-3="1" rowspan-4="1" rowspan-5="1">
<td id="42645DAAFFF00036FC70F8B56D9CF8B8" box="[949,1433,1900,1914]" gridcol="6" gridrow="15" pageId="1" pageNumber="284">Grande, 24.III.2013 (light trap), E. Mota, M. Aragão &amp; E.</td>
</tr>
<tr id="01B534D6FFF00036FFA0F85A6D9CF853" box="[101,1433,1923,1937]" gridrow="16" pageId="1" pageNumber="284" rowspan-0="1" rowspan-1="1" rowspan-2="1" rowspan-3="1" rowspan-4="1" rowspan-5="1">
<td id="42645DAAFFF00036FC70F85A6D9CF853" box="[949,1433,1923,1937]" gridcol="6" gridrow="16" pageId="1" pageNumber="284">Menezes leg.</td>
</tr>
</table>
</paragraph>
<caption id="EBFA661CFFF3FFCBFFB7FC096A37FB92" pageId="2" pageNumber="285" startId="2.[114,141,976,990]" targetBox="[129,770,148,946]" targetPageId="2" targetType="figure">
<paragraph id="BF3A3694FFF3FFCBFFB7FC096A37FB92" blockId="2.[114,786,975,1105]" pageId="2" pageNumber="285">
<emphasis id="8DF1EA86FFF3FFCBFFB7FC0968A7FC1C" bold="true" box="[114,162,976,990]" pageId="2" pageNumber="285">Fig. 1.</emphasis>
19
<taxonomicName id="78854D17FFF3FFCBFF09FC16698BFC1C" authorityName="Araújo &amp; Aragão &amp; Cordeiro &amp; Bravo &amp; Carvalho &amp; Andena" authorityYear="2018" box="[204,398,975,990]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="285" phylum="Arthropoda" rank="species" species="pseudoannae" status="sp. nov.">
<emphasis id="8DF1EA86FFF3FFCBFF09FC16698BFC1C" box="[204,398,975,990]" italics="true" pageId="2" pageNumber="285">Trichomyia pseudoannae</emphasis>
</taxonomicName>
<taxonomicNameLabel id="96C257FDFFF3FFCBFE55FC0969CBFC1C" box="[400,462,976,990]" pageId="2" pageNumber="285" rank="species">sp. nov.</taxonomicNameLabel>
1. Scape, pedicel and flagellomeres 1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate).
</paragraph>
</caption>
<caption id="EBFA661CFFF3FFCBFFB7F9F96A3DF99E" pageId="2" pageNumber="285" startId="2.[114,141,1568,1582]" targetBox="[129,766,1152,1537]" targetPageId="2" targetType="figure">
<paragraph id="BF3A3694FFF3FFCBFFB7F9F96A3DF99E" blockId="2.[114,786,1567,1628]" pageId="2" pageNumber="285">
<emphasis id="8DF1EA86FFF3FFCBFFB7F9F968A7F9EC" bold="true" box="[114,162,1568,1582]" pageId="2" pageNumber="285">Fig. 2.</emphasis>
13
<taxonomicName id="78854D17FFF3FFCBFF08F9C6698AF9EC" authorityName="Araújo &amp; Aragão &amp; Cordeiro &amp; Bravo &amp; Carvalho &amp; Andena" authorityYear="2018" box="[205,399,1567,1582]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="285" phylum="Arthropoda" rank="species" species="pseudoannae" status="sp. nov.">
<emphasis id="8DF1EA86FFF3FFCBFF08F9C6698AF9EC" box="[205,399,1567,1582]" italics="true" pageId="2" pageNumber="285">Trichomyia pseudoannae</emphasis>
</taxonomicName>
<taxonomicNameLabel id="96C257FDFFF3FFCBFE57F9F969D5F9EC" box="[402,464,1568,1582]" pageId="2" pageNumber="285" rank="species">sp. nov.</taxonomicNameLabel>
1. Female terminalia, ventral; 2. Median apodeme and spermathecae; 3. Female terminalia, dorsal (map, median apodeme; cer, cercus; spm, spermathecae; subp, subgenital plate).
</paragraph>
</caption>
<paragraph id="BF3A3694FFF3FFCBFF57F917690BF923" blockId="2.[114,785,1686,1984]" box="[146,270,1742,1761]" pageId="2" pageNumber="285">Description.</paragraph>
<paragraph id="BF3A3694FFF3FFCBFF57F9336B98FD1B" blockId="2.[114,785,1686,1984]" lastBlockId="2.[833,1505,152,1622]" pageId="2" pageNumber="285">
Male. Head subcircular, eyes rounded. Supraocular setae in single row (
<figureCitation id="27BE2A11FFF3FFCBFF0BF8DF6913F8DB" box="[206,278,1798,1817]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="2" pageNumber="285">Fig. 1.3</figureCitation>
). Occipital setae arranged in single row (
<figureCitation id="27BE2A11FFF3FFCBFD7EF8DF6B01F8DB" box="[699,772,1798,1817]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="2" pageNumber="285">Fig. 1.4</figureCitation>
). Antennal pit subtriangular, short distance between antennae (less than 1/3 of the width of the pits and with sclerotic fold). Scape subcylindrical and pedicel subespherical, basal flagellomeres pyriform and eccentric; with a pair of mediobasal digitiform and S-shaped ascoids, first and second flagellomere equal in length, ascoids 1.4 times length of flagellomere (
<figureCitation id="27BE2A11FFF3FFCBFE69F87469FDF802" box="[428,504,1965,1984]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="2" pageNumber="285">Fig. 1.1</figureCitation>
). Palpus three-segmented; first segment with sensilla in depressed pit on inner side; palpus formula: 1.0:0.6:0.9 (
<figureCitation id="27BE2A11FFF3FFCBFBDFFF6D6C66FF05" box="[1050,1123,180,199]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="2" pageNumber="285">Fig. 1.5</figureCitation>
). Wing (
<figureCitation id="27BE2A11FFF3FFCBFB79FF6D6D00FF05" box="[1212,1285,180,199]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="2" pageNumber="285">Fig. 1.2</figureCitation>
). Sc-r sclerotized but not microsetose, r-m present, radial fork distal of apices of CuA
<subScript id="230134D1FFF3FFCBFA6EFF0E6DB0FF27" attach="left" box="[1451,1461,215,229]" fontSize="6" pageId="2" pageNumber="285">2</subScript>
and medial fork, base of M
<subScript id="230134D1FFF3FFCBFBE2FF2A6C34FEC3" attach="left" box="[1063,1073,243,257]" fontSize="6" pageId="2" pageNumber="285">2</subScript>
sclerotized but without microsetae. Male terminalia. Hypandrium fused with gonocoxites and expanded posteriorly as an apically slightly bifucate plate covering the aedeagus. Two pairs of arms of gonocoxite (
<figureCitation id="27BE2A11FFF3FFCBFB63FEE66CF4FE90" box="[1190,1265,319,338]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="2" pageNumber="285">Fig. 1.8</figureCitation>
: agd, agv), one dorsal, directed to apical region and with fine bristles distributed irregularly and a ventral pair, longer than dorsal one, directed to internal region of genitalia at an angle of 60
<superScript id="48F09BDCFFF3FFCBFB65FE566CADFE5F" attach="none" box="[1184,1192,399,413]" fontSize="6" pageId="2" pageNumber="285"></superScript>
. Pair of dorsal arms digitiform, with row of rod-like setae at apex and simple bristles distributed irregularly. Gonostylus sub-circular, slightly sclerotized and with fine bristles, articulated with ventral region of gonocoxite (
<figureCitation id="27BE2A11FFF3FFCBFA49FE3E6DD7FE38" box="[1420,1490,487,506]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="2" pageNumber="285">Fig. 1.8</figureCitation>
). Gonocoxal apodeme with medium, narrow and sclerotized projection directed to dorsal region of genitalia (
<figureCitation id="27BE2A11FFF3FFCBFB18FDC76D68FDF0" box="[1245,1389,542,562]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="2" pageNumber="285">Fig.1.6 and 1.8</figureCitation>
). Aedeagus bifid; two pairs of parameres, dorsal lanciform and ventral digitiform, ejaculatory apodeme long, 1.75 times length of parameres (
<figureCitation id="27BE2A11FFF3FFCBFC8CFDAB6B91FD47" box="[841,916,626,645]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="2" pageNumber="285">Fig. 1.9</figureCitation>
). Cercus cuneiform with bristles distributed irregularly. Hypoproct with micropilosity and apex rounded. Epandrium trapezoidal and pilose, with alveoli distributed in two lateral patches (
<figureCitation id="27BE2A11FFF3FFCBFC8CFD1F6B95FD1B" box="[841,912,710,729]" captionStart="Fig" captionStartId="2.[114,141,976,990]" captionTargetBox="[129,770,148,946]" captionTargetId="figure-14@2.[129,770,148,946]" captionTargetPageId="2" captionText="Fig.1. 19Trichomyia pseudoannaesp.nov.1. Scape,pediceland flagellomeres1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate)." pageId="2" pageNumber="285">Fig. 1.7</figureCitation>
).
</paragraph>
<paragraph id="BF3A3694FFF3FFCBFCA5FD3B6DB1FC7A" blockId="2.[833,1505,152,1622]" pageId="2" pageNumber="285">
Female.Head, antennae, mouthparts, palpi and wings as in male. Female terminalia. subgenital plate trapezoidal bifurcated apically. Cerci elongate, about 5.2 times longer than wide; sclerotized arch between cerci acuminate and with microseate, 0.4 as long as cerci (
<figureCitation id="27BE2A11FFF3FFCBFC8CFC886BEBFCA6" box="[841,1006,849,868]" captionStart="Fig" captionStartId="2.[114,141,1568,1582]" captionTargetBox="[129,766,1152,1537]" captionTargetId="figure-123@2.[129,770,1152,1537]" captionTargetPageId="2" captionText="Fig.2. 13 Trichomyia pseudoannae sp.nov.1. Female terminalia,ventral;2.Median apodeme and spermathecae; 3. Female terminalia, dorsal (map, median apodeme; cer, cercus; spm, spermathecae; subp, subgenital plate)." pageId="2" pageNumber="285">Fig. 2.1 and 2.3</figureCitation>
). Spermathecae with ducts annulated, inflated apically, apex slightly truncated. Median apodeme with two sclerotized projections anteriorly and three posteriorly; median posterior projection three times longer than other projections (
<figureCitation id="27BE2A11FFF3FFCBFAA5FC7C6DA2FC7A" box="[1376,1447,933,952]" captionStart="Fig" captionStartId="2.[114,141,1568,1582]" captionTargetBox="[129,766,1152,1537]" captionTargetId="figure-123@2.[129,770,1152,1537]" captionTargetPageId="2" captionText="Fig.2. 13 Trichomyia pseudoannae sp.nov.1. Female terminalia,ventral;2.Median apodeme and spermathecae; 3. Female terminalia, dorsal (map, median apodeme; cer, cercus; spm, spermathecae; subp, subgenital plate)." pageId="2" pageNumber="285">Fig. 2.2</figureCitation>
).
</paragraph>
<paragraph id="BF3A3694FFF3FFCBFCA5FC186BB1FA98" blockId="2.[833,1505,152,1622]" pageId="2" pageNumber="285">
Material examined: Voucher #m and
<typeStatus id="603E8836FFF3FFCBFAC5FC186D5FFC16" box="[1280,1370,961,980]" pageId="2" pageNumber="285" type="holotype">holotype</typeStatus>
#
<materialsCitation id="0FED3CC9FFF3FFCBFAB0FC186D47FBE5" collectingDate="2013-05-18" collectionCode="MZFS" collectorName="M. Aragao &amp; E. Menezes" country="Brazil" county="Igrapiuna" location="Pancada Grande" municipality="Reserva Ecologica da Michelin" pageId="2" pageNumber="285" specimenCount="1" stateProvince="Bahia" typeStatus="holotype">
m (
<collectionCode id="D994AE51FFF3FFCBFA58FC186DDCFC16" box="[1437,1497,961,980]" pageId="2" pageNumber="285">MZFS</collectionCode>
)
<collectingCountry id="C7927604FFF3FFCBFC84FC046B78FC32" box="[833,893,989,1008]" name="Brazil" pageId="2" pageNumber="285">Brazil</collectingCountry>
,
<collectingRegion id="7D41F876FFF3FFCBFC4CFC046BC6FC32" box="[905,963,989,1008]" country="Brazil" name="Bahia" pageId="2" pageNumber="285">Bahia</collectingRegion>
,
<collectingCounty id="565B4E18FFF3FFCBFC15FC046C36FC32" box="[976,1075,989,1008]" pageId="2" pageNumber="285">Igrapiuna</collectingCounty>
,
<collectingMunicipality id="5F5EACEEFFF3FFCBFB85FC046D7BFC32" box="[1088,1406,989,1008]" pageId="2" pageNumber="285">Reserva Ecológica da Michelin</collectingMunicipality>
,
<location id="BA5A604FFFF3FFCBFA4EFC046B88FBCE" LSID="urn:lsid:plazi:treatment:372C8782FFF0FFCBFC81FB316C4CF997:BA5A604FFFF3FFCBFA4EFC046B88FBCE" country="Brazil" county="Igrapiuna" municipality="Reserva Ecologica da Michelin" name="Pancada Grande" pageId="2" pageNumber="285" stateProvince="Bahia">Pancada Grande</location>
,
<date id="CB3B1054FFF3FFCBFC52FC206BFAFBCE" box="[919,1023,1017,1036]" pageId="2" pageNumber="285" value="2013-05-18">
<collectingDate id="DB7FE9BCFFF3FFCBFC52FC206BFAFBCE" box="[919,1023,1017,1036]" pageId="2" pageNumber="285" value="2013-05-18">18.V.2013</collectingDate>
</date>
,
<collectorName id="12705342FFF3FFCBFBCFFC206C77FBCE" box="[1034,1138,1017,1036]" pageId="2" pageNumber="285">M. Aragão</collectorName>
&amp;
<collectorName id="12705342FFF3FFCBFB55FC206D06FBCE" box="[1168,1283,1017,1036]" pageId="2" pageNumber="285">E. Menezes</collectorName>
cols.;
<specimenCount id="A983FD1DFFF3FFCBFA83FC206DB1FBCE" box="[1350,1460,1017,1036]" count="1" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">1 paratype</specimenCount>
#m (
<collectionCode id="D994AE51FFF3FFCBFC82FBCC6B86FBEA" box="[839,899,1045,1064]" pageId="2" pageNumber="285">MZFS</collectionCode>
) the same locality and collector as
<typeStatus id="603E8836FFF3FFCBFB23FBCD6D47FBE5" box="[1254,1346,1044,1063]" pageId="2" pageNumber="285" type="holotype">holotype</typeStatus>
</materialsCitation>
,
<materialsCitation id="0FED3CC9FFF3FFCBFA89FBCD6BB5FA98" collectingDate="2012-07-21" collectingDateMax="2013-12-16" collectingDateMin="2012-07-21" collectionCode="MZFS" collectorName="Pacange, M &amp; E. Menezes &amp; M. Aragao" country="Brazil" county="Reserva Ecologica da Michelin" location="Reserva Ecologica da Michelin" municipality="Reserva Ecologica da Michelin" pageId="2" pageNumber="285" specimenCount="46" stateProvince="Bahia" typeStatus="allotype">
<date id="CB3B1054FFF3FFCBFA89FBCD6DB9FBE5" box="[1356,1468,1044,1063]" pageId="2" pageNumber="285" value="2013-06-15">
<collectingDate id="DB7FE9BCFFF3FFCBFA89FBCD6DB9FBE5" box="[1356,1468,1044,1063]" pageId="2" pageNumber="285" value="2013-06-15">15.VI.2013</collectingDate>
</date>
;
<specimenCount id="A983FD1DFFF3FFCBFA03FBCC6BA0FB86" count="22" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">22 paratypes</specimenCount>
#m (
<collectionCode id="D994AE51FFF3FFCBFC25FBE86C19FB86" box="[992,1052,1073,1092]" pageId="2" pageNumber="285">MZFS</collectionCode>
)
<collectingCountry id="C7927604FFF3FFCBFBEEFBE96C62FB81" box="[1067,1127,1072,1091]" name="Brazil" pageId="2" pageNumber="285">Brazil</collectingCountry>
,
<collectingRegion id="7D41F876FFF3FFCBFBB6FBE96CA8FB81" box="[1139,1197,1072,1091]" country="Brazil" name="Bahia" pageId="2" pageNumber="285">Bahia</collectingRegion>
, Igrapiuna,
<collectingCounty id="565B4E18FFF3FFCBFAEDFBE86BBEFB9D" pageId="2" pageNumber="285">Reserva Ecológica da Michelin</collectingCounty>
,
<collectorName id="12705342FFF3FFCBFC00FB956C3EFBA2" box="[965,1083,1100,1120]" pageId="2" pageNumber="285">Pacangê, M</collectorName>
. Aragão &amp;
<collectorName id="12705342FFF3FFCBFB62FB946D1FFBA2" box="[1191,1306,1101,1120]" pageId="2" pageNumber="285">E. Menezes</collectorName>
cols.
<date id="CB3B1054FFF3FFCBFA96FB956DDAFB9D" box="[1363,1503,1100,1119]" pageId="2" pageNumber="285" value="2012-10-27" valueMax="2012-10-28" valueMin="2012-10-27">
<collectingDate id="DB7FE9BCFFF3FFCBFA96FB956DDAFB9D" box="[1363,1503,1100,1119]" pageId="2" pageNumber="285" value="2012-10-27" valueMax="2012-10-28" valueMin="2012-10-27">2728.X.2012</collectingDate>
</date>
(
<specimenCount id="A983FD1DFFF3FFCBFC8EFBB16BC6FBB9" box="[843,963,1128,1147]" count="1" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">1 paratype</specimenCount>
);
<date id="CB3B1054FFF3FFCBFC18FBB16C81FBB9" box="[989,1156,1128,1147]" pageId="2" pageNumber="285" value="2012-09-22" valueMax="2012-10-28" valueMin="2012-09-22">
<collectingDate id="DB7FE9BCFFF3FFCBFC18FBB16C81FBB9" box="[989,1156,1128,1147]" pageId="2" pageNumber="285" value="2012-09-22" valueMax="2012-10-28" valueMin="2012-09-22">22.IX28.X.2012</collectingDate>
</date>
(
<specimenCount id="A983FD1DFFF3FFCBFB5EFBB16D25FBB9" box="[1179,1312,1128,1147]" count="5" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">5 paratypes</specimenCount>
);
<date id="CB3B1054FFF3FFCBFAFCFBB16DDAFBB9" box="[1337,1503,1128,1147]" pageId="2" pageNumber="285" value="2013-12-16" valueMax="2013-01-20" valueMin="2013-12-16">
<collectingDate id="DB7FE9BCFFF3FFCBFAFCFBB16DDAFBB9" box="[1337,1503,1128,1147]" pageId="2" pageNumber="285" value="2013-12-16" valueMax="2013-01-20" valueMin="2013-12-16">16.XII20.I.2013</collectingDate>
</date>
(
<specimenCount id="A983FD1DFFF3FFCBFC8CFB5D6BDFFB55" box="[841,986,1156,1175]" count="11" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">11 paratypes</specimenCount>
);
<date id="CB3B1054FFF3FFCBFC31FB5D6C9CFB55" box="[1012,1177,1156,1175]" pageId="2" pageNumber="285" value="2013-02-24" valueMax="2013-03-31" valueMin="2013-02-24">
<collectingDate id="DB7FE9BCFFF3FFCBFC31FB5D6C9CFB55" box="[1012,1177,1156,1175]" pageId="2" pageNumber="285" value="2013-02-24" valueMax="2013-03-31" valueMin="2013-02-24">24.II31.III.2013</collectingDate>
</date>
(
<specimenCount id="A983FD1DFFF3FFCBFB77FB5D6D2EFB55" box="[1202,1323,1156,1175]" count="1" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">1 paratype</specimenCount>
);
<date id="CB3B1054FFF3FFCBFA83FB5D6DE5FB55" box="[1350,1504,1156,1175]" pageId="2" pageNumber="285" value="2012-07-21" valueMax="2012-07-22" valueMin="2012-07-21">
<collectingDate id="DB7FE9BCFFF3FFCBFA83FB5D6DE5FB55" box="[1350,1504,1156,1175]" pageId="2" pageNumber="285" value="2012-07-21" valueMax="2012-07-22" valueMin="2012-07-21">2122.VII.2012</collectingDate>
</date>
(
<specimenCount id="A983FD1DFFF3FFCBFC8EFB796BC1FB71" box="[843,964,1184,1203]" count="1" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">1 paratype</specimenCount>
);
<date id="CB3B1054FFF3FFCBFC1AFB796C77FB71" box="[991,1138,1184,1203]" pageId="2" pageNumber="285" value="2013-04-27" valueMax="2013-04-28" valueMin="2013-04-27">
<collectingDate id="DB7FE9BCFFF3FFCBFC1AFB796C77FB71" box="[991,1138,1184,1203]" pageId="2" pageNumber="285" value="2013-04-27" valueMax="2013-04-28" valueMin="2013-04-27">2728.IV.2013</collectingDate>
</date>
(
<specimenCount id="A983FD1DFFF3FFCBFB4CFB796D0BFB71" box="[1161,1294,1184,1203]" count="2" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">2 paratypes</specimenCount>
);
<date id="CB3B1054FFF3FFCBFAECFB796DBEFB71" box="[1321,1467,1184,1203]" pageId="2" pageNumber="285" value="2013-03-30" valueMax="2013-03-31" valueMin="2013-03-30">
<collectingDate id="DB7FE9BCFFF3FFCBFAECFB796DBEFB71" box="[1321,1467,1184,1203]" pageId="2" pageNumber="285" value="2013-03-30" valueMax="2013-03-31" valueMin="2013-03-30">3031.III.2013</collectingDate>
</date>
(
<specimenCount id="A983FD1DFFF3FFCBFA11FB796BA5FB0D" count="1" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">1 paratype</specimenCount>
);
<specimenCount id="A983FD1DFFF3FFCBFC74FB656C18FB0D" box="[945,1053,1212,1231]" count="1" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">1 paratype</specimenCount>
#m (
<collectionCode id="D994AE51FFF3FFCBFB96FB656C8AFB0D" box="[1107,1167,1212,1231]" pageId="2" pageNumber="285">MZFS</collectionCode>
)
<collectingCountry id="C7927604FFF3FFCBFB5EFB656CD2FB0D" box="[1179,1239,1212,1231]" name="Brazil" pageId="2" pageNumber="285">Brazil</collectingCountry>
,
<collectingRegion id="7D41F876FFF3FFCBFB25FB656D1FFB0D" box="[1248,1306,1212,1231]" country="Brazil" name="Bahia" pageId="2" pageNumber="285">Bahia</collectingRegion>
, Igrapiuna,
<collectingMunicipality id="5F5EACEEFFF3FFCBFA55FB656C2FFB29" pageId="2" pageNumber="285">Reserva Ecológica da Michelin</collectingMunicipality>
, Vila 5,
<date id="CB3B1054FFF3FFCBFB42FB016D2BFB29" box="[1159,1326,1240,1259]" pageId="2" pageNumber="285" value="2013-02-24" valueMax="2013-03-31" valueMin="2013-02-24">
<collectingDate id="DB7FE9BCFFF3FFCBFB42FB016D2BFB29" box="[1159,1326,1240,1259]" pageId="2" pageNumber="285" value="2013-02-24" valueMax="2013-03-31" valueMin="2013-02-24">24.II31.III.2013</collectingDate>
</date>
,
<collectorName id="12705342FFF3FFCBFAF9FB016DADFB29" box="[1340,1448,1240,1259]" pageId="2" pageNumber="285">M. Aragão</collectorName>
&amp;
<collectorName id="12705342FFF3FFCBFA0BFB016B9EFAC5" pageId="2" pageNumber="285">E. Menezes</collectorName>
cols.; Voucher #f (
<collectionCode id="D994AE51FFF3FFCBFB93FB2D6C97FAC5" box="[1110,1170,1268,1287]" pageId="2" pageNumber="285">MZFS</collectionCode>
)
<collectingCountry id="C7927604FFF3FFCBFB58FB2D6CDCFAC5" box="[1181,1241,1268,1287]" name="Brazil" pageId="2" pageNumber="285">Brazil</collectingCountry>
,
<collectingRegion id="7D41F876FFF3FFCBFB27FB2D6D19FAC5" box="[1250,1308,1268,1287]" country="Brazil" name="Bahia" pageId="2" pageNumber="285">Bahia</collectingRegion>
, Igrapiuna,
<location id="BA5A604FFFF3FFCBFA55FB2D6C1BFAE1" LSID="urn:lsid:plazi:treatment:372C8782FFF0FFCBFC81FB316C4CF997:BA5A604FFFF3FFCBFA55FB2D6C1BFAE1" country="Brazil" county="Reserva Ecologica da Michelin" municipality="Reserva Ecologica da Michelin" name="Reserva Ecologica da Michelin" pageId="2" pageNumber="285" stateProvince="Bahia">Reserva Ecológica da Michelin</location>
, Pancada Grande,
<date id="CB3B1054FFF3FFCBFB13FAC96D41FAE1" box="[1238,1348,1296,1315]" pageId="2" pageNumber="285" value="2012-09-22">
<collectingDate id="DB7FE9BCFFF3FFCBFB13FAC96D41FAE1" box="[1238,1348,1296,1315]" pageId="2" pageNumber="285" value="2012-09-22">22.IX.2012</collectingDate>
</date>
,
<collectorName id="12705342FFF3FFCBFA88FAC96DB6FAE1" box="[1357,1459,1296,1315]" pageId="2" pageNumber="285">M. Aragão</collectorName>
&amp;
<collectorName id="12705342FFF3FFCBFA0BFAC96B9EFAFD" pageId="2" pageNumber="285">E. Menezes</collectorName>
cols.;
<specimenCount id="A983FD1DFFF3FFCBFC12FAF56C46FAFD" box="[983,1091,1324,1343]" count="1" pageId="2" pageNumber="285" type="generic" typeStatus="paratype">1 paratype</specimenCount>
#f (
<collectionCode id="D994AE51FFF3FFCBFBADFAF56CA1FAFD" box="[1128,1188,1324,1343]" pageId="2" pageNumber="285">MZFS</collectionCode>
) the same locality and collector as
<typeStatus id="603E8836FFF3FFCBFC9EFA9E6BB5FA98" box="[859,944,1351,1370]" pageId="2" pageNumber="285" type="allotype">allotype</typeStatus>
</materialsCitation>
.
</paragraph>
<paragraph id="BF3A3694FFF3FFCBFCA5FABA6C76FA50" blockId="2.[833,1505,152,1622]" pageId="2" pageNumber="285">
Etymology. The epithet refers to morphological similarity with
<taxonomicName id="78854D17FFF3FFCBFC84FAA76C6AFA50" authority="Bravo, 2001" authorityName="Bravo" authorityYear="2001" box="[833,1135,1406,1427]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="285" phylum="Arthropoda" rank="species" species="annae">
<emphasis id="8DF1EA86FFF3FFCBFC84FAA76BF5FA50" box="[833,1008,1406,1426]" italics="true" pageId="2" pageNumber="285">Trichomyia annae</emphasis>
Bravo, 2001
</taxonomicName>
.
</paragraph>
<paragraph id="BF3A3694FFF3FFCBFCA5FA426D4DFA6C" blockId="2.[833,1505,152,1622]" box="[864,1352,1435,1454]" pageId="2" pageNumber="285">
Distribution. Known only from the
<typeStatus id="603E8836FFF3FFCBFB01FA426CF4FA6C" box="[1220,1265,1435,1454]" pageId="2" pageNumber="285">type</typeStatus>
locality.
</paragraph>
<paragraph id="BF3A3694FFF3FFCBFCA5FA6E6C4CF997" blockId="2.[833,1505,152,1622]" pageId="2" pageNumber="285">
Comments. The new species is morphologically similar to
<taxonomicName id="78854D17FFF3FFCBFC84FA0B6BF7FA24" authorityName="Bravo" authorityYear="2001" box="[833,1010,1490,1510]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="285" phylum="Arthropoda" rank="species" species="annae">
<emphasis id="8DF1EA86FFF3FFCBFC84FA0B6BF7FA24" box="[833,1010,1490,1510]" italics="true" pageId="2" pageNumber="285">Trichomyia annae</emphasis>
</taxonomicName>
. The differences are in the male terminalia, the plate expanded posteriorly of hypandrium and gonocoxites has a small bifurcation apically with projections on rounded apex and not lanciform as in
<emphasis id="8DF1EA86FFF3FFCBFBCEF9FC6C60F9FB" box="[1035,1125,1573,1593]" italics="true" pageId="2" pageNumber="285">
<taxonomicName id="78854D17FFF3FFCBFBCEF9FC6C64F9FB" authorityName="Bravo" authorityYear="2001" box="[1035,1121,1573,1593]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="285" phylum="Arthropoda" rank="species" species="annae">T. annae</taxonomicName>
.
</emphasis>
Both species, to date, have not been included in any subgenus.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,135 @@
<document id="68C0FE6356A27E4631DCDECEDA1194EF" ID-DOI="10.1016/j.rbe.2018.08.004" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722639927852" checkinUser="felipe" docAuthor="Araújo, Maíra Xavier, Aragão, Marcos, Cordeiro, Danilo, Bravo, Freddy, Carvalho, Claudio José Barros de &amp; Andena, Sergio R." docDate="2018" docId="372C8782FFF2FFCAFFB0FAD8698CFA1A" docLanguage="en" docName="RevBrasEntomol.62.4.283-287.pdf" docOrigin="Revista Brasileira de Entomologia 62 (4)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.08.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Trichomyia cerdosa Araujo &amp; Bravo 2016" docType="treatment" docVersion="1" lastPageNumber="286" masterDocId="CB15FFFAFFF1FFC9FFC5FFD96805FFC2" masterDocTitle="Male and female association in Trichomyia Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil" masterLastPageNumber="287" masterPageNumber="283" pageNumber="286" updateTime="1722683598029" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="D2FCF0782F35C37553D176A9DCD5B16D" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="B235A4225C55DC806BECDAD52E625614">
<mods:title id="795032F6EDD20905D94FCCF91DD9724B">Male and female association in Trichomyia Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil</mods:title>
</mods:titleInfo>
<mods:name id="32DEA37B3CDC334D2CCDBD5815D76D1E" type="personal">
<mods:role id="C34BF09F4A5FA721A6A07C1EEC99F214">
<mods:roleTerm id="28A7E9B6AD8AA7FA4B253783770652FB">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="7FF1AB5D3B90F60BC196E3C2B7EBCBBF">Araújo, Maíra Xavier</mods:namePart>
<mods:affiliation id="FFE954F7D42306E0DBE601322AEEBEAD">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="49C0A9AA082BD3849B4B340E58F4B0AF" type="personal">
<mods:role id="68367F04A2B9A373C10848B619F96669">
<mods:roleTerm id="95FA36B4763E28C87F850E6BA6A8044F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="6C61040032789766ABD3E9DAE2257D00">Aragão, Marcos</mods:namePart>
<mods:affiliation id="6BB668EA71B71E19E41C1FFB12DDEA94">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="E6D12A189E4E4DE07BA7A10E974DA8A7" type="personal">
<mods:role id="3BADF408CB6488E0A1688AC4020E2645">
<mods:roleTerm id="EB180F201E7A87C2224CAFD36E9E700B">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="91D7CB90F14F615E5CB03293CEB8641B">Cordeiro, Danilo</mods:namePart>
<mods:affiliation id="FDC6C12F6601460A76BFA75366275ABB">Instituto Nacional de Pesquisa da Amazônia, Coordenação de Biodiversidade, Manaus, AM, Brazil</mods:affiliation>
</mods:name>
<mods:name id="99C39ABAC18A4CF4AD9B428EA967CFB8" type="personal">
<mods:role id="3389E724830547439F8D4E2F399341EA">
<mods:roleTerm id="AEB356D8D8518A03C7AB807FC6590F70">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="908EDE25C2FD050AFDA7D68335038E7F">Bravo, Freddy</mods:namePart>
<mods:affiliation id="7082712CFA9BCA57B0B742CD89CF03E4">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="4125710E5BD85EA7C0C6D919B713617F" type="personal">
<mods:role id="164B6D337E0AC92D4D6A1E2DA401E874">
<mods:roleTerm id="84A78EDBDAFF5DBD8E45CAD772F7E3C3">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="F7CEE067CF43A9CBCCC8A0094DB1B185">Carvalho, Claudio José Barros de</mods:namePart>
<mods:affiliation id="63A7A4FC9B38C20DE38EE15DC3CA3A0B">Universidade Federal do Paraná, Departamento de Zoologia, Programa de Pós-graduação em Entomologia, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:name id="86A7207077A06BAB3BB5AA951666C596" type="personal">
<mods:role id="8A6082A5C27841461CFD9BD4A1F4DA5F">
<mods:roleTerm id="303924CA4354013B497F479FF54C6E30">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="E068EA10888CA7F54A5264F70BBD3FC6">Andena, Sergio R.</mods:namePart>
<mods:affiliation id="E16A60E468EAD6328670070A8DB29DA8">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="B6AC34B0C7B0488139A3034DF2053950">text</mods:typeOfResource>
<mods:relatedItem id="25189BADD327D274A5613E08D835E6AF" type="host">
<mods:titleInfo id="A4ACAF5C1804653961CDCC98FA125178">
<mods:title id="165F0998EE5A2694894FBBFEA186C2C0">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="6DF8936DF6E982809571D174A5970AD3">
<mods:date id="9F932E1499FF6EDF27FACA238FD88458">2018</mods:date>
<mods:detail id="88F9C1CCBB3BCE03A7727632B1CCEF18" type="pubDate">
<mods:number id="BF0E49731FDBFA008A858ACF9FF8920C">2018-09-05</mods:number>
</mods:detail>
<mods:detail id="1FF7A4FD577D080669F52DDFBEB7AD7D" type="volume">
<mods:number id="CAB758505169403B75130D804AFBC769">62</mods:number>
</mods:detail>
<mods:detail id="A567DF112AD69BCBB0E64C848F91C563" type="issue">
<mods:number id="EB50E95E2CB7D8357E78AC91C59D18B0">4</mods:number>
</mods:detail>
<mods:extent id="547AA8996204D4004104259575557A59" unit="page">
<mods:start id="48894EB0A9A07658A0DE89A90A3ED661">283</mods:start>
<mods:end id="36F10587A9285850D46CEB9EB46C0E74">287</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="9EDAEF759071C3C28C763DD79E832D9E">
<mods:url id="893B34FE2F7660FD9DAC0617F6857FFB">http://dx.doi.org/10.1016/j.rbe.2018.08.004</mods:url>
</mods:location>
<mods:classification id="3817BF277AEC19D0452C126C459FC25D">journal article</mods:classification>
<mods:identifier id="95CA01233DD34D93F259D274198B4761" type="DOI">10.1016/j.rbe.2018.08.004</mods:identifier>
<mods:identifier id="7FD61F2E60B16F3BD460577E10398072" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="372C8782FFF2FFCAFFB0FAD8698CFA1A" LSID="urn:lsid:plazi:treatment:372C8782FFF2FFCAFFB0FAD8698CFA1A" httpUri="http://treatment.plazi.org/id/372C8782FFF2FFCAFFB0FAD8698CFA1A" lastPageNumber="286" pageId="3" pageNumber="286">
<subSubSection id="F79F651FFFF2FFCAFFB0FAD86AE5FAD7" box="[117,736,1281,1301]" pageId="3" pageNumber="286" type="nomenclature">
<paragraph id="BF3A3694FFF2FFCAFFB0FAD86AE5FAD7" blockId="3.[85,757,1281,1496]" box="[117,736,1281,1301]" pageId="3" pageNumber="286">
<heading id="E47281F8FFF2FFCAFFB0FAD86AE5FAD7" box="[117,736,1281,1301]" centered="true" fontSize="8" level="2" pageId="3" pageNumber="286" reason="7">
<treatmentCitationGroup id="9F9511BAFFF2FFCAFFB0FAD86AE5FAD7" box="[117,736,1281,1301]" pageId="3" pageNumber="286">
<treatmentCitation id="3E241085FFF2FFCAFFB0FAD86A59FAD7" author="Araujo, M. X. &amp; Bravo, F." box="[117,604,1281,1301]" page="40" pageId="3" pageNumber="286" year="2016">
<taxonomicName id="78854D17FFF2FFCAFFB0FAD86A59FAD7" ID-CoL="8FHKW" authority="Araujo &amp; Bravo, 2016: 39 - 40" authorityName="Araujo &amp; Bravo" authorityPageNumber="39 - 40" authorityYear="2016" box="[117,604,1281,1301]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="cerdosa">
<emphasis id="8DF1EA86FFF2FFCAFFB0FAD86937FAD7" box="[117,306,1281,1301]" italics="true" pageId="3" pageNumber="286">Trichomyia cerdosa</emphasis>
<bibRefCitation id="DB144B65FFF2FFCAFEFDFADB6A59FAD7" author="Araujo, M. X. &amp; Bravo, F." box="[312,604,1282,1301]" pageId="3" pageNumber="286" pagination="1 - 76" refId="ref3771" refString="Araujo, M. X., Bravo, F., 2016. Description of forty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera: Psychodidae, Trichomyiinae). Zootaxa 4130, 1 - 76." type="journal article" year="2016">Araújo &amp; Bravo, 2016: 3940</bibRefCitation>
</taxonomicName>
</treatmentCitation>
, figs. 20AH.
</treatmentCitationGroup>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="F79F651FFFF2FFCAFFB0FAC7698CFA1A" pageId="3" pageNumber="286" type="discussion">
<paragraph id="BF3A3694FFF2FFCAFFB0FAC76A02FAAA" blockId="3.[85,757,1281,1496]" pageId="3" pageNumber="286">
Comments. Males of
<taxonomicName id="78854D17FFF2FFCAFE89FAC469A9FAF3" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[332,428,1309,1329]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="cerdosa">
<emphasis id="8DF1EA86FFF2FFCAFE89FAC469A9FAF3" box="[332,428,1309,1329]" italics="true" pageId="3" pageNumber="286">T. cerdosa</emphasis>
</taxonomicName>
are recognized by the genitalia, with an elongate arm of gonocoxite with elongate apical bristles. The cercus has four apical bristles rod-like.
</paragraph>
<paragraph id="BF3A3694FFF2FFCAFFB0FAA86973FA7E" blockId="3.[85,757,1281,1496]" pageId="3" pageNumber="286">
<materialsCitation id="0FED3CC9FFF2FFCAFFB0FAA869A7FA62" collectionCode="VI" country="Brazil" location="Bahia" pageId="3" pageNumber="286" specimenCount="1" stateProvince="Bahia">
Material examined.
<collectingCountry id="C7927604FFF2FFCAFE81FAA86985FA46" box="[324,384,1393,1412]" name="Brazil" pageId="3" pageNumber="286">Brazil</collectingCountry>
,
<collectingRegion id="7D41F876FFF2FFCAFE4EFAA869C0FA46" box="[395,453,1393,1412]" country="Brazil" name="Bahia" pageId="3" pageNumber="286">Bahia</collectingRegion>
, Igrapiuna, Reserva Ecológica Michelin, Pancada Grande,
<date id="CB3B1054FFF2FFCAFEA9FA5469A7FA62" box="[364,418,1421,1440]" pageId="3" pageNumber="286" value="2013-06-15">
15.
<collectionCode id="D994AE51FFF2FFCAFE43FA5469A7FA62" box="[390,418,1421,1440]" country="Norway" name="Mykotektet, National Veterinary Institute" pageId="3" pageNumber="286">VI</collectionCode>
</date>
</materialsCitation>
<materialsCitation id="0FED3CC9FFF2FFCAFE67FA546977FA7E" collectionCode="MZFS" collectorName="M. Aragao &amp; E. Menezes" country="Brazil" pageId="3" pageNumber="286" specimenCount="1" stateProvince="Bahia">
.2013 (
<collectingMethod id="66C44E83FFF2FFCAFE22FA546A4FFA62" box="[487,586,1421,1440]" pageId="3" pageNumber="286">light trap</collectingMethod>
),
<collectorName id="12705342FFF2FFCAFD98FA576AC0FA62" box="[605,709,1421,1441]" pageId="3" pageNumber="286">M. Aragão</collectorName>
&amp;
<collectorName id="12705342FFF2FFCAFD27FA5768AAFA7F" pageId="3" pageNumber="286">E. Menezes</collectorName>
cols., 2 #m (
<collectionCode id="D994AE51FFF2FFCAFEEBFA706969FA7E" box="[302,364,1449,1468]" pageId="3" pageNumber="286">MZFS</collectionCode>
)
</materialsCitation>
.
</paragraph>
<paragraph id="BF3A3694FFF2FFCAFFB0FA1C698CFA1A" blockId="3.[85,757,1281,1496]" box="[117,393,1477,1496]" pageId="3" pageNumber="286">
Distribution.
<collectingCountry id="C7927604FFF2FFCAFF3EFA1C6930FA1A" box="[251,309,1477,1496]" name="Brazil" pageId="3" pageNumber="286">Brazil</collectingCountry>
(
<collectingRegion id="7D41F876FFF2FFCAFE84FA1C697BFA1A" box="[321,382,1477,1496]" country="Brazil" name="Bahia" pageId="3" pageNumber="286">Bahia</collectingRegion>
).
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,347 @@
<document id="08AB518F6A58876F24163DF2F428D64F" ID-DOI="10.1016/j.rbe.2018.08.004" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722639927852" checkinUser="felipe" docAuthor="Araújo, Maíra Xavier, Aragão, Marcos, Cordeiro, Danilo, Bravo, Freddy, Carvalho, Claudio José Barros de &amp; Andena, Sergio R." docDate="2018" docId="372C8782FFF3FFCAFCA5F97B68E5FBF2" docLanguage="en" docName="RevBrasEntomol.62.4.283-287.pdf" docOrigin="Revista Brasileira de Entomologia 62 (4)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.08.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Trichomyia ituberensis Araujo &amp; Bravo 2016" docType="treatment" docVersion="1" lastPageNumber="286" masterDocId="CB15FFFAFFF1FFC9FFC5FFD96805FFC2" masterDocTitle="Male and female association in Trichomyia Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil" masterLastPageNumber="287" masterPageNumber="283" pageNumber="285" updateTime="1722683598029" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="EAFD947E37F6914EC3072B385F0E6241" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="C81EBB1C39A401774BCEA999526AF0AF">
<mods:title id="6101DE11D865D90A84107A2F675EF391">Male and female association in Trichomyia Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil</mods:title>
</mods:titleInfo>
<mods:name id="D971DBE6278868E372030D6ABFBE4682" type="personal">
<mods:role id="EC3595A36CF33B83504B51D663B98D20">
<mods:roleTerm id="5CE2AA78B80ABAA3934B91161252C872">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="29EB76A2C90DA996D988F7F2C2945648">Araújo, Maíra Xavier</mods:namePart>
<mods:affiliation id="01C7B4FC251FBAFD6530756611D94E94">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="4632E5CFD5451D86C8D6541C6196DC2A" type="personal">
<mods:role id="78EC88E6F911D8ACC5E950BF7574BF74">
<mods:roleTerm id="45774BFF07CD37BBF799F704F8B8A2FF">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="7BB68A06554F4E88C90FBE65703E4AF1">Aragão, Marcos</mods:namePart>
<mods:affiliation id="376DDACB31D7D89E622FB6E7C483F1C4">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="2109FE14C69A50D3AA639566BD8455ED" type="personal">
<mods:role id="2C302039A2D624893D09963A8076152F">
<mods:roleTerm id="78F451B3C79D530B2F8FFC405D94F3D3">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="04B80E4EE2A89EC6D557E988028A9702">Cordeiro, Danilo</mods:namePart>
<mods:affiliation id="A81EDBDD52E7B35741EEEE3B743B0AF1">Instituto Nacional de Pesquisa da Amazônia, Coordenação de Biodiversidade, Manaus, AM, Brazil</mods:affiliation>
</mods:name>
<mods:name id="77855BA3839E48A5262EF18308E426AC" type="personal">
<mods:role id="FBF8A4D425435886C9560773F9E380A1">
<mods:roleTerm id="E29361E2CD6DF1A64B365E4C0A9F3040">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="B0B6F57491810FA710EBAC9830540A4D">Bravo, Freddy</mods:namePart>
<mods:affiliation id="C398DF3C420125BB39DD70ED1CC55EBF">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="6208B4090693B62C3EEEE3640C1A8042" type="personal">
<mods:role id="EF7A3FD23D3266916A0CB0073C6486BA">
<mods:roleTerm id="5F9AD38FA91B7DA7A89A70C40391CF5C">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="E214541530639D00576164B38ECBB641">Carvalho, Claudio José Barros de</mods:namePart>
<mods:affiliation id="5E515A68A157D61B0AFB11B1F48FE67E">Universidade Federal do Paraná, Departamento de Zoologia, Programa de Pós-graduação em Entomologia, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:name id="BF3999143AFEEF7C03EA549D68EC672B" type="personal">
<mods:role id="3F5BC58EFE70CBE0F1CDE3C511BC3CE5">
<mods:roleTerm id="DDFD77C120D56AA9E5696E482EDA10B2">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="E5F2CD295033E619D567527A0883CE50">Andena, Sergio R.</mods:namePart>
<mods:affiliation id="F740202FDF7128F9E61A5C905C7A9561">Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="54EDCFAA5828D2C0B8981E26D0ACA9F4">text</mods:typeOfResource>
<mods:relatedItem id="5082E5B96333E66361FB365C48484A58" type="host">
<mods:titleInfo id="8D14684E730C6D4A4F9C51A6D69F714A">
<mods:title id="7BF241291D6B2D2F499ABF84714894DE">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="E533F61C9BB8ECD4F9033BBF714163B2">
<mods:date id="86CDDDCA7C4688D1D366EFEA691E5B53">2018</mods:date>
<mods:detail id="D4F81850286246F011AEC133D47CD3E6" type="pubDate">
<mods:number id="AEF6567185AA6BD96488B5CCAB42C66B">2018-09-05</mods:number>
</mods:detail>
<mods:detail id="6B906544A34813FE6CBE9C85F16A2442" type="volume">
<mods:number id="F8D9877D15ECB6019A372842F25F0FBE">62</mods:number>
</mods:detail>
<mods:detail id="EB0AE0C45FB9821DF894607CF522A6E4" type="issue">
<mods:number id="3E8E9AC68371073B9C999EF7DCCF5AB5">4</mods:number>
</mods:detail>
<mods:extent id="417FF6DAAC8E23B1D9D0524E5729FE98" unit="page">
<mods:start id="91423282A8314CEB24246411F145D4C0">283</mods:start>
<mods:end id="58F7000DC4F7A67585557086A88ADDA4">287</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="05E458229221361EDA85F553548F99E9">
<mods:url id="771F9413E0B8C02DA24D3B9E94903F57">http://dx.doi.org/10.1016/j.rbe.2018.08.004</mods:url>
</mods:location>
<mods:classification id="4616141A5B797BE80006096CC1861AB0">journal article</mods:classification>
<mods:identifier id="25B72FFC04C6DDE2BD3B1548C4217980" type="DOI">10.1016/j.rbe.2018.08.004</mods:identifier>
<mods:identifier id="7E60D3A7EBE62AC97E7FCE7E941D004B" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="372C8782FFF3FFCAFCA5F97B68E5FBF2" LSID="urn:lsid:plazi:treatment:372C8782FFF3FFCAFCA5F97B68E5FBF2" httpUri="http://treatment.plazi.org/id/372C8782FFF3FFCAFCA5F97B68E5FBF2" lastPageId="3" lastPageNumber="286" pageId="2" pageNumber="285">
<subSubSection id="F79F651FFFF3FFCBFCA5F97B6DE5F975" box="[864,1504,1698,1719]" pageId="2" pageNumber="285" type="nomenclature">
<paragraph id="BF3A3694FFF3FFCBFCA5F97B6DE5F975" blockId="2.[833,1504,1698,1969]" box="[864,1504,1698,1719]" pageId="2" pageNumber="285">
<heading id="E47281F8FFF3FFCBFCA5F97B6DE5F975" box="[864,1504,1698,1719]" fontSize="8" level="2" pageId="2" pageNumber="285" reason="7">
<treatmentCitationGroup id="9F9511BAFFF3FFCBFCA5F97B6DE5F975" box="[864,1504,1698,1719]" pageId="2" pageNumber="285">
<treatmentCitation id="3E241085FFF3FFCBFCA5F97B6D62F975" author="Araujo, M. X. &amp; Bravo, F." box="[864,1383,1698,1719]" page="31" pageId="2" pageNumber="285" year="2016">
<taxonomicName id="78854D17FFF3FFCBFCA5F97B6D62F975" ID-CoL="8FHM9" authority="Araujo &amp; Bravo, 2016: 30 - 31" authorityName="Araujo &amp; Bravo" authorityPageNumber="30 - 31" authorityYear="2016" box="[864,1383,1698,1719]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="285" phylum="Arthropoda" rank="species" species="ituberensis">
<emphasis id="8DF1EA86FFF3FFCBFCA5F97B6C38F974" box="[864,1085,1698,1718]" italics="true" pageId="2" pageNumber="285">Trichomyia ituberensis</emphasis>
<bibRefCitation id="DB144B65FFF3FFCBFB86F97A6D62F975" author="Araujo, M. X. &amp; Bravo, F." box="[1091,1383,1699,1719]" pageId="2" pageNumber="285" pagination="1 - 76" refId="ref3771" refString="Araujo, M. X., Bravo, F., 2016. Description of forty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera: Psychodidae, Trichomyiinae). Zootaxa 4130, 1 - 76." type="journal article" year="2016">Araújo &amp; Bravo, 2016: 3031</bibRefCitation>
</taxonomicName>
</treatmentCitation>
, figs. 13AI.
</treatmentCitationGroup>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="F79F651FFFF3FFCAFCA5F96668E5FBF2" lastPageId="3" lastPageNumber="286" pageId="2" pageNumber="285" type="discussion">
<paragraph id="BF3A3694FFF3FFCBFCA5F9666C23F880" blockId="2.[833,1504,1698,1969]" pageId="2" pageNumber="285">
Comments. Males of
<taxonomicName id="78854D17FFF3FFCBFBF9F9676CBAF910" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[1084,1215,1726,1746]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="285" phylum="Arthropoda" rank="species" species="ituberensis">
<emphasis id="8DF1EA86FFF3FFCBFBF9F9676CBAF910" box="[1084,1215,1726,1746]" italics="true" pageId="2" pageNumber="285">T. ituberensis</emphasis>
</taxonomicName>
are recognized by the genitalia, with a hypandrium fused with gonocoxites and expanded posteriorly as an apically strongly bifucate plate covering the aedeagus. There are two pairs of parameres and rod-like setae in the arm of gonocoxite.
</paragraph>
<paragraph id="BF3A3694FFF3FFCBFCA5F8926C07F854" blockId="2.[833,1504,1698,1969]" pageId="2" pageNumber="285">
<materialsCitation id="0FED3CC9FFF3FFCBFCA5F8926C51F8B8" collectionCode="V" country="Brazil" location="Bahia" pageId="2" pageNumber="285" specimenCount="1" stateProvince="Bahia">
Material examined.
<collectingCountry id="C7927604FFF3FFCBFBEAF8926C6EF89C" box="[1071,1131,1867,1886]" name="Brazil" pageId="2" pageNumber="285">Brazil</collectingCountry>
,
<collectingRegion id="7D41F876FFF3FFCBFBB3F8926CB5F89C" box="[1142,1200,1867,1886]" country="Brazil" name="Bahia" pageId="2" pageNumber="285">Bahia</collectingRegion>
, Igrapiuna, Reserva Ecológica Michelin, Vila 5,
<date id="CB3B1054FFF3FFCBFC26F8BE6C51F8B8" box="[995,1108,1895,1914]" pageId="2" pageNumber="285" value="2013-04-28" valueMax="2013-05-19" valueMin="2013-04-28">
28.IV19.
<collectionCode id="D994AE51FFF3FFCBFB87F8BE6C51F8B8" box="[1090,1108,1895,1914]" country="Canada" lsid="urn:lsid:biocol.org:col:13946" name="Royal British Columbia Museum - Herbarium" pageId="2" pageNumber="285" type="Museum">V</collectionCode>
</date>
</materialsCitation>
<materialsCitation id="0FED3CC9FFF3FFCBFB91F8BE6BFBF854" collectionCode="MZFS" collectorName="M. Aragao &amp; E. Menezes" country="Brazil" pageId="2" pageNumber="285" specimenCount="1" stateProvince="Bahia">
.2013 (Malaise),
<collectorName id="12705342FFF3FFCBFB30F8BE6D5FF8B8" box="[1269,1370,1895,1914]" pageId="2" pageNumber="285">M. Aragão</collectorName>
&amp;
<collectorName id="12705342FFF3FFCBFAB5F8BE6DE5F8B8" box="[1392,1504,1895,1914]" pageId="2" pageNumber="285">E. Menezes</collectorName>
cols., 1 #m (
<collectionCode id="D994AE51FFF3FFCBFC7FF85A6BFDF854" box="[954,1016,1923,1942]" pageId="2" pageNumber="285">MZFS</collectionCode>
)
</materialsCitation>
.
</paragraph>
<paragraph id="BF3A3694FFF3FFCBFCA5F8476C70F873" blockId="2.[833,1504,1698,1969]" box="[864,1141,1950,1969]" pageId="2" pageNumber="285">
Distribution.
<collectingCountry id="C7927604FFF3FFCBFC23F8476C25F873" box="[998,1056,1950,1969]" name="Brazil" pageId="2" pageNumber="285">Brazil</collectingCountry>
(
<collectingRegion id="7D41F876FFF3FFCBFBE8F8476C6FF873" box="[1069,1130,1950,1969]" country="Brazil" name="Bahia" pageId="2" pageNumber="285">Bahia</collectingRegion>
).
</paragraph>
<caption id="EBFA661CFFF2FFCAFF90FF4E6C1FFF79" pageId="3" pageNumber="286" startId="3.[85,131,151,165]" targetType="table">
<paragraph id="BF3A3694FFF2FFCAFF90FF4E6894FF66" blockId="3.[85,1050,150,188]" box="[85,145,150,165]" pageId="3" pageNumber="286">
<emphasis id="8DF1EA86FFF2FFCAFF90FF4E6894FF66" bold="true" box="[85,145,150,165]" pageId="3" pageNumber="286">Table 3</emphasis>
</paragraph>
<paragraph id="BF3A3694FFF2FFCAFF90FF746C1FFF79" blockId="3.[85,1050,150,188]" box="[85,1050,173,188]" pageId="3" pageNumber="286">
Matrix of p-distances among males and females of specimens of
<emphasis id="8DF1EA86FFF2FFCAFDA4FF746ABBFF7E" box="[609,702,173,188]" italics="true" pageId="3" pageNumber="286">
<taxonomicName id="78854D17FFF2FFCAFDA4FF746ABFFF7E" authorityName="Haliday" authorityYear="1839" box="[609,698,173,188]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="genus">Trichomyia</taxonomicName>
.
</emphasis>
Bold denotes shortest distances; F, female.
</paragraph>
</caption>
<paragraph id="BF3A3694FFF2FFCAFEF5FF0D68B4FDC3" pageId="3" pageNumber="286">
<table id="CD85C434FFF20036FFA0FF0A6DBFFDC3" box="[101,1466,211,513]" gridcols="8" gridrows="13" pageId="3" pageNumber="286">
<tr id="01B534D6FFF20036FFA0FF0A6DBFFF20" box="[101,1466,211,226]" gridrow="0" pageId="3" pageNumber="286" rowspan-0="1">
<th id="42645DAAFFF20036FEF5FF0A696EFF20" box="[304,363,211,226]" gridcol="1" gridrow="0" pageId="3" pageNumber="286">
#P4
<emphasis id="8DF1EA86FFF2FFCAFE90FF0A6961FF20" box="[341,356,211,226]" italics="true" pageId="3" pageNumber="286">T.</emphasis>
</th>
<th id="42645DAAFFF20036FE7EFF0A6A39FF20" box="[443,572,211,226]" gridcol="2" gridrow="0" pageId="3" pageNumber="286">
#P46
<emphasis id="8DF1EA86FFF2FFCAFE2FFF0A69FCFF20" box="[490,505,211,226]" italics="true" pageId="3" pageNumber="286">T.</emphasis>
</th>
<th id="42645DAAFFF20036FD43FF0A6AC1FF20" box="[646,708,211,226]" gridcol="3" gridrow="0" pageId="3" pageNumber="286">
#T15
<emphasis id="8DF1EA86FFF2FFCAFD70FF0A6AC1FF20" box="[693,708,211,226]" italics="true" pageId="3" pageNumber="286">T.</emphasis>
</th>
<th id="42645DAAFFF20036FCD7FF0A6B7CFF20" box="[786,889,211,226]" gridcol="4" gridrow="0" pageId="3" pageNumber="286">
#P28
<emphasis id="8DF1EA86FFF2FFCAFC84FF0A6B55FF20" box="[833,848,211,226]" italics="true" pageId="3" pageNumber="286">T.</emphasis>
</th>
<th id="42645DAAFFF20036FC18FF0A6C61FF20" box="[989,1124,211,226]" gridcol="5" gridrow="0" pageId="3" pageNumber="286">
#P29
<taxonomicName id="78854D17FFF2FFCAFBC9FF0A6C61FF20" authorityName="Haliday" authorityYear="1839" box="[1036,1124,211,226]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="genus">
<emphasis id="8DF1EA86FFF2FFCAFBC9FF0A6C61FF20" box="[1036,1124,211,226]" italics="true" pageId="3" pageNumber="286">Trichomyia</emphasis>
</taxonomicName>
</th>
<th id="42645DAAFFF20036FB6DFF0A6CF8FF20" box="[1192,1277,211,226]" gridcol="6" gridrow="0" pageId="3" pageNumber="286">
#P21
<emphasis id="8DF1EA86FFF2FFCAFB12FF0A6CE3FF20" box="[1239,1254,211,226]" italics="true" pageId="3" pageNumber="286">T.</emphasis>
</th>
<th id="42645DAAFFF20036FAF6FF0A6DBFFF20" box="[1331,1466,211,226]" gridcol="7" gridrow="0" pageId="3" pageNumber="286">
#P44
<taxonomicName id="78854D17FFF2FFCAFAA7FF0A6DBFFF20" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[1378,1466,211,226]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="cerdosa">
<emphasis id="8DF1EA86FFF2FFCAFAA7FF0A6DBFFF20" box="[1378,1466,211,226]" italics="true" pageId="3" pageNumber="286">Trichomyia</emphasis>
</taxonomicName>
</th>
</tr>
<tr id="01B534D6FFF20036FFA0FF336DBFFF3B" box="[101,1466,234,249]" gridrow="1" pageId="3" pageNumber="286" rowspan-0="1">
<td id="42645DAAFFF20036FEF5FF33696EFF3B" box="[304,363,234,249]" gridcol="1" gridrow="1" pageId="3" pageNumber="286">
<emphasis id="8DF1EA86FFF2FFCAFEF5FF33696EFF3B" box="[304,363,234,249]" italics="true" pageId="3" pageNumber="286">cerdosa</emphasis>
</td>
<td id="42645DAAFFF20036FE7EFF336A39FF3B" box="[443,572,234,249]" gridcol="2" gridrow="1" pageId="3" pageNumber="286">
<taxonomicName id="78854D17FFF2FFCAFE7EFF336A27FF3B" authorityName="Araújo &amp; Aragão &amp; Cordeiro &amp; Bravo &amp; Carvalho &amp; Andena" authorityYear="2018" box="[443,546,234,249]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="pseudoannae">
<emphasis id="8DF1EA86FFF2FFCAFE7EFF336A27FF3B" box="[443,546,234,249]" italics="true" pageId="3" pageNumber="286">pseudoannae</emphasis>
</taxonomicName>
(F)
</td>
<td id="42645DAAFFF20036FD43FF336AC1FF3B" box="[646,708,234,249]" gridcol="3" gridrow="1" pageId="3" pageNumber="286">
<taxonomicName id="78854D17FFF2FFCAFD43FF336AC4FF3B" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[646,705,234,249]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="cerdosa">
<emphasis id="8DF1EA86FFF2FFCAFD43FF336AC4FF3B" box="[646,705,234,249]" italics="true" pageId="3" pageNumber="286">cerdosa</emphasis>
</taxonomicName>
</td>
<td id="42645DAAFFF20036FCD7FF336B7CFF3B" box="[786,889,234,249]" gridcol="4" gridrow="1" pageId="3" pageNumber="286">
<taxonomicName id="78854D17FFF2FFCAFCD7FF336B7CFF3B" authorityName="Araújo &amp; Aragão &amp; Cordeiro &amp; Bravo &amp; Carvalho &amp; Andena" authorityYear="2018" box="[786,889,234,249]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="pseudoannae">
<emphasis id="8DF1EA86FFF2FFCAFCD7FF336B7CFF3B" box="[786,889,234,249]" italics="true" pageId="3" pageNumber="286">pseudoannae</emphasis>
</taxonomicName>
</td>
<td id="42645DAAFFF20036FC18FF336C61FF3B" box="[989,1124,234,249]" gridcol="5" gridrow="1" pageId="3" pageNumber="286">sp1 (F)</td>
<td id="42645DAAFFF20036FB6DFF336CF8FF3B" box="[1192,1277,234,249]" gridcol="6" gridrow="1" pageId="3" pageNumber="286">
<taxonomicName id="78854D17FFF2FFCAFB6DFF336CF8FF3B" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[1192,1277,234,249]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="ituberensis">
<emphasis id="8DF1EA86FFF2FFCAFB6DFF336CF8FF3B" box="[1192,1277,234,249]" italics="true" pageId="3" pageNumber="286">ituberensis</emphasis>
</taxonomicName>
</td>
<td id="42645DAAFFF20036FAF6FF336DBFFF3B" box="[1331,1466,234,249]" gridcol="7" gridrow="1" pageId="3" pageNumber="286">sp2 (F)</td>
</tr>
<tr id="01B534D6FFF20036FFA0FED46DBFFEDE" box="[101,1466,269,284]" gridrow="2" pageId="3" pageNumber="286" rowspan-1="1">
<th id="42645DAAFFF20036FFA0FED468FEFEDE" box="[101,251,269,284]" gridcol="0" gridrow="2" pageId="3" pageNumber="286">
#P4
<taxonomicName id="78854D17FFF2FFCAFF4FFED468D3FEDE" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[138,214,269,284]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="cerdosa">
<emphasis id="8DF1EA86FFF2FFCAFF4FFED468D3FEDE" box="[138,214,269,284]" italics="true" pageId="3" pageNumber="286">T. cerdosa</emphasis>
</taxonomicName>
</th>
<td id="42645DAAFFF20036FE7EFED46A39FEDE" box="[443,572,269,284]" gridcol="2" gridrow="2" pageId="3" pageNumber="286">0.156</td>
<td id="42645DAAFFF20036FD43FED46AC1FEDE" box="[646,708,269,284]" gridcol="3" gridrow="2" pageId="3" pageNumber="286">
<emphasis id="8DF1EA86FFF2FFCAFD43FED76AB1FEDE" bold="true" box="[646,692,270,284]" pageId="3" pageNumber="286">0.010</emphasis>
</td>
<td id="42645DAAFFF20036FCD7FED46B7CFEDE" box="[786,889,269,284]" gridcol="4" gridrow="2" pageId="3" pageNumber="286">0.162</td>
<td id="42645DAAFFF20036FC18FED46C61FEDE" box="[989,1124,269,284]" gridcol="5" gridrow="2" pageId="3" pageNumber="286">0.197</td>
<td id="42645DAAFFF20036FB6DFED46CF8FEDE" box="[1192,1277,269,284]" gridcol="6" gridrow="2" pageId="3" pageNumber="286">0.216</td>
<td id="42645DAAFFF20036FAF6FED46DBFFEDE" box="[1331,1466,269,284]" gridcol="7" gridrow="2" pageId="3" pageNumber="286">0.276</td>
</tr>
<tr id="01B534D6FFF20036FFA0FEFD6DBFFEF1" box="[101,1466,292,307]" gridrow="3" pageId="3" pageNumber="286" rowspan-2="1">
<th id="42645DAAFFF20036FFA0FEFD68FEFEF1" box="[101,251,292,307]" gridcol="0" gridrow="3" pageId="3" pageNumber="286">
#P46
<emphasis id="8DF1EA86FFF2FFCAFF51FEFD68A6FEF1" box="[148,163,292,307]" italics="true" pageId="3" pageNumber="286">T.</emphasis>
</th>
<td id="42645DAAFFF20036FEF5FEFD696EFEF1" box="[304,363,292,307]" gridcol="1" gridrow="3" pageId="3" pageNumber="286">0.156</td>
<td id="42645DAAFFF20036FD43FEFD6AC1FEF1" box="[646,708,292,307]" gridcol="3" gridrow="3" pageId="3" pageNumber="286">0.166</td>
<td id="42645DAAFFF20036FCD7FEFD6B7CFEF1" box="[786,889,292,307]" gridcol="4" gridrow="3" pageId="3" pageNumber="286">
<emphasis id="8DF1EA86FFF2FFCAFCD7FEFC6B45FEF1" bold="true" box="[786,832,293,307]" pageId="3" pageNumber="286">0.002</emphasis>
</td>
<td id="42645DAAFFF20036FC18FEFD6C61FEF1" box="[989,1124,292,307]" gridcol="5" gridrow="3" pageId="3" pageNumber="286">0.188</td>
<td id="42645DAAFFF20036FB6DFEFD6CF8FEF1" box="[1192,1277,292,307]" gridcol="6" gridrow="3" pageId="3" pageNumber="286">0.139</td>
<td id="42645DAAFFF20036FAF6FEFD6DBFFEF1" box="[1331,1466,292,307]" gridcol="7" gridrow="3" pageId="3" pageNumber="286">0.287</td>
</tr>
<tr id="01B534D6FFF20036FFA0FEE26DBFFE88" box="[101,1466,315,330]" gridrow="4" pageId="3" pageNumber="286">
<th id="42645DAAFFF20036FFA0FEE26DBFFE88" box="[101,1466,315,330]" colspan="8" colspanRight="7" gridcol="0" gridrow="4" pageId="3" pageNumber="286">
<taxonomicName id="78854D17FFF2FFCAFFB3FEE268D8FE88" authorityName="Araújo &amp; Aragão &amp; Cordeiro &amp; Bravo &amp; Carvalho &amp; Andena" authorityYear="2018" box="[118,221,315,330]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="pseudoannae">
<emphasis id="8DF1EA86FFF2FFCAFFB3FEE268D8FE88" box="[118,221,315,330]" italics="true" pageId="3" pageNumber="286">pseudoannae</emphasis>
</taxonomicName>
(F)
</th>
</tr>
<tr id="01B534D6FFF20036FFA0FE8B6DBFFEA3" box="[101,1466,338,353]" gridrow="5" pageId="3" pageNumber="286" rowspan-3="1">
<th id="42645DAAFFF20036FFA0FE8B68FEFEA3" box="[101,251,338,353]" gridcol="0" gridrow="5" pageId="3" pageNumber="286">
#T15
<taxonomicName id="78854D17FFF2FFCAFF51FE8B68E4FEA3" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[148,225,338,353]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="cerdosa">
<emphasis id="8DF1EA86FFF2FFCAFF51FE8B68E4FEA3" box="[148,225,338,353]" italics="true" pageId="3" pageNumber="286">T. cerdosa</emphasis>
</taxonomicName>
</th>
<td id="42645DAAFFF20036FEF5FE8B696EFEA3" box="[304,363,338,353]" gridcol="1" gridrow="5" pageId="3" pageNumber="286">
<emphasis id="8DF1EA86FFF2FFCAFEF5FE8A695BFEA3" bold="true" box="[304,350,339,353]" pageId="3" pageNumber="286">0.010</emphasis>
</td>
<td id="42645DAAFFF20036FE7EFE8B6A39FEA3" box="[443,572,338,353]" gridcol="2" gridrow="5" pageId="3" pageNumber="286">0.166</td>
<td id="42645DAAFFF20036FCD7FE8B6B7CFEA3" box="[786,889,338,353]" gridcol="4" gridrow="5" pageId="3" pageNumber="286">0.168</td>
<td id="42645DAAFFF20036FC18FE8B6C61FEA3" box="[989,1124,338,353]" gridcol="5" gridrow="5" pageId="3" pageNumber="286">0.201</td>
<td id="42645DAAFFF20036FB6DFE8B6CF8FEA3" box="[1192,1277,338,353]" gridcol="6" gridrow="5" pageId="3" pageNumber="286">0.220</td>
<td id="42645DAAFFF20036FAF6FE8B6DBFFEA3" box="[1331,1466,338,353]" gridcol="7" gridrow="5" pageId="3" pageNumber="286">0.294</td>
</tr>
<tr id="01B534D6FFF20036FFA0FEB06DBFFEBA" box="[101,1466,361,376]" gridrow="6" pageId="3" pageNumber="286" rowspan-4="1">
<th id="42645DAAFFF20036FFA0FEB068FEFEBA" box="[101,251,361,376]" gridcol="0" gridrow="6" pageId="3" pageNumber="286">
#P28
<emphasis id="8DF1EA86FFF2FFCAFF51FEB068A6FEBA" box="[148,163,361,376]" italics="true" pageId="3" pageNumber="286">T.</emphasis>
</th>
<td id="42645DAAFFF20036FEF5FEB0696EFEBA" box="[304,363,361,376]" gridcol="1" gridrow="6" pageId="3" pageNumber="286">0.162</td>
<td id="42645DAAFFF20036FE7EFEB06A39FEBA" box="[443,572,361,376]" gridcol="2" gridrow="6" pageId="3" pageNumber="286">
<emphasis id="8DF1EA86FFF2FFCAFE7EFEB069ECFEB5" bold="true" box="[443,489,361,375]" pageId="3" pageNumber="286">0.002</emphasis>
</td>
<td id="42645DAAFFF20036FD43FEB06AC1FEBA" box="[646,708,361,376]" gridcol="3" gridrow="6" pageId="3" pageNumber="286">0.168</td>
<td id="42645DAAFFF20036FC18FEB06C61FEBA" box="[989,1124,361,376]" gridcol="5" gridrow="6" pageId="3" pageNumber="286">0.202</td>
<td id="42645DAAFFF20036FB6DFEB06CF8FEBA" box="[1192,1277,361,376]" gridcol="6" gridrow="6" pageId="3" pageNumber="286">0.154</td>
<td id="42645DAAFFF20036FAF6FEB06DBFFEBA" box="[1331,1466,361,376]" gridcol="7" gridrow="6" pageId="3" pageNumber="286">0.304</td>
</tr>
<tr id="01B534D6FFF20036FFA0FE596DBFFE4D" box="[101,1466,384,399]" gridrow="7" pageId="3" pageNumber="286" rowspan-1="1" rowspan-2="1" rowspan-3="1" rowspan-4="1" rowspan-5="1" rowspan-6="1" rowspan-7="1">
<th id="42645DAAFFF20036FFA0FE5968FEFE4D" box="[101,251,384,399]" gridcol="0" gridrow="7" pageId="3" pageNumber="286">
<taxonomicName id="78854D17FFF2FFCAFFB3FE5968D8FE4D" authorityName="Araújo &amp; Aragão &amp; Cordeiro &amp; Bravo &amp; Carvalho &amp; Andena" authorityYear="2018" box="[118,221,384,399]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="pseudoannae">
<emphasis id="8DF1EA86FFF2FFCAFFB3FE5968D8FE4D" box="[118,221,384,399]" italics="true" pageId="3" pageNumber="286">pseudoannae</emphasis>
</taxonomicName>
</th>
</tr>
<tr id="01B534D6FFF20036FFA0FE4F6DBFFE67" box="[101,1466,406,421]" gridrow="8" pageId="3" pageNumber="286" rowspan-5="1">
<th id="42645DAAFFF20036FFA0FE4F68FEFE67" box="[101,251,406,421]" gridcol="0" gridrow="8" pageId="3" pageNumber="286">
#P29
<taxonomicName id="78854D17FFF2FFCAFF51FE4F68E9FE67" authorityName="Haliday" authorityYear="1839" box="[148,236,406,421]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="genus">
<emphasis id="8DF1EA86FFF2FFCAFF51FE4F68E9FE67" box="[148,236,406,421]" italics="true" pageId="3" pageNumber="286">Trichomyia</emphasis>
</taxonomicName>
</th>
<td id="42645DAAFFF20036FEF5FE4F696EFE67" box="[304,363,406,421]" gridcol="1" gridrow="8" pageId="3" pageNumber="286">0.197</td>
<td id="42645DAAFFF20036FE7EFE4F6A39FE67" box="[443,572,406,421]" gridcol="2" gridrow="8" pageId="3" pageNumber="286">0.188</td>
<td id="42645DAAFFF20036FD43FE4F6AC1FE67" box="[646,708,406,421]" gridcol="3" gridrow="8" pageId="3" pageNumber="286">0.201</td>
<td id="42645DAAFFF20036FCD7FE4F6B7CFE67" box="[786,889,406,421]" gridcol="4" gridrow="8" pageId="3" pageNumber="286">0.202</td>
<td id="42645DAAFFF20036FB6DFE4F6CF8FE67" box="[1192,1277,406,421]" gridcol="6" gridrow="8" pageId="3" pageNumber="286">0.218</td>
<td id="42645DAAFFF20036FAF6FE4F6DBFFE67" box="[1331,1466,406,421]" gridcol="7" gridrow="8" pageId="3" pageNumber="286">0.388</td>
</tr>
<tr id="01B534D6FFF20036FFA0FE776DBFFE7E" box="[101,1466,430,444]" gridrow="9" pageId="3" pageNumber="286">
<th id="42645DAAFFF20036FFA0FE776DBFFE7E" box="[101,1466,430,444]" colspan="8" colspanRight="7" gridcol="0" gridrow="9" pageId="3" pageNumber="286">sp.1 (F)</th>
</tr>
<tr id="01B534D6FFF20036FFA0FE1D6DBFFE11" box="[101,1466,452,467]" gridrow="10" pageId="3" pageNumber="286" rowspan-6="1">
<th id="42645DAAFFF20036FFA0FE1D68FEFE11" box="[101,251,452,467]" gridcol="0" gridrow="10" pageId="3" pageNumber="286">
#P21
<taxonomicName id="78854D17FFF2FFCAFF51FE1D68FEFE11" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[148,251,452,467]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="ituberensis">
<emphasis id="8DF1EA86FFF2FFCAFF51FE1D68FEFE11" box="[148,251,452,467]" italics="true" pageId="3" pageNumber="286">T. ituberensis</emphasis>
</taxonomicName>
</th>
<td id="42645DAAFFF20036FEF5FE1D696EFE11" box="[304,363,452,467]" gridcol="1" gridrow="10" pageId="3" pageNumber="286">0.216</td>
<td id="42645DAAFFF20036FE7EFE1D6A39FE11" box="[443,572,452,467]" gridcol="2" gridrow="10" pageId="3" pageNumber="286">0.139</td>
<td id="42645DAAFFF20036FD43FE1D6AC1FE11" box="[646,708,452,467]" gridcol="3" gridrow="10" pageId="3" pageNumber="286">0.220</td>
<td id="42645DAAFFF20036FCD7FE1D6B7CFE11" box="[786,889,452,467]" gridcol="4" gridrow="10" pageId="3" pageNumber="286">0.154</td>
<td id="42645DAAFFF20036FC18FE1D6C61FE11" box="[989,1124,452,467]" gridcol="5" gridrow="10" pageId="3" pageNumber="286">0.218</td>
<td id="42645DAAFFF20036FAF6FE1D6DBFFE11" box="[1331,1466,452,467]" gridcol="7" gridrow="10" pageId="3" pageNumber="286">0.314</td>
</tr>
<tr id="01B534D6FFF20036FFA0FE026DBFFE28" box="[101,1466,475,490]" gridrow="11" pageId="3" pageNumber="286" rowspan-7="1">
<th id="42645DAAFFF20036FFA0FE0268FEFE28" box="[101,251,475,490]" gridcol="0" gridrow="11" pageId="3" pageNumber="286">
#P44
<taxonomicName id="78854D17FFF2FFCAFF51FE0268E9FE28" authorityName="Haliday" authorityYear="1839" box="[148,236,475,490]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="genus">
<emphasis id="8DF1EA86FFF2FFCAFF51FE0268E9FE28" box="[148,236,475,490]" italics="true" pageId="3" pageNumber="286">Trichomyia</emphasis>
</taxonomicName>
</th>
<td id="42645DAAFFF20036FEF5FE02696EFE28" box="[304,363,475,490]" gridcol="1" gridrow="11" pageId="3" pageNumber="286">0.276</td>
<td id="42645DAAFFF20036FE7EFE026A39FE28" box="[443,572,475,490]" gridcol="2" gridrow="11" pageId="3" pageNumber="286">0.287</td>
<td id="42645DAAFFF20036FD43FE026AC1FE28" box="[646,708,475,490]" gridcol="3" gridrow="11" pageId="3" pageNumber="286">0.294</td>
<td id="42645DAAFFF20036FCD7FE026B7CFE28" box="[786,889,475,490]" gridcol="4" gridrow="11" pageId="3" pageNumber="286">0.304</td>
<td id="42645DAAFFF20036FC18FE026C61FE28" box="[989,1124,475,490]" gridcol="5" gridrow="11" pageId="3" pageNumber="286">0.388</td>
<td id="42645DAAFFF20036FB6DFE026CF8FE28" box="[1192,1277,475,490]" gridcol="6" gridrow="11" pageId="3" pageNumber="286">0.314</td>
</tr>
<tr id="01B534D6FFF20036FFA0FE2A6DBFFDC3" box="[101,1466,499,513]" gridrow="12" pageId="3" pageNumber="286">
<th id="42645DAAFFF20036FFA0FE2A6DBFFDC3" box="[101,1466,499,513]" colspan="8" colspanRight="7" gridcol="0" gridrow="12" pageId="3" pageNumber="286">sp.2 (F)</th>
</tr>
</table>
</paragraph>
<paragraph id="BF3A3694FFF2FFCAFEBEFDEC6AC2FD0B" blockId="3.[379,550,565,580]" box="[379,711,565,713]" lastBlockId="3.[586,711,698,713]" pageId="3" pageNumber="286">
P46
<taxonomicName id="78854D17FFF2FFCAFE59FDEC6A08FD86" authorityName="Araújo &amp; Aragão &amp; Cordeiro &amp; Bravo &amp; Carvalho &amp; Andena" authorityYear="2018" box="[412,525,565,580]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="pseudoannae">T. pseudoannae</taxonomicName>
(F) P21
<taxonomicName id="78854D17FFF2FFCAFDAFFD636AC2FD0B" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[618,711,698,713]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="ituberensis">T. ituberensis</taxonomicName>
</paragraph>
<paragraph id="BF3A3694FFF2FFCAFD82FC1D6AE2FC11" blockId="3.[583,743,964,979]" box="[583,743,964,979]" pageId="3" pageNumber="286">
P44
<taxonomicName id="78854D17FFF2FFCAFDA6FC1D6ACBFC11" box="[611,718,964,979]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="286" phylum="Arthropoda" rank="species" species="undefined-2">Trichomyia sp2</taxonomicName>
(F)
</paragraph>
<paragraph id="BF3A3694FFF2FFCAFF7DFBF868E5FBF2" blockId="3.[184,224,1057,1072]" box="[184,224,1057,1072]" pageId="3" pageNumber="286">0.050</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -1,42 +1,43 @@
<document id="7F868F2A15F7863D95C8B94C869502FC" ID-DOI="10.1016/j.rbe.2018.11.004" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635836314" checkinUser="felipe" docAuthor="Silveira, Orlando Tobias" docDate="2019" docId="5558D340FFC10869FC8AF9B4B069F9F3" docLanguage="en" docName="RevBrasEntomol.63.1.53-72.pdf" docOrigin="Revista Brasileira de Entomologia 63 (1)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.11.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Mischocyttarus mixtus Richards 1978" docType="treatment" docVersion="1" lastPageNumber="69" masterDocId="A961AB38FFCE0879FFAEFFB2B448FFE9" masterDocTitle="Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)" masterLastPageNumber="72" masterPageNumber="53" pageNumber="68" updateTime="1722680433140" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0"> <document id="4FC02ACFE0F2AB9EA58F455FBD317FC9" ID-DOI="10.1016/j.rbe.2018.11.004" ID-ISSN="1806-9665" ID-Zenodo-Dep="13196034" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635836314" checkinUser="felipe" docAuthor="Silveira, Orlando Tobias" docDate="2019" docId="5558D340FFC10869FC8AF9B4B069F9F3" docLanguage="en" docName="RevBrasEntomol.63.1.53-72.pdf" docOrigin="Revista Brasileira de Entomologia 63 (1)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.11.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Mischocyttarus mixtus Richards 1978" docType="treatment" docVersion="2" lastPageNumber="69" masterDocId="A961AB38FFCE0879FFAEFFB2B448FFE9" masterDocTitle="Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)" masterLastPageNumber="72" masterPageNumber="53" pageNumber="68" updateTime="1722683539161" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="CDB140E7767948A7CDA1874D28FC40C6" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="8D36B0763665FB9AAD8C249C8B410F1E" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="A2DD916A7C984E1D4F48069ADED8F4A2"> <mods:titleInfo id="5E12839BECC4CFBD905500D3776D04D9">
<mods:title id="62208803F73C5184986E69E1461AD8E8">Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)</mods:title> <mods:title id="DB748E7F59A9048DD9B52C046BB02D2A">Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="0F0D514300578B9A8DA16058FCA3A924" type="personal"> <mods:name id="2DB9B0DFCED3CFC256ED20D2CB97C39A" type="personal">
<mods:role id="97136491A3B51001359DCC367A455E8A"> <mods:role id="FB7A128CB1C547773D374AAAF1910D31">
<mods:roleTerm id="66A71F5C229A29FFE16AE21F1AF685DA">Author</mods:roleTerm> <mods:roleTerm id="D77C23D5A3B9E374315C69D8C60E1202">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="FB3766822896B2BD316062EA51C94A15">Silveira, Orlando Tobias</mods:namePart> <mods:namePart id="D2E1DBC83C87238F18C9F80B3B4116CC">Silveira, Orlando Tobias</mods:namePart>
</mods:name> </mods:name>
<mods:typeOfResource id="734689E8B02817F97B9EC02BCB56209C">text</mods:typeOfResource> <mods:typeOfResource id="F1391752CD5C2B5478EA39204E7F3075">text</mods:typeOfResource>
<mods:relatedItem id="3640795BC819EF657492C36E9CB03C8F" type="host"> <mods:relatedItem id="9C3677CD9A7130834D9E932F8E7DEC84" type="host">
<mods:titleInfo id="ADD75531E4AB80349E8ABF087A0D108E"> <mods:titleInfo id="5D1AC287FD170F02AC13602E0BF592FB">
<mods:title id="B2FA8854EA0AA17EF18866EC56B92F2F">Revista Brasileira de Entomologia</mods:title> <mods:title id="12378E3CE9BB32523B6EAAAF0869F712">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="C0B9E492A78CA98F60BC2EF1BE0CCBC4"> <mods:part id="8F0CFEB267D249BD88F02E87AD0F25CD">
<mods:date id="37A7AD710DBDEF3F5F627362AB65F64D">2019</mods:date> <mods:date id="15CD69CBA3B8E9AF81908564922D8271">2019</mods:date>
<mods:detail id="FC9218E3033C8BE54AF4BFE4A5716EB3" type="pubDate"> <mods:detail id="617B04CE64FA51F8E7379EA0E5530A34" type="pubDate">
<mods:number id="859790875EE4A189ACDC3FED6735949A">2018-12-11</mods:number> <mods:number id="07C423C9DD9E0DFE6C1180D48B4A89CE">2018-12-11</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="F8F0E96337D766689A1FC36C6FB18A7A" type="volume"> <mods:detail id="D254282DF95508FB3AABDB01B0AE88B8" type="volume">
<mods:number id="590ADB3E6E4A9BE713AEC95267031BB8">63</mods:number> <mods:number id="4F57F71A8DB2FDE515C91A4ADA7E8F3C">63</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="D9AB3C090A3BE4902E52B11E66665701" type="issue"> <mods:detail id="414BB3050ECADF9EE7219099AE1435AA" type="issue">
<mods:number id="6254E6FDCF72A1ACF5648BABD680171D">1</mods:number> <mods:number id="C66F7F99B5DFF3718882B7A9565E1C4E">1</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="F20BC254306E9EA06FC502C5C5C2E5EA" unit="page"> <mods:extent id="085F49FF59FDDD1ACEFDC34CA2428500" unit="page">
<mods:start id="114709D39C1BD51EEAC3765B4EE0BE51">53</mods:start> <mods:start id="04B2EB0294A3C8C9641A84F0B687C872">53</mods:start>
<mods:end id="BEB2DF86FC7C02BFB2DFBD4CE5A33353">72</mods:end> <mods:end id="87AB7BA82EDB34E6C53919AF73A94A81">72</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="4BE027511EA69DB9AEAEEF2626976B7C"> <mods:location id="C24F603C3D6D9A7FD5A5FB727E7AE234">
<mods:url id="6F4DDD5AA6ABF3A1E4363B5214503170">http://dx.doi.org/10.1016/j.rbe.2018.11.004</mods:url> <mods:url id="FD7360E1C50158B1CBEFD4F93075E347">http://dx.doi.org/10.1016/j.rbe.2018.11.004</mods:url>
</mods:location> </mods:location>
<mods:classification id="69336A532460E285CD8D1984834F1347">journal article</mods:classification> <mods:classification id="CB922226395AD46DE7A1E7C2931A1842">journal article</mods:classification>
<mods:identifier id="7905F42CD818A9C7859D0E76D3D22BFA" type="DOI">10.1016/j.rbe.2018.11.004</mods:identifier> <mods:identifier id="C37D7341AD0DB3694866EA2DEFC5059A" type="DOI">10.1016/j.rbe.2018.11.004</mods:identifier>
<mods:identifier id="09A74CC5B8B5C5804240D72CFEF3BB15" type="ISSN">1806-9665</mods:identifier> <mods:identifier id="3E3A32D211537629742003546BCFBF52" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="CAA4FE6A77D37A5C95A3F1709EF67418" type="Zenodo-Dep">13196034</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="5558D340FFC10869FC8AF9B4B069F9F3" LSID="urn:lsid:plazi:treatment:5558D340FFC10869FC8AF9B4B069F9F3" httpUri="http://treatment.plazi.org/id/5558D340FFC10869FC8AF9B4B069F9F3" lastPageId="16" lastPageNumber="69" pageId="15" pageNumber="68"> <treatment id="5558D340FFC10869FC8AF9B4B069F9F3" LSID="urn:lsid:plazi:treatment:5558D340FFC10869FC8AF9B4B069F9F3" httpUri="http://treatment.plazi.org/id/5558D340FFC10869FC8AF9B4B069F9F3" lastPageId="16" lastPageNumber="69" pageId="15" pageNumber="68">
<subSubSection id="95EB31DDFFC10876FC8AF9B4B0DEF9F3" box="[804,1174,1542,1562]" pageId="15" pageNumber="68" type="nomenclature"> <subSubSection id="95EB31DDFFC10876FC8AF9B4B0DEF9F3" box="[804,1174,1542,1562]" pageId="15" pageNumber="68" type="nomenclature">
@ -52,9 +53,9 @@ Richards 1978
<subSubSection id="95EB31DDFFC10869FC8AF991B069F9F3" lastPageId="16" lastPageNumber="69" pageId="15" pageNumber="68" type="description"> <subSubSection id="95EB31DDFFC10869FC8AF991B069F9F3" lastPageId="16" lastPageNumber="69" pageId="15" pageNumber="68" type="description">
<paragraph id="DD4E6256FFC10876FC8AF991B061F9DF" blockId="15.[804,1475,1542,1674]" box="[804,1065,1570,1590]" pageId="15" pageNumber="68"> <paragraph id="DD4E6256FFC10876FC8AF991B061F9DF" blockId="15.[804,1475,1542,1674]" box="[804,1065,1570,1590]" pageId="15" pageNumber="68">
( (
<figureCitation id="45CA7ED3FFC10876FC82F990B79EF9DF" box="[812,982,1570,1590]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." pageId="15" pageNumber="68">Figs. 6; 9; 11; 13</figureCitation> <figureCitation id="45CA7ED3FFC10876FC82F990B79EF9DF" box="[812,982,1570,1590]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." figureDoi="http://doi.org/10.5281/zenodo.13196038" httpUri="https://zenodo.org/record/13196038/files/figure.png" pageId="15" pageNumber="68">Figs. 6; 9; 11; 13</figureCitation>
; ;
<figureCitation id="45CA7ED3FFC10876FC4EF991B069F9DF" box="[992,1057,1571,1590]" captionStart="Figs" captionStartId="6.[114,149,1355,1369]" captionTargetBox="[390,1225,149,1324]" captionTargetId="figure-11@6.[390,1225,149,1324]" captionTargetPageId="6" captionText="Figs. 2734. General dorsal and lateral body views (females). 2728: M. mourei (Brazil, PR, Curitiba, paralectotype, IOC); 2930: M. barbatus (Colombia: Antioquia, MPEG); 3132:M.mixtus (Mexico:Chiapas, EBCC); 3334:M.imeldai (33 dorsal holotype, Peru, IOC) (34 lateral Bolivia,NHM); all scales =1.0 mm; scales in figs. (2728), (3334) are estimates." pageId="15" pageNumber="68">31; 32</figureCitation> <figureCitation id="45CA7ED3FFC10876FC4EF991B069F9DF" box="[992,1057,1571,1590]" captionStart="Figs" captionStartId="6.[114,149,1355,1369]" captionTargetBox="[390,1225,149,1324]" captionTargetId="figure-11@6.[390,1225,149,1324]" captionTargetPageId="6" captionText="Figs. 2734. General dorsal and lateral body views (females). 2728: M. mourei (Brazil, PR, Curitiba, paralectotype, IOC); 2930: M. barbatus (Colombia: Antioquia, MPEG); 3132:M.mixtus (Mexico:Chiapas, EBCC); 3334:M.imeldai (33 dorsal holotype, Peru, IOC) (34 lateral Bolivia,NHM); all scales =1.0 mm; scales in figs. (2728), (3334) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196042" httpUri="https://zenodo.org/record/13196042/files/figure.png" pageId="15" pageNumber="68">31; 32</figureCitation>
) )
</paragraph> </paragraph>
<paragraph id="DD4E6256FFC10876FC8AF98FB092F963" blockId="15.[804,1475,1542,1674]" pageId="15" pageNumber="68"> <paragraph id="DD4E6256FFC10876FC8AF98FB092F963" blockId="15.[804,1475,1542,1674]" pageId="15" pageNumber="68">
@ -123,7 +124,7 @@ Vestiture: eyes bare; clypeus covered by fine appressed shining (silvery) pubesc
</paragraph> </paragraph>
<paragraph id="DD4E6256FFDE0869FF3CFA61B7A0FDD8" blockId="16.[114,786,152,1985]" lastBlockId="16.[833,1504,152,561]" pageId="16" pageNumber="69"> <paragraph id="DD4E6256FFDE0869FF3CFA61B7A0FDD8" blockId="16.[114,786,152,1985]" lastBlockId="16.[833,1504,152,561]" pageId="16" pageNumber="69">
Color (see Color (see
<figureCitation id="45CA7ED3FFDE0869FF50FA61B53AFA0F" box="[254,370,1491,1510]" captionStart="Figs" captionStartId="6.[114,149,1355,1369]" captionTargetBox="[390,1225,149,1324]" captionTargetId="figure-11@6.[390,1225,149,1324]" captionTargetPageId="6" captionText="Figs. 2734. General dorsal and lateral body views (females). 2728: M. mourei (Brazil, PR, Curitiba, paralectotype, IOC); 2930: M. barbatus (Colombia: Antioquia, MPEG); 3132:M.mixtus (Mexico:Chiapas, EBCC); 3334:M.imeldai (33 dorsal holotype, Peru, IOC) (34 lateral Bolivia,NHM); all scales =1.0 mm; scales in figs. (2728), (3334) are estimates." pageId="16" pageNumber="69">Figs. 31; 32</figureCitation> <figureCitation id="45CA7ED3FFDE0869FF50FA61B53AFA0F" box="[254,370,1491,1510]" captionStart="Figs" captionStartId="6.[114,149,1355,1369]" captionTargetBox="[390,1225,149,1324]" captionTargetId="figure-11@6.[390,1225,149,1324]" captionTargetPageId="6" captionText="Figs. 2734. General dorsal and lateral body views (females). 2728: M. mourei (Brazil, PR, Curitiba, paralectotype, IOC); 2930: M. barbatus (Colombia: Antioquia, MPEG); 3132:M.mixtus (Mexico:Chiapas, EBCC); 3334:M.imeldai (33 dorsal holotype, Peru, IOC) (34 lateral Bolivia,NHM); all scales =1.0 mm; scales in figs. (2728), (3334) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196042" httpUri="https://zenodo.org/record/13196042/files/figure.png" pageId="16" pageNumber="69">Figs. 31; 32</figureCitation>
): Black; mandible anteriorly and basally mostly yellow gradually turning to reddish brown at apex; antennal articles 912 yellowish to light reddish beneath; apical area of clypeus reddish yellow to light reddish brown (in north of ): Black; mandible anteriorly and basally mostly yellow gradually turning to reddish brown at apex; antennal articles 912 yellowish to light reddish beneath; apical area of clypeus reddish yellow to light reddish brown (in north of
<collectingCountry id="A5E622C6FFDE0869FF3FF9F0B493F9BC" box="[145,219,1602,1621]" name="Mexico" pageId="16" pageNumber="69">Mexico</collectingCountry> <collectingCountry id="A5E622C6FFDE0869FF3FF9F0B493F9BC" box="[145,219,1602,1621]" name="Mexico" pageId="16" pageNumber="69">Mexico</collectingCountry>
specimens, the ventral half of clypeus and a dorsal spot are yellow, separated by a blackish area); inner orbits to about center of ocular sinus, genal stripe (outer orbit), yellow to reddish yellow, sometimes interrupted or blurred below; small mark on pronotum ventral corner (sometimes reddish, or entirely absent), tubercle (sometimes reddish, or entirely absent), carina (sometimes discontinuously), and hind margin of pronotum (sometimes indistinct or reddish), front margin of metanotum narrowly (sometimes absent), propodeal valves (sometimes dark), and paired propodeal posterior dorsal spots (sometimes only small dots, or fading reddish, or entirely absent), one dorsolateral stripe on mid coxa (sometimes just a dot, or absent), one outer dorsal stripe on hind coxae (sometimes absent), none inner stripe on hind coxa; small apical mark on all femora; distal lateral marks on metasomal sternum 1 (sometimes absent), narrow distal bands on metasomal terga l-2 (or -4, somewhat indistinctly, or without any tergal bands) and sterna 2 (or -4, somewhat indistinctly, or without any sternal bands), yellow; axillar spot and most of disc of scutellum light reddish brown; other red suffused areas on lateral (sometimes hind margin) of pronotum, mesepisternum and upper and lower metapleural plate; posterior margin of meso and metasternum extending laterally to border of coxal articulation (sometimes indistinct), anterior ventral face of fore and mid coxae (hind coxae only distally very narrowly), and all trochanters, elongate marks on anterior face of all femora (interrupted on fore femur) and tibiae, light reddish brown specimens, the ventral half of clypeus and a dorsal spot are yellow, separated by a blackish area); inner orbits to about center of ocular sinus, genal stripe (outer orbit), yellow to reddish yellow, sometimes interrupted or blurred below; small mark on pronotum ventral corner (sometimes reddish, or entirely absent), tubercle (sometimes reddish, or entirely absent), carina (sometimes discontinuously), and hind margin of pronotum (sometimes indistinct or reddish), front margin of metanotum narrowly (sometimes absent), propodeal valves (sometimes dark), and paired propodeal posterior dorsal spots (sometimes only small dots, or fading reddish, or entirely absent), one dorsolateral stripe on mid coxa (sometimes just a dot, or absent), one outer dorsal stripe on hind coxae (sometimes absent), none inner stripe on hind coxa; small apical mark on all femora; distal lateral marks on metasomal sternum 1 (sometimes absent), narrow distal bands on metasomal terga l-2 (or -4, somewhat indistinctly, or without any tergal bands) and sterna 2 (or -4, somewhat indistinctly, or without any sternal bands), yellow; axillar spot and most of disc of scutellum light reddish brown; other red suffused areas on lateral (sometimes hind margin) of pronotum, mesepisternum and upper and lower metapleural plate; posterior margin of meso and metasternum extending laterally to border of coxal articulation (sometimes indistinct), anterior ventral face of fore and mid coxae (hind coxae only distally very narrowly), and all trochanters, elongate marks on anterior face of all femora (interrupted on fore femur) and tibiae, light reddish brown
@ -144,7 +145,7 @@ Distribution Mexico and Central America:
; ;
<collectingCountry id="A5E622C6FFDE0869FAAFFC68B11AFC04" box="[1281,1362,986,1005]" name="Panama" pageId="16" pageNumber="69">Panamá</collectingCountry> <collectingCountry id="A5E622C6FFDE0869FAAFFC68B11AFC04" box="[1281,1362,986,1005]" name="Panama" pageId="16" pageNumber="69">Panamá</collectingCountry>
( (
<figureCitation id="45CA7ED3FFDE0869FACEFC68B1EAFC04" box="[1376,1442,986,1005]" captionStart="Fig" captionStartId="15.[85,112,1463,1477]" captionTargetBox="[301,1260,799,1432]" captionTargetId="figure-149@15.[300,1260,796,1433]" captionTargetPageId="15" captionText="Fig. 46. Partial truncated map for Central and South America with species distributions for the M. barbatus group, and with the pooled distribution of the group of M.wagneri (see next figure for detailed representation of distributions of species of this group)." pageId="16" pageNumber="69">Fig. 46</figureCitation> <figureCitation id="45CA7ED3FFDE0869FACEFC68B1EAFC04" box="[1376,1442,986,1005]" captionStart="Fig" captionStartId="15.[85,112,1463,1477]" captionTargetBox="[301,1260,799,1432]" captionTargetId="figure-149@15.[300,1260,796,1433]" captionTargetPageId="15" captionText="Fig. 46. Partial truncated map for Central and South America with species distributions for the M. barbatus group, and with the pooled distribution of the group of M.wagneri (see next figure for detailed representation of distributions of species of this group)." figureDoi="http://doi.org/10.5281/zenodo.13196052" httpUri="https://zenodo.org/record/13196052/files/figure.png" pageId="16" pageNumber="69">Fig. 46</figureCitation>
) )
</paragraph> </paragraph>
<paragraph id="DD4E6256FFDE0869FCEFFBADB7D1FBDB" blockId="16.[833,1504,1055,1354]" box="[833,921,1055,1074]" pageId="16" pageNumber="69">Remarks</paragraph> <paragraph id="DD4E6256FFDE0869FCEFFBADB7D1FBDB" blockId="16.[833,1504,1055,1354]" box="[833,921,1055,1074]" pageId="16" pageNumber="69">Remarks</paragraph>

View file

@ -1,44 +1,45 @@
<document id="B935DC5869A89A93E18634AE7480B39D" ID-DOI="10.1016/j.rbe.2018.11.004" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635836314" checkinUser="felipe" docAuthor="Silveira, Orlando Tobias" docDate="2019" docId="5558D340FFC60873FFDCFBFFB5EBFC05" docLanguage="en" docName="RevBrasEntomol.63.1.53-72.pdf" docOrigin="Revista Brasileira de Entomologia 63 (1)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.11.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Mischocyttarus camanducaia Silveira, 2019, sp. nov." docType="treatment" docVersion="1" lastPageNumber="63" masterDocId="A961AB38FFCE0879FFAEFFB2B448FFE9" masterDocTitle="Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)" masterLastPageNumber="72" masterPageNumber="53" pageNumber="61" updateTime="1722680433140" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0"> <document id="95A54C7FBAE151B423C7439F58481D5A" ID-DOI="10.1016/j.rbe.2018.11.004" ID-ISSN="1806-9665" ID-Zenodo-Dep="13196034" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635836314" checkinUser="felipe" docAuthor="Silveira, Orlando Tobias" docDate="2019" docId="5558D340FFC60873FFDCFBFFB5EBFC05" docLanguage="en" docName="RevBrasEntomol.63.1.53-72.pdf" docOrigin="Revista Brasileira de Entomologia 63 (1)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.11.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Mischocyttarus camanducaia Silveira, 2019, sp. nov." docType="treatment" docVersion="3" lastPageNumber="63" masterDocId="A961AB38FFCE0879FFAEFFB2B448FFE9" masterDocTitle="Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)" masterLastPageNumber="72" masterPageNumber="53" pageNumber="61" updateTime="1722683539161" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="006F8F10375A5148CA573213987E0521" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="D9FC77667EE49C2C9F65EC086B11DB62" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="AE30204F87D48E1B839D4956F6CC7F2B"> <mods:titleInfo id="BA7C61722AC867BF0E5CA8BD128DB698">
<mods:title id="4DF86770D0C5682E5C952EC23E7B913F">Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)</mods:title> <mods:title id="9F9A803D1596352468F3DA42078C98A7">Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="27EF45E3DE479FA7A70B7C05A20016E3" type="personal"> <mods:name id="56E10083CA5BC3095B1BB826ED6C901A" type="personal">
<mods:role id="F84FF14ECC62447F61F6F9DA918C04D2"> <mods:role id="DE762B6157E004201D082D4DAAB40EC3">
<mods:roleTerm id="2820AE6E4A3E05580D859679FEA4E18A">Author</mods:roleTerm> <mods:roleTerm id="E5885DBF2D09AA72C692AD3341A3E976">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="9895089D75B22D433D13A95D7FB445BA">Silveira, Orlando Tobias</mods:namePart> <mods:namePart id="6A83DF4CB4032C76015D7C301AF58B45">Silveira, Orlando Tobias</mods:namePart>
</mods:name> </mods:name>
<mods:typeOfResource id="2AA8652A0FFB7CB4D7B9EC2D00A2DA7A">text</mods:typeOfResource> <mods:typeOfResource id="681E69BD40A67D9BC9F75C04FB6C377F">text</mods:typeOfResource>
<mods:relatedItem id="0CB6CCF046D8971E9C62FFC68B9D6C5E" type="host"> <mods:relatedItem id="D27FDC2D50AA714A0456AD3BAAC98724" type="host">
<mods:titleInfo id="803BE9CECF56B3F46AA16BC01BB7B3BC"> <mods:titleInfo id="3E2269D38E92E4980473DD32A94E878F">
<mods:title id="39FC80F499FB9F0105AFC5EA58FA63CC">Revista Brasileira de Entomologia</mods:title> <mods:title id="6A478E72826A5822CFEE67B92EF8018B">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="B72E2624FA31D95E8353168E9409EB6C"> <mods:part id="90F436305DC898C0C9EECAB916057917">
<mods:date id="E26E7F5FB50AD9715C8D9D8A558B13AF">2019</mods:date> <mods:date id="CEEFD1BFDA9E7323AEAC89494077677C">2019</mods:date>
<mods:detail id="2B9B33940DCDFDBA2255D37D5BDB5181" type="pubDate"> <mods:detail id="2E2D82F8B6D333824064C3117E9F0A91" type="pubDate">
<mods:number id="C5EA8A5590E4C3652CC8E19FEFCB3115">2018-12-11</mods:number> <mods:number id="DD9B2963F0B2DFD5CB91F3F9FAF2E542">2018-12-11</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="17BCD5A1100836D6377AD2030F6EBAD8" type="volume"> <mods:detail id="E941D9488AA5B05FB4B52779B5ABB6B9" type="volume">
<mods:number id="880DFA41FCE661B5C1E969550C3B1312">63</mods:number> <mods:number id="5620333746C8477D96114A09A8F33EBC">63</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="BD92CE591178AF21373BF259DFFCDE9E" type="issue"> <mods:detail id="DD5925367D4E8EEC10064A7EC49E9F23" type="issue">
<mods:number id="13D3911AFFDEDC1D54B242B8AA56282A">1</mods:number> <mods:number id="A264D9F7EAC5EE1153116C690EB28B79">1</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="82CF71BAB5720F57029CE7E67EE29B0C" unit="page"> <mods:extent id="287CFDC315A3C1EB969683AEDC4AC122" unit="page">
<mods:start id="7607F727975D20D7D79DBA1FEA26E998">53</mods:start> <mods:start id="7B840C0BB4C69CB823E3D0EE448473A7">53</mods:start>
<mods:end id="17FD1D0F00EEEF44CA900ADF59E21E74">72</mods:end> <mods:end id="F8F70BBC52B8D87C5927DD84A58B71FE">72</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="677026353671DDC32B6C433EE37E6969"> <mods:location id="65C1FBCA43EF74E70C4B052C51F6CADD">
<mods:url id="03F67738F1543A9BD7E50E18B993B1A4">http://dx.doi.org/10.1016/j.rbe.2018.11.004</mods:url> <mods:url id="06063498E84E0E5B01DF528643089F8B">http://dx.doi.org/10.1016/j.rbe.2018.11.004</mods:url>
</mods:location> </mods:location>
<mods:classification id="FFC14836A4C55C2CC4B018F5FFD8D867">journal article</mods:classification> <mods:classification id="3C2F2E2B1AAAF904C089F31BFA83A5AD">journal article</mods:classification>
<mods:identifier id="2C949EF09C2CB6DE60AD0E0992EF209E" type="DOI">10.1016/j.rbe.2018.11.004</mods:identifier> <mods:identifier id="CCCB6E46A3193039E5B4CE9795229204" type="DOI">10.1016/j.rbe.2018.11.004</mods:identifier>
<mods:identifier id="4A52CE641F1D0C160B56A8D0C7D8A0DA" type="ISSN">1806-9665</mods:identifier> <mods:identifier id="4523DCEE7B40D7AF4461BC576CF24717" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="2A7C60E9B5F481258359697C91062C46" type="Zenodo-Dep">13196034</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="5558D340FFC60873FFDCFBFFB5EBFC05" LSID="urn:lsid:plazi:treatment:5558D340FFC60873FFDCFBFFB5EBFC05" httpUri="http://treatment.plazi.org/id/5558D340FFC60873FFDCFBFFB5EBFC05" lastPageId="10" lastPageNumber="63" pageId="8" pageNumber="61"> <treatment id="5558D340FFC60873FFDCFBFFB5EBFC05" ID-DOI="http://doi.org/10.5281/zenodo.13194831" ID-Zenodo-Dep="13194831" LSID="urn:lsid:plazi:treatment:5558D340FFC60873FFDCFBFFB5EBFC05" httpUri="http://treatment.plazi.org/id/5558D340FFC60873FFDCFBFFB5EBFC05" lastPageId="10" lastPageNumber="63" pageId="8" pageNumber="61">
<subSubSection id="95EB31DDFFC60871FFDCFBFFB5AAFB88" box="[114,482,1101,1121]" pageId="8" pageNumber="61" type="nomenclature"> <subSubSection id="95EB31DDFFC60871FFDCFBFFB5AAFB88" box="[114,482,1101,1121]" pageId="8" pageNumber="61" type="nomenclature">
<paragraph id="DD4E6256FFC60871FFDCFBFFB5AAFB88" blockId="8.[114,786,1101,1233]" box="[114,482,1101,1121]" pageId="8" pageNumber="61"> <paragraph id="DD4E6256FFC60871FFDCFBFFB5AAFB88" blockId="8.[114,786,1101,1233]" box="[114,482,1101,1121]" pageId="8" pageNumber="61">
<heading id="8606D53AFFC60871FFDCFBFFB5AAFB88" box="[114,482,1101,1121]" fontSize="8" level="2" pageId="8" pageNumber="61" reason="6"> <heading id="8606D53AFFC60871FFDCFBFFB5AAFB88" box="[114,482,1101,1121]" fontSize="8" level="2" pageId="8" pageNumber="61" reason="6">
@ -52,11 +53,11 @@
<subSubSection id="95EB31DDFFC60873FFDCFBD8B5EBFC05" lastPageId="10" lastPageNumber="63" pageId="8" pageNumber="61" type="description"> <subSubSection id="95EB31DDFFC60873FFDCFBD8B5EBFC05" lastPageId="10" lastPageNumber="63" pageId="8" pageNumber="61" type="description">
<paragraph id="DD4E6256FFC60871FFDCFBD8B518FB94" blockId="8.[114,786,1101,1233]" box="[114,336,1129,1149]" pageId="8" pageNumber="61"> <paragraph id="DD4E6256FFC60871FFDCFBD8B518FB94" blockId="8.[114,786,1101,1233]" box="[114,336,1129,1149]" pageId="8" pageNumber="61">
( (
<figureCitation id="45CA7ED3FFC60871FFD4FBD8B49EFB95" box="[122,214,1129,1149]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." pageId="8" pageNumber="61">Figs. 15d</figureCitation> <figureCitation id="45CA7ED3FFC60871FFD4FBD8B49EFB95" box="[122,214,1129,1149]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." figureDoi="http://doi.org/10.5281/zenodo.13196038" httpUri="https://zenodo.org/record/13196038/files/figure.png" pageId="8" pageNumber="61">Figs. 15d</figureCitation>
; ;
<figureCitation id="45CA7ED3FFC60871FF4FFBD8B56DFB94" box="[225,293,1130,1149]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." pageId="8" pageNumber="61">21; 22</figureCitation> <figureCitation id="45CA7ED3FFC60871FF4FFBD8B56DFB94" box="[225,293,1130,1149]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." figureDoi="http://doi.org/10.5281/zenodo.13196040" httpUri="https://zenodo.org/record/13196040/files/figure.png" pageId="8" pageNumber="61">21; 22</figureCitation>
; ;
<figureCitation id="45CA7ED3FFC60871FE80FBDBB500FB95" box="[302,328,1129,1148]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." pageId="8" pageNumber="61">35</figureCitation> <figureCitation id="45CA7ED3FFC60871FE80FBDBB500FB95" box="[302,328,1129,1148]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196044" httpUri="https://zenodo.org/record/13196044/files/figure.png" pageId="8" pageNumber="61">35</figureCitation>
) )
</paragraph> </paragraph>
<paragraph id="DD4E6256FFC60871FFDCFB37B681FB5D" blockId="8.[114,786,1101,1233]" pageId="8" pageNumber="61"> <paragraph id="DD4E6256FFC60871FFDCFB37B681FB5D" blockId="8.[114,786,1101,1233]" pageId="8" pageNumber="61">
@ -96,9 +97,9 @@
Length of fore wing Length of fore wing
<quantity id="1A09CFB3FFC60871FEE3FA94B598FAD3" box="[333,464,1318,1338]" metricMagnitude="-2" metricUnit="m" metricValue="1.025" metricValueMax="1.05" metricValueMin="1.0" pageId="8" pageNumber="61" unit="mm" value="10.25" valueMax="10.5" valueMin="10.0">1010.5 mm</quantity> <quantity id="1A09CFB3FFC60871FEE3FA94B598FAD3" box="[333,464,1318,1338]" metricMagnitude="-2" metricUnit="m" metricValue="1.025" metricValueMax="1.05" metricValueMin="1.0" pageId="8" pageNumber="61" unit="mm" value="10.25" valueMax="10.5" valueMin="10.0">1010.5 mm</quantity>
; clypeus distinctly wider than high, H/WCLP 0.89, apex narrowly truncate ( ; clypeus distinctly wider than high, H/WCLP 0.89, apex narrowly truncate (
<figureCitation id="45CA7ED3FFC60871FDEFFAF0B6CEFABC" box="[577,646,1346,1365]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." pageId="8" pageNumber="61">Fig. 35</figureCitation> <figureCitation id="45CA7ED3FFC60871FDEFFAF0B6CEFABC" box="[577,646,1346,1365]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196044" httpUri="https://zenodo.org/record/13196044/files/figure.png" pageId="8" pageNumber="61">Fig. 35</figureCitation>
), clypeus not so extensively in contact with eye, free upper part of lateral margin relatively long, about 0.35 times the clypeus height at middle; malar space narrow; tentorial pit almost as close to eye margin than to antennal socket; oceli as in a nearly equilateral triangle; occiput rounded, carina absent; gena a little narrower than the upper lobe of the eye; pronotum with lateral fovea, central part of the anterior margin of pronotum with the lamella wide and rather raised but not reflexed, region immediately behind produced into a secondary margin which is acute and projecting over the lamella; humeral angle poorly developed, total humeral width nearly equal to that of mesoscutum, sides of the pronotum as seen from above distinctly converging; pronotal carina completely absent at center, poorly salient at sides, not forming true lobes and not at all reflexed, with a very narrow translucent lamellar portion at the extremity, mesoscutum about as long as wide, L/WMS around 1.0, lateral margin adjacent to tegula well demarcated and prominent; fore wing relatively more elongate for this group, LDIS/HMP about 2.50 (see ), clypeus not so extensively in contact with eye, free upper part of lateral margin relatively long, about 0.35 times the clypeus height at middle; malar space narrow; tentorial pit almost as close to eye margin than to antennal socket; oceli as in a nearly equilateral triangle; occiput rounded, carina absent; gena a little narrower than the upper lobe of the eye; pronotum with lateral fovea, central part of the anterior margin of pronotum with the lamella wide and rather raised but not reflexed, region immediately behind produced into a secondary margin which is acute and projecting over the lamella; humeral angle poorly developed, total humeral width nearly equal to that of mesoscutum, sides of the pronotum as seen from above distinctly converging; pronotal carina completely absent at center, poorly salient at sides, not forming true lobes and not at all reflexed, with a very narrow translucent lamellar portion at the extremity, mesoscutum about as long as wide, L/WMS around 1.0, lateral margin adjacent to tegula well demarcated and prominent; fore wing relatively more elongate for this group, LDIS/HMP about 2.50 (see
<figureCitation id="45CA7ED3FFC60871FFDCF88AB4FCF8A2" box="[114,180,1848,1867]" captionStart="Fig" captionStartId="9.[85,112,1895,1909]" captionTargetBox="[385,1169,1431,1865]" captionTargetId="figure-125@9.[420,1173,1450,1837]" captionTargetPageId="9" captionText="Fig. 44. Scattergram of ratio variables for species of the group of M. wagneri: x axis LSI HMP (length of first metasomal segment over height of mesopleuron); y axis LDIS HMP (length of fore wing discal cell over height of mesopleuron); open squares: M. wagneri; pink filled squares: M. mourei; black asterisks: M. proximus; blue filled triangles: M. camanducaia sp. nov.; black filled diamonds: M. declaratus." pageId="8" pageNumber="61">Fig. 44</figureCitation> <figureCitation id="45CA7ED3FFC60871FFDCF88AB4FCF8A2" box="[114,180,1848,1867]" captionStart="Fig" captionStartId="9.[85,112,1895,1909]" captionTargetBox="[385,1169,1431,1865]" captionTargetId="figure-125@9.[420,1173,1450,1837]" captionTargetPageId="9" captionText="Fig. 44. Scattergram of ratio variables for species of the group of M. wagneri: x axis LSI HMP (length of first metasomal segment over height of mesopleuron); y axis LDIS HMP (length of fore wing discal cell over height of mesopleuron); open squares: M. wagneri; pink filled squares: M. mourei; black asterisks: M. proximus; blue filled triangles: M. camanducaia sp. nov.; black filled diamonds: M. declaratus." figureDoi="http://doi.org/10.5281/zenodo.13196046" httpUri="https://zenodo.org/record/13196046/files/figure.png" pageId="8" pageNumber="61">Fig. 44</figureCitation>
); basal inner (posterior side) margin of fore coxa raised and strongly reflexed; inner claw of hind tarsus with the apex narrowly pointed, but not acute; propodeal dorsal cavity shorter and deep, triangular in shape, propodeal valve relatively narrow, shaped as a high triangle, lamellar margin behind distinctly oblique; first segment of metasoma only moderately elongate, its length hardly larger than 1.30× height of mesopleuron, and about 3.30× width at apex, about 2.20× wider at apex than at base, spiracles scarcely prominent. ); basal inner (posterior side) margin of fore coxa raised and strongly reflexed; inner claw of hind tarsus with the apex narrowly pointed, but not acute; propodeal dorsal cavity shorter and deep, triangular in shape, propodeal valve relatively narrow, shaped as a high triangle, lamellar margin behind distinctly oblique; first segment of metasoma only moderately elongate, its length hardly larger than 1.30× height of mesopleuron, and about 3.30× width at apex, about 2.20× wider at apex than at base, spiracles scarcely prominent.
</paragraph> </paragraph>
<paragraph id="DD4E6256FFC60871FCCEFE91B7D9FD54" blockId="8.[833,1504,152,1956]" pageId="8" pageNumber="61"> <paragraph id="DD4E6256FFC60871FCCEFE91B7D9FD54" blockId="8.[833,1504,152,1956]" pageId="8" pageNumber="61">
@ -125,12 +126,12 @@ mm
<paragraph id="DD4E6256FFC60871FCCEFD74B72BFC75" blockId="8.[833,1504,152,1956]" pageId="8" pageNumber="61">Vestiture: eyes bare; most body parts covered by fine appressed shining pubescence, not so dense to the point of obscuring the pattern of micropunctures underneath; clypeus with sparser erect longer setae especially near apical margin, shorter erect setae also on frons and vertex, setae on pronotum and mesoscutum erect and outstanding; gena beneath with distinctly longer hairs; propodeum dorsolaterally with very long fine hairs with recurved tip.</paragraph> <paragraph id="DD4E6256FFC60871FCCEFD74B72BFC75" blockId="8.[833,1504,152,1956]" pageId="8" pageNumber="61">Vestiture: eyes bare; most body parts covered by fine appressed shining pubescence, not so dense to the point of obscuring the pattern of micropunctures underneath; clypeus with sparser erect longer setae especially near apical margin, shorter erect setae also on frons and vertex, setae on pronotum and mesoscutum erect and outstanding; gena beneath with distinctly longer hairs; propodeum dorsolaterally with very long fine hairs with recurved tip.</paragraph>
<paragraph id="DD4E6256FFC60871FCCEFC17B7C1F84D" blockId="8.[833,1504,152,1956]" pageId="8" pageNumber="61"> <paragraph id="DD4E6256FFC60871FCCEFC17B7C1F84D" blockId="8.[833,1504,152,1956]" pageId="8" pageNumber="61">
Color (see Color (see
<figureCitation id="45CA7ED3FFC60871FC62FC17B00CFC51" box="[972,1092,933,952]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." pageId="8" pageNumber="61">Figs. 21; 22</figureCitation> <figureCitation id="45CA7ED3FFC60871FC62FC17B00CFC51" box="[972,1092,933,952]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." figureDoi="http://doi.org/10.5281/zenodo.13196040" httpUri="https://zenodo.org/record/13196040/files/figure.png" pageId="8" pageNumber="61">Figs. 21; 22</figureCitation>
; ;
<figureCitation id="45CA7ED3FFC60871FBE0FC17B020FC51" box="[1102,1128,933,952]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." pageId="8" pageNumber="61">35</figureCitation> <figureCitation id="45CA7ED3FFC60871FBE0FC17B020FC51" box="[1102,1128,933,952]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196044" httpUri="https://zenodo.org/record/13196044/files/figure.png" pageId="8" pageNumber="61">35</figureCitation>
): Black on most parts, relatively few areas reddish brown on sides of head, mesosoma and some of metasomal terga and sterna; mandibles reddish, with yellow area near apical teeth and a variably large proximal mark; clypeus reddish to darker brown, except for yellow ventral area close to apical margin (sometimes whole clypeus dark brown); antennal segments 12 beneath black; antennal flagellum beneath (or only articles 812) reddish; part of subspherical radicle of antennal scape and part of dorsal margin of antennal socket yellow to yellowish brown; diffuse marks on proximal half of femora (gradually connecting to distal yellow counterparts), reddish brown; mid and hind tibiae ventrolaterally light yellowish brown gradually changing to a subapical yellow mark (dorsal surface darker brown), hind tibia distal pad light orange brown; inner orbits to vertex, fusing with the postocellary marks (these sometimes as separate spots), malar space and genal stripe (sometimes interrupted or absent below), mark on pronotum tubercle (sometimes indistinct), pronotal carina and hind margin of pronotum, discal stripes on mesoscutum, part of axillae, anterior transversal stripe on scutellum (sometimes absent), side plates and anterior margin of metanotum; valves (sometimes dark) and two elongate spots on propodeum, large scrobal spot, rather large spot on upper metapleural plate, large posterior area and margin of mesosternum and hind margin of metasternum (in both cases extending to coxal articulation), large spot on apex of fore coxa (almost the distal half), large ventral mark and one dorsolateral stripe on mid coxa, two stripes on hind coxa, distal margin of all trochanters, triple pattern of distal longitudinal marks on fore femur (sometimes obscured), double pattern of distal longitudinal marks on mid and hind femora, narrow posterior distal bands on gastral terga 12 (or -3) extending forward at sides, but sometimes indistinct; rather wide areas near distal margin of sterna 24 (or -5), yellow; also yellow is most of fore tibia (except for an anterior dorsal dark mark) and all of fore tarsus including claws; mid and hind tarsi with articles 14 largely yellowish (only tarsomere 5 entirely dark brown or black); tegula brown with a small posterior yellow spot (sometimes absent); wings hyaline, venation brown. ): Black on most parts, relatively few areas reddish brown on sides of head, mesosoma and some of metasomal terga and sterna; mandibles reddish, with yellow area near apical teeth and a variably large proximal mark; clypeus reddish to darker brown, except for yellow ventral area close to apical margin (sometimes whole clypeus dark brown); antennal segments 12 beneath black; antennal flagellum beneath (or only articles 812) reddish; part of subspherical radicle of antennal scape and part of dorsal margin of antennal socket yellow to yellowish brown; diffuse marks on proximal half of femora (gradually connecting to distal yellow counterparts), reddish brown; mid and hind tibiae ventrolaterally light yellowish brown gradually changing to a subapical yellow mark (dorsal surface darker brown), hind tibia distal pad light orange brown; inner orbits to vertex, fusing with the postocellary marks (these sometimes as separate spots), malar space and genal stripe (sometimes interrupted or absent below), mark on pronotum tubercle (sometimes indistinct), pronotal carina and hind margin of pronotum, discal stripes on mesoscutum, part of axillae, anterior transversal stripe on scutellum (sometimes absent), side plates and anterior margin of metanotum; valves (sometimes dark) and two elongate spots on propodeum, large scrobal spot, rather large spot on upper metapleural plate, large posterior area and margin of mesosternum and hind margin of metasternum (in both cases extending to coxal articulation), large spot on apex of fore coxa (almost the distal half), large ventral mark and one dorsolateral stripe on mid coxa, two stripes on hind coxa, distal margin of all trochanters, triple pattern of distal longitudinal marks on fore femur (sometimes obscured), double pattern of distal longitudinal marks on mid and hind femora, narrow posterior distal bands on gastral terga 12 (or -3) extending forward at sides, but sometimes indistinct; rather wide areas near distal margin of sterna 24 (or -5), yellow; also yellow is most of fore tibia (except for an anterior dorsal dark mark) and all of fore tarsus including claws; mid and hind tarsi with articles 14 largely yellowish (only tarsomere 5 entirely dark brown or black); tegula brown with a small posterior yellow spot (sometimes absent); wings hyaline, venation brown.
</paragraph> </paragraph>
<caption id="898E32DEFFC70870FFFBFB4AB0FDFAA2" pageId="9" pageNumber="62" startId="9.[85,120,1272,1286]" targetBox="[363,1194,152,1240]" targetPageId="9" targetType="figure"> <caption id="898E32DEFFC70870FFFBFB4AB0FDFAA2" ID-DOI="http://doi.org/10.5281/zenodo.13196044" ID-Zenodo-Dep="13196044" httpUri="https://zenodo.org/record/13196044/files/figure.png" pageId="9" pageNumber="62" startId="9.[85,120,1272,1286]" targetBox="[363,1194,152,1240]" targetPageId="9" targetType="figure">
<paragraph id="DD4E6256FFC70870FFFBFB4AB0FDFAA2" blockId="9.[85,1476,1271,1355]" pageId="9" pageNumber="62"> <paragraph id="DD4E6256FFC70870FFFBFB4AB0FDFAA2" blockId="9.[85,1476,1271,1355]" pageId="9" pageNumber="62">
<emphasis id="EF85BE44FFC70870FFFBFB4AB4F2FAEF" bold="true" box="[85,186,1272,1286]" pageId="9" pageNumber="62">Figs. 3543.</emphasis> <emphasis id="EF85BE44FFC70870FFFBFB4AB4F2FAEF" bold="true" box="[85,186,1272,1286]" pageId="9" pageNumber="62">Figs. 3543.</emphasis>
3538: frontal view of female head (35: 3538: frontal view of female head (35:
@ -172,7 +173,7 @@ do Jordão, MPEG; 42:
(MG, Barroso; MPEG); all scales = 0.50 mm, except Figs. 39 and 42 (= 1.0 mm); scales in figs. (3738), (40) are estimates. (MG, Barroso; MPEG); all scales = 0.50 mm, except Figs. 39 and 42 (= 1.0 mm); scales in figs. (3738), (40) are estimates.
</paragraph> </paragraph>
</caption> </caption>
<caption id="898E32DEFFC70870FFFBF8D5B6D1F84A" pageId="9" pageNumber="62" startId="9.[85,112,1895,1909]" targetBox="[385,1169,1431,1865]" targetPageId="9" targetType="figure"> <caption id="898E32DEFFC70870FFFBF8D5B6D1F84A" ID-DOI="http://doi.org/10.5281/zenodo.13196046" ID-Zenodo-Dep="13196046" httpUri="https://zenodo.org/record/13196046/files/figure.png" pageId="9" pageNumber="62" startId="9.[85,112,1895,1909]" targetBox="[385,1169,1431,1865]" targetPageId="9" targetType="figure">
<paragraph id="DD4E6256FFC70870FFFBF8D5B6D1F84A" blockId="9.[85,1474,1894,1955]" pageId="9" pageNumber="62"> <paragraph id="DD4E6256FFC70870FFFBF8D5B6D1F84A" blockId="9.[85,1474,1894,1955]" pageId="9" pageNumber="62">
<emphasis id="EF85BE44FFC70870FFFBF8D5B4DAF89C" bold="true" box="[85,146,1895,1909]" pageId="9" pageNumber="62">Fig. 44.</emphasis> <emphasis id="EF85BE44FFC70870FFFBF8D5B4DAF89C" bold="true" box="[85,146,1895,1909]" pageId="9" pageNumber="62">Fig. 44.</emphasis>
Scattergram of ratio variables for species of the group of Scattergram of ratio variables for species of the group of
@ -221,7 +222,7 @@ Distribution
: :
<collectingRegion id="1F35ACB4FFC40873FF77FD98B515FDD4" box="[217,349,554,573]" country="Brazil" name="Minas Gerais" pageId="10" pageNumber="63">Minas Gerais</collectingRegion> <collectingRegion id="1F35ACB4FFC40873FF77FD98B515FDD4" box="[217,349,554,573]" country="Brazil" name="Minas Gerais" pageId="10" pageNumber="63">Minas Gerais</collectingRegion>
( (
<figureCitation id="45CA7ED3FFC40873FEC5FD98B5E5FDD7" box="[363,429,554,574]" captionStart="Fig" captionStartId="17.[85,112,1096,1110]" captionTargetBox="[303,1257,153,1064]" captionTargetId="figure-12@17.[300,1260,151,1066]" captionTargetPageId="17" captionText="Fig. 47. Map detail of southeastern South America (with partial view of some Brazilian states) with species distributions for the M. wagneri group. MG: Minas Gerais, RJ:Rio de Janeiro, SP: São Paulo, PR:Paraná, SC: Santa Catarina, RS: Rio Grande do Sul." pageId="10" pageNumber="63">Fig. 47</figureCitation> <figureCitation id="45CA7ED3FFC40873FEC5FD98B5E5FDD7" box="[363,429,554,574]" captionStart="Fig" captionStartId="17.[85,112,1096,1110]" captionTargetBox="[303,1257,153,1064]" captionTargetId="figure-12@17.[300,1260,151,1066]" captionTargetPageId="17" captionText="Fig. 47. Map detail of southeastern South America (with partial view of some Brazilian states) with species distributions for the M. wagneri group. MG: Minas Gerais, RJ:Rio de Janeiro, SP: São Paulo, PR:Paraná, SC: Santa Catarina, RS: Rio Grande do Sul." figureDoi="http://doi.org/10.5281/zenodo.13196054" httpUri="https://zenodo.org/record/13196054/files/figure.png" pageId="10" pageNumber="63">Fig. 47</figureCitation>
). ).
</paragraph> </paragraph>
<paragraph id="DD4E6256FFC40873FFDCFDDDB497FD6B" blockId="10.[114,785,623,699]" box="[114,223,623,642]" pageId="10" pageNumber="63">Etymology</paragraph> <paragraph id="DD4E6256FFC40873FFDCFDDDB497FD6B" blockId="10.[114,785,623,699]" box="[114,223,623,642]" pageId="10" pageNumber="63">Etymology</paragraph>

View file

@ -1,42 +1,43 @@
<document id="EEFE97FD50B8D29D42DAFA8CC89AD0E3" ID-DOI="10.1016/j.rbe.2018.11.004" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635836314" checkinUser="felipe" docAuthor="Silveira, Orlando Tobias" docDate="2019" docId="5558D340FFCD087FFFFBF8B7B48EF9DD" docLanguage="en" docName="RevBrasEntomol.63.1.53-72.pdf" docOrigin="Revista Brasileira de Entomologia 63 (1)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.11.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Mischocyttarus wagneri" docType="treatment" docVersion="1" lastPageNumber="59" masterDocId="A961AB38FFCE0879FFAEFFB2B448FFE9" masterDocTitle="Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)" masterLastPageNumber="72" masterPageNumber="53" pageNumber="56" updateTime="1722680433140" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0"> <document id="2C5738C4BCD7B59B2E174AA8095763F1" ID-DOI="10.1016/j.rbe.2018.11.004" ID-ISSN="1806-9665" ID-Zenodo-Dep="13196034" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635836314" checkinUser="felipe" docAuthor="Silveira, Orlando Tobias" docDate="2019" docId="5558D340FFCD087FFFFBF8B7B48EF9DD" docLanguage="en" docName="RevBrasEntomol.63.1.53-72.pdf" docOrigin="Revista Brasileira de Entomologia 63 (1)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.11.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Mischocyttarus wagneri" docType="treatment" docVersion="2" lastPageNumber="59" masterDocId="A961AB38FFCE0879FFAEFFB2B448FFE9" masterDocTitle="Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)" masterLastPageNumber="72" masterPageNumber="53" pageNumber="56" updateTime="1722683539161" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="AAB3184D24973A0CD9A1260DBFCE6C26" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="5F502A895DB9648817CAACB152995BC0" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="619E2FCEEEB75D127342C6B7DCA7E797"> <mods:titleInfo id="FE2F53D198EC948564499C80E390AE57">
<mods:title id="5AC0C50BD1FE4FD1DCD1B9E9FDDF86B7">Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)</mods:title> <mods:title id="FCD212C3D79E0F5CD8AC9ADD78858F29">Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="3621B4EE2D9F60363F16B7D5A637C5BE" type="personal"> <mods:name id="22441678CAF40A0381A7933DD6A82EE2" type="personal">
<mods:role id="449215A3E3740E3678C5FAB90365BCBB"> <mods:role id="639142FBCD32C10C3CB4DF0E5962226B">
<mods:roleTerm id="6DB272A86CCC7EDF11E0A70F03B9F29B">Author</mods:roleTerm> <mods:roleTerm id="0A13BBFD0A1092DDBA8C9E8162147BD3">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="E6F9218C59DB70C2261E60D776CE543C">Silveira, Orlando Tobias</mods:namePart> <mods:namePart id="5DF5738E705A0C2A2EE2F0CE6C969724">Silveira, Orlando Tobias</mods:namePart>
</mods:name> </mods:name>
<mods:typeOfResource id="C6F491F47A364D5BB0A1313ABBCAACD4">text</mods:typeOfResource> <mods:typeOfResource id="16111DA5D14AB060AD940D48D0ED068F">text</mods:typeOfResource>
<mods:relatedItem id="0FEE66DB96E0F088F75D3F118DE98E58" type="host"> <mods:relatedItem id="1E6F1440FC2E051349BF5DC408FF5A7B" type="host">
<mods:titleInfo id="25A13A3458EE243770E8E41A165111BD"> <mods:titleInfo id="5EFA8B6117478C8D676A821BA743BB5E">
<mods:title id="C1C02759B1CA9BD363A457EA887D3814">Revista Brasileira de Entomologia</mods:title> <mods:title id="0C466F44F0FCE90E54C493DF09B56C6E">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="636F9BEBDC7E701BA97480DA34BAFF05"> <mods:part id="B4666A7386CE57682C1218753A885788">
<mods:date id="E5F37A14D9AFB96E77717A892A756C13">2019</mods:date> <mods:date id="AA36DCB889A00CFE33D1CF395E64B3F2">2019</mods:date>
<mods:detail id="63374A581A27EBB6C55008B13A61EBAF" type="pubDate"> <mods:detail id="A9A3FEFE3941CA536EBBF05F8623B2BA" type="pubDate">
<mods:number id="C6ED1655E6060477F4647C5D66B96216">2018-12-11</mods:number> <mods:number id="8FC30B968B5220ADD19880AAB85BDCE9">2018-12-11</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="7F64891BF10E70BDA27D88C896153560" type="volume"> <mods:detail id="C9CF059333F27E81A117153D8D2E78C8" type="volume">
<mods:number id="89641D1C769ECDD029052476ABA7695A">63</mods:number> <mods:number id="AE59A512D0CA13A4CE1AC210C530DCEA">63</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="ACA072BA2A424D07251BDA45FDC79F02" type="issue"> <mods:detail id="4C3C01AE295F037BC330F4D3DA4E10BF" type="issue">
<mods:number id="1E92660243FF901A8992DD8F82316AC1">1</mods:number> <mods:number id="5B32CF7731CE289FFA22AD4BA8117BDE">1</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="E9CF1D24F1B148B42813CB96ED58FDBB" unit="page"> <mods:extent id="E21066263F4FE2BADCCDDB75EEB1AE4D" unit="page">
<mods:start id="682C1499812BC34B52CA43D270A28FD4">53</mods:start> <mods:start id="D6FA556EA823048DE8C1AAEEA2B57D71">53</mods:start>
<mods:end id="D640212AA8F4CA66344F67E8B98D5139">72</mods:end> <mods:end id="7632FC94DAD5FD57C94A2A79B137CA78">72</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="87187B356FBFFCD7BFC7E34A51FDEB98"> <mods:location id="4C3A76C0D2E2C62A1FD80DA31EF24856">
<mods:url id="872E29E3550BC69DA76851D9882BC44F">http://dx.doi.org/10.1016/j.rbe.2018.11.004</mods:url> <mods:url id="F87630AAB33BF0CAFF063DD12EB780B2">http://dx.doi.org/10.1016/j.rbe.2018.11.004</mods:url>
</mods:location> </mods:location>
<mods:classification id="8DF190348780A96B9BCFBC0A930F4238">journal article</mods:classification> <mods:classification id="7D87A78A3934732CB0998F4489F72860">journal article</mods:classification>
<mods:identifier id="F57F710E27F7671232E56658BE2D52E9" type="DOI">10.1016/j.rbe.2018.11.004</mods:identifier> <mods:identifier id="8D092483ACCA6FBF3B4635DD3C6D8D39" type="DOI">10.1016/j.rbe.2018.11.004</mods:identifier>
<mods:identifier id="10487AB6D246ED3A3935610E06184C7E" type="ISSN">1806-9665</mods:identifier> <mods:identifier id="9C71C2E0ED6847FE411684A7B22B8872" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="B92BB2E13C78BC043BAA1A75CD88E9CD" type="Zenodo-Dep">13196034</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="5558D340FFCD087FFFFBF8B7B48EF9DD" LSID="urn:lsid:plazi:treatment:5558D340FFCD087FFFFBF8B7B48EF9DD" httpUri="http://treatment.plazi.org/id/5558D340FFCD087FFFFBF8B7B48EF9DD" lastPageId="6" lastPageNumber="59" pageId="3" pageNumber="56"> <treatment id="5558D340FFCD087FFFFBF8B7B48EF9DD" LSID="urn:lsid:plazi:treatment:5558D340FFCD087FFFFBF8B7B48EF9DD" httpUri="http://treatment.plazi.org/id/5558D340FFCD087FFFFBF8B7B48EF9DD" lastPageId="6" lastPageNumber="59" pageId="3" pageNumber="56">
<subSubSection id="95EB31DDFFCD087AFFFBF8B7B649F8F0" box="[85,513,1797,1817]" pageId="3" pageNumber="56" type="nomenclature"> <subSubSection id="95EB31DDFFCD087AFFFBF8B7B649F8F0" box="[85,513,1797,1817]" pageId="3" pageNumber="56" type="nomenclature">
@ -52,9 +53,9 @@
<subSubSection id="95EB31DDFFCD087AFFFBF890B5D1F8DC" box="[85,409,1825,1845]" pageId="3" pageNumber="56" type="description"> <subSubSection id="95EB31DDFFCD087AFFFBF890B5D1F8DC" box="[85,409,1825,1845]" pageId="3" pageNumber="56" type="description">
<paragraph id="DD4E6256FFCD087AFFFBF890B5D1F8DC" blockId="3.[85,756,1797,1985]" box="[85,409,1825,1845]" pageId="3" pageNumber="56"> <paragraph id="DD4E6256FFCD087AFFFBF890B5D1F8DC" blockId="3.[85,756,1797,1985]" box="[85,409,1825,1845]" pageId="3" pageNumber="56">
( (
<figureCitation id="45CA7ED3FFCD087AFFF3F890B50FF8DC" box="[93,327,1825,1845]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." pageId="3" pageNumber="56">Figs. 7; 10; 12; 15a; 17</figureCitation> <figureCitation id="45CA7ED3FFCD087AFFF3F890B50FF8DC" box="[93,327,1825,1845]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." figureDoi="http://doi.org/10.5281/zenodo.13196038" httpUri="https://zenodo.org/record/13196038/files/figure.png" pageId="3" pageNumber="56">Figs. 7; 10; 12; 15a; 17</figureCitation>
; ;
<figureCitation id="45CA7ED3FFCD087AFEFFF890B5DAF8DC" box="[337,402,1826,1845]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." pageId="3" pageNumber="56">19; 20</figureCitation> <figureCitation id="45CA7ED3FFCD087AFEFFF890B5DAF8DC" box="[337,402,1826,1845]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." figureDoi="http://doi.org/10.5281/zenodo.13196040" httpUri="https://zenodo.org/record/13196040/files/figure.png" pageId="3" pageNumber="56">19; 20</figureCitation>
) )
</paragraph> </paragraph>
</subSubSection> </subSubSection>
@ -163,18 +164,18 @@ by
Length of fore wing Length of fore wing
<quantity id="1A09CFB3FFCD087AFC41F8C2B02DF86D" box="[1007,1125,1904,1924]" metricMagnitude="-3" metricUnit="m" metricValue="9.25" metricValueMax="10.5" metricValueMin="8.0" pageId="3" pageNumber="56" unit="mm" value="9.25" valueMax="10.5" valueMin="8.0">810.5 mm</quantity> <quantity id="1A09CFB3FFCD087AFC41F8C2B02DF86D" box="[1007,1125,1904,1924]" metricMagnitude="-3" metricUnit="m" metricValue="9.25" metricValueMax="10.5" metricValueMin="8.0" pageId="3" pageNumber="56" unit="mm" value="9.25" valueMax="10.5" valueMin="8.0">810.5 mm</quantity>
; clypeus wider than high, H/WCLP about 0.93 (minmax: 0.880.96), apex narrowly truncate, clypeus not so extensively in contact with eye, free upper part of lateral margin relatively long, a little more than 0.3 times the clypeus height at middle; malar space narrow; tentorial pit a little closer to eye margin than to antennal socket; ocelli as in an equilateral triangle; occiput rounded, carina absent; gena just narrower than the upper lobe of the eye; pronotum with lateral fovea, central part of the anterior margin of pronotum with the lamella wide and rather raised but not reflexed, region immediately behind produced into a secondary margin which is acute and projecting over the lamella ( ; clypeus wider than high, H/WCLP about 0.93 (minmax: 0.880.96), apex narrowly truncate, clypeus not so extensively in contact with eye, free upper part of lateral margin relatively long, a little more than 0.3 times the clypeus height at middle; malar space narrow; tentorial pit a little closer to eye margin than to antennal socket; ocelli as in an equilateral triangle; occiput rounded, carina absent; gena just narrower than the upper lobe of the eye; pronotum with lateral fovea, central part of the anterior margin of pronotum with the lamella wide and rather raised but not reflexed, region immediately behind produced into a secondary margin which is acute and projecting over the lamella (
<figureCitation id="45CA7ED3FFCA087DFF66F979B562F937" box="[200,298,1739,1759]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." pageId="4" pageNumber="57">Figs. 7; 10</figureCitation> <figureCitation id="45CA7ED3FFCA087DFF66F979B562F937" box="[200,298,1739,1759]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." figureDoi="http://doi.org/10.5281/zenodo.13196038" httpUri="https://zenodo.org/record/13196038/files/figure.png" pageId="4" pageNumber="57">Figs. 7; 10</figureCitation>
); humeral angle poorly developed, total humeral width nearly equal to that of mesoscutum, sides of the pronotum as seen from above distinctly converging; pronotal carina completely absent at center, poorly salient at sides, not forming true lobes and not at all reflexed, with a very narrow translucent lamellar portion at the extremity, mesoscutum about as long as wide, L/WMS around 1.0, lateral margin adjacent to tegula well demarcated and prominent; fore wing comparatively short for this group, LDIS/HMP nearly always below 2.20 (only one of ); humeral angle poorly developed, total humeral width nearly equal to that of mesoscutum, sides of the pronotum as seen from above distinctly converging; pronotal carina completely absent at center, poorly salient at sides, not forming true lobes and not at all reflexed, with a very narrow translucent lamellar portion at the extremity, mesoscutum about as long as wide, L/WMS around 1.0, lateral margin adjacent to tegula well demarcated and prominent; fore wing comparatively short for this group, LDIS/HMP nearly always below 2.20 (only one of
<specimenCount id="CBF7A9DFFFCA087DFDF1F818B758F854" box="[607,784,1962,1981]" count="15" pageId="4" pageNumber="57" type="generic">fifteen specimens</specimenCount> <specimenCount id="CBF7A9DFFFCA087DFDF1F818B758F854" box="[607,784,1962,1981]" count="15" pageId="4" pageNumber="57" type="generic">fifteen specimens</specimenCount>
above this value) (mean 2.12; minmax: 2.002.27); basal inner (posterior side) margin of fore coxa raised and strongly reflexed ( above this value) (mean 2.12; minmax: 2.002.27); basal inner (posterior side) margin of fore coxa raised and strongly reflexed (
<figureCitation id="45CA7ED3FFCA087DFCE7F996B7C2F9DE" box="[841,906,1572,1591]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." pageId="4" pageNumber="57">Fig. 12</figureCitation> <figureCitation id="45CA7ED3FFCA087DFCE7F996B7C2F9DE" box="[841,906,1572,1591]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." figureDoi="http://doi.org/10.5281/zenodo.13196038" httpUri="https://zenodo.org/record/13196038/files/figure.png" pageId="4" pageNumber="57">Fig. 12</figureCitation>
); inner claw of hind tarsus with the apex narrowly pointed, but not acute; propodeal dorsal cavity comparatively deep and elongate, almost reaching propodeal anterior margin, propodeal valve rather broadly round, lamellar margin behind not distinctly oblique, not conferring to valve a triangular shape; first segment of metasoma very elongate and slender ( ); inner claw of hind tarsus with the apex narrowly pointed, but not acute; propodeal dorsal cavity comparatively deep and elongate, almost reaching propodeal anterior margin, propodeal valve rather broadly round, lamellar margin behind not distinctly oblique, not conferring to valve a triangular shape; first segment of metasoma very elongate and slender (
<figureCitation id="45CA7ED3FFCA087DFB41F91DB120F92A" box="[1263,1384,1711,1731]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." pageId="4" pageNumber="57">Figs. 19; 20</figureCitation> <figureCitation id="45CA7ED3FFCA087DFB41F91DB120F92A" box="[1263,1384,1711,1731]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." figureDoi="http://doi.org/10.5281/zenodo.13196040" httpUri="https://zenodo.org/record/13196040/files/figure.png" pageId="4" pageNumber="57">Figs. 19; 20</figureCitation>
), its length always larger than 1.3× height of mesopleuron (mean LSI/HMP 1.39; minmax: 1.341.50), and nearly always more than 3.30× width at apex (except in two of 15 examined specimens), about 2.12× wider at apex than at base (minmax: 2.002.25), spiracles moderate to distinctly prominent ( ), its length always larger than 1.3× height of mesopleuron (mean LSI/HMP 1.39; minmax: 1.341.50), and nearly always more than 3.30× width at apex (except in two of 15 examined specimens), about 2.12× wider at apex than at base (minmax: 2.002.25), spiracles moderate to distinctly prominent (
<figureCitation id="45CA7ED3FFCA087DFB0CF889B0ACF8A7" box="[1186,1252,1851,1870]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." pageId="4" pageNumber="57">Fig. 20</figureCitation> <figureCitation id="45CA7ED3FFCA087DFB0CF889B0ACF8A7" box="[1186,1252,1851,1870]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." figureDoi="http://doi.org/10.5281/zenodo.13196040" httpUri="https://zenodo.org/record/13196040/files/figure.png" pageId="4" pageNumber="57">Fig. 20</figureCitation>
). ).
</paragraph> </paragraph>
<caption id="898E32DEFFCA087DFFDCFAE1B084FA91" pageId="4" pageNumber="57" startId="4.[114,149,1363,1377]" targetBox="[391,1222,151,1329]" targetPageId="4" targetType="figure"> <caption id="898E32DEFFCA087DFFDCFAE1B084FA91" ID-DOI="http://doi.org/10.5281/zenodo.13196040" ID-Zenodo-Dep="13196040" httpUri="https://zenodo.org/record/13196040/files/figure.png" pageId="4" pageNumber="57" startId="4.[114,149,1363,1377]" targetBox="[391,1222,151,1329]" targetPageId="4" targetType="figure">
<paragraph id="DD4E6256FFCA087DFFDCFAE1B084FA91" blockId="4.[114,1505,1362,1400]" pageId="4" pageNumber="57"> <paragraph id="DD4E6256FFCA087DFFDCFAE1B084FA91" blockId="4.[114,1505,1362,1400]" pageId="4" pageNumber="57">
<emphasis id="EF85BE44FFCA087DFFDCFAE1B49CFA88" bold="true" box="[114,212,1363,1377]" pageId="4" pageNumber="57">Figs. 1926.</emphasis> <emphasis id="EF85BE44FFCA087DFFDCFAE1B49CFA88" bold="true" box="[114,212,1363,1377]" pageId="4" pageNumber="57">Figs. 1926.</emphasis>
General dorsal and lateral body views (females; all from Brazil). 1920: General dorsal and lateral body views (females; all from Brazil). 1920:
@ -221,7 +222,7 @@ mm
<paragraph id="DD4E6256FFCB087CFFDBFE03B544FD61" blockId="5.[85,756,155,1429]" pageId="5" pageNumber="58">Vestiture: eyes bare; most body parts covered by fine appressed shining pubescence, dense to the point of obscuring the pattern of micropunctures underneath; clypeus with sparser erect longer setae especially near apical margin, shorter erect setae also on frons and vertex, setae on pronotum and mesoscutum strongly decumbent and often not outstanding at all; gena beneath with distinctly longer hairs; propodeum dorsolaterally with very long fine hairs with recurved tip.</paragraph> <paragraph id="DD4E6256FFCB087CFFDBFE03B544FD61" blockId="5.[85,756,155,1429]" pageId="5" pageNumber="58">Vestiture: eyes bare; most body parts covered by fine appressed shining pubescence, dense to the point of obscuring the pattern of micropunctures underneath; clypeus with sparser erect longer setae especially near apical margin, shorter erect setae also on frons and vertex, setae on pronotum and mesoscutum strongly decumbent and often not outstanding at all; gena beneath with distinctly longer hairs; propodeum dorsolaterally with very long fine hairs with recurved tip.</paragraph>
<paragraph id="DD4E6256FFCB087CFFDBFD23B4D6FA7C" blockId="5.[85,756,155,1429]" pageId="5" pageNumber="58"> <paragraph id="DD4E6256FFCB087CFFDBFD23B4D6FA7C" blockId="5.[85,756,155,1429]" pageId="5" pageNumber="58">
Color (see Color (see
<figureCitation id="45CA7ED3FFCB087CFF4BFD23B5CEFD4D" box="[229,390,657,676]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." pageId="5" pageNumber="58">Figs. 19 and 20</figureCitation> <figureCitation id="45CA7ED3FFCB087CFF4BFD23B5CEFD4D" box="[229,390,657,676]" captionStart="Figs" captionStartId="4.[114,149,1363,1377]" captionTargetBox="[391,1222,151,1329]" captionTargetId="figure-11@4.[390,1225,150,1332]" captionTargetPageId="4" captionText="Figs. 1926. General dorsal and lateral body views (females; all from Brazil).1920: M.wagneri (RS, Sta. Cruz do Sul; MPEG);2122: M.camanducaia sp. nov.(holotype:MG, Camanducaia; MPEG); 2324: M. proximus (SP, Campos do Jordão; MPEG); 2526: M. declaratus (MG, Barroso; MPEG); all scales = 1.0mm." figureDoi="http://doi.org/10.5281/zenodo.13196040" httpUri="https://zenodo.org/record/13196040/files/figure.png" pageId="5" pageNumber="58">Figs. 19 and 20</figureCitation>
): Black, largely suffused with dark reddish brown (but propodeum dorsum distinctly darker, blackish to black); mandibles pitchy red with a yellow longitudinal mark (sometimes indistinct); antennae with segments 3 and 912 reddish (to pale yellowish) beneath (but sometimes indistinct); clypeus (except actual ventral margins, black dorsal sides and large discal red brown spot) [sometimes practically whole clypeus brown, leaving only the ventral marginal area yellow], inner orbits to top of eye, antennal segments 12 beneath (sometimes indistinct), small spots above and below antennal sockets (sometimes indistinct), malar space and narrow genal stripe (outer orbit) [often interrupted or absent below], two dots behind ocelli, pronotum ventral corner (near fovea) and tubercle [sometimes indistinct], pronotal carina and hind margin of pronotum, pair of discal streaks on mesoscutum (sometimes evanescent), axillae and scutellum except disk, anterior margin of metanotum, valves and two elongate spots on propodeum, scrobal spot (sometimes very small), spot on upper metapleural plate, hind margin of mesosternum (sometimes only around coxal articulation), apex of fore coxa (sometimes indistinct), one dorsolateral stripe on mid coxa, and two stripes on hind coxa, posterior spot at apex of fore femur (sometimes indistinct), distal spots on mid and hind femora, narrow posterior bands on gastral terga 12 (or -4) extending forward at sides (sometimes indistinct), on sterna 23 (or -4) [but often indistinct], yellow; tibiae and tarsi brown, hind tarsus articles 24 blackish; inner side of hind tibia darker before apical pad which is paler; tegula brown; wings hyaline, venation brown. ): Black, largely suffused with dark reddish brown (but propodeum dorsum distinctly darker, blackish to black); mandibles pitchy red with a yellow longitudinal mark (sometimes indistinct); antennae with segments 3 and 912 reddish (to pale yellowish) beneath (but sometimes indistinct); clypeus (except actual ventral margins, black dorsal sides and large discal red brown spot) [sometimes practically whole clypeus brown, leaving only the ventral marginal area yellow], inner orbits to top of eye, antennal segments 12 beneath (sometimes indistinct), small spots above and below antennal sockets (sometimes indistinct), malar space and narrow genal stripe (outer orbit) [often interrupted or absent below], two dots behind ocelli, pronotum ventral corner (near fovea) and tubercle [sometimes indistinct], pronotal carina and hind margin of pronotum, pair of discal streaks on mesoscutum (sometimes evanescent), axillae and scutellum except disk, anterior margin of metanotum, valves and two elongate spots on propodeum, scrobal spot (sometimes very small), spot on upper metapleural plate, hind margin of mesosternum (sometimes only around coxal articulation), apex of fore coxa (sometimes indistinct), one dorsolateral stripe on mid coxa, and two stripes on hind coxa, posterior spot at apex of fore femur (sometimes indistinct), distal spots on mid and hind femora, narrow posterior bands on gastral terga 12 (or -4) extending forward at sides (sometimes indistinct), on sterna 23 (or -4) [but often indistinct], yellow; tibiae and tarsi brown, hind tarsus articles 24 blackish; inner side of hind tibia darker before apical pad which is paler; tegula brown; wings hyaline, venation brown.
</paragraph> </paragraph>
<paragraph id="DD4E6256FFCB087CFFFBFA75B4CFFA33" blockId="5.[85,756,1479,1833]" box="[85,135,1479,1498]" pageId="5" pageNumber="58">Male</paragraph> <paragraph id="DD4E6256FFCB087CFFFBFA75B4CFFA33" blockId="5.[85,756,1479,1833]" box="[85,135,1479,1498]" pageId="5" pageNumber="58">Male</paragraph>
@ -238,7 +239,7 @@ are remarkably homogeneous in color, even when comparing representatives of popu
and and
<collectingRegion id="1F35ACB4FFCB087CFBCFFF2AB16FFF42" box="[1121,1319,152,171]" country="Brazil" name="Rio Grande do Sul" pageId="5" pageNumber="58">Rio Grande do Sul</collectingRegion> <collectingRegion id="1F35ACB4FFCB087CFBCFFF2AB16FFF42" box="[1121,1319,152,171]" country="Brazil" name="Rio Grande do Sul" pageId="5" pageNumber="58">Rio Grande do Sul</collectingRegion>
. The length of the first metasomal segment, while varying to considerable extent, remains always above a certain lower limit (i.e. larger than 1.30× height of mesopleuron), longer than most of the specimens examined of the remaining species in this group (see . The length of the first metasomal segment, while varying to considerable extent, remains always above a certain lower limit (i.e. larger than 1.30× height of mesopleuron), longer than most of the specimens examined of the remaining species in this group (see
<figureCitation id="45CA7ED3FFCB087CFCFDFE91B7DDFEDF" box="[851,917,291,310]" captionStart="Fig" captionStartId="9.[85,112,1895,1909]" captionTargetBox="[385,1169,1431,1865]" captionTargetId="figure-125@9.[420,1173,1450,1837]" captionTargetPageId="9" captionText="Fig. 44. Scattergram of ratio variables for species of the group of M. wagneri: x axis LSI HMP (length of first metasomal segment over height of mesopleuron); y axis LDIS HMP (length of fore wing discal cell over height of mesopleuron); open squares: M. wagneri; pink filled squares: M. mourei; black asterisks: M. proximus; blue filled triangles: M. camanducaia sp. nov.; black filled diamonds: M. declaratus." pageId="5" pageNumber="58">Fig. 44</figureCitation> <figureCitation id="45CA7ED3FFCB087CFCFDFE91B7DDFEDF" box="[851,917,291,310]" captionStart="Fig" captionStartId="9.[85,112,1895,1909]" captionTargetBox="[385,1169,1431,1865]" captionTargetId="figure-125@9.[420,1173,1450,1837]" captionTargetPageId="9" captionText="Fig. 44. Scattergram of ratio variables for species of the group of M. wagneri: x axis LSI HMP (length of first metasomal segment over height of mesopleuron); y axis LDIS HMP (length of fore wing discal cell over height of mesopleuron); open squares: M. wagneri; pink filled squares: M. mourei; black asterisks: M. proximus; blue filled triangles: M. camanducaia sp. nov.; black filled diamonds: M. declaratus." figureDoi="http://doi.org/10.5281/zenodo.13196046" httpUri="https://zenodo.org/record/13196046/files/figure.png" pageId="5" pageNumber="58">Fig. 44</figureCitation>
). ).
</paragraph> </paragraph>
<paragraph id="DD4E6256FFCB087CFC8AFED6B71AFE9E" blockId="5.[804,1476,356,1127]" box="[804,850,356,375]" pageId="5" pageNumber="58">Nest</paragraph> <paragraph id="DD4E6256FFCB087CFC8AFED6B71AFE9E" blockId="5.[804,1476,356,1127]" box="[804,850,356,375]" pageId="5" pageNumber="58">Nest</paragraph>
@ -273,7 +274,7 @@ emerged of the cells until 5/iii
. Zikán (1949, fig. 381) also presents a photo of a nest of this species, showing an elongated comb with the irregular profile described above, and it has a very eccentric pedicel. . Zikán (1949, fig. 381) also presents a photo of a nest of this species, showing an elongated comb with the irregular profile described above, and it has a very eccentric pedicel.
</paragraph> </paragraph>
<paragraph id="DD4E6256FFCB087CFCEAFBB3B0D7FB8E" blockId="5.[804,1476,356,1127]" pageId="5" pageNumber="58"> <paragraph id="DD4E6256FFCB087CFCEAFBB3B0D7FB8E" blockId="5.[804,1476,356,1127]" pageId="5" pageNumber="58">
<figureCitation id="45CA7ED3FFCB087CFCEAFBB3B7C0FBFD" box="[836,904,1025,1044]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." pageId="5" pageNumber="58">Fig. 17</figureCitation> <figureCitation id="45CA7ED3FFCB087CFCEAFBB3B7C0FBFD" box="[836,904,1025,1044]" captionStart="Figs" captionStartId="3.[85,120,1392,1406]" captionTargetBox="[364,1194,151,1353]" captionTargetId="figure-11@3.[361,1196,149,1361]" captionTargetPageId="3" captionText="Figs. 518. 57: frontaldorsal view of anterior face of pronotum showing secondary margin (arrow) in M. barbatus (5), M.mixtus (6), M. wagneri (7); 810: same structures and species in dorsal view; 1112: mesial view of fore coxa showing raised basal margin (arrow) in M. mixtus (11), M wagneri (12); 1314: inner (larger) hind tarsal claw (arrow) in M. mixtus (13, lateral) and M. barbatus (14, ventral); 15: hind tarsus of M. wagneri (a), M. mourei (b), M. proximus (c), M. camanducaia sp. nov. (d), M. declaratus (e); 1618: nests of M. proximus (16), M. wagneri (17), M. barbatus (18); all scales = 0.50mm, except in Fig.18 (= 10 mm); groups of figs. (57), (810), (1112), (1314) share the same scale." figureDoi="http://doi.org/10.5281/zenodo.13196038" httpUri="https://zenodo.org/record/13196038/files/figure.png" pageId="5" pageNumber="58">Fig. 17</figureCitation>
presents two views of a nest from Caraguatatuba ( presents two views of a nest from Caraguatatuba (
<collectingRegion id="1F35ACB4FFCB087CFA33FBB3B716FBC6" country="Brazil" name="Sao Paulo" pageId="5" pageNumber="58">São Paulo</collectingRegion> <collectingRegion id="1F35ACB4FFCB087CFA33FBB3B716FBC6" country="Brazil" name="Sao Paulo" pageId="5" pageNumber="58">São Paulo</collectingRegion>
) which was mentioned in Richards (1978). It has suffered a little damage, but the comb preserves an elongated shape as mentioned in published descriptions. ) which was mentioned in Richards (1978). It has suffered a little damage, but the comb preserves an elongated shape as mentioned in published descriptions.
@ -291,7 +292,7 @@ presents two views of a nest from Caraguatatuba (
; ;
<collectingRegion id="1F35ACB4FFCB087CFA9EFB07B70CFB0D" country="Brazil" name="Rio Grande do Sul" pageId="5" pageNumber="58">Rio Grande do Sul</collectingRegion> <collectingRegion id="1F35ACB4FFCB087CFA9EFB07B70CFB0D" country="Brazil" name="Rio Grande do Sul" pageId="5" pageNumber="58">Rio Grande do Sul</collectingRegion>
(see (see
<figureCitation id="45CA7ED3FFCB087CFCD6FB63B7F2FB0D" box="[888,954,1233,1252]" captionStart="Fig" captionStartId="17.[85,112,1096,1110]" captionTargetBox="[303,1257,153,1064]" captionTargetId="figure-12@17.[300,1260,151,1066]" captionTargetPageId="17" captionText="Fig. 47. Map detail of southeastern South America (with partial view of some Brazilian states) with species distributions for the M. wagneri group. MG: Minas Gerais, RJ:Rio de Janeiro, SP: São Paulo, PR:Paraná, SC: Santa Catarina, RS: Rio Grande do Sul." pageId="5" pageNumber="58">Fig. 47</figureCitation> <figureCitation id="45CA7ED3FFCB087CFCD6FB63B7F2FB0D" box="[888,954,1233,1252]" captionStart="Fig" captionStartId="17.[85,112,1096,1110]" captionTargetBox="[303,1257,153,1064]" captionTargetId="figure-12@17.[300,1260,151,1066]" captionTargetPageId="17" captionText="Fig. 47. Map detail of southeastern South America (with partial view of some Brazilian states) with species distributions for the M. wagneri group. MG: Minas Gerais, RJ:Rio de Janeiro, SP: São Paulo, PR:Paraná, SC: Santa Catarina, RS: Rio Grande do Sul." figureDoi="http://doi.org/10.5281/zenodo.13196054" httpUri="https://zenodo.org/record/13196054/files/figure.png" pageId="5" pageNumber="58">Fig. 47</figureCitation>
) )
</materialsCitation> </materialsCitation>
. .
@ -316,7 +317,7 @@ is also undoubtedly correct. All records of this species come from localities in
extend the range of this species for nearly extend the range of this species for nearly
<quantity id="1A09CFB3FFCB087CFB5DF9D7B103F991" box="[1267,1355,1637,1656]" metricMagnitude="6" metricUnit="m" metricValue="1.0" pageId="5" pageNumber="58" unit="km" value="1000.0">1000 km</quantity> <quantity id="1A09CFB3FFCB087CFB5DF9D7B103F991" box="[1267,1355,1637,1656]" metricMagnitude="6" metricUnit="m" metricValue="1.0" pageId="5" pageNumber="58" unit="km" value="1000.0">1000 km</quantity>
southward ( southward (
<figureCitation id="45CA7ED3FFCB087CFC82F933B7D6F97D" box="[812,926,1665,1684]" captionStart-0="Fig" captionStart-1="Fig" captionStartId-0="15.[85,112,1463,1477]" captionStartId-1="17.[85,112,1096,1110]" captionTargetBox-0="[301,1260,799,1432]" captionTargetBox-1="[303,1257,153,1064]" captionTargetId-0="figure-149@15.[300,1260,796,1433]" captionTargetId-1="figure-12@17.[300,1260,151,1066]" captionTargetPageId-0="15" captionTargetPageId-1="17" captionText-0="Fig. 46. Partial truncated map for Central and South America with species distributions for the M. barbatus group, and with the pooled distribution of the group of M.wagneri (see next figure for detailed representation of distributions of species of this group)." captionText-1="Fig. 47. Map detail of southeastern South America (with partial view of some Brazilian states) with species distributions for the M. wagneri group. MG: Minas Gerais, RJ:Rio de Janeiro, SP: São Paulo, PR:Paraná, SC: Santa Catarina, RS: Rio Grande do Sul." pageId="5" pageNumber="58">Figs. 4647</figureCitation> <figureCitation id="45CA7ED3FFCB087CFC82F933B7D6F97D" box="[812,926,1665,1684]" captionStart-0="Fig" captionStart-1="Fig" captionStartId-0="15.[85,112,1463,1477]" captionStartId-1="17.[85,112,1096,1110]" captionTargetBox-0="[301,1260,799,1432]" captionTargetBox-1="[303,1257,153,1064]" captionTargetId-0="figure-149@15.[300,1260,796,1433]" captionTargetId-1="figure-12@17.[300,1260,151,1066]" captionTargetPageId-0="15" captionTargetPageId-1="17" captionText-0="Fig. 46. Partial truncated map for Central and South America with species distributions for the M. barbatus group, and with the pooled distribution of the group of M.wagneri (see next figure for detailed representation of distributions of species of this group)." captionText-1="Fig. 47. Map detail of southeastern South America (with partial view of some Brazilian states) with species distributions for the M. wagneri group. MG: Minas Gerais, RJ:Rio de Janeiro, SP: São Paulo, PR:Paraná, SC: Santa Catarina, RS: Rio Grande do Sul." figureDoi-0="http://doi.org/10.5281/zenodo.13196052" figureDoi-1="http://doi.org/10.5281/zenodo.13196054" httpUri-0="https://zenodo.org/record/13196052/files/figure.png" httpUri-1="https://zenodo.org/record/13196054/files/figure.png" pageId="5" pageNumber="58">Figs. 4647</figureCitation>
). ).
</paragraph> </paragraph>
<paragraph id="DD4E6256FFCB087CFC8AF974B18BF851" blockId="5.[804,1475,1734,1977]" pageId="5" pageNumber="58"> <paragraph id="DD4E6256FFCB087CFC8AF974B18BF851" blockId="5.[804,1475,1734,1977]" pageId="5" pageNumber="58">
@ -460,7 +461,7 @@ of
<emphasis id="EF85BE44FFC8087FFD83FFD6B06DFF9D" box="[557,1061,100,116]" italics="true" pageId="6" pageNumber="59">O.T. Silveira / Revista Brasileira de Entomologia 63 (2019) 5372</emphasis> <emphasis id="EF85BE44FFC8087FFD83FFD6B06DFF9D" box="[557,1061,100,116]" italics="true" pageId="6" pageNumber="59">O.T. Silveira / Revista Brasileira de Entomologia 63 (2019) 5372</emphasis>
59 59
</paragraph> </paragraph>
<caption id="898E32DEFFC8087FFFDCFAF9B4ACFA6F" pageId="6" pageNumber="59" startId="6.[114,149,1355,1369]" targetBox="[390,1225,149,1324]" targetPageId="6" targetType="figure"> <caption id="898E32DEFFC8087FFFDCFAF9B4ACFA6F" ID-DOI="http://doi.org/10.5281/zenodo.13196042" ID-Zenodo-Dep="13196042" httpUri="https://zenodo.org/record/13196042/files/figure.png" pageId="6" pageNumber="59" startId="6.[114,149,1355,1369]" targetBox="[390,1225,149,1324]" targetPageId="6" targetType="figure">
<paragraph id="DD4E6256FFC8087FFFDCFAF9B4ACFA6F" blockId="6.[114,1505,1354,1415]" pageId="6" pageNumber="59"> <paragraph id="DD4E6256FFC8087FFFDCFAF9B4ACFA6F" blockId="6.[114,1505,1354,1415]" pageId="6" pageNumber="59">
<emphasis id="EF85BE44FFC8087FFFDCFAF9B49DFAB0" bold="true" box="[114,213,1355,1369]" pageId="6" pageNumber="59">Figs. 2734.</emphasis> <emphasis id="EF85BE44FFC8087FFFDCFAF9B49DFAB0" bold="true" box="[114,213,1355,1369]" pageId="6" pageNumber="59">Figs. 2734.</emphasis>
General dorsal and lateral body views (females). 2728: General dorsal and lateral body views (females). 2728:

View file

@ -1,42 +1,43 @@
<document id="85D47998B56683A3FE39940C3D65CF2A" ID-DOI="10.1016/j.rbe.2018.11.004" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635836314" checkinUser="felipe" docAuthor="Silveira, Orlando Tobias" docDate="2019" docId="5558D340FFDE086BFCEFF9F9B5EEFA18" docLanguage="en" docName="RevBrasEntomol.63.1.53-72.pdf" docOrigin="Revista Brasileira de Entomologia 63 (1)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.11.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Mischocyttarus imeldai Zikan 1949" docType="treatment" docVersion="1" lastPageNumber="71" masterDocId="A961AB38FFCE0879FFAEFFB2B448FFE9" masterDocTitle="Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)" masterLastPageNumber="72" masterPageNumber="53" pageNumber="69" updateTime="1722680433140" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0"> <document id="0CA6AD13AD6B12D0B0CF8A8862BA00F4" ID-DOI="10.1016/j.rbe.2018.11.004" ID-ISSN="1806-9665" ID-Zenodo-Dep="13196034" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722635836314" checkinUser="felipe" docAuthor="Silveira, Orlando Tobias" docDate="2019" docId="5558D340FFDE086BFCEFF9F9B5EEFA18" docLanguage="en" docName="RevBrasEntomol.63.1.53-72.pdf" docOrigin="Revista Brasileira de Entomologia 63 (1)" docSource="http://dx.doi.org/10.1016/j.rbe.2018.11.004" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Mischocyttarus imeldai Zikan 1949" docType="treatment" docVersion="2" lastPageNumber="71" masterDocId="A961AB38FFCE0879FFAEFFB2B448FFE9" masterDocTitle="Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)" masterLastPageNumber="72" masterPageNumber="53" pageNumber="69" updateTime="1722683539161" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="EA4C22DC9E0040F861F16A78B5110D4E" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="31E37692831BB440F147CF54CF1261A0" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="426036B4102338A683139F195B69DEF9"> <mods:titleInfo id="A0DEC9D1A4AB6F76F534DDEAEB3E86E8">
<mods:title id="01DDFB8BD36226C461BF78C3E4435F60">Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)</mods:title> <mods:title id="86F3E52009FF3FC839AC118E3BA7BD6D">Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae)</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="7BF270624F4EFAD40F96706ADBE2C655" type="personal"> <mods:name id="20230BD4DA224A25C909B3531B9A0FA4" type="personal">
<mods:role id="1A3AFC57EA2E0F781E93BEBA36987039"> <mods:role id="59038E666D7D497BF9CC7E392D9AEFA6">
<mods:roleTerm id="A76087D6E91646225EC7F407396172D5">Author</mods:roleTerm> <mods:roleTerm id="3A09065E17B5F0278A7DA2E55CE3C895">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="F6FF7E95B227D2F0FBADA25A887DD4F7">Silveira, Orlando Tobias</mods:namePart> <mods:namePart id="2404AB562C6F28E421F8FD2C09765079">Silveira, Orlando Tobias</mods:namePart>
</mods:name> </mods:name>
<mods:typeOfResource id="148D34D7CC321230AE0E90A707469FEC">text</mods:typeOfResource> <mods:typeOfResource id="5743B05ECFC3F36374C9F33BDB9FA054">text</mods:typeOfResource>
<mods:relatedItem id="CB5A4D8B790BB64BA39A05769AD40B34" type="host"> <mods:relatedItem id="1F4C94119D7E260AF49EE56B9A37399D" type="host">
<mods:titleInfo id="CA020A3D5240FA01F1AE768ACF1AF405"> <mods:titleInfo id="A52B7114B4AE5397DAE92D05C5322969">
<mods:title id="DBDFE107E205484BE5065250D48DAB78">Revista Brasileira de Entomologia</mods:title> <mods:title id="DAACA7E63EFC70A294396785A42A6AF1">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="B3464FDCCC89F8404431A7174A9AE77E"> <mods:part id="291BAE271DCA9A300DEF3322EEF38435">
<mods:date id="87AAA7E8C00350CAA715236ED15A4BF4">2019</mods:date> <mods:date id="8E4A6AC201308BD92C4590A8347718F3">2019</mods:date>
<mods:detail id="5AFB76E80C2B051E59E34A1C6B61926E" type="pubDate"> <mods:detail id="9B0749ABCF36E93CBAD9D5EEAA60D932" type="pubDate">
<mods:number id="11BD479D73F3C037DE37BB934E8ED097">2018-12-11</mods:number> <mods:number id="563D1D0DEBF97BB07E337B6D1E49C20A">2018-12-11</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="A9C6ADD186A822C1014E25CEE135BE41" type="volume"> <mods:detail id="6061F521A593EA76A8E916C7577F2084" type="volume">
<mods:number id="C3A2F5918FE0CC3AAA8AC2FD47192574">63</mods:number> <mods:number id="D2F55309C0E340E9DB68834D569A279F">63</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="62F15887F7D3A546F9B74E790FF8D82B" type="issue"> <mods:detail id="403A7E69E6AACB57018390BE865A33E3" type="issue">
<mods:number id="42594F99BFFAA65B08B9FECD4FB1A07C">1</mods:number> <mods:number id="E75B50997A8E708ED53E8FDA1FA90810">1</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="57D77241A229C35DA8A562E5A640A16A" unit="page"> <mods:extent id="A9AC7BA537E9B34B8A91BB87B8A567D0" unit="page">
<mods:start id="2E8158443A7579C7BE64F7A48417878E">53</mods:start> <mods:start id="8DC22E80CA8CF4082C03CC9D350E7675">53</mods:start>
<mods:end id="8B121DAA8E88BC717766EA6D4590BA61">72</mods:end> <mods:end id="A587FB137BCD60ED7C63FD951486292B">72</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="68C87C30375A9D226B06C474968377D9"> <mods:location id="FC900E17F6943EC9C60262B26973ED37">
<mods:url id="BC6FE88C6C4C2169E19CA9CBED376586">http://dx.doi.org/10.1016/j.rbe.2018.11.004</mods:url> <mods:url id="CC431BDC172EDB63DC20C26999805C11">http://dx.doi.org/10.1016/j.rbe.2018.11.004</mods:url>
</mods:location> </mods:location>
<mods:classification id="93A4C54531352577E6676E8CD237AB92">journal article</mods:classification> <mods:classification id="93B5E072B624868EB791091166F67882">journal article</mods:classification>
<mods:identifier id="16A587E9F2D10CFC7DCA039A18D11F1F" type="DOI">10.1016/j.rbe.2018.11.004</mods:identifier> <mods:identifier id="D931B4D25F6964C383AE0A20A8857915" type="DOI">10.1016/j.rbe.2018.11.004</mods:identifier>
<mods:identifier id="AB44A0EFEFA747315588A3CD22305B02" type="ISSN">1806-9665</mods:identifier> <mods:identifier id="4BDE85FCF17ECB32A51F80908326957D" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="B3F66E2932791A9140232724F029A5C7" type="Zenodo-Dep">13196034</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="5558D340FFDE086BFCEFF9F9B5EEFA18" LSID="urn:lsid:plazi:treatment:5558D340FFDE086BFCEFF9F9B5EEFA18" httpUri="http://treatment.plazi.org/id/5558D340FFDE086BFCEFF9F9B5EEFA18" lastPageId="18" lastPageNumber="71" pageId="16" pageNumber="69"> <treatment id="5558D340FFDE086BFCEFF9F9B5EEFA18" LSID="urn:lsid:plazi:treatment:5558D340FFDE086BFCEFF9F9B5EEFA18" httpUri="http://treatment.plazi.org/id/5558D340FFDE086BFCEFF9F9B5EEFA18" lastPageId="18" lastPageNumber="71" pageId="16" pageNumber="69">
<subSubSection id="95EB31DDFFDE0869FCEFF9F9B0D2F9B6" box="[833,1178,1611,1631]" pageId="16" pageNumber="69" type="nomenclature"> <subSubSection id="95EB31DDFFDE0869FCEFF9F9B0D2F9B6" box="[833,1178,1611,1631]" pageId="16" pageNumber="69" type="nomenclature">
@ -52,9 +53,9 @@ Zikán 1949
<subSubSection id="95EB31DDFFDE0869FCEFF9DAB017F992" box="[833,1119,1640,1659]" pageId="16" pageNumber="69" type="description"> <subSubSection id="95EB31DDFFDE0869FCEFF9DAB017F992" box="[833,1119,1640,1659]" pageId="16" pageNumber="69" type="description">
<paragraph id="DD4E6256FFDE0869FCEFF9DAB017F992" blockId="16.[833,1504,1611,1771]" box="[833,1119,1640,1659]" pageId="16" pageNumber="69"> <paragraph id="DD4E6256FFDE0869FCEFF9DAB017F992" blockId="16.[833,1504,1611,1771]" box="[833,1119,1640,1659]" pageId="16" pageNumber="69">
( (
<figureCitation id="45CA7ED3FFDE0869FCE7F9DAB7F7F992" box="[841,959,1640,1659]" captionStart="Figs" captionStartId="6.[114,149,1355,1369]" captionTargetBox="[390,1225,149,1324]" captionTargetId="figure-11@6.[390,1225,149,1324]" captionTargetPageId="6" captionText="Figs. 2734. General dorsal and lateral body views (females). 2728: M. mourei (Brazil, PR, Curitiba, paralectotype, IOC); 2930: M. barbatus (Colombia: Antioquia, MPEG); 3132:M.mixtus (Mexico:Chiapas, EBCC); 3334:M.imeldai (33 dorsal holotype, Peru, IOC) (34 lateral Bolivia,NHM); all scales =1.0 mm; scales in figs. (2728), (3334) are estimates." pageId="16" pageNumber="69">Figs. 33; 34</figureCitation> <figureCitation id="45CA7ED3FFDE0869FCE7F9DAB7F7F992" box="[841,959,1640,1659]" captionStart="Figs" captionStartId="6.[114,149,1355,1369]" captionTargetBox="[390,1225,149,1324]" captionTargetId="figure-11@6.[390,1225,149,1324]" captionTargetPageId="6" captionText="Figs. 2734. General dorsal and lateral body views (females). 2728: M. mourei (Brazil, PR, Curitiba, paralectotype, IOC); 2930: M. barbatus (Colombia: Antioquia, MPEG); 3132:M.mixtus (Mexico:Chiapas, EBCC); 3334:M.imeldai (33 dorsal holotype, Peru, IOC) (34 lateral Bolivia,NHM); all scales =1.0 mm; scales in figs. (2728), (3334) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196042" httpUri="https://zenodo.org/record/13196042/files/figure.png" pageId="16" pageNumber="69">Figs. 33; 34</figureCitation>
; ;
<figureCitation id="45CA7ED3FFDE0869FC67F9DAB010F992" box="[969,1112,1640,1659]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." pageId="16" pageNumber="69">37; 38; 40; 41</figureCitation> <figureCitation id="45CA7ED3FFDE0869FC67F9DAB010F992" box="[969,1112,1640,1659]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196044" httpUri="https://zenodo.org/record/13196044/files/figure.png" pageId="16" pageNumber="69">37; 38; 40; 41</figureCitation>
) )
</paragraph> </paragraph>
</subSubSection> </subSubSection>
@ -96,7 +97,7 @@ Length of fore wing
<quantity id="1A09CFB3FFDE0869FB8DF88AB03AF8A5" box="[1059,1138,1848,1868]" metricMagnitude="-3" metricUnit="m" metricValue="9.5" pageId="16" pageNumber="69" unit="mm" value="9.5">9.5 mm</quantity> <quantity id="1A09CFB3FFDE0869FB8DF88AB03AF8A5" box="[1059,1138,1848,1868]" metricMagnitude="-3" metricUnit="m" metricValue="9.5" pageId="16" pageNumber="69" unit="mm" value="9.5">9.5 mm</quantity>
; clypeus a little wider than high, H/WCLP about 0.94, apex very narrowly truncate (more rounded in the Bolivian specimen), not so extensively in contact with eye, free upper part of lateral margin relatively long, more than 0.3 times the clypeus height at middle; malar space not so narrow; tentorial pit distinctly closer to eye margin than to antennal socket, the first distance only about 60% of the second; ocelli nearly as in a equilateral triangle, posterior ocelli only slightly more spaced; occiput rounded, carina absent; gena distinctly narrower than the upper lobe of the eye; pronotum with lateral fovea, central part of the anterior margin of pronotum with the lamella not so wide and poorly raised, not at all reflexed, region immediately behind produced into a secondary margin which is fairly acute but does not strongly project itself over the lamella; humeral angle poorly developed and not strongly projecting laterally, total humeral width about equal that of mesoscutum, sides of the pronotum as seen from above distinctly converging; pronotal carina absent at center, and very low at sides having a narrow translucent lamellar portion, mesoscutum about as wide as long, lateral margin adjacent to tegula poorly developed; fore wing relatively well elongate LDIS/HMP ca. 2.3; basal inner (posterior side) margin of fore coxa raised but less reflexed; inner claw of hind tarsus with the apex pointed but not definitely acute; propodeal dorsal cavity considerably deep and wide, developed along ca. two-thirds of length of dorsal face at middle; propodeal valve well developed on top and bottom, uniformly expanded, but rather angular below; first segment of metasoma well elongate, its length more than 1.3× height of mesopleuron (LSI/HMP about 1.4 or slightly more), and distinctly slender, only about 1.862.00× wider at apex than at base, spiracles not strongly prominent. ; clypeus a little wider than high, H/WCLP about 0.94, apex very narrowly truncate (more rounded in the Bolivian specimen), not so extensively in contact with eye, free upper part of lateral margin relatively long, more than 0.3 times the clypeus height at middle; malar space not so narrow; tentorial pit distinctly closer to eye margin than to antennal socket, the first distance only about 60% of the second; ocelli nearly as in a equilateral triangle, posterior ocelli only slightly more spaced; occiput rounded, carina absent; gena distinctly narrower than the upper lobe of the eye; pronotum with lateral fovea, central part of the anterior margin of pronotum with the lamella not so wide and poorly raised, not at all reflexed, region immediately behind produced into a secondary margin which is fairly acute but does not strongly project itself over the lamella; humeral angle poorly developed and not strongly projecting laterally, total humeral width about equal that of mesoscutum, sides of the pronotum as seen from above distinctly converging; pronotal carina absent at center, and very low at sides having a narrow translucent lamellar portion, mesoscutum about as wide as long, lateral margin adjacent to tegula poorly developed; fore wing relatively well elongate LDIS/HMP ca. 2.3; basal inner (posterior side) margin of fore coxa raised but less reflexed; inner claw of hind tarsus with the apex pointed but not definitely acute; propodeal dorsal cavity considerably deep and wide, developed along ca. two-thirds of length of dorsal face at middle; propodeal valve well developed on top and bottom, uniformly expanded, but rather angular below; first segment of metasoma well elongate, its length more than 1.3× height of mesopleuron (LSI/HMP about 1.4 or slightly more), and distinctly slender, only about 1.862.00× wider at apex than at base, spiracles not strongly prominent.
</paragraph> </paragraph>
<caption id="898E32DEFFDF0868FFFBFBFAB69DFB84" pageId="17" pageNumber="70" startId="17.[85,112,1096,1110]" targetBox="[303,1257,153,1064]" targetPageId="17" targetType="figure"> <caption id="898E32DEFFDF0868FFFBFBFAB69DFB84" ID-DOI="http://doi.org/10.5281/zenodo.13196054" ID-Zenodo-Dep="13196054" httpUri="https://zenodo.org/record/13196054/files/figure.png" pageId="17" pageNumber="70" startId="17.[85,112,1096,1110]" targetBox="[303,1257,153,1064]" targetPageId="17" targetType="figure">
<paragraph id="DD4E6256FFDF0868FFFBFBFAB69DFB84" blockId="17.[85,1474,1095,1133]" pageId="17" pageNumber="70"> <paragraph id="DD4E6256FFDF0868FFFBFBFAB69DFB84" blockId="17.[85,1474,1095,1133]" pageId="17" pageNumber="70">
<emphasis id="EF85BE44FFDF0868FFFBFBFAB4D9FBBF" bold="true" box="[85,145,1096,1110]" pageId="17" pageNumber="70">Fig. 47.</emphasis> <emphasis id="EF85BE44FFDF0868FFFBFBFAB4D9FBBF" bold="true" box="[85,145,1096,1110]" pageId="17" pageNumber="70">Fig. 47.</emphasis>
Map detail of southeastern South America (with partial view of some Brazilian states) with species distributions for the Map detail of southeastern South America (with partial view of some Brazilian states) with species distributions for the
@ -118,16 +119,16 @@ Vestiture: (following Richards, 1978) “
</paragraph> </paragraph>
<paragraph id="DD4E6256FFDF0868FCEAFABBB725F853" blockId="17.[804,1475,1177,1978]" pageId="17" pageNumber="70"> <paragraph id="DD4E6256FFDF0868FCEAFABBB725F853" blockId="17.[804,1475,1177,1978]" pageId="17" pageNumber="70">
Color (see Color (see
<figureCitation id="45CA7ED3FFDF0868FC00FABBB06BFAF5" box="[942,1059,1289,1308]" captionStart="Figs" captionStartId="6.[114,149,1355,1369]" captionTargetBox="[390,1225,149,1324]" captionTargetId="figure-11@6.[390,1225,149,1324]" captionTargetPageId="6" captionText="Figs. 2734. General dorsal and lateral body views (females). 2728: M. mourei (Brazil, PR, Curitiba, paralectotype, IOC); 2930: M. barbatus (Colombia: Antioquia, MPEG); 3132:M.mixtus (Mexico:Chiapas, EBCC); 3334:M.imeldai (33 dorsal holotype, Peru, IOC) (34 lateral Bolivia,NHM); all scales =1.0 mm; scales in figs. (2728), (3334) are estimates." pageId="17" pageNumber="70">Figs. 33; 34</figureCitation> <figureCitation id="45CA7ED3FFDF0868FC00FABBB06BFAF5" box="[942,1059,1289,1308]" captionStart="Figs" captionStartId="6.[114,149,1355,1369]" captionTargetBox="[390,1225,149,1324]" captionTargetId="figure-11@6.[390,1225,149,1324]" captionTargetPageId="6" captionText="Figs. 2734. General dorsal and lateral body views (females). 2728: M. mourei (Brazil, PR, Curitiba, paralectotype, IOC); 2930: M. barbatus (Colombia: Antioquia, MPEG); 3132:M.mixtus (Mexico:Chiapas, EBCC); 3334:M.imeldai (33 dorsal holotype, Peru, IOC) (34 lateral Bolivia,NHM); all scales =1.0 mm; scales in figs. (2728), (3334) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196042" httpUri="https://zenodo.org/record/13196042/files/figure.png" pageId="17" pageNumber="70">Figs. 33; 34</figureCitation>
; ;
<figureCitation id="45CA7ED3FFDF0868FB83FABBB026FAF5" box="[1069,1134,1289,1308]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." pageId="17" pageNumber="70">37; 38</figureCitation> <figureCitation id="45CA7ED3FFDF0868FB83FABBB026FAF5" box="[1069,1134,1289,1308]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196044" httpUri="https://zenodo.org/record/13196044/files/figure.png" pageId="17" pageNumber="70">37; 38</figureCitation>
): Black; most of mandible anteriorly yellow, gradually turning to reddish at apex; antennal articles 912 yellowish to light reddish beneath; antennal scape (including radicle) beneath, reddish yellow; clypeus largely (except for large discal area and, sometimes, a narrow area adjacent to upper lateral margin), sometimes diffuse marks on supra-clypeal area, narrow streak adjacent to dorsal margin of antennal socket, malar space and inner orbits to top of ocular sinus, genal stripe (outer orbit), sometimes (nearly continuous to orbital mark) two paired very small dots on vertex by the inner side of eye upper lobe, small mark on pronotum ventral corner, tubercle, carina, and hind margin of pronotum, axillar mark, anterior transversal stripe and side plates of scutellum, anterior transversal stripe and side areas of metanotum, propodeal valves, and paired propodeal posterior dorsal spots (sometimes reduced), one dorsolateral stripe on mid coxa, two dorsal stripes on hind coxae; apical mark on all femora; distal bands on metasomal terga l-3 (-4, somewhat indistinctly), and sterna 23 (-4, somewhat indistinctly), yellow (somewhat reddish hue); reddish suffused areas on lateral of pronotum, mesepisternum and upper and lower metapleural plate, and disc of metasomal tergum 2; ): Black; most of mandible anteriorly yellow, gradually turning to reddish at apex; antennal articles 912 yellowish to light reddish beneath; antennal scape (including radicle) beneath, reddish yellow; clypeus largely (except for large discal area and, sometimes, a narrow area adjacent to upper lateral margin), sometimes diffuse marks on supra-clypeal area, narrow streak adjacent to dorsal margin of antennal socket, malar space and inner orbits to top of ocular sinus, genal stripe (outer orbit), sometimes (nearly continuous to orbital mark) two paired very small dots on vertex by the inner side of eye upper lobe, small mark on pronotum ventral corner, tubercle, carina, and hind margin of pronotum, axillar mark, anterior transversal stripe and side plates of scutellum, anterior transversal stripe and side areas of metanotum, propodeal valves, and paired propodeal posterior dorsal spots (sometimes reduced), one dorsolateral stripe on mid coxa, two dorsal stripes on hind coxae; apical mark on all femora; distal bands on metasomal terga l-3 (-4, somewhat indistinctly), and sterna 23 (-4, somewhat indistinctly), yellow (somewhat reddish hue); reddish suffused areas on lateral of pronotum, mesepisternum and upper and lower metapleural plate, and disc of metasomal tergum 2;
<emphasis id="EF85BE44FFDF0868FBF7F884B7A6F88F" italics="true" pageId="17" pageNumber="70">base of mid and hind femora with a reddish anterior spot</emphasis> <emphasis id="EF85BE44FFDF0868FBF7F884B7A6F88F" italics="true" pageId="17" pageNumber="70">base of mid and hind femora with a reddish anterior spot</emphasis>
; elongate mark on anterior face of hind tibiae, reddish brown; first article of all tarsi light reddish brown, remaining articles black; tegula light brown; wings hyaline, venation brown. ; elongate mark on anterior face of hind tibiae, reddish brown; first article of all tarsi light reddish brown, remaining articles black; tegula light brown; wings hyaline, venation brown.
</paragraph> </paragraph>
<paragraph id="DD4E6256FFDC086BFFDCFF2AB6F8FF42" blockId="18.[114,785,152,590]" box="[114,688,152,171]" pageId="18" pageNumber="71"> <paragraph id="DD4E6256FFDC086BFFDCFF2AB6F8FF42" blockId="18.[114,785,152,590]" box="[114,688,152,171]" pageId="18" pageNumber="71">
Male (see Male (see
<figureCitation id="45CA7ED3FFDC086BFF77FF2AB504FF42" box="[217,332,152,171]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." pageId="18" pageNumber="71">Figs. 40; 41</figureCitation> <figureCitation id="45CA7ED3FFDC086BFF77FF2AB504FF42" box="[217,332,152,171]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196044" httpUri="https://zenodo.org/record/13196044/files/figure.png" pageId="18" pageNumber="71">Figs. 40; 41</figureCitation>
) (largely following Richards, 1978) ) (largely following Richards, 1978)
</paragraph> </paragraph>
<paragraph id="DD4E6256FFDC086BFFDCFF01B6F1FF16" blockId="18.[114,785,152,590]" pageId="18" pageNumber="71"> <paragraph id="DD4E6256FFDC086BFFDCFF01B6F1FF16" blockId="18.[114,785,152,590]" pageId="18" pageNumber="71">
@ -158,9 +159,9 @@ from
(also in (also in
<collectionCode id="BBE0FA93FFDC086BFD7DFD5DB742FCEB" box="[723,778,751,770]" country="United Kingdom" lsid="urn:lsid:biocol.org:col:14908" name="University of Nottingham" pageId="18" pageNumber="71" type="Herbarium">NHM</collectionCode> <collectionCode id="BBE0FA93FFDC086BFD7DFD5DB742FCEB" box="[723,778,751,770]" country="United Kingdom" lsid="urn:lsid:biocol.org:col:14908" name="University of Nottingham" pageId="18" pageNumber="71" type="Herbarium">NHM</collectionCode>
) ( ) (
<figureCitation id="45CA7ED3FFDC086BFFD4FCB9B480FCF7" box="[122,200,779,798]" captionStart="Figs" captionStartId="6.[114,149,1355,1369]" captionTargetBox="[390,1225,149,1324]" captionTargetId="figure-11@6.[390,1225,149,1324]" captionTargetPageId="6" captionText="Figs. 2734. General dorsal and lateral body views (females). 2728: M. mourei (Brazil, PR, Curitiba, paralectotype, IOC); 2930: M. barbatus (Colombia: Antioquia, MPEG); 3132:M.mixtus (Mexico:Chiapas, EBCC); 3334:M.imeldai (33 dorsal holotype, Peru, IOC) (34 lateral Bolivia,NHM); all scales =1.0 mm; scales in figs. (2728), (3334) are estimates." pageId="18" pageNumber="71">Figs. 34</figureCitation> <figureCitation id="45CA7ED3FFDC086BFFD4FCB9B480FCF7" box="[122,200,779,798]" captionStart="Figs" captionStartId="6.[114,149,1355,1369]" captionTargetBox="[390,1225,149,1324]" captionTargetId="figure-11@6.[390,1225,149,1324]" captionTargetPageId="6" captionText="Figs. 2734. General dorsal and lateral body views (females). 2728: M. mourei (Brazil, PR, Curitiba, paralectotype, IOC); 2930: M. barbatus (Colombia: Antioquia, MPEG); 3132:M.mixtus (Mexico:Chiapas, EBCC); 3334:M.imeldai (33 dorsal holotype, Peru, IOC) (34 lateral Bolivia,NHM); all scales =1.0 mm; scales in figs. (2728), (3334) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196042" httpUri="https://zenodo.org/record/13196042/files/figure.png" pageId="18" pageNumber="71">Figs. 34</figureCitation>
; ;
<figureCitation id="45CA7ED3FFDC086BFF7EFCB9B4A2FCF7" box="[208,234,779,798]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." pageId="18" pageNumber="71">38</figureCitation> <figureCitation id="45CA7ED3FFDC086BFF7EFCB9B4A2FCF7" box="[208,234,779,798]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196044" httpUri="https://zenodo.org/record/13196044/files/figure.png" pageId="18" pageNumber="71">38</figureCitation>
). Richards identified this specimen as ). Richards identified this specimen as
<taxonomicName id="1AF119D5FFDC086BFDCBFCB8B681FCF7" authorityName="Zikan" authorityYear="1949" box="[613,713,778,798]" class="Insecta" family="Vespidae" genus="Mischocyttarus" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" pageId="18" pageNumber="71" phylum="Arthropoda" rank="species" species="imeldai"> <taxonomicName id="1AF119D5FFDC086BFDCBFCB8B681FCF7" authorityName="Zikan" authorityYear="1949" box="[613,713,778,798]" class="Insecta" family="Vespidae" genus="Mischocyttarus" higherTaxonomySource="GBIF" kingdom="Animalia" order="Hymenoptera" pageId="18" pageNumber="71" phylum="Arthropoda" rank="species" species="imeldai">
<emphasis id="EF85BE44FFDC086BFDCBFCB8B681FCF7" box="[613,713,778,798]" italics="true" pageId="18" pageNumber="71">M. imeldai</emphasis> <emphasis id="EF85BE44FFDC086BFDCBFCB8B681FCF7" box="[613,713,778,798]" italics="true" pageId="18" pageNumber="71">M. imeldai</emphasis>
@ -177,7 +178,7 @@ near
) and agrees with the ) and agrees with the
<typeStatus id="024ADCF4FFDC086BFDC4FCEDB68CFC9B" box="[618,708,863,882]" pageId="18" pageNumber="71" type="holotype">holotype</typeStatus> <typeStatus id="024ADCF4FFDC086BFDC4FCEDB68CFC9B" box="[618,708,863,882]" pageId="18" pageNumber="71" type="holotype">holotype</typeStatus>
female in most characters, except for a somewhat trivial difference in the length of the first metasomal tergum (relatively shorter), and for a small difference in the shape of the apex of the clypeus which seems narrower (compare female in most characters, except for a somewhat trivial difference in the length of the first metasomal tergum (relatively shorter), and for a small difference in the shape of the apex of the clypeus which seems narrower (compare
<figureCitation id="45CA7ED3FFDC086BFE2CFC7CB651FC08" box="[386,537,974,993]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." pageId="18" pageNumber="71">Figs. 37 and 38</figureCitation> <figureCitation id="45CA7ED3FFDC086BFE2CFC7CB651FC08" box="[386,537,974,993]" captionStart="Figs" captionStartId="9.[85,120,1272,1286]" captionTargetBox="[363,1194,152,1240]" captionTargetId="figure-11@9.[361,1196,150,1242]" captionTargetPageId="9" captionText="Figs. 3543. 3538: frontal view of female head (35: M. camanducaia sp. nov., holotype, Brazil, MG, Camanducaia, MPEG; 36: M. declaratus, MG, Barroso, MPEG; 37: M. imeldai, holotype, Peru, IOC; 38: M. imeldai, Bolivia, NHM); 39 and 42: general lateral body view of males (39: M. proximus, SP, Campos do Jordão, MPEG; 42: M. declaratus, MG, Barroso, MPEG); 4041: male M. imeldai (Peru, NHM) showing mandibles, clypeus and lower face (40) and antennal flagellum (41); 43: anterior-ventral view of face of male M. declaratus (MG, Barroso; MPEG); all scales = 0.50mm, except Figs.39 and 42 (= 1.0mm); scales in figs. (3738), (40) are estimates." figureDoi="http://doi.org/10.5281/zenodo.13196044" httpUri="https://zenodo.org/record/13196044/files/figure.png" pageId="18" pageNumber="71">Figs. 37 and 38</figureCitation>
) )
</materialsCitation> </materialsCitation>
. .
@ -189,7 +190,7 @@ Distribution
and and
<collectingCountry id="A5E622C6FFDC086BFF5FFB22B57EFB4A" box="[241,310,1168,1187]" name="Bolivia" pageId="18" pageNumber="71">Bolivia</collectingCountry> <collectingCountry id="A5E622C6FFDC086BFF5FFB22B57EFB4A" box="[241,310,1168,1187]" name="Bolivia" pageId="18" pageNumber="71">Bolivia</collectingCountry>
( (
<figureCitation id="45CA7ED3FFDC086BFEEAFB22B5CFFB4A" box="[324,391,1168,1187]" captionStart="Fig" captionStartId="15.[85,112,1463,1477]" captionTargetBox="[301,1260,799,1432]" captionTargetId="figure-149@15.[300,1260,796,1433]" captionTargetPageId="15" captionText="Fig. 46. Partial truncated map for Central and South America with species distributions for the M. barbatus group, and with the pooled distribution of the group of M.wagneri (see next figure for detailed representation of distributions of species of this group)." pageId="18" pageNumber="71">Fig. 46</figureCitation> <figureCitation id="45CA7ED3FFDC086BFEEAFB22B5CFFB4A" box="[324,391,1168,1187]" captionStart="Fig" captionStartId="15.[85,112,1463,1477]" captionTargetBox="[301,1260,799,1432]" captionTargetId="figure-149@15.[300,1260,796,1433]" captionTargetPageId="15" captionText="Fig. 46. Partial truncated map for Central and South America with species distributions for the M. barbatus group, and with the pooled distribution of the group of M.wagneri (see next figure for detailed representation of distributions of species of this group)." figureDoi="http://doi.org/10.5281/zenodo.13196052" httpUri="https://zenodo.org/record/13196052/files/figure.png" pageId="18" pageNumber="71">Fig. 46</figureCitation>
) )
</paragraph> </paragraph>
<paragraph id="DD4E6256FFDC086BFFDCFB67B482FB01" blockId="18.[114,785,1237,1396]" box="[114,202,1237,1256]" pageId="18" pageNumber="71">Remarks</paragraph> <paragraph id="DD4E6256FFDC086BFFDCFB67B482FB01" blockId="18.[114,785,1237,1396]" box="[114,202,1237,1256]" pageId="18" pageNumber="71">Remarks</paragraph>

View file

@ -0,0 +1,181 @@
<document id="49161B90CBB86211D6D5EFB76E3890B9" ID-DOI="10.1590/1806-9665-RBENT-2023-0091" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722639546042" checkinUser="felipe" docAuthor="Carmo, Daniel Dias Dornelas do &amp; Henriques, Augusto Loureiro" docDate="2024" docId="9A75D465FF8BFF80C344FBBD7ACCFB5E" docLanguage="en" docName="RevBrasEntomol.68.1.e20230091.pdf" docOrigin="Revista Brasileira de Entomologia (e 20230091) 68 (1)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2023-0091" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Tabanus argentistrigatus Carmo &amp; Henriques, 2024, sp.n." docType="treatment" docVersion="1" lastPageNumber="2" masterDocId="664CAC1DFF8AFF81C317FFEE7F6FFFCD" masterDocTitle="Eighty-five years awaiting for description: a new species of Tabanus Linnaeus (Diptera: Tabanidae) from the Paraná State, in Brazil" masterLastPageNumber="5" masterPageNumber="1" pageNumber="2" updateTime="1722683284668" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="92ABAC4E1C4512D034EDD3621F4FE614" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="6E582D301BE9DCECDBCA3100F62A5986">
<mods:title id="F8339D47E55FFEE42BBE1F623EDBE263">Eighty-five years awaiting for description: a new species of Tabanus Linnaeus (Diptera: Tabanidae) from the Paraná State, in Brazil</mods:title>
</mods:titleInfo>
<mods:name id="9969E6DD1B536B0AD1D9776594A50DDC" type="personal">
<mods:role id="8B144B617D7ED46C1DB89E0E0F6A06F0">
<mods:roleTerm id="08DB72CBB04C31609B0B0F0414F8E616">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="18353804453244340EBEAD635C6226BF">Carmo, Daniel Dias Dornelas do</mods:namePart>
<mods:affiliation id="D1604EDCF4188FB943EED83E77FB0A03">Universidade de São Paulo, Faculdade de Filosofia, Ciências e Letras, Departamento de Biologia, Ribeirão Preto, SP, Brasil.</mods:affiliation>
<mods:nameIdentifier id="E75C0B99E0755A9AA92EDF5188AE7F1E" type="email">dandorndias@gmail.com</mods:nameIdentifier>
</mods:name>
<mods:name id="C47CE729B6FC09D09ABDBBBF93B3E387" type="personal">
<mods:role id="F163D6766B0A278E5AA9DFC351E18DCF">
<mods:roleTerm id="A4792E855D25E17A240E87CC36299F90">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="482E9A37BE3BA6227AE33662D6F00C0E">Henriques, Augusto Loureiro</mods:namePart>
<mods:affiliation id="7E9F99F3157FCEE0D606EBBCDC581A66">Instituto Nacional de Pesquisas da Amazônia, Manaus, AM, Brasil.</mods:affiliation>
</mods:name>
<mods:typeOfResource id="A966208BE901F0B8057A390613A1EB60">text</mods:typeOfResource>
<mods:relatedItem id="44B2240FAB6E83D5430C86A14E49B444" type="host">
<mods:titleInfo id="74F4647D3B8C0EB9AFC9C3E5418C7142">
<mods:title id="FEB13D6A7463E73A1D023E34B150CB51">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="804A1325872CE8E663C58C67CFD0CE9E">
<mods:date id="2DD9CEDD1A6235753A0652E0E168D7DF">2024</mods:date>
<mods:detail id="7F62E8D973AB313F68E123BEE264D025" type="series">
<mods:title id="39F4B2CC4461730583B1E61522BA680E">e 20230091</mods:title>
</mods:detail>
<mods:detail id="FC90EFC80AF84B74C3E8FE228A08846C" type="pubDate">
<mods:number id="01DE4A645D8DDE1F79DBE7C47C4377B5">2024-04-19</mods:number>
</mods:detail>
<mods:detail id="180BE511DC4982F796EF13D325E6F4E8" type="volume">
<mods:number id="E85A13C1FC7D4C6631E9A00F4CA3E1A8">68</mods:number>
</mods:detail>
<mods:detail id="8842494557911B9A8A3BF0BC9FCC4EBD" type="issue">
<mods:number id="F6246616AB37A1B2FB974A30EA0AE74B">1</mods:number>
</mods:detail>
<mods:extent id="93F2E169426609C2872F47DB740E185A" unit="page">
<mods:start id="EA4EB8C0112BCCF2144C75985E4F0B83">1</mods:start>
<mods:end id="FF02AD6067435F2F4E455F50B60D50F1">5</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="51D61A4FC006F81C11EC22359024BDF0">
<mods:url id="231E98D1E031B957B100EA27826396C1">http://dx.doi.org/10.1590/1806-9665-rbent-2023-0091</mods:url>
</mods:location>
<mods:classification id="FF8CBC822470D830EE36CCFD6A79937F">journal article</mods:classification>
<mods:identifier id="AD1D6B7D9DD83E5A78EC24D58FADB12F" type="DOI">10.1590/1806-9665-RBENT-2023-0091</mods:identifier>
<mods:identifier id="7D34BA3B5BA64A56DB9DE19DD2F10956" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="9A75D465FF8BFF80C344FBBD7ACCFB5E" LSID="urn:lsid:plazi:treatment:9A75D465FF8BFF80C344FBBD7ACCFB5E" httpUri="http://treatment.plazi.org/id/9A75D465FF8BFF80C344FBBD7ACCFB5E" lastPageNumber="2" pageId="1" pageNumber="2">
<subSubSection id="5AC636F8FF8BFF80C344FBBD7EE8FBAB" box="[83,391,1107,1126]" pageId="1" pageNumber="2" type="nomenclature">
<paragraph id="12636573FF8BFF80C344FBBD7EE8FBAB" blockId="1.[83,391,1107,1126]" box="[83,391,1107,1126]" pageId="1" pageNumber="2">
<heading id="492BD21FFF8BFF80C344FBBD7EE8FBAB" bold="true" box="[83,391,1107,1126]" fontSize="8" level="2" pageId="1" pageNumber="2" reason="2">
<emphasis id="20A8B961FF8BFF80C344FBBD7EE8FBAB" bold="true" box="[83,391,1107,1126]" pageId="1" pageNumber="2">
<taxonomicName id="D5DC1EF0FF8BFF80C344FBBD7E3EFBAB" ID-CoL="CF6NX" authorityName="Carmo &amp; Henriques" authorityYear="2024" box="[83,337,1107,1126]" class="Insecta" family="Tabanidae" genus="Tabanus" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="2" phylum="Arthropoda" rank="species" species="argentistrigatus" status="sp. nov.">Tabanus argentistrigatus</taxonomicName>
<taxonomicNameLabel id="3B9B041AFF8BFF80C240FBBD7EE8FBAB" box="[343,391,1107,1126]" pageId="1" pageNumber="2" rank="species">sp.n.</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="5AC636F8FF8BFF80C344FB837D9BFB75" pageId="1" pageNumber="2" type="description">
<paragraph id="12636573FF8BFF80C344FB837D9BFB75" blockId="1.[83,186,1133,1152]" lastBlockId="1.[82,757,1189,1985]" pageId="1" pageNumber="2">
<heading id="492BD21FFF8BFF80C344FB837FD5FB4D" bold="true" box="[83,186,1133,1152]" fontSize="8" level="2" pageId="1" pageNumber="2" reason="2">
<emphasis id="20A8B961FF8BFF80C344FB837FD5FB4D" bold="true" box="[83,186,1133,1152]" pageId="1" pageNumber="2">
<figureCitation id="8AE779F6FF8BFF80C344FB837FE0FB4D" box="[83,143,1133,1152]" captionStart="Figure 1" captionStartId="2.[113,165,1947,1964]" captionTargetBox="[113,1500,182,1930]" captionTargetId="figure-13@2.[110,1507,182,1934]" captionTargetPageId="2" captionText="Figure 1 Tabanus argentistrigatus sp.n. Holotype female. A. Dorsal habitus.B. Lateral habitus.C. Frons.D. Head,lateral view.Paratype female. E. Dorsal habitus.Labels. F. Holotype. G. Paratype.H. Paratype, verse.Scale bars. A, B, E = 5 mm; C, D = 1 mm." pageId="1" pageNumber="2">Figs. 1</figureCitation>
A-H
</emphasis>
</heading>
<uri id="664D6971FF8BFF80C36EFB4B7D9BFB75" box="[121,756,1189,1208]" pageId="1" pageNumber="2">
urn:lsid:zoobank.org:act:
<uuid id="667A5FA6FF8BFF80C258FB4B7D9BFB75" box="[335,756,1189,1208]" pageId="1" pageNumber="2">32B003E4-0750-4832-8B4B-0DDAEB687267</uuid>
</uri>
</paragraph>
</subSubSection>
<subSubSection id="5AC636F8FF8BFF80C36EFB2D7D9BFA47" pageId="1" pageNumber="2" type="diagnosis">
<paragraph id="12636573FF8BFF80C36EFB2D7D9BFA47" blockId="1.[82,757,1189,1985]" pageId="1" pageNumber="2">
<emphasis id="20A8B961FF8BFF80C36EFB2D7F89FB1B" bold="true" box="[121,230,1219,1238]" pageId="1" pageNumber="2">Diagnosis:</emphasis>
The new species differ from the other Neotropical
<taxonomicName id="D5DC1EF0FF8BFF80C344FB0F7FCDFB39" authorityName="Linnaeus" authorityYear="1758" box="[83,162,1249,1268]" class="Insecta" family="Tabanidae" genus="Tabanus" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="2" phylum="Arthropoda" rank="genus">Tabanus</taxonomicName>
by the following combination of characters: large size, about
<quantity id="D524C896FF8BFF80C343FB117FF6FADE" box="[84,153,1279,1299]" metricMagnitude="-2" metricUnit="m" metricValue="2.0" pageId="1" pageNumber="2" unit="mm" value="20.0">20 mm</quantity>
, reddish brown integument, with a single prominent middorsal abdominal stripe of golden setulae. Additionally, the wing, including calypters, is yellowish fumose,with a narrow,yellow, nearly indiscernible pterostigma.The flagellum is light yellow with sparse black setulae, basal plate slender, shorter to the same size of style. Frons broad and parallel.
</paragraph>
</subSubSection>
<subSubSection id="5AC636F8FF8BFF80C36EFA7B7C82FCA0" pageId="1" pageNumber="2" type="materials_examined">
<paragraph id="12636573FF8BFF80C36EFA7B7A6CFDC0" blockId="1.[82,757,1189,1985]" lastBlockId="1.[800,1475,153,1172]" pageId="1" pageNumber="2">
<emphasis id="20A8B961FF8BFF80C36EFA7B7E5AFA6A" bold="true" box="[121,309,1428,1448]" pageId="1" pageNumber="2">
<typeStatus id="CD67DBD1FF8BFF80C36EFA7B7FB6FA65" box="[121,217,1429,1448]" pageId="1" pageNumber="2" type="holotype">Holotype</typeStatus>
female (
</emphasis>
<figureCitation id="8AE779F6FF8BFF80C222FA7A7E01FA65" box="[309,366,1428,1448]" captionStart="Figure 1" captionStartId="2.[113,165,1947,1964]" captionTargetBox="[113,1500,182,1930]" captionTargetId="figure-13@2.[110,1507,182,1934]" captionTargetPageId="2" captionText="Figure 1 Tabanus argentistrigatus sp.n. Holotype female. A. Dorsal habitus.B. Lateral habitus.C. Frons.D. Head,lateral view.Paratype female. E. Dorsal habitus.Labels. F. Holotype. G. Paratype.H. Paratype, verse.Scale bars. A, B, E = 5 mm; C, D = 1 mm." pageId="1" pageNumber="2">Figs. 1</figureCitation>
A-D, F
<emphasis id="20A8B961FF8BFF80C2A6FA7A7EAFFA6A" bold="true" box="[433,448,1428,1447]" pageId="1" pageNumber="2">):</emphasis>
Length
<quantity id="D524C896FF8BFF80C107FA7B7D38FA65" box="[528,599,1429,1448]" metricMagnitude="-2" metricUnit="m" metricValue="1.9" pageId="1" pageNumber="2" unit="mm" value="19.0">19 mm</quantity>
, reddish brown integument. Frons moderately broad (FI = 3.6) and parallel (DI = 1.2), with brown integument covered with yellow pruinosity, white near vertex, and with mixed black and golden setulae. Vertex slightly sunken, with shiny brown area, no vestiges of ocelli. Occiput with mostly golden setulae, a few black near the eye margin. Frontal callus drop shaped, yellowish brown, not touching the eyes margins. Median callus a dorsal extension of the frontal callus, narrow and almost reaching the eye triangle. Subcallus and clypeus yellowish pruinose, gena darker, both clypeus and gena covered with short dark brown setulae. Palpi enlarged at base, yellowish pruinose with black setulae. Both proboscis and stylets shorter than half the head height, prementum yellow, labella dark brown with sparse black setulae and wholly pruinose. Antennae wholly yellow, scape with black setulae. Pedicel with a short spike, not surpassing scape height. Basal plate slender, with similar size to the style. Style with four segments, with short, sparse black setulae, some golden setulae at the apex of the fourth. Mesonotum reddish brown with gray pruinosity and mixed black and golden setulae. Notopleuron concolorous, mostly with black setulae, but some golden dorsally. Scutellum mostly with black setulae, golden at the apex. Pleura light brown, yellow pruinose, mostly with dark brown setulae with a light brown tuft dorsally at anepisternum near to the axillary sclerites. Legs mostly yellowish brown, except by the darker tarsi. All coxae and femora with black setulae. Fore tibia with golden setulae ventrally. Mid and hind tibia with mixed black and golden setulae. Wings including calypters, yellowish fumose, pterostigma yellow, almost inconspicuous. Abdomen very long, nearly twice the length of the mesonotum, reddish brown, with black setulae, golden setulae laterally and on a dorsomedial stripe from segments 1 to 7, paler on the last segments. Sternites with black setulae, with few golden setulae at the middle of segments 1 to 7.
</paragraph>
<paragraph id="12636573FF8BFF80C050FDF97C85FDE7" blockId="1.[800,1475,153,1172]" box="[839,1002,535,554]" pageId="1" pageNumber="2">
<emphasis id="20A8B961FF8BFF80C050FDF97C10FDE7" bold="true" box="[839,895,535,554]" pageId="1" pageNumber="2">Male.</emphasis>
Unknown.
</paragraph>
<paragraph id="12636573FF8BFF80C050FDDB7B1EFCD8" blockId="1.[800,1475,153,1172]" pageId="1" pageNumber="2">
<emphasis id="20A8B961FF8BFF80C050FDDB7CB5FD8A" bold="true" box="[839,986,564,584]" pageId="1" pageNumber="2">Type material.</emphasis>
<materialsCitation id="A2B46F2EFF8BFF80C0F7FDDB7B07FD4F" collectorName="Coll. Claretiano" country="Brazil" county="Curityba" latitude="-25.460835" location="Parolim" longLatPrecision="21" longitude="-49.267223" municipality="Sic" pageId="1" pageNumber="2" specimenCount="1" stateProvince="Parana" typeStatus="holotype">
<emphasis id="20A8B961FF8BFF80C0F7FDDB7BE5FD8A" bold="true" box="[992,1162,564,584]" pageId="1" pageNumber="2">
<typeStatus id="CD67DBD1FF8BFF80C0F7FDDB7B52FD85" box="[992,1085,565,584]" pageId="1" pageNumber="2" type="holotype">Holotype</typeStatus>
female
</emphasis>
: [
<collectingCountry id="6ACB25E3FF8BFF80C78BFDDB7BB6FD85" box="[1180,1241,565,584]" name="Brazil" pageId="1" pageNumber="2">Brazil</collectingCountry>
]•
<collectingRegion id="D018AB91FF8BFF80C7FCFDDB7A40FD85" box="[1259,1327,565,584]" country="Brazil" name="Parana" pageId="1" pageNumber="2">Paraná</collectingRegion>
,
<collectingCounty id="FB021DFFFF8BFF80C62FFDDB7AE3FD85" box="[1336,1420,565,584]" pageId="1" pageNumber="2">Curityba</collectingCounty>
(
<collectingMunicipality id="F207FF09FF8BFF80C68FFDDB7AD8FD85" box="[1432,1463,565,584]" pageId="1" pageNumber="2">Sic</collectingMunicipality>
), (
<location id="170333A8FF8BFF80C03FFDBC7C18FDA8" LSID="urn:lsid:plazi:treatment:9A75D465FF8BFF80C344FBBD7ACCFB5E:170333A8FF8BFF80C03FFDBC7C18FDA8" box="[808,887,594,613]" country="Brazil" county="Curityba" latitude="-25.460835" longLatPrecision="21" longitude="-49.267223" municipality="Sic" name="Parolim" pageId="1" pageNumber="2" stateProvince="Parana">Parolim</location>
) [
<geoCoordinate id="77E803B4FF8BFF80C09DFDBC7C96FDA8" box="[906,1017,594,613]" degrees="25" direction="south" minutes="27" orientation="latitude" pageId="1" pageNumber="2" precision="15" seconds="39" value="-25.460835">25°2739”S</geoCoordinate>
,
<geoCoordinate id="77E803B4FF8BFF80C713FDBC7BEFFDA8" box="[1028,1152,594,613]" degrees="49" direction="west" minutes="16" orientation="longitude" pageId="1" pageNumber="2" precision="15" seconds="02" value="-49.267223">49°1602”W</geoCoordinate>
]; XI.938 [1938];
<collectorName id="BF2900A5FF8BFF80C632FDBC7AD0FDA8" box="[1317,1471,594,613]" pageId="1" pageNumber="2">Coll. Claretiano</collectorName>
;
<taxonomicName id="D5DC1EF0FF8BFF80C036FD817B07FD4F" authority="Fairchild" authorityName="Fairchild" box="[801,1128,623,642]" class="Insecta" family="Tabanidae" genus="Tabanus" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="2" phylum="Arthropoda" rank="species" species="argentistrigatus">Tabanus argentistrigatus Fairchild</taxonomicName>
</materialsCitation>
<materialsCitation id="A2B46F2EFF8BFF80C77BFD817AD0FD4E" box="[1132,1471,623,643]" collectionCode="MZ" country="Brazil" pageId="1" pageNumber="2" specimenCode="MZ01411" specimenCount="1" stateProvince="Parana" typeStatus="holotype">
<typeStatus id="CD67DBD1FF8BFF80C77BFD817BA9FD4F" box="[1132,1222,623,642]" pageId="1" pageNumber="2" type="holotype">Holotype</typeStatus>
[Handwritten];
<specimenCode id="427ACD08FF8BFF80C674FD9E7AD0FD4E" box="[1379,1471,624,643]" collectionCode="MZ" country="0" name="Museum of the Earth, Polish Academy of Sciences" pageId="1" pageNumber="2">MZ01411</specimenCode>
</materialsCitation>
;
<typeStatus id="CD67DBD1FF8BFF80C037FD637C1AFD6D" box="[800,885,653,672]" pageId="1" pageNumber="2" type="holotype">Holótipo</typeStatus>
[on lateral]
<taxonomicName id="D5DC1EF0FF8BFF80C0F1FD637AF9FD6D" authority="Carmo &amp; Henriques" authorityName="Carmo &amp; Henriques" authorityYear="2024" box="[998,1430,653,672]" class="Insecta" family="Tabanidae" genus="Tabanus" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="2" phylum="Arthropoda" rank="species" species="argentistrigatus">Tabanus argentistrigatus Carmo &amp; Henriques</taxonomicName>
[red label].
<materialsCitation id="A2B46F2EFF8BFF80C076FD457C1AFD16" collectionCode="MZ" country="Brazil" pageId="1" pageNumber="2" specimenCount="1" specimenCount-female="1" stateProvince="Parana" typeStatus="paratype">
<typeStatus id="CD67DBD1FF8BFF80C076FD457CD3FD73" box="[865,956,683,702]" pageId="1" pageNumber="2" type="paratype">Paratype</typeStatus>
:
<specimenCount id="04DAAEFAFF8BFF80C0D4FD447C8EFD73" box="[963,993,682,702]" count="1" pageId="1" pageNumber="2" type="female">1♀</specimenCount>
; Same data as holotype;
<taxonomicName id="D5DC1EF0FF8BFF80C7C5FD447C1AFD16" authority="Fairchild" authorityName="Fairchild" class="Insecta" family="Tabanidae" genus="Tabanus" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="2" phylum="Arthropoda" rank="species" species="argentistrigatus">Tabanus argentistrigatus Fairchild</taxonomicName>
</materialsCitation>
<typeStatus id="CD67DBD1FF8BFF80C06CFD267CBEFD16" box="[891,977,712,731]" pageId="1" pageNumber="2" type="paratype">Paratype</typeStatus>
[Handwritten]; This sp. never published GBF 1959 [On verse, handwritten];
<typeStatus id="CD67DBD1FF8BFF80C704FD0B7B0BFD35" box="[1043,1124,741,760]" pageId="1" pageNumber="2" type="paratype">Parátipo</typeStatus>
[on lateral]
<taxonomicName id="D5DC1EF0FF8BFF80C7C3FD0B7C8FFCD8" authority="Carmo &amp; Henriques" authorityName="Carmo &amp; Henriques" authorityYear="2024" class="Insecta" family="Tabanidae" genus="Tabanus" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="2" phylum="Arthropoda" rank="species" species="argentistrigatus">Tabanus argentistrigatus Carmo &amp; Henriques</taxonomicName>
[yellow label].
</paragraph>
<paragraph id="12636573FF8BFF80C050FCCE7C82FCA0" blockId="1.[800,1475,153,1172]" pageId="1" pageNumber="2">
<materialsCitation id="A2B46F2EFF8BFF80C050FCCE7C85FCA0" collectionCode="R" pageId="1" pageNumber="2" specimenCode="R4" specimenCount="2" typeStatus="paratype">
<emphasis id="20A8B961FF8BFF80C050FCCE7B4EFCFF" bold="true" box="[839,1057,799,819]" pageId="1" pageNumber="2">
<typeStatus id="CD67DBD1FF8BFF80C050FCCE7CC9FCFE" box="[839,934,800,819]" pageId="1" pageNumber="2" type="paratype">Paratype</typeStatus>
variations:
</emphasis>
Length =
<quantity id="D524C896FF8BFF80C79AFCCE7B84FCFE" box="[1165,1259,800,819]" metricMagnitude="-2" metricUnit="m" metricValue="1.83" pageId="1" pageNumber="2" unit="mm" value="18.3">18.3 mm</quantity>
. Frontal index = 3.3. Divergence Index = 1.1. Basal plate broader than
<typeStatus id="CD67DBD1FF8BFF80C617FCD37A36FC9D" box="[1280,1369,829,848]" pageId="1" pageNumber="2" type="holotype">holotype</typeStatus>
.
<specimenCode id="427ACD08FF8BFF80C674FCD37A12FC9D" box="[1379,1405,829,848]" collectionCode="R" country="Chile" name="Departamento de Geologia, Universidad de Chile" pageId="1" pageNumber="2">R4</specimenCode>
with a very short appendix
</materialsCitation>
.
</paragraph>
</subSubSection>
<subSubSection id="5AC636F8FF8BFF80C050FC967ACCFB5E" pageId="1" pageNumber="2" type="etymology">
<paragraph id="12636573FF8BFF80C050FC967ACCFB5E" blockId="1.[800,1475,153,1172]" pageId="1" pageNumber="2">
<emphasis id="20A8B961FF8BFF80C050FC967CD5FC46" bold="true" box="[839,954,888,907]" pageId="1" pageNumber="2">Etymology.</emphasis>
From Latin,argentum (silver) + strigatus (color band). The name refers to the abdominal stripe with light setulae, contrasting with the brown integument of the specimens.This is the name intended by Fairchild, as indicated by his labels left in the specimens (
<figureCitation id="8AE779F6FF8BFF80C620FC3E7AD9FC2E" box="[1335,1462,976,995]" captionStart="Figure 1" captionStartId="2.[113,165,1947,1964]" captionTargetBox="[113,1500,182,1930]" captionTargetId="figure-13@2.[110,1507,182,1934]" captionTargetPageId="2" captionText="Figure 1 Tabanus argentistrigatus sp.n. Holotype female. A. Dorsal habitus.B. Lateral habitus.C. Frons.D. Head,lateral view.Paratype female. E. Dorsal habitus.Labels. F. Holotype. G. Paratype.H. Paratype, verse.Scale bars. A, B, E = 5 mm; C, D = 1 mm." pageId="1" pageNumber="2">Figs. 1F and G</figureCitation>
). Despite observing that the setulae on the abdominal stripe are not silver, we decided to keep the name as intended by Fairchild, since the setulae on the stripe are paler on the last segments. Also, it is possible to see a flash of silver depending to the incidence of light. We decided to keep the name as a way to honoring this researcher, who was the first to recognize the new species, although without describing it.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -1,63 +1,64 @@
<document id="E11DEB76ED757C85C72559DAEC3DBA90" ID-DOI="10.1590/1806-9665-RBENT-2018-131" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722636595181" checkinUser="felipe" docAuthor="Gonzalez, Patricia, Claps, Lucia &amp; Juarez, Andrea" docDate="2020" docId="9D0A6F1B0445FFB7FF5DCC73FB1F8AB9" docLanguage="en" docName="RevBrasEntomol.64.1.e2018131.pdf" docOrigin="Revista Brasileira de Entomologia (e 2018131) 64 (1)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2018-131" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Neotectococcus lenticularis Hempel 1937" docType="treatment" docVersion="1" lastPageNumber="7" masterDocId="613317630443FFB1FFCACA49FFE68935" masterDocTitle="Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species" masterLastPageNumber="9" masterPageNumber="1" pageNumber="7" updateTime="1722680918204" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0"> <document id="52EC8CD06FBD6B0DCD17382B01FAE250" ID-DOI="10.1590/1806-9665-RBENT-2018-131" ID-ISSN="1806-9665" ID-Zenodo-Dep="13196379" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722636595181" checkinUser="felipe" docAuthor="Gonzalez, Patricia, Claps, Lucia &amp; Juarez, Andrea" docDate="2020" docId="9D0A6F1B0445FFB7FF5DCC73FB1F8AB9" docLanguage="en" docName="RevBrasEntomol.64.1.e2018131.pdf" docOrigin="Revista Brasileira de Entomologia (e 2018131) 64 (1)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2018-131" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Neotectococcus lenticularis Hempel 1937" docType="treatment" docVersion="3" lastPageNumber="7" masterDocId="613317630443FFB1FFCACA49FFE68935" masterDocTitle="Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species" masterLastPageNumber="9" masterPageNumber="1" pageNumber="7" updateTime="1722684236940" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="88397630460AF613DB03BCFB2EAEBCFC" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="1245A16A9563D08317FF237BD2116122" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="1B86EA6784F8E9169177FC809C5C8788"> <mods:titleInfo id="3FE0FB80035796A0D0D36B96C66B7F00">
<mods:title id="04DC6E4964F45F00E56ADC83B26D3C61">Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species</mods:title> <mods:title id="B6BDDCAD9D4E622C0561E4B6DB662E54">Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="0E01F8B48BA1DCC369440C32F3EF02F6" type="personal"> <mods:name id="432B698F3E3CECDAE364DFD7F8DFA7B7" type="personal">
<mods:role id="972BF6F687917C08993F23EE730E1294"> <mods:role id="85EDAB040D80B8DE40DC289EF5567481">
<mods:roleTerm id="6CD7297CCE0E91740BCFF88BA14C6C7D">Author</mods:roleTerm> <mods:roleTerm id="1E8FE6C8DCF4C10C1574D5711958D5F6">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="459689BBF094B7343FE5CE8AFAA51668">Gonzalez, Patricia</mods:namePart> <mods:namePart id="8DB904F20A0CB1F350EF4BD6DD51231F">Gonzalez, Patricia</mods:namePart>
<mods:affiliation id="B09B669E9C1900484CECC756DDEE2769">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation> <mods:affiliation id="C89F3AE7BE6D8DB546C1525FE26620BF">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation>
<mods:nameIdentifier id="C615684256826E4984B859C82AF262AE" type="email">mopagon2004@yahoo.com.ar</mods:nameIdentifier> <mods:nameIdentifier id="C6C9DFB5D6905997FB5328A1F505A7E6" type="email">mopagon2004@yahoo.com.ar</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="3ABAD6CB58F580A22BE8C6850D086CA9" type="personal"> <mods:name id="6BDA210727619976FBA265123E332911" type="personal">
<mods:role id="8FFB539157D7D97CC94F3FF2AF28E075"> <mods:role id="0F1F4B0B55F2EAAD0C20C7CDA6E0BADF">
<mods:roleTerm id="FACD2F0C83A881CB3176ECDD74C5AC9F">Author</mods:roleTerm> <mods:roleTerm id="8AF77906F6A8051AE819488BD6B46CC5">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="4307A92190164B405F4F040DB8E227A4">Claps, Lucia</mods:namePart> <mods:namePart id="2E6BCF723384C63F7F006556262E8749">Claps, Lucia</mods:namePart>
<mods:affiliation id="4DAEB4C018EC2C1F5F9DFE56032F3DBE">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation> <mods:affiliation id="2382D3D9CB6AAFB999611EC051FB3CB6">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation>
</mods:name> </mods:name>
<mods:name id="3CC14AFD4EBE361D10BA43F41931F2E3" type="personal"> <mods:name id="DD2811D3D6866F8893621DB7BBE20E47" type="personal">
<mods:role id="0F55F50A6F76F6DD3CADC9324FAC34FF"> <mods:role id="E7B7FFD45E369DE4E70836238BB1D340">
<mods:roleTerm id="7514F7C53121A5A99FC6C5AC06DBA3D9">Author</mods:roleTerm> <mods:roleTerm id="077801AA8110D99094B3D8F610FFE06F">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="187476B4EF9F7F7DC23310C04A328529">Juarez, Andrea</mods:namePart> <mods:namePart id="E8A479EA8DFCD0F014840F675CB34813">Juarez, Andrea</mods:namePart>
<mods:affiliation id="FB2FF7AE201D17882735B4DD22B194C3">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation> <mods:affiliation id="C4C916993B6193585F97485F27A68B21">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation>
</mods:name> </mods:name>
<mods:typeOfResource id="A0DBEB86476F2FA438F9FADD490BC1F2">text</mods:typeOfResource> <mods:typeOfResource id="498DE8DAE1EFBB4BCC519877C1CF5E5A">text</mods:typeOfResource>
<mods:relatedItem id="ABA9437372BCE189843485918B133456" type="host"> <mods:relatedItem id="BD3A62736C8A9FA4ED280BF2F3C956BC" type="host">
<mods:titleInfo id="3FA0A613FC0F7EA34B041525664F23E9"> <mods:titleInfo id="D591075B8145BEED5D98519E72AB6A36">
<mods:title id="F8EB8A3A36B991D432BC31180F9228FA">Revista Brasileira de Entomologia</mods:title> <mods:title id="F5C57CC1418D054D6D3E548AC47D32A4">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="820558F579A0DB94D49646D25DF8AA41"> <mods:part id="909FA22EE1E162D9E54B51EA39C9CA8B">
<mods:date id="DEDBBB6CDFE3F62A4577C229D5B9F85E">2020</mods:date> <mods:date id="3C308CAF43CB6531B8B397B4EEFCEC14">2020</mods:date>
<mods:detail id="522E648602708D013D3744585D9A7767" type="series"> <mods:detail id="9C9C8F30AEDB2CB34BDA5FB89EB9B428" type="series">
<mods:title id="5ACFF986DF6CB73D62296536FFF9F055">e 2018131</mods:title> <mods:title id="ABBEF675BFEA22B124AE2A3D6C3B0CD3">e 2018131</mods:title>
</mods:detail> </mods:detail>
<mods:detail id="A68A38011E9B132961C259B376C1C56F" type="pubDate"> <mods:detail id="0BE0C259A7F04B6A4057927DB3644B36" type="pubDate">
<mods:number id="00BE1AD7E417B517EBA271EE27B94E10">2020-03-23</mods:number> <mods:number id="03A57137DE12EBC4FFF6D6705A30FEAF">2020-03-23</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="33128B216D0BD9CD5870A062A4F80F56" type="volume"> <mods:detail id="79EBE5B47AD77FF49A2B32C515844809" type="volume">
<mods:number id="86BB1D35C448919AC22922FCBB88E0A8">64</mods:number> <mods:number id="C8498A4C8C92AD9F4342C30C91B750D4">64</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="153F752FF6DB46A197F0F62298684C14" type="issue"> <mods:detail id="83611946D775F121CA4DCD587537A43C" type="issue">
<mods:number id="5FB231A9530116114377F0F2927AA3FC">1</mods:number> <mods:number id="683BDB099DE842F53D923FEAC21F3BF5">1</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="B3CBA6876623713E4A7F494EB6265889" unit="page"> <mods:extent id="764DBFEB3FFCD78344FBAEA531C00D25" unit="page">
<mods:start id="BE65450BA0B660D7732BC56C45A010E5">1</mods:start> <mods:start id="DDFC75F2BB3368C0458B4D5FC353C24A">1</mods:start>
<mods:end id="4B31498DC12211B8D5FF1005FF24ED34">9</mods:end> <mods:end id="D3A47E2955E62E640CF53B53DD65189B">9</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="99B62A926913080D74D07B6620A71FBC"> <mods:location id="8782506D0BFEC6AAB8D7F3430FB0085D">
<mods:url id="DFF4501A8AD372C1E219FEF1CEBABCCB">http://dx.doi.org/10.1590/1806-9665-rbent-2018-131</mods:url> <mods:url id="7B0BCFF4A4D9D6D7C942DB0DB9737913">http://dx.doi.org/10.1590/1806-9665-rbent-2018-131</mods:url>
</mods:location> </mods:location>
<mods:classification id="8B2CCD5CAE9A9E6FC05461CABAA13A37">journal article</mods:classification> <mods:classification id="2C84ADD8B47A1802D287BCC09679C3B1">journal article</mods:classification>
<mods:identifier id="8FAE325A69DF745F656254D3A1E7989A" type="DOI">10.1590/1806-9665-RBENT-2018-131</mods:identifier> <mods:identifier id="99EBDA682C71D9D60E746A817B65AE0A" type="DOI">10.1590/1806-9665-RBENT-2018-131</mods:identifier>
<mods:identifier id="A0BE0DE6C52C472EBA18B52987EA9994" type="ISSN">1806-9665</mods:identifier> <mods:identifier id="6C88D1238B13C249217BEDC057F1DC3C" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="B6B75E7829E7B67EC4706990EC34EDCE" type="Zenodo-Dep">13196379</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="9D0A6F1B0445FFB7FF5DCC73FB1F8AB9" LSID="urn:lsid:plazi:treatment:9D0A6F1B0445FFB7FF5DCC73FB1F8AB9" httpUri="http://treatment.plazi.org/id/9D0A6F1B0445FFB7FF5DCC73FB1F8AB9" lastPageNumber="7" pageId="6" pageNumber="7"> <treatment id="9D0A6F1B0445FFB7FF5DCC73FB1F8AB9" ID-DOI="http://doi.org/10.5281/zenodo.13195135" ID-Zenodo-Dep="13195135" LSID="urn:lsid:plazi:treatment:9D0A6F1B0445FFB7FF5DCC73FB1F8AB9" httpUri="http://treatment.plazi.org/id/9D0A6F1B0445FFB7FF5DCC73FB1F8AB9" lastPageNumber="7" pageId="6" pageNumber="7">
<subSubSection id="5DB98D860445FFB7FF5DCC73FD6D8F78" box="[151,651,1594,1613]" pageId="6" pageNumber="7" type="nomenclature"> <subSubSection id="5DB98D860445FFB7FF5DCC73FD6D8F78" box="[151,651,1594,1613]" pageId="6" pageNumber="7" type="nomenclature">
<paragraph id="151CDE0D0445FFB7FF5DCC73FD6D8F78" blockId="6.[151,651,1594,1613]" box="[151,651,1594,1613]" pageId="6" pageNumber="7"> <paragraph id="151CDE0D0445FFB7FF5DCC73FD6D8F78" blockId="6.[151,651,1594,1613]" box="[151,651,1594,1613]" pageId="6" pageNumber="7">
<heading id="4E5469610445FFB7FF5DCC73FD6D8F78" bold="true" box="[151,651,1594,1613]" fontSize="8" level="2" pageId="6" pageNumber="7" reason="2"> <heading id="4E5469610445FFB7FF5DCC73FD6D8F78" bold="true" box="[151,651,1594,1613]" fontSize="8" level="2" pageId="6" pageNumber="7" reason="2">
@ -67,7 +68,7 @@ Neotectococcus lenticularis
<bibRefCitation id="7132A3FC0445FFB7FE7DCC73FDA68F78" author="Hempel, A." box="[439,576,1594,1613]" pageId="6" pageNumber="7" pagination="5 - 36" refId="ref9669" refString="Hempel, A., 1937. Novas especies de Coccideos (Homoptera) do Brasil. Arq. Inst. Biol. 8, 5 - 36." type="journal article" year="1937">Hempel, 1937</bibRefCitation> <bibRefCitation id="7132A3FC0445FFB7FE7DCC73FDA68F78" author="Hempel, A." box="[439,576,1594,1613]" pageId="6" pageNumber="7" pagination="5 - 36" refId="ref9669" refString="Hempel, A., 1937. Novas especies de Coccideos (Homoptera) do Brasil. Arq. Inst. Biol. 8, 5 - 36." type="journal article" year="1937">Hempel, 1937</bibRefCitation>
</taxonomicName> </taxonomicName>
( (
<figureCitation id="8D98C2880445FFB7FD86CC73FD628F78" box="[588,644,1594,1613]" captionStart="Figure 4" captionStartId="6.[831,884,728,745]" captionTargetBox="[860,1471,167,695]" captionTargetId="figure-989@6.[849,1486,159,707]" captionTargetPageId="6" captionText="Figure 4: Neotectococcus lenticularis Hempel. Adult female." pageId="6" pageNumber="7">Fig. 4</figureCitation> <figureCitation id="8D98C2880445FFB7FD86CC73FD628F78" box="[588,644,1594,1613]" captionStart="Figure 4" captionStartId="6.[831,884,728,745]" captionTargetBox="[860,1471,167,695]" captionTargetId="figure-989@6.[849,1486,159,707]" captionTargetPageId="6" captionText="Figure 4: Neotectococcus lenticularis Hempel. Adult female." figureDoi="http://doi.org/10.5281/zenodo.13196387" httpUri="https://zenodo.org/record/13196387/files/figure.png" pageId="6" pageNumber="7">Fig. 4</figureCitation>
) )
</emphasis> </emphasis>
</heading> </heading>

View file

@ -1,61 +1,62 @@
<document id="2CAA7A5E9649B4364A6B8B27E9056F2B" ID-DOI="10.1590/1806-9665-RBENT-2018-131" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722636595181" checkinUser="felipe" docAuthor="Gonzalez, Patricia, Claps, Lucia &amp; Juarez, Andrea" docDate="2020" docId="9D0A6F1B0447FFB4FCAFCD78FD478D58" docLanguage="en" docName="RevBrasEntomol.64.1.e2018131.pdf" docOrigin="Revista Brasileira de Entomologia (e 2018131) 64 (1)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2018-131" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Acanthococcus papaveroi Gonzalez, Claps &amp; Juarez 2020, sp. nov." docType="treatment" docVersion="1" lastPageNumber="6" masterDocId="613317630443FFB1FFCACA49FFE68935" masterDocTitle="Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species" masterLastPageNumber="9" masterPageNumber="1" pageNumber="5" updateTime="1722680918204" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0"> <document id="11E4AA5AA9C23FF6771D42544D9225D0" ID-DOI="10.1590/1806-9665-RBENT-2018-131" ID-ISSN="1806-9665" ID-Zenodo-Dep="13196379" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722636595181" checkinUser="felipe" docAuthor="Gonzalez, Patricia, Claps, Lucia &amp; Juarez, Andrea" docDate="2020" docId="9D0A6F1B0447FFB4FCAFCD78FD478D58" docLanguage="en" docName="RevBrasEntomol.64.1.e2018131.pdf" docOrigin="Revista Brasileira de Entomologia (e 2018131) 64 (1)" docSource="http://dx.doi.org/10.1590/1806-9665-rbent-2018-131" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Acanthococcus papaveroi Gonzalez, Claps &amp; Juarez 2020, sp. nov." docType="treatment" docVersion="2" lastPageNumber="6" masterDocId="613317630443FFB1FFCACA49FFE68935" masterDocTitle="Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species" masterLastPageNumber="9" masterPageNumber="1" pageNumber="5" updateTime="1722684236940" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="1B1D20CF56DD805F1077EE7FFFF8580C" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="856F90E6C8DEF9F79E1EA57F511DE0A4" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="A29D1BEEF04D46EA7AF89BC229742F6E"> <mods:titleInfo id="52C4ED1763944A125EF4F41802B90AA5">
<mods:title id="0BB58B7F5EA49B9373918EEDDD6F82ED">Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species</mods:title> <mods:title id="753C9F3448442256B668395337FA7947">Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="C9F6ACD5A9B07CC9C0040070D7566E4C" type="personal"> <mods:name id="D50EA4250B3B3AB5CB34ABB7EA238DBF" type="personal">
<mods:role id="6812B425C2CDAA013322BF206F502E52"> <mods:role id="ECB037065602493793170724713B0EC4">
<mods:roleTerm id="12940AD92BAA5050B8762F3FB005D133">Author</mods:roleTerm> <mods:roleTerm id="AF985717FBBA76DC108FD7E9D7CCB403">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="3A7D46C95C969C2DB7145716A7974928">Gonzalez, Patricia</mods:namePart> <mods:namePart id="F402C9456B743571B1EED6B04C74510F">Gonzalez, Patricia</mods:namePart>
<mods:affiliation id="E1500181534BE4ACA44328EAC8DE5F00">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation> <mods:affiliation id="816CA7AD939927C7FEB5E4629469AEF3">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation>
<mods:nameIdentifier id="0071B2122D4CB19C42EBA95C102523DC" type="email">mopagon2004@yahoo.com.ar</mods:nameIdentifier> <mods:nameIdentifier id="8E00B4C4CBD2C314AC724C34C8822CBC" type="email">mopagon2004@yahoo.com.ar</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="25D6CEF33343D345F904A88004EA8A55" type="personal"> <mods:name id="E51DF311E507AD696883B16F948B308F" type="personal">
<mods:role id="D06DC90544EE1FCAD8728327A060C0BD"> <mods:role id="29A8759D115FA284208175C9A6D84C31">
<mods:roleTerm id="4EBBE3C727992F5974FFC93D96B9BF45">Author</mods:roleTerm> <mods:roleTerm id="A6E7F888F05DD57057387446FC65B90D">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="E2908A30D32C9DB1656DB52B7F7B3E2D">Claps, Lucia</mods:namePart> <mods:namePart id="EB049472AD815AAF2064A3F53BFF7920">Claps, Lucia</mods:namePart>
<mods:affiliation id="B4DC82D77C41ECB059C2179CDF59F152">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation> <mods:affiliation id="F687CA90CA0A23E6B1A995166137FB5B">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation>
</mods:name> </mods:name>
<mods:name id="B4F85152C3D920E60555BA24245F77AF" type="personal"> <mods:name id="244C3AB1DCBE7B4F136BC26A8E2D9B59" type="personal">
<mods:role id="D6FB25F727999664B73A42963B6DE6C0"> <mods:role id="0DE38F7E4CDCBA5960835FBEF95BB583">
<mods:roleTerm id="44E2F86B87B05947600F501284393ABF">Author</mods:roleTerm> <mods:roleTerm id="984990C1CF962C453006A5FB930651F7">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="FEA7CCA659C382B5F051E2188F723E3C">Juarez, Andrea</mods:namePart> <mods:namePart id="056ED68239B5AAA538839C3F2BF599D8">Juarez, Andrea</mods:namePart>
<mods:affiliation id="1594AD51EA88B8406EAF192640ABAC85">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation> <mods:affiliation id="5EFE4B2B094C8708F87004CC9D8463D3">Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología</mods:affiliation>
</mods:name> </mods:name>
<mods:typeOfResource id="276499B8E1EDF0FCE21107AFA4246BD7">text</mods:typeOfResource> <mods:typeOfResource id="CF53862DE59CC24833BF63E0B14E25FC">text</mods:typeOfResource>
<mods:relatedItem id="FE0680A717EC10A32F3B996D06A6BD59" type="host"> <mods:relatedItem id="85950BB13589672762C80DAB4CF78459" type="host">
<mods:titleInfo id="411464EAAA77BEAA56498E67A4002A53"> <mods:titleInfo id="9263A961D73C1B50C2EDC806B4C984B8">
<mods:title id="F64FF3532F101C13107026228EDDC71F">Revista Brasileira de Entomologia</mods:title> <mods:title id="C2907B59F5E89EDB95C5D3A38E3929A6">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="26AE2572CCFCA05FAAB55EDB4AF61DCA"> <mods:part id="DDC99FB8F4BAFFDB3FAA1FC3A985D7A8">
<mods:date id="5DDB0769072D73031E909BBEF0EBB36E">2020</mods:date> <mods:date id="D73B42746867BCB562E002C67FFB7103">2020</mods:date>
<mods:detail id="E22A5A83FF430C16D5AC1C7C9937A4A1" type="series"> <mods:detail id="6E7E766222FAED29C8D01111C29D85BF" type="series">
<mods:title id="735E99800549C44C3A31EFB63A104697">e 2018131</mods:title> <mods:title id="7768439067B8CF5BE70293224B364EAD">e 2018131</mods:title>
</mods:detail> </mods:detail>
<mods:detail id="16C4D6BA5A13415B3153F10E1A2813D2" type="pubDate"> <mods:detail id="7F886E707747C34511C5AACC400D6B99" type="pubDate">
<mods:number id="F791078624555954E211F2F078996C74">2020-03-23</mods:number> <mods:number id="D06ABE60C678D459FAC06EF540C985F6">2020-03-23</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="AA6F9390BAE61CA7B6536B51107BDB8F" type="volume"> <mods:detail id="DDF2F59B5C546E40EDD5245601400AA5" type="volume">
<mods:number id="33B06A0290B833CA58EBD9EFACE8A415">64</mods:number> <mods:number id="08553F9C064BBF055B10410ACD3226B4">64</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="079C71B54188A2C08F10A5E8186C5132" type="issue"> <mods:detail id="3996967A4BB09603A08B17F50E3A1421" type="issue">
<mods:number id="DCBDE4CA783F51F430595FA75126E73C">1</mods:number> <mods:number id="4E8482D14BDA447CB387E052136C8D0D">1</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="90390B5DAA9471312C672B6F11201B84" unit="page"> <mods:extent id="6B9EA52EFC9521AF3C144CE5086BECEC" unit="page">
<mods:start id="1B00FD8A87DB80DE44F34CC05E277E59">1</mods:start> <mods:start id="565FAB2790BAD9B1F31D0DAF3FF6208E">1</mods:start>
<mods:end id="C967DBA10D2191655DCEC7864775D453">9</mods:end> <mods:end id="ABD0AD80291C9B9896A0661AB4280728">9</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="93FE4D4597A3E7A167CDDE7AD22A027E"> <mods:location id="556A7818542A908A947078F2E4FC4F9C">
<mods:url id="D5F21AB79DD5E5193D39D37E84C1C438">http://dx.doi.org/10.1590/1806-9665-rbent-2018-131</mods:url> <mods:url id="ED9FE7754AD8C2D19FCA0AB70BC12EB8">http://dx.doi.org/10.1590/1806-9665-rbent-2018-131</mods:url>
</mods:location> </mods:location>
<mods:classification id="1968CDC9BBDA86020BDB92ACD3AF36F9">journal article</mods:classification> <mods:classification id="DD975B234BCAC117C28F420AF09E8434">journal article</mods:classification>
<mods:identifier id="C1220DC20EF0C80978D1227AC64FCD54" type="DOI">10.1590/1806-9665-RBENT-2018-131</mods:identifier> <mods:identifier id="DDFA3755EFD1D7491F045D3F8D422589" type="DOI">10.1590/1806-9665-RBENT-2018-131</mods:identifier>
<mods:identifier id="7087DEC373C27C5D14DBFF4358BABB2C" type="ISSN">1806-9665</mods:identifier> <mods:identifier id="2CD49365D520ABDF83486B6E0E660F05" type="ISSN">1806-9665</mods:identifier>
<mods:identifier id="3AE47E2788E56D812406D672B3D12CB0" type="Zenodo-Dep">13196379</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="9D0A6F1B0447FFB4FCAFCD78FD478D58" LSID="urn:lsid:plazi:treatment:9D0A6F1B0447FFB4FCAFCD78FD478D58" httpUri="http://treatment.plazi.org/id/9D0A6F1B0447FFB4FCAFCD78FD478D58" lastPageId="5" lastPageNumber="6" pageId="4" pageNumber="5"> <treatment id="9D0A6F1B0447FFB4FCAFCD78FD478D58" LSID="urn:lsid:plazi:treatment:9D0A6F1B0447FFB4FCAFCD78FD478D58" httpUri="http://treatment.plazi.org/id/9D0A6F1B0447FFB4FCAFCD78FD478D58" lastPageId="5" lastPageNumber="6" pageId="4" pageNumber="5">
<subSubSection id="5DB98D860447FFB5FCAFCD78FA398E71" box="[869,1503,1840,1860]" pageId="4" pageNumber="5" type="nomenclature"> <subSubSection id="5DB98D860447FFB5FCAFCD78FA398E71" box="[869,1503,1840,1860]" pageId="4" pageNumber="5" type="nomenclature">
@ -65,7 +66,7 @@
<taxonomicName id="D2A3A58E0447FFB5FCAFCD78FAA88E71" authority="Gonzalez, Claps &amp; Juarez" authorityName="Gonzalez, Claps &amp; Juarez" authorityYear="2020" box="[869,1358,1840,1860]" class="Insecta" family="Eriococcidae" genus="Acanthococcus" kingdom="Animalia" order="Hemiptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="papaveroi" status="sp. nov.">Acanthococcus papaveroi González, Claps &amp; Juarez</taxonomicName> <taxonomicName id="D2A3A58E0447FFB5FCAFCD78FAA88E71" authority="Gonzalez, Claps &amp; Juarez" authorityName="Gonzalez, Claps &amp; Juarez" authorityYear="2020" box="[869,1358,1840,1860]" class="Insecta" family="Eriococcidae" genus="Acanthococcus" kingdom="Animalia" order="Hemiptera" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="papaveroi" status="sp. nov.">Acanthococcus papaveroi González, Claps &amp; Juarez</taxonomicName>
<taxonomicNameLabel id="3CE4BF640447FFB5FA9BCD78FA7F8E71" box="[1361,1433,1841,1860]" pageId="4" pageNumber="5" rank="species">sp. nov.</taxonomicNameLabel> <taxonomicNameLabel id="3CE4BF640447FFB5FA9BCD78FA7F8E71" box="[1361,1433,1841,1860]" pageId="4" pageNumber="5" rank="species">sp. nov.</taxonomicNameLabel>
( (
<figureCitation id="8D98C2880447FFB5FA69CD78FA358E71" box="[1443,1491,1841,1860]" captionStart="Figure 3" captionStartId="5.[82,135,895,912]" captionTargetBox="[131,674,153,857]" captionTargetId="figure-937@5.[129,709,151,871]" captionTargetPageId="5" captionText="Figure 3: Acanthococcus papaveroi González, Claps &amp; Juárez sp. nov. Adult female. B, microtubular duct of type B." pageId="4" pageNumber="5">Fig 3</figureCitation> <figureCitation id="8D98C2880447FFB5FA69CD78FA358E71" box="[1443,1491,1841,1860]" captionStart="Figure 3" captionStartId="5.[82,135,895,912]" captionTargetBox="[131,674,153,857]" captionTargetId="figure-937@5.[129,709,151,871]" captionTargetPageId="5" captionText="Figure 3: Acanthococcus papaveroi González, Claps &amp; Juárez sp. nov. Adult female. B, microtubular duct of type B." figureDoi="http://doi.org/10.5281/zenodo.13196385" httpUri="https://zenodo.org/record/13196385/files/figure.png" pageId="4" pageNumber="5">Fig 3</figureCitation>
). ).
</emphasis> </emphasis>
</heading> </heading>
@ -104,7 +105,7 @@ in life.
<collectorName id="B856BBDB0447FFB5FBE0CDE7FB768EF4" box="[1066,1168,1966,1985]" pageId="4" pageNumber="5">Unknown.</collectorName> <collectorName id="B856BBDB0447FFB5FBE0CDE7FB768EF4" box="[1066,1168,1966,1985]" pageId="4" pageNumber="5">Unknown.</collectorName>
</materialsCitation> </materialsCitation>
</paragraph> </paragraph>
<caption id="41DC8E850446FFB4FF98C936FEA18A90" pageId="5" pageNumber="6" startId="5.[82,135,895,912]" targetBox="[131,674,153,857]" targetPageId="5" targetType="figure"> <caption id="41DC8E850446FFB4FF98C936FEA18A90" ID-DOI="http://doi.org/10.5281/zenodo.13196385" ID-Zenodo-Dep="13196385" httpUri="https://zenodo.org/record/13196385/files/figure.png" pageId="5" pageNumber="6" startId="5.[82,135,895,912]" targetBox="[131,674,153,857]" targetPageId="5" targetType="figure">
<paragraph id="151CDE0D0446FFB4FF98C936FEA18A90" blockId="5.[82,758,895,933]" pageId="5" pageNumber="6"> <paragraph id="151CDE0D0446FFB4FF98C936FEA18A90" blockId="5.[82,758,895,933]" pageId="5" pageNumber="6">
<emphasis id="27D7021F0446FFB4FF98C936FF7B8AA5" bold="true" box="[82,157,895,912]" pageId="5" pageNumber="6">Figure 3:</emphasis> <emphasis id="27D7021F0446FFB4FF98C936FF7B8AA5" bold="true" box="[82,157,895,912]" pageId="5" pageNumber="6">Figure 3:</emphasis>
<taxonomicName id="D2A3A58E0446FFB4FF6EC936FDD98AA5" authority="Gonzalez, Claps &amp; Juarez" authorityName="Gonzalez, Claps &amp; Juarez" authorityYear="2020" box="[164,575,895,912]" class="Insecta" family="Eriococcidae" genus="Acanthococcus" kingdom="Animalia" order="Hemiptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="papaveroi" status="sp. nov.">Acanthococcus papaveroi González, Claps &amp; Juárez</taxonomicName> <taxonomicName id="D2A3A58E0446FFB4FF6EC936FDD98AA5" authority="Gonzalez, Claps &amp; Juarez" authorityName="Gonzalez, Claps &amp; Juarez" authorityYear="2020" box="[164,575,895,912]" class="Insecta" family="Eriococcidae" genus="Acanthococcus" kingdom="Animalia" order="Hemiptera" pageId="5" pageNumber="6" phylum="Arthropoda" rank="species" species="papaveroi" status="sp. nov.">Acanthococcus papaveroi González, Claps &amp; Juárez</taxonomicName>

View file

@ -0,0 +1,241 @@
<document id="3641E529A6B3CAA7A6ACFFEC7301BCFD" ID-DOI="10.1016/j.rbe.2017.04.002" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722639565813" checkinUser="felipe" docAuthor="Araújo, Maíra Xavier, Bravo, Freddy &amp; Carvalho, Claudio José Barros de" docDate="2017" docId="B8133161863DFFB0FCD7C5E50282D0CA" docLanguage="en" docName="RevBrasEntomol.61.3.203-207.pdf" docOrigin="Revista Brasileira de Entomologia 61 (3)" docSource="http://dx.doi.org/10.1016/j.rbe.2017.04.002" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Trichomyia lamasi Araújo, Bravo &amp; Carvalho, 2017, sp. nov." docType="treatment" docVersion="1" lastPageNumber="205" masterDocId="442A4919863DFFB3FF96C04E0342D16C" masterDocTitle="Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil" masterLastPageNumber="207" masterPageNumber="203" pageNumber="203" updateTime="1722683297540" updateUser="GgImagineBatch" zenodo-license-document="CC-BY-4.0">
<mods:mods id="DB2EDDB20CF1BB58FED3AA4E13714E1D" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="621A1FEBCCCA30EF336FA12F2440F471">
<mods:title id="B92D9B7A8B38A52C038C3930177F9DBF">Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil</mods:title>
</mods:titleInfo>
<mods:name id="544F1623EDFB2CD7F6AA180D3FB4F312" type="personal">
<mods:role id="83E7AE7880BBCE82ED3EEEFE1BBF6317">
<mods:roleTerm id="713B58386BC1355B7F388615CE0E5921">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="962D08CAE367B58F496B8BA0B67F33EE">Araújo, Maíra Xavier</mods:namePart>
<mods:affiliation id="AE80ED8139A50CE0B71331E40C60187D">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:name id="10DED0888555278588ECE4B1C4532E9A" type="personal">
<mods:role id="1646C4B6E51576775785479C04192DF1">
<mods:roleTerm id="B6A24B937DEE11B692C73CEFE48463CD">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="C9AF6C5D7817F62E0CE0EC8F481882CF">Bravo, Freddy</mods:namePart>
<mods:affiliation id="6B689DD866792C4FF303A1671B129F44">Universidade Estadual de Feira de Santana, Programa de Pós-graduação em Zoologia, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="DBA2F826B7E5897432B5DB2667E7B3EA" type="personal">
<mods:role id="D0A6DF0A0B010BACAE8821514967EC43">
<mods:roleTerm id="9CC6383C806E84935193FBF8EA1FBAD4">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="B7644CC970AD653604FAF59D6EA772E1">Carvalho, Claudio José Barros de</mods:namePart>
<mods:affiliation id="31D2A78A3DB90240C74BB10EDEEAB682">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="61059E45526F94E1A9A0ED3CE0A88B33">text</mods:typeOfResource>
<mods:relatedItem id="8D12B5F6C428923A42B0C8675BAC5031" type="host">
<mods:titleInfo id="C7D3BE517522B0333C49B315EE89233F">
<mods:title id="2440538B08A71404FBE44AAA70CC79B1">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="685570E77404B3E70B3CC2B19DF3D4CF">
<mods:date id="FB92E1A079BCEAAAD2279B0A6AA881F7">2017</mods:date>
<mods:detail id="4464A928E698991E6720209F73FA480C" type="pubDate">
<mods:number id="DF15EEE5FA74F69FB8269D5F6EA7BD0C">2017-04-22</mods:number>
</mods:detail>
<mods:detail id="190694C800EB5F2911F72B857AA3BFF6" type="volume">
<mods:number id="E34C6376C04202B517CFD77BC5723C46">61</mods:number>
</mods:detail>
<mods:detail id="000BA1F10F3E56E492121AE8F40DEDAD" type="issue">
<mods:number id="860B01D194B5911C16AFC2A3635053DF">3</mods:number>
</mods:detail>
<mods:extent id="F672049D6E113CA6720D00AA6C40678C" unit="page">
<mods:start id="089F61CA3C16357DE3CEC24F7FA3EADD">203</mods:start>
<mods:end id="008D8060DF96EDC5B6CE623C1AA2611B">207</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="DC39CA6F01F0E92C780F750B4C91D248">
<mods:url id="E4F17BA75F85C6AD148ABE7DC40680D4">http://dx.doi.org/10.1016/j.rbe.2017.04.002</mods:url>
</mods:location>
<mods:classification id="39948FE4AC7406667216549C1FCAA0BD">journal article</mods:classification>
<mods:identifier id="B71AA16BD656F68CABCC95578E6EF0BB" type="DOI">10.1016/j.rbe.2017.04.002</mods:identifier>
<mods:identifier id="3CECDA2E57C3D7A6F6B2DA529D73CF4E" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="B8133161863DFFB0FCD7C5E50282D0CA" LSID="urn:lsid:plazi:treatment:B8133161863DFFB0FCD7C5E50282D0CA" httpUri="http://treatment.plazi.org/id/B8133161863DFFB0FCD7C5E50282D0CA" lastPageId="3" lastPageNumber="205" pageId="0" pageNumber="203">
<subSubSection id="78A0D3FC863DFFB3FCD7C5E50701D4D3" box="[833,1091,1451,1471]" pageId="0" pageNumber="203" type="nomenclature">
<paragraph id="30058077863DFFB3FCD7C5E50701D4D3" blockId="0.[833,1091,1451,1471]" box="[833,1091,1451,1471]" pageId="0" pageNumber="203">
<heading id="6B4D371B863DFFB3FCD7C5E50701D4D3" box="[833,1091,1451,1471]" fontSize="8" level="2" pageId="0" pageNumber="203" reason="6">
<emphasis id="02CE5C65863DFFB3FCD7C5E50701D4D3" box="[833,1091,1451,1471]" italics="true" pageId="0" pageNumber="203">
<taxonomicName id="F7BAFBF4863DFFB3FCD7C5E500B6D4D3" ID-CoL="9HYNM" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[833,1012,1451,1471]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="0" pageNumber="203" phylum="Arthropoda" rank="species" species="lamasi" status="sp. nov.">Trichomyia lamasi</taxonomicName>
<taxonomicNameLabel id="19FDE11E863DFFB3FC6FC5E50701D4D3" box="[1017,1091,1451,1471]" pageId="0" pageNumber="203" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="78A0D3FC863DFFB1FCF6C5AA00CED63C" lastPageId="2" lastPageNumber="205" pageId="0" pageNumber="203" type="diagnosis">
<paragraph id="30058077863DFFB3FCF6C5AA0610D743" blockId="0.[833,1504,1508,1890]" pageId="0" pageNumber="203">Diagnosis. Apex of gonocoxites rounded and with bristles. One pair of parameres fused basally and involved by a membranous parameral sheath. Hypoproct pyriform with setulae.</paragraph>
<paragraph id="30058077863DFFB3FCF6C6760630D7BA" blockId="0.[833,1504,1508,1890]" pageId="0" pageNumber="203">
Description. Male. Head ellipsoidal (
<figureCitation id="A8819CF2863DFFB3FB5DC6760642D727" box="[1227,1280,1592,1611]" captionStart="Figs" captionStartId="1.[85,120,1810,1824]" captionTargetBox="[198,1361,148,1780]" captionTargetId="figure-14@1.[198,1361,148,1780]" captionTargetPageId="1" captionText="Figs. 110. Trichomyia lamasi sp. nov.1. Head; 2. Left wing; 3. Palpus; 4.Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7.Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed= aedeagus, ag =arm of gonocoxite, bri =gonocoxal bridge, cer= cercus, gst= gonostylus, hyp =hypoproct, pm= paramere, she =parameral sheath)." pageId="0" pageNumber="203">Fig. 1</figureCitation>
). Antenna incomplete in the studied specimens; scape the same length as subspherical pedicel; flagellomeres pyriform and eccentric (
<figureCitation id="A8819CF2863DFFB3FA8CC621060DD7EE" box="[1306,1359,1647,1666]" captionStart="Figs" captionStartId="1.[85,120,1810,1824]" captionTargetBox="[198,1361,148,1780]" captionTargetId="figure-14@1.[198,1361,148,1780]" captionTargetPageId="1" captionText="Figs. 110. Trichomyia lamasi sp. nov.1. Head; 2. Left wing; 3. Palpus; 4.Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7.Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed= aedeagus, ag =arm of gonocoxite, bri =gonocoxal bridge, cer= cercus, gst= gonostylus, hyp =hypoproct, pm= paramere, she =parameral sheath)." pageId="0" pageNumber="203">Fig. 6</figureCitation>
); ascoids 1.75 times flagellomere length. Palpus formula 1.0:0.5:0.7; 1st segment with sensilla in depressed pit on inner side (
<figureCitation id="A8819CF2863DFFB3FA89C6E9061AD7D6" box="[1311,1368,1703,1722]" captionStart="Figs" captionStartId="1.[85,120,1810,1824]" captionTargetBox="[198,1361,148,1780]" captionTargetId="figure-14@1.[198,1361,148,1780]" captionTargetPageId="1" captionText="Figs. 110. Trichomyia lamasi sp. nov.1. Head; 2. Left wing; 3. Palpus; 4.Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7.Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed= aedeagus, ag =arm of gonocoxite, bri =gonocoxal bridge, cer= cercus, gst= gonostylus, hyp =hypoproct, pm= paramere, she =parameral sheath)." pageId="0" pageNumber="203">Fig. 3</figureCitation>
). Wing. R
<subScript id="AC3E8232863DFFB3FA54C6E1069CD7D1" attach="left" box="[1474,1502,1711,1725]" fontSize="6" pageId="0" pageNumber="203">4+5</subScript>
complete at base; r-m present and m-cu absent (
<figureCitation id="A8819CF2863DFFB3FAA6C68D0627D7BA" box="[1328,1381,1731,1750]" captionStart="Figs" captionStartId="1.[85,120,1810,1824]" captionTargetBox="[198,1361,148,1780]" captionTargetId="figure-14@1.[198,1361,148,1780]" captionTargetPageId="1" captionText="Figs. 110. Trichomyia lamasi sp. nov.1. Head; 2. Left wing; 3. Palpus; 4.Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7.Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed= aedeagus, ag =arm of gonocoxite, bri =gonocoxal bridge, cer= cercus, gst= gonostylus, hyp =hypoproct, pm= paramere, she =parameral sheath)." pageId="0" pageNumber="203">Fig. 2</figureCitation>
).
</paragraph>
<paragraph id="30058077863DFFB1FCF6C6910053D658" blockId="0.[833,1504,1508,1890]" lastBlockId="2.[114,786,1714,1984]" lastPageId="2" lastPageNumber="205" pageId="0" pageNumber="203">
Male terminalia: Hypandrium fused with gonocoxites, with medial posterior expansion, bifurcate (
<figureCitation id="A8819CF2863DFFB3FB46C6B50645D662" box="[1232,1287,1787,1806]" captionStart="Figs" captionStartId="1.[85,120,1810,1824]" captionTargetBox="[198,1361,148,1780]" captionTargetId="figure-14@1.[198,1361,148,1780]" captionTargetPageId="1" captionText="Figs. 110. Trichomyia lamasi sp. nov.1. Head; 2. Left wing; 3. Palpus; 4.Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7.Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed= aedeagus, ag =arm of gonocoxite, bri =gonocoxal bridge, cer= cercus, gst= gonostylus, hyp =hypoproct, pm= paramere, she =parameral sheath)." pageId="0" pageNumber="203">Fig. 9</figureCitation>
), each pair of arm of gonocoxite with rounded apex and elongated bristles along the internal margin (
<figureCitation id="A8819CF2863DFFB3FC64C77D0725D62A" box="[1010,1127,1842,1862]" captionStart="Figs" captionStartId="1.[85,120,1810,1824]" captionTargetBox="[198,1361,148,1780]" captionTargetId="figure-14@1.[198,1361,148,1780]" captionTargetPageId="1" captionText="Figs. 110. Trichomyia lamasi sp. nov.1. Head; 2. Left wing; 3. Palpus; 4.Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7.Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed= aedeagus, ag =arm of gonocoxite, bri =gonocoxal bridge, cer= cercus, gst= gonostylus, hyp =hypoproct, pm= paramere, she =parameral sheath)." pageId="0" pageNumber="203">Figs. 4, 5, 9</figureCitation>
). Gonostylus elongated and straight in dorsal view. One pair of parameres present, with apical setae, enclosed in a membranous parameral sheath (
<figureCitation id="A8819CF2863FFFB1FDCEC6FC01F6D7A9" box="[600,692,1714,1733]" captionStart="Figs" captionStartId="1.[85,120,1810,1824]" captionTargetBox="[198,1361,148,1780]" captionTargetId="figure-14@1.[198,1361,148,1780]" captionTargetPageId="1" captionText="Figs. 110. Trichomyia lamasi sp. nov.1. Head; 2. Left wing; 3. Palpus; 4.Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7.Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed= aedeagus, ag =arm of gonocoxite, bri =gonocoxal bridge, cer= cercus, gst= gonostylus, hyp =hypoproct, pm= paramere, she =parameral sheath)." pageId="2" pageNumber="205">Figs. 7, 8</figureCitation>
). Aedeagus bifid. Ejaculatory apodeme 0.75 times the length of parameres (
<figureCitation id="A8819CF2863FFFB1FFECC6A703F2D791" box="[122,176,1769,1789]" captionStart="Figs" captionStartId="1.[85,120,1810,1824]" captionTargetBox="[198,1361,148,1780]" captionTargetId="figure-14@1.[198,1361,148,1780]" captionTargetPageId="1" captionText="Figs. 110. Trichomyia lamasi sp. nov.1. Head; 2. Left wing; 3. Palpus; 4.Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7.Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed= aedeagus, ag =arm of gonocoxite, bri =gonocoxal bridge, cer= cercus, gst= gonostylus, hyp =hypoproct, pm= paramere, she =parameral sheath)." pageId="2" pageNumber="205">Fig. 9</figureCitation>
). Epandrium trapezoidal and pilose, with some alveoli concentrated at the apicolateral margins. Cercus rounded and pilose. Hypoproct pyriform with setulae and apical micropilosity (
<figureCitation id="A8819CF2863FFFB1FD54C76F0046D658" box="[706,772,1825,1844]" captionStart="Figs" captionStartId="1.[85,120,1810,1824]" captionTargetBox="[198,1361,148,1780]" captionTargetId="figure-14@1.[198,1361,148,1780]" captionTargetPageId="1" captionText="Figs. 110. Trichomyia lamasi sp. nov.1. Head; 2. Left wing; 3. Palpus; 4.Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7.Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed= aedeagus, ag =arm of gonocoxite, bri =gonocoxal bridge, cer= cercus, gst= gonostylus, hyp =hypoproct, pm= paramere, she =parameral sheath)." pageId="2" pageNumber="205">Fig. 10</figureCitation>
).
</paragraph>
<caption id="64C5D0FF863CFFB2FFC3C75C008DD622" pageId="1" pageNumber="204" startId="1.[85,120,1810,1824]" targetBox="[198,1361,148,1780]" targetPageId="1" targetType="figure">
<paragraph id="30058077863CFFB2FFC3C75C008DD622" blockId="1.[85,1476,1809,1870]" pageId="1" pageNumber="204">
<emphasis id="02CE5C65863CFFB2FFC3C75C03EFD64C" bold="true" box="[85,173,1810,1824]" pageId="1" pageNumber="204">Figs. 110.</emphasis>
<taxonomicName id="F7BAFBF4863CFFB2FF20C75F0206D64C" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[182,324,1809,1824]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="1" pageNumber="204" phylum="Arthropoda" rank="species" species="lamasi" status="sp. nov.">
<emphasis id="02CE5C65863CFFB2FF20C75F0206D64C" box="[182,324,1809,1824]" italics="true" pageId="1" pageNumber="204">Trichomyia lamasi</emphasis>
</taxonomicName>
<taxonomicNameLabel id="19FDE11E863CFFB2FEDEC75D02C5D64D" box="[328,391,1811,1825]" pageId="1" pageNumber="204" rank="species">sp. nov.</taxonomicNameLabel>
1. Head; 2. Left wing; 3. Palpus; 4. Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7. Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed = aedeagus, ag = arm of gonocoxite, bri = gonocoxal bridge, cer = cercus, gst = gonostylus, hyp = hypoproct, pm = paramere, she = parameral sheath).
</paragraph>
</caption>
<caption id="64C5D0FF863FFFB1FFE4C67702C3D719" pageId="2" pageNumber="205" startId="2.[114,149,1593,1607]" targetBox="[174,1443,148,1562]" targetPageId="2" targetType="figure">
<paragraph id="30058077863FFFB1FFE4C67702C3D719" blockId="2.[114,1504,1592,1653]" pageId="2" pageNumber="205">
<emphasis id="02CE5C65863FFFB1FFE4C6770397D72B" bold="true" box="[114,213,1593,1607]" pageId="2" pageNumber="205">Figs. 1119.</emphasis>
<taxonomicName id="F7BAFBF4863FFFB1FF48C67602DAD72B" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[222,408,1592,1607]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="205" phylum="Arthropoda" rank="species" species="pantanensis" status="sp. nov.">
<emphasis id="02CE5C65863FFFB1FF48C67602DAD72B" box="[222,408,1592,1607]" italics="true" pageId="2" pageNumber="205">Trichomyia pantanensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="19FDE11E863FFFB1FE0AC6770299D72B" box="[412,475,1593,1607]" pageId="2" pageNumber="205" rank="species">sp. nov.</taxonomicNameLabel>
11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basal flagellomeres; 18. Cerci, epandrium and hypropoct; 19. Male terminalia, dorsal (abbreviations:aed = aedeagus, cer = cercus, gst = gonostylus, hyp = hypoproct, il = internal lobe, pm = paramere).
</paragraph>
</caption>
<paragraph id="30058077863FFFB1FF04C7730104D6AC" blockId="2.[114,786,1714,1984]" pageId="2" pageNumber="205">
Material examined.
<collectingCountry id="48ADC0E7863FFFB1FECFC77302D7D63C" box="[345,405,1853,1872]" name="Brazil" pageId="2" pageNumber="205">Brazil</collectingCountry>
,
<collectingRegion id="F27E4E95863FFFB1FE0AC770015ED63C" box="[412,540,1853,1873]" country="Brazil" name="Mato Grosso" pageId="2" pageNumber="205">Mato Grosso</collectingRegion>
, Poconé,
<date id="4404A6B7863FFFB1FDE3C773004ED63C" box="[629,780,1853,1872]" pageId="2" pageNumber="205" value="2012-07-15" valueMax="2012-07-17" valueMin="2012-07-15">15-17.VII.2012</date>
,
<typeStatus id="EF013ED5863FFFB1FFE4C717038ED600" box="[114,204,1881,1900]" pageId="2" pageNumber="205" type="holotype">holotype</typeStatus>
male, A.M. Silva-Neto leg. (MZFS);
<specimenCount id="26BC4BFE863FFFB1FDABC71701F8D600" box="[573,698,1881,1900]" count="2" pageId="2" pageNumber="205" type="generic" typeStatus="paratype">2 paratypes</specimenCount>
:
<materialsCitation id="80D28A2A863FFFB1FD53C7170264D6C8" collectingDate="1997-10-05" collectionCode="MZSP" collectorName="Chapada dos Guimaraes" location="Mato Grosso" pageId="2" pageNumber="205" specimenCount="1" specimenCount-male="1" stateProvince="Mato Grosso">
<specimenCount id="26BC4BFE863FFFB1FD53C717004FD600" box="[709,781,1881,1900]" count="1" pageId="2" pageNumber="205" type="male">1 male</specimenCount>
,
<collectingRegion id="F27E4E95863FFFB1FFE4C73B03B6D6E4" box="[114,244,1909,1928]" country="Brazil" name="Mato Grosso" pageId="2" pageNumber="205">Mato Grosso</collectingRegion>
,
<collectorName id="9D4FE5A1863FFFB1FF69C73B02B4D6E4" box="[255,502,1909,1928]" pageId="2" pageNumber="205">Chapada dos Guimarães</collectorName>
,
<date id="4404A6B7863FFFB1FD96C73B0119D6E4" box="[512,603,1909,1928]" pageId="2" pageNumber="205" value="1997-10-05">
<collectingDate id="54405F5F863FFFB1FD96C73B0119D6E4" box="[512,603,1909,1928]" pageId="2" pageNumber="205" value="1997-10-05">5.X.1997</collectingDate>
</date>
, without name of collector. (
<collectionCode id="56AB18B2863FFFB1FF48C7DF025DD6C8" box="[222,287,1937,1956]" country="Brazil" httpUri="http://grbio.org/cool/9yp6-zxp9" name="Sao Paulo, Museu de Zoologia da Universidade de Sao Paulo" pageId="2" pageNumber="205" type="Museum">MZSP</collectionCode>
)
</materialsCitation>
;
<materialsCitation id="80D28A2A863FFFB1FEA7C7DF0100D6AC" collectingDate="1998-11-17" collectionCode="MZSP" collectorName="Chapada dos Guimaraes" location="Mato Grosso" pageId="2" pageNumber="205" specimenCount="1" specimenCount-male="1" stateProvince="Mato Grosso">
<specimenCount id="26BC4BFE863FFFB1FEA7C7DF023BD6C8" box="[305,377,1937,1956]" count="1" pageId="2" pageNumber="205" type="male">1 male</specimenCount>
,
<collectingRegion id="F27E4E95863FFFB1FE12C7DF014AD6C8" box="[388,520,1937,1956]" country="Brazil" name="Mato Grosso" pageId="2" pageNumber="205">Mato Grosso</collectingRegion>
,
<collectorName id="9D4FE5A1863FFFB1FD85C7DF004FD6C8" box="[531,781,1937,1956]" pageId="2" pageNumber="205">Chapada dos Guimarães</collectorName>
,
<date id="4404A6B7863FFFB1FFE4C7E303A2D6AC" box="[114,224,1965,1984]" pageId="2" pageNumber="205" value="1998-11-17">
<collectingDate id="54405F5F863FFFB1FFE4C7E303A2D6AC" box="[114,224,1965,1984]" pageId="2" pageNumber="205" value="1998-11-17">17.XI.1998</collectingDate>
</date>
, without name of collector (
<collectionCode id="56AB18B2863FFFB1FE6AC7E30179D6AC" box="[508,571,1965,1984]" country="Brazil" httpUri="http://grbio.org/cool/9yp6-zxp9" name="Sao Paulo, Museu de Zoologia da Universidade de Sao Paulo" pageId="2" pageNumber="205" type="Museum">MZSP</collectionCode>
)
</materialsCitation>
.
</paragraph>
<paragraph id="30058077863FFFB1FCF6C6FC0630D674" blockId="2.[833,1503,1714,1872]" pageId="2" pageNumber="205">
Etymology. The species is named in honor of Dr. Carlos José Einicker Lamas, curator of
<taxonomicName id="F7BAFBF4863FFFB1FBD1C68007D1D78D" box="[1095,1171,1742,1761]" class="Insecta" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="205" phylum="Arthropoda" rank="order">Diptera</taxonomicName>
in the Museu de Zoologia da Universidade de
<collectingRegion id="F27E4E95863FFFB1FC5AC6A40773D790" box="[972,1073,1769,1789]" country="Brazil" name="Sao Paulo" pageId="2" pageNumber="205">São Paulo</collectingRegion>
, and general coordinator of the SISBIOTA
<taxonomicName id="F7BAFBF4863FFFB1FCD7C74B00CFD674" box="[833,909,1797,1816]" class="Insecta" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="205" phylum="Arthropoda" rank="order">Diptera</taxonomicName>
project under which specimens were collected.
</paragraph>
<paragraph id="30058077863FFFB1FCF6C76F00CED63C" blockId="2.[833,1503,1714,1872]" pageId="2" pageNumber="205">
Distribution. Known from Poconé in the Brazilian state of
<collectingRegion id="F27E4E95863FFFB1FA3CC76C00CBD63C" country="Brazil" name="Mato Grosso" pageId="2" pageNumber="205">Mato Grosso</collectingRegion>
.
</paragraph>
</subSubSection>
<subSubSection id="78A0D3FC863FFFB0FCD7C73B0282D0CA" lastPageId="3" lastPageNumber="206" pageId="2" pageNumber="205" type="discussion">
<paragraph id="30058077863FFFB0FCD7C73B0282D0CA" blockId="2.[833,1503,1908,1984]" lastBlockId="3.[85,756,152,422]" lastPageId="3" lastPageNumber="206" pageId="2" pageNumber="205">
<emphasis id="02CE5C65863FFFB1FCD7C73B00E6D6E4" bold="true" box="[833,932,1909,1928]" pageId="2" pageNumber="205">Remarks.</emphasis>
<taxonomicName id="F7BAFBF4863FFFB1FC2DC73A072CD6E4" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[955,1134,1908,1928]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="205" phylum="Arthropoda" rank="species" species="lamasi" status="sp. nov.">
<emphasis id="02CE5C65863FFFB1FC2DC73A072CD6E4" box="[955,1134,1908,1928]" italics="true" pageId="2" pageNumber="205">Trichomyia lamasi</emphasis>
</taxonomicName>
<taxonomicNameLabel id="19FDE11E863FFFB1FBE2C7380781D6E5" box="[1140,1219,1910,1929]" pageId="2" pageNumber="205" rank="species">sp. nov.</taxonomicNameLabel>
does not have any diagnostic characteristics of the currently named subgenus of
<taxonomicName id="F7BAFBF4863FFFB1FAFBC7DE0699D6C8" authorityName="Haliday" authorityYear="1839" box="[1389,1499,1936,1956]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="205" phylum="Arthropoda" rank="genus">
<emphasis id="02CE5C65863FFFB1FAFBC7DE0699D6C8" box="[1389,1499,1936,1956]" italics="true" pageId="2" pageNumber="205">Trichomyia</emphasis>
</taxonomicName>
. The species does resemble those identified in the
<taxonomicName id="F7BAFBF4863FFFB1FAA3C7E306D6D6AC" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[1333,1428,1965,1984]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="2" pageNumber="205" phylum="Arthropoda" rank="species" species="truncata">“truncata</taxonomicName>
group” described in
<bibRefCitation id="542BFD86863EFFB0FF45C0D60284D1C7" author="Araujo, M. X. &amp; Bravo, F." box="[211,454,152,171]" pageId="3" pageNumber="206" pagination="1 - 76" refId="ref2448" refString="Araujo, M. X., Bravo, F., 2016. Description of fourty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera Psychodidae, Trichomyiinae). Zootaxa 4130, 1 - 76." type="journal article" year="2016">Araújo and Bravo (2016)</bibRefCitation>
. The shape of the arm of gonocoxite of
<taxonomicName id="F7BAFBF4863EFFB0FF25C0FD024BD1AB" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[179,265,179,199]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="lamasi">
<emphasis id="02CE5C65863EFFB0FF25C0FD024BD1AB" box="[179,265,179,199]" italics="true" pageId="3" pageNumber="206">T. lamasi</emphasis>
</taxonomicName>
is similar to those in
<taxonomicName id="F7BAFBF4863EFFB0FE73C0FD03C8D18F" authority="Araujo &amp; Bravo, 2016" authorityName="Araujo &amp; Bravo" authorityYear="2016" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="truncata">
<emphasis id="02CE5C65863EFFB0FE73C0FD010DD1AB" box="[485,591,179,199]" italics="true" pageId="3" pageNumber="206">T. truncata</emphasis>
<bibRefCitation id="542BFD86863EFFB0FDC3C0FA03C8D18F" author="Araujo, M. X. &amp; Bravo, F." pageId="3" pageNumber="206" pagination="1 - 76" refId="ref2448" refString="Araujo, M. X., Bravo, F., 2016. Description of fourty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera Psychodidae, Trichomyiinae). Zootaxa 4130, 1 - 76." type="journal article" year="2016">Araújo &amp; Bravo, 2016</bibRefCitation>
</taxonomicName>
,
<taxonomicName id="F7BAFBF4863EFFB0FF04C0810159D18F" authority="Araujo &amp; Bravo, 2016" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[146,539,207,227]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="manacapurensis">
<emphasis id="02CE5C65863EFFB0FF04C0810207D18F" box="[146,325,207,227]" italics="true" pageId="3" pageNumber="206">T. manacapurensis</emphasis>
<bibRefCitation id="542BFD86863EFFB0FEDFC09E0159D18F" author="Araujo, M. X. &amp; Bravo, F." box="[329,539,208,227]" pageId="3" pageNumber="206" pagination="1 - 76" refId="ref2448" refString="Araujo, M. X., Bravo, F., 2016. Description of fourty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera Psychodidae, Trichomyiinae). Zootaxa 4130, 1 - 76." type="journal article" year="2016">Araújo &amp; Bravo, 2016</bibRefCitation>
</taxonomicName>
and
<taxonomicName id="F7BAFBF4863EFFB0FDDFC08103A1D193" authority="Araujo &amp; Bravo, 2016" authorityName="Araujo &amp; Bravo" authorityYear="2016" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="cinthiae">
<emphasis id="02CE5C65863EFFB0FDDFC08101EED18F" box="[585,684,207,227]" italics="true" pageId="3" pageNumber="206">T. cinthiae</emphasis>
<bibRefCitation id="542BFD86863EFFB0FD26C09E03A1D193" author="Araujo, M. X. &amp; Bravo, F." pageId="3" pageNumber="206" pagination="1 - 76" refId="ref2448" refString="Araujo, M. X., Bravo, F., 2016. Description of fourty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera Psychodidae, Trichomyiinae). Zootaxa 4130, 1 - 76." type="journal article" year="2016">Araújo &amp; Bravo, 2016</bibRefCitation>
</taxonomicName>
. However, the gonostylus is more elongate and thinner in
<emphasis id="02CE5C65863EFFB0FF02C14803B2D076" box="[148,240,262,282]" italics="true" pageId="3" pageNumber="206">
<taxonomicName id="F7BAFBF4863EFFB0FF02C14803A9D076" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[148,235,262,282]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="lamasi">T. lamasi</taxonomicName>
.
</emphasis>
On the other hand, the shape of paramere is similar as
<taxonomicName id="F7BAFBF4863EFFB0FFF9C16C02F5D05A" authority="Araujo &amp; Bravo, 2016" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[111,439,290,311]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="nortensis">
<emphasis id="02CE5C65863EFFB0FFF9C16C039CD05A" box="[111,222,290,310]" italics="true" pageId="3" pageNumber="206">T. nortensis</emphasis>
<bibRefCitation id="542BFD86863EFFB0FF75C16D02F5D05A" author="Araujo, M. X. &amp; Bravo, F." box="[227,439,291,311]" pageId="3" pageNumber="206" pagination="1 - 76" refId="ref2448" refString="Araujo, M. X., Bravo, F., 2016. Description of fourty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera Psychodidae, Trichomyiinae). Zootaxa 4130, 1 - 76." type="journal article" year="2016">Araújo &amp; Bravo, 2016</bibRefCitation>
</taxonomicName>
(=projections of aedeagal complex, according
<bibRefCitation id="542BFD86863EFFB0FF60C17102A6D03E" author="Araujo, M. X. &amp; Bravo, F." box="[246,484,319,339]" pageId="3" pageNumber="206" pagination="1 - 76" refId="ref2448" refString="Araujo, M. X., Bravo, F., 2016. Description of fourty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera Psychodidae, Trichomyiinae). Zootaxa 4130, 1 - 76." type="journal article" year="2016">Araújo and Bravo, 2016</bibRefCitation>
), a species not included in the
<taxonomicName id="F7BAFBF4863EFFB0FFEAC1150399D002" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[124,219,347,366]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="truncata">“truncata</taxonomicName>
group”. The setulae of the hypoproct, which is one of the diagnostic characters of
<taxonomicName id="F7BAFBF4863EFFB0FEECC1380290D0E6" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[378,466,374,394]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="lamasi">
<emphasis id="02CE5C65863EFFB0FEECC1380290D0E6" box="[378,466,374,394]" italics="true" pageId="3" pageNumber="206">T. lamasi</emphasis>
</taxonomicName>
, is also found in
<taxonomicName id="F7BAFBF4863EFFB0FD10C13803E5D0CA" authorityName="Araujo &amp; Bravo" authorityYear="2016" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="manacapurensis">
<emphasis id="02CE5C65863EFFB0FD10C13803E5D0CA" italics="true" pageId="3" pageNumber="206">T. manacapurensis</emphasis>
</taxonomicName>
,
<taxonomicName id="F7BAFBF4863EFFB0FF27C1DC0258D0CA" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[177,282,402,422]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="truncata">
<emphasis id="02CE5C65863EFFB0FF27C1DC0258D0CA" box="[177,282,402,422]" italics="true" pageId="3" pageNumber="206">T. truncata</emphasis>
</taxonomicName>
and
<taxonomicName id="F7BAFBF4863EFFB0FEDAC1DC02F9D0CA" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[332,443,402,422]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="nortensis">
<emphasis id="02CE5C65863EFFB0FEDAC1DC02F9D0CA" box="[332,443,402,422]" italics="true" pageId="3" pageNumber="206">T. nortensis</emphasis>
</taxonomicName>
.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,145 @@
<document id="ECC3537E856451CA30131ECE788F61B8" ID-DOI="10.1016/j.rbe.2017.04.002" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722639565813" checkinUser="felipe" docAuthor="Araújo, Maíra Xavier, Bravo, Freddy &amp; Carvalho, Claudio José Barros de" docDate="2017" docId="B8133161863EFFB0FCB2C1D70036D272" docLanguage="en" docName="RevBrasEntomol.61.3.203-207.pdf" docOrigin="Revista Brasileira de Entomologia 61 (3)" docSource="http://dx.doi.org/10.1016/j.rbe.2017.04.002" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Trichomyia spinicauda Araujo &amp; Bravo 2016" docType="treatment" docVersion="2" lastPageNumber="206" masterDocId="442A4919863DFFB3FF96C04E0342D16C" masterDocTitle="Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil" masterLastPageNumber="207" masterPageNumber="203" pageNumber="206" updateTime="1722684407175" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="7214037C389DF33FA21BC6BF1FC25F66" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="C6C7685B4589E9264A29ADEA6F9E552F">
<mods:title id="81F622178A626C5D6AB82D464605E3E5">Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil</mods:title>
</mods:titleInfo>
<mods:name id="04269E54F338D4C8C2DDC363A3CFF5BE" type="personal">
<mods:role id="51811ED931F04CA154DF539AD233B7EF">
<mods:roleTerm id="0C1648148C850B64B3B3E10D9AC41CE1">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="48ED6EF595AAF6CB2D46C973462EF33B">Araújo, Maíra Xavier</mods:namePart>
<mods:affiliation id="C2F6A0DF462B1D8D33CE3B039C464705">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:name id="7F374B8B97B17CEBBC8EFFFC2E1D5380" type="personal">
<mods:role id="4DB67E1173CFE736E6C6C1A8C928C59D">
<mods:roleTerm id="B305F77A8471AECD21BB93CC10B97012">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="AE769A8C351CEE503508F0E2E145DB87">Bravo, Freddy</mods:namePart>
<mods:affiliation id="814B69AEFE92E3FD02B64E9B4F434E55">Universidade Estadual de Feira de Santana, Programa de Pós-graduação em Zoologia, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="1374E11FE8C7DB7596B8197FC9A200C9" type="personal">
<mods:role id="D2B560DB09498E601BD335A4261533FF">
<mods:roleTerm id="F1345AE0A672B9AC9A1419D723BACA9F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="B8D725B89217E25FF75239BC3EDED433">Carvalho, Claudio José Barros de</mods:namePart>
<mods:affiliation id="40F2A67A407FEA3C8E60BA9F86E434DA">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="3420809F1AE321A8D5F15E2185823470">text</mods:typeOfResource>
<mods:relatedItem id="7C581D6A8EB8F999FC5324E92CEC499D" type="host">
<mods:titleInfo id="9B8FA7AC657C558011786AF9309AE64B">
<mods:title id="2F760C3902E3C2615506266622BD6465">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="9F2E2A4B417C85AC824D80862E987309">
<mods:date id="39FBA2A4C83E8B6C806E38D14E428D67">2017</mods:date>
<mods:detail id="1E511F3CDD94B8EDB10D200F68971609" type="pubDate">
<mods:number id="18BD80B8EED40DF234538190DA5BAA43">2017-04-22</mods:number>
</mods:detail>
<mods:detail id="4A981A093D384C0FDD267F7D8BC422FB" type="volume">
<mods:number id="D07505E563C190C83CCE3E8DDA02810C">61</mods:number>
</mods:detail>
<mods:detail id="D0B6ACF6B3AD6C8D21783CA84A72B4F7" type="issue">
<mods:number id="52CEC702B75185AB1F49553E338DCAA3">3</mods:number>
</mods:detail>
<mods:extent id="FFFD7C588585C3CA3FF5C55F45CE835D" unit="page">
<mods:start id="76AED047F20955A1C107F8E42515D163">203</mods:start>
<mods:end id="29A9287011719FDCDD500920113EF993">207</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="DCC9983AF9934972FA2E9CFFF3045927">
<mods:url id="B0F592AF218226E9359F49810059EE8A">http://dx.doi.org/10.1016/j.rbe.2017.04.002</mods:url>
</mods:location>
<mods:classification id="5975C890468ABB2F3E50A8F191C5CDA1">journal article</mods:classification>
<mods:identifier id="84F2437045C7622093131E54B08D9928" type="DOI">10.1016/j.rbe.2017.04.002</mods:identifier>
<mods:identifier id="BCBF4206EC32FDD2C382A1DE5B98F400" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="B8133161863EFFB0FCB2C1D70036D272" ID-DOI="http://doi.org/10.5281/zenodo.13196455" ID-Zenodo-Dep="13196455" LSID="urn:lsid:plazi:treatment:B8133161863EFFB0FCB2C1D70036D272" httpUri="http://treatment.plazi.org/id/B8133161863EFFB0FCB2C1D70036D272" lastPageNumber="206" pageId="3" pageNumber="206">
<subSubSection id="78A0D3FC863EFFB0FCB2C1D706C9D0C1" box="[804,1419,409,429]" pageId="3" pageNumber="206" type="nomenclature">
<paragraph id="30058077863EFFB0FCB2C1D706C9D0C1" blockId="3.[804,1419,409,429]" box="[804,1419,409,429]" pageId="3" pageNumber="206">
<heading id="6B4D371B863EFFB0FCB2C1D706C9D0C1" box="[804,1419,409,429]" fontSize="8" level="2" pageId="3" pageNumber="206" reason="6">
<treatmentCitationGroup id="10AAA759863EFFB0FCB2C1D706C9D0C1" box="[804,1419,409,429]" pageId="3" pageNumber="206">
<emphasis id="02CE5C65863EFFB0FCB2C1D706C9D0C1" box="[804,1419,409,429]" italics="true" pageId="3" pageNumber="206">
<treatmentCitation id="B11BA666863EFFB0FCB2C1D70660D0C1" ID-DOI="http://doi.org/10.5281/zenodo.6080147" ID-Zenodo-Dep="6080147" author="Araujo, M. X. &amp; Bravo, F." box="[804,1314,409,429]" httpUri="http://treatment.plazi.org/id/03A7ED58F8056C576B98F88EB978AD6C" page="69" pageId="3" pageNumber="206" year="2016">
<taxonomicName id="F7BAFBF4863EFFB0FCB2C1D70660D0C1" ID-CoL="8FHNX" authority="Araujo &amp; Bravo, 2016: 68 - 69" authorityName="Araujo &amp; Bravo" authorityPageNumber="68 - 69" authorityYear="2016" box="[804,1314,409,429]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="spinicauda">
Trichomyia spinicauda
<bibRefCitation id="542BFD86863EFFB0FB90C1D70660D0C1" author="Araujo, M. X. &amp; Bravo, F." box="[1030,1314,409,429]" pageId="3" pageNumber="206" pagination="1 - 76" refId="ref2448" refString="Araujo, M. X., Bravo, F., 2016. Description of fourty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera Psychodidae, Trichomyiinae). Zootaxa 4130, 1 - 76." type="journal article" year="2016">Araújo &amp; Bravo, 2016: 6869</bibRefCitation>
</taxonomicName>
</treatmentCitation>
, fig. 42AF
</emphasis>
</treatmentCitationGroup>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="78A0D3FC863EFFB0FCB2C1AD0036D272" pageId="3" pageNumber="206" type="discussion">
<paragraph id="30058077863EFFB0FCB2C1AD063ED326" blockId="3.[804,1475,482,586]" pageId="3" pageNumber="206">
<emphasis id="02CE5C65863EFFB0FCB2C1AD00C5D09A" bold="true" box="[804,903,483,502]" pageId="3" pageNumber="206">Remarks.</emphasis>
Male
<taxonomicName id="F7BAFBF4863EFFB0FC4AC1AC071DD09A" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[988,1119,482,502]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="spinicauda">
<emphasis id="02CE5C65863EFFB0FC4AC1AC071DD09A" box="[988,1119,482,502]" italics="true" pageId="3" pageNumber="206">T. spinicauda</emphasis>
</taxonomicName>
can be recognized by the medial posterior expansion of hypandrium/gonocoxites, rounded apically; the arm of the gonocoxites with rod-like bristles apically and thick bristles basally; two pairs of parameres and bifid aedeagus.
</paragraph>
<paragraph id="30058077863EFFB0FCD2C22A07EFD3FF" blockId="3.[804,1475,612,798]" pageId="3" pageNumber="206">
<materialsCitation id="80D28A2A863EFFB0FCD2C22A07EFD3FF" collectingDate="2002-08-14" collectionCode="MZFS" collectorName="de Maria &amp; F. Bravo" country="Brazil" location="Coracao de Maria" municipality="Material" pageId="3" pageNumber="206" specimenCount="1" stateProvince="Bahia" typeStatus="holotype">
<collectingMunicipality id="D0611A0D863EFFB0FCD2C22A00D8D31B" box="[836,922,612,631]" pageId="3" pageNumber="206">Material</collectingMunicipality>
examined.
<collectingCountry id="48ADC0E7863EFFB0FB83C22A0713D31B" box="[1045,1105,612,631]" name="Brazil" pageId="3" pageNumber="206">Brazil</collectingCountry>
,
<collectingRegion id="F27E4E95863EFFB0FBCBC22A07D5D31B" box="[1117,1175,612,631]" country="Brazil" name="Bahia" pageId="3" pageNumber="206">Bahia</collectingRegion>
,
<location id="3565D6AC863EFFB0FB35C22A061ED31B" LSID="urn:lsid:plazi:treatment:B8133161863EFFB0FCB2C1D70036D272:3565D6AC863EFFB0FB35C22A061ED31B" box="[1187,1372,612,631]" country="Brazil" municipality="Material" name="Coracao de Maria" pageId="3" pageNumber="206" stateProvince="Bahia">
Coração
<collectorName id="9D4FE5A1863EFFB0FB6BC22A061ED31B" box="[1277,1372,612,631]" pageId="3" pageNumber="206">de Maria</collectorName>
</location>
,
<typeStatus id="EF013ED5863EFFB0FAFEC22A0680D31B" box="[1384,1474,612,631]" pageId="3" pageNumber="206" type="holotype">holotype</typeStatus>
male,
<date id="4404A6B7863EFFB0FCF7C2CE009ED3FF" box="[865,988,640,659]" pageId="3" pageNumber="206" value="2002-08-14">
<collectingDate id="54405F5F863EFFB0FCF7C2CE009ED3FF" box="[865,988,640,659]" pageId="3" pageNumber="206" value="2002-08-14">14.VIII.2002</collectingDate>
</date>
,
<collectorName id="9D4FE5A1863EFFB0FC70C2CE0774D3FF" box="[998,1078,640,659]" pageId="3" pageNumber="206">F. Bravo</collectorName>
leg. (
<collectionCode id="56AB18B2863EFFB0FBFCC2CE07E4D3FF" box="[1130,1190,640,659]" pageId="3" pageNumber="206">MZFS</collectionCode>
)
</materialsCitation>
</paragraph>
<paragraph id="30058077863EFFB0FCD2C2D206F1D3A7" blockId="3.[804,1475,612,798]" pageId="3" pageNumber="206">
Other material examined.
<materialsCitation id="80D28A2A863EFFB0FBC7C2D206EDD3A7" collectingDate="2012-07-15" collectingDateMax="2012-07-17" collectingDateMin="2012-07-15" collectionCode="MZFS" collectorName="Silva-Neto, A. M. &amp; A. M. Silva-Neto" country="Brazil" location="Pocone" pageId="3" pageNumber="206" specimenCount="1" specimenCount-male="1" stateProvince="Mato Grosso">
<collectingCountry id="48ADC0E7863EFFB0FBC7C2D207CFD3C3" box="[1105,1165,668,687]" name="Brazil" pageId="3" pageNumber="206">Brazil</collectingCountry>
,
<collectingRegion id="F27E4E95863EFFB0FB01C2D2065BD3C3" box="[1175,1305,668,687]" country="Brazil" name="Mato Grosso" pageId="3" pageNumber="206">Mato Grosso</collectingRegion>
,
<location id="3565D6AC863EFFB0FAB5C2D2062CD3C3" LSID="urn:lsid:plazi:treatment:B8133161863EFFB0FCB2C1D70036D272:3565D6AC863EFFB0FAB5C2D2062CD3C3" box="[1315,1390,668,687]" country="Brazil" name="Pocone" pageId="3" pageNumber="206" stateProvince="Mato Grosso">Poconé</location>
,
<specimenCount id="26BC4BFE863EFFB0FAEEC2D206FDD3C3" box="[1400,1471,668,687]" count="1" pageId="3" pageNumber="206" type="male">1 male</specimenCount>
,
<date id="4404A6B7863EFFB0FCB2C2F900FDD3A6" box="[804,959,695,714]" pageId="3" pageNumber="206" value="2012-07-15" valueMax="2012-07-17" valueMin="2012-07-15">
<collectingDate id="54405F5F863EFFB0FCB2C2F900FDD3A6" box="[804,959,695,714]" pageId="3" pageNumber="206" value="2012-07-15" valueMax="2012-07-17" valueMin="2012-07-15">1517.VII.2012</collectingDate>
</date>
,
<collectorName id="9D4FE5A1863EFFB0FC5EC2F6072ED3A7" box="[968,1132,696,715]" pageId="3" pageNumber="206">Silva-Neto, A.M.</collectorName>
col.
<collectorName id="9D4FE5A1863EFFB0FB0FC2F60674D3A7" box="[1177,1334,696,715]" pageId="3" pageNumber="206">A.M. Silva-Neto</collectorName>
leg. (
<collectionCode id="56AB18B2863EFFB0FAFDC2F606EBD3A7" box="[1387,1449,696,715]" pageId="3" pageNumber="206">MZFS</collectionCode>
)
</materialsCitation>
.
</paragraph>
<paragraph id="30058077863EFFB0FCD2C29D0036D272" blockId="3.[804,1475,612,798]" pageId="3" pageNumber="206">
Distribution. Known from the
<typeStatus id="EF013ED5863EFFB0FB12C29A07F3D38B" box="[1156,1201,724,743]" pageId="3" pageNumber="206">type</typeStatus>
locality in
<collectingCountry id="48ADC0E7863EFFB0FABAC29D062AD38A" box="[1324,1384,723,742]" name="Brazil" pageId="3" pageNumber="206">Brazil</collectingCountry>
, state of
<collectingRegion id="F27E4E95863EFFB0FCB2C2A1001ED26E" box="[804,860,751,770]" country="Brazil" name="Bahia" pageId="3" pageNumber="206">Bahia</collectingRegion>
(Coração de Maria) and state of
<collectingRegion id="F27E4E95863EFFB0FB30C2BE0664D26F" box="[1190,1318,752,771]" country="Brazil" name="Mato Grosso" pageId="3" pageNumber="206">Mato Grosso</collectingRegion>
(Poconé new record).
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,223 @@
<document id="F2E1231F982952B4D03AAD31A3329616" ID-DOI="10.1016/j.rbe.2017.04.002" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722639565813" checkinUser="felipe" docAuthor="Araújo, Maíra Xavier, Bravo, Freddy &amp; Carvalho, Claudio José Barros de" docDate="2017" docId="B8133161863EFFB0FFC3C19C010DD7E7" docLanguage="en" docName="RevBrasEntomol.61.3.203-207.pdf" docOrigin="Revista Brasileira de Entomologia 61 (3)" docSource="http://dx.doi.org/10.1016/j.rbe.2017.04.002" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Trichomyia pantanensis Araújo, Bravo &amp; Carvalho, 2017, sp. nov." docType="treatment" docVersion="2" lastPageNumber="206" masterDocId="442A4919863DFFB3FF96C04E0342D16C" masterDocTitle="Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil" masterLastPageNumber="207" masterPageNumber="203" pageNumber="206" updateTime="1722684407175" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="7B48846987180008F01EE27D4AC8B10F" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="3835653B3D7679A2FFF2BD5E93FC4276">
<mods:title id="6D96FAEC69AAEEE906E762354C25EF67">Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil</mods:title>
</mods:titleInfo>
<mods:name id="70F348779E30E29E9E5978C314033A2A" type="personal">
<mods:role id="FC78F3E697058ED20B0D583B2510F311">
<mods:roleTerm id="B4AFEBC40AB33D83ACEAA284D69FA976">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="037DC0CDE8E1CF003ECC0B8AC0BD6F94">Araújo, Maíra Xavier</mods:namePart>
<mods:affiliation id="6B28333D8278D4A92467189E591D0572">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:name id="3C893673B9D13BB610735B326C8A2824" type="personal">
<mods:role id="2BA998C6038480FDA18E0973E5AD540E">
<mods:roleTerm id="967190C1B2BCCC01307EDEA0E819C1F3">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="7128AC25C6341CB1EED9DC0564EFC7F3">Bravo, Freddy</mods:namePart>
<mods:affiliation id="B4E300672D3BEC98A130DB11F48F10D6">Universidade Estadual de Feira de Santana, Programa de Pós-graduação em Zoologia, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="DC2F078B466B4181B43CDFE4EF244D30" type="personal">
<mods:role id="728C47862BDF34BF28B9C34073FE1B45">
<mods:roleTerm id="FB87BD983B2B5F8DD5E719D64E09E3C1">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="7E870A4429557253CED9363F69E352A3">Carvalho, Claudio José Barros de</mods:namePart>
<mods:affiliation id="D4A485CBDD8C79BE4B10C22BE048E4E8">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="6E0CB85D3F72F9DB4F0AB28D6DDDBCE7">text</mods:typeOfResource>
<mods:relatedItem id="A4DA2C67201A14CD75BD49D08F9F905A" type="host">
<mods:titleInfo id="DB6334A1672467B3A82D725D61740C8E">
<mods:title id="94520AD4B79525D44493FB05CA9D7E3C">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="6B219F6FD2443F4632BD260B7A14E3EA">
<mods:date id="53C68D6B16150D76A7AB8ADEB30BD2FE">2017</mods:date>
<mods:detail id="D0A1E916A04A1568E68481D3F01FC0BE" type="pubDate">
<mods:number id="DDFF0BB9B998EC98216A3060F1F151FF">2017-04-22</mods:number>
</mods:detail>
<mods:detail id="2AC6113B6EEC32B4B8D3D3AAE42F4D31" type="volume">
<mods:number id="D61778386EE9DFB57C5B1664E24CAC0C">61</mods:number>
</mods:detail>
<mods:detail id="51FE3824879CDB093C43165B4B711315" type="issue">
<mods:number id="3B7EAC7869F5EDC2EF0F3D250359A6B0">3</mods:number>
</mods:detail>
<mods:extent id="F08CE700AAECA719EAF236CEF42DCE84" unit="page">
<mods:start id="6CC956C2547EB7A237002084E38EF95A">203</mods:start>
<mods:end id="7E153420BAD19D08C44D8089F369DCCB">207</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="B23ECE26B4353533737AB803F535FD54">
<mods:url id="7770A824C4D3F5242756665F0CBD84B1">http://dx.doi.org/10.1016/j.rbe.2017.04.002</mods:url>
</mods:location>
<mods:classification id="C925520849380CF1C987A56CFDA68D91">journal article</mods:classification>
<mods:identifier id="6BB8091D2D19B7AD12751C58E53A1508" type="DOI">10.1016/j.rbe.2017.04.002</mods:identifier>
<mods:identifier id="28E17A1745F1532619DCA737102FB34D" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="B8133161863EFFB0FFC3C19C010DD7E7" ID-DOI="http://doi.org/10.5281/zenodo.13196451" ID-Zenodo-Dep="13196451" LSID="urn:lsid:plazi:treatment:B8133161863EFFB0FFC3C19C010DD7E7" httpUri="http://treatment.plazi.org/id/B8133161863EFFB0FFC3C19C010DD7E7" lastPageNumber="206" pageId="3" pageNumber="206">
<subSubSection id="78A0D3FC863EFFB0FFC3C19C02CFD08A" box="[85,397,466,486]" pageId="3" pageNumber="206" type="nomenclature">
<paragraph id="30058077863EFFB0FFC3C19C02CFD08A" blockId="3.[85,397,466,486]" box="[85,397,466,486]" pageId="3" pageNumber="206">
<heading id="6B4D371B863EFFB0FFC3C19C02CFD08A" box="[85,397,466,486]" fontSize="8" level="2" pageId="3" pageNumber="206" reason="6">
<emphasis id="02CE5C65863EFFB0FFC3C19C02CFD08A" box="[85,397,466,486]" italics="true" pageId="3" pageNumber="206">
<taxonomicName id="F7BAFBF4863EFFB0FFC3C19C027FD08A" ID-CoL="9HW2Y" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[85,317,466,486]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="pantanensis" status="sp. nov.">Trichomyia pantanensis</taxonomicName>
<taxonomicNameLabel id="19FDE11E863EFFB0FED5C19C02CFD08A" box="[323,397,466,486]" pageId="3" pageNumber="206" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="78A0D3FC863EFFB0FFE3C24503E3D42B" pageId="3" pageNumber="206" type="diagnosis">
<paragraph id="30058077863EFFB0FFE3C24501C9D355" blockId="3.[85,756,523,1351]" pageId="3" pageNumber="206">Diagnosis. Palpus four-segmented. Gonocoxite with pilose internal lobe. Gonostylus bifurcated and aedeagus bifid.</paragraph>
<paragraph id="30058077863EFFB0FFE3C20C03EFD578" blockId="3.[85,756,523,1351]" pageId="3" pageNumber="206">
Description. Male. Head subcircular (
<figureCitation id="A8819CF2863EFFB0FE71C20C016AD33A" box="[487,552,578,598]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Fig. 11</figureCitation>
). Antenna with subcylindrical scape shorter than subspherical pedicel; flagellomeres pyriform and eccentric (
<figureCitation id="A8819CF2863EFFB0FED9C23402D1D3E1" box="[335,403,634,653]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Fig. 17</figureCitation>
); 13th flagellomere subcylindrical with terminal apiculus separated by suture (
<figureCitation id="A8819CF2863EFFB0FD88C2D80120D3C5" box="[542,610,662,681]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Fig. 13</figureCitation>
); ascoids 1.35 times flagellomere length. Palpus four-segmented, with first two segments partially fused; palpus formula 1.0:0.5:0.8:1.5, first and second segment with sensilla in depressed pits on the inner side (
<figureCitation id="A8819CF2863EFFB0FFCBC34803E0D275" box="[93,162,774,793]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Fig. 14</figureCitation>
). Wing. Apex of Sc sclerotized; R
<subScript id="AC3E8232863EFFB0FE6BC343015BD277" attach="left" box="[509,537,781,795]" fontSize="6" pageId="3" pageNumber="206">4+5</subScript>
complete at base; rm and m-cu absent (
<figureCitation id="A8819CF2863EFFB0FEBAC36C0232D259" box="[300,368,802,821]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Fig. 12</figureCitation>
). Male terminalia: Hypandrium fused with gonocoxites (
<figureCitation id="A8819CF2863EFFB0FE8FC373021DD23D" box="[281,351,829,849]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Fig. 19</figureCitation>
). Gonocoxite projects ventrally with a pilose internal lobe (
<figureCitation id="A8819CF2863EFFB0FEBBC31702E0D200" box="[301,418,857,876]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Figs. 15, 19</figureCitation>
). Gonostylus bifurcated apically, slightly sclerotized, articulated to the apex of the gonocoxite, bare, curved and with pointed apices. Aedeagus bifid. One pair of membranous parameres (
<figureCitation id="A8819CF2863EFFB0FEB1C3E30228D2AC" box="[295,362,941,960]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Fig. 19</figureCitation>
). Epandrium wider than long in dorsal view and bare (
<figureCitation id="A8819CF2863EFFB0FF63C387027AD2B0" box="[245,312,969,988]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Fig. 18</figureCitation>
). Cercus pilose, abruptly constricted before apex in lateral view (
<figureCitation id="A8819CF2863EFFB0FEBBC3AB0232D294" box="[301,368,997,1016]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Fig. 15</figureCitation>
). Hypoproct with apical micropilosity (
<figureCitation id="A8819CF2863EFFB0FFCBC44F03E2D578" box="[93,160,1025,1044]" captionStart="Figs" captionStartId="2.[114,149,1593,1607]" captionTargetBox="[174,1443,148,1562]" captionTargetId="figure-14@2.[174,1443,148,1562]" captionTargetPageId="2" captionText="Figs. 1119. Trichomyia pantanensis sp. nov. 11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basalflagellomeres;18.Cerci,epandriumand hypropoct;19.Male terminalia,dorsal (abbreviations:aed =aedeagus,cer =cercus,gst = gonostylus,hyp =hypoproct, il= internal lobe, pm =paramere)." pageId="3" pageNumber="206">Fig. 18</figureCitation>
).
</paragraph>
<paragraph id="30058077863EFFB0FFE3C45303F6D5BB" blockId="3.[85,756,523,1351]" pageId="3" pageNumber="206">
<materialsCitation id="80D28A2A863EFFB0FFE3C45301F5D527" collectingDate="2012-07-15" collectingDateMax="2012-07-17" collectingDateMin="2012-07-15" collectionCode="MZFS" collectorName="A. M. Silva-Neto" country="Brazil" location="Pocone" municipality="Material" pageId="3" pageNumber="206" specimenCount="7" specimenCount-male="7" stateProvince="Mato Grosso" typeStatus="holotype">
<collectingMunicipality id="D0611A0D863EFFB0FFE3C4530389D55C" box="[117,203,1053,1072]" pageId="3" pageNumber="206">Material</collectingMunicipality>
examined.
<collectingCountry id="48ADC0E7863EFFB0FEADC4530235D55C" box="[315,375,1053,1072]" name="Brazil" pageId="3" pageNumber="206">Brazil</collectingCountry>
,
<collectingRegion id="F27E4E95863EFFB0FEEBC45302BFD55C" box="[381,509,1053,1072]" country="Brazil" name="Mato Grosso" pageId="3" pageNumber="206">Mato Grosso</collectingRegion>
,
<location id="3565D6AC863EFFB0FD95C453010CD55C" LSID="urn:lsid:plazi:treatment:B8133161863EFFB0FFC3C19C010DD7E7:3565D6AC863EFFB0FD95C453010CD55C" box="[515,590,1053,1072]" country="Brazil" municipality="Material" name="Pocone" pageId="3" pageNumber="206" stateProvince="Mato Grosso">Poconé</location>
,
<date id="4404A6B7863EFFB0FDC3C45201B2D543" box="[597,752,1052,1071]" pageId="3" pageNumber="206" value="2012-07-15" valueMax="2012-07-17" valueMin="2012-07-15">
<collectingDate id="54405F5F863EFFB0FDC3C45201B2D543" box="[597,752,1052,1071]" pageId="3" pageNumber="206" value="2012-07-15" valueMax="2012-07-17" valueMin="2012-07-15">1517.VII.2012</collectingDate>
</date>
,
<typeStatus id="EF013ED5863EFFB0FFC3C47603EDD527" box="[85,175,1080,1099]" pageId="3" pageNumber="206" type="holotype">holotype</typeStatus>
male,
<collectorName id="9D4FE5A1863EFFB0FF79C47702C8D527" box="[239,394,1080,1100]" pageId="3" pageNumber="206">A.M. Silva-Neto</collectorName>
leg. (
<collectionCode id="56AB18B2863EFFB0FE2AC47702BED520" box="[444,508,1081,1100]" pageId="3" pageNumber="206">MZFS</collectionCode>
);
<specimenCount id="26BC4BFE863EFFB0FD9CC47701F5D527" box="[522,695,1080,1100]" count="7" pageId="3" pageNumber="206" type="male" typeStatus="paratype">7 paratypes male</specimenCount>
</materialsCitation>
,
<materialsCitation id="80D28A2A863EFFB0FD28C47701B2D50B" collectingDate="2012-07-15" collectingDateMax="2012-07-17" collectingDateMin="2012-07-15" collectionCode="MZSP" collectorName="A. M. Silva-Neto" country="Brazil" location="Pocone" municipality="Material" pageId="3" pageNumber="206" specimenCount="21" specimenCount-male="21" stateProvince="Mato Grosso" typeStatus="holotype">
same locality, date and collector as
<typeStatus id="EF013ED5863EFFB0FEE9C41A029BD50B" box="[383,473,1108,1127]" pageId="3" pageNumber="206" type="holotype">holotype</typeStatus>
(
<collectionCode id="56AB18B2863EFFB0FE73C41B0164D504" box="[485,550,1109,1128]" country="Brazil" httpUri="http://grbio.org/cool/9yp6-zxp9" name="Sao Paulo, Museu de Zoologia da Universidade de Sao Paulo" pageId="3" pageNumber="206" type="Museum">MZSP</collectionCode>
);
<specimenCount id="26BC4BFE863EFFB0FDA3C41B01B2D50B" box="[565,752,1108,1128]" count="21" pageId="3" pageNumber="206" type="male" typeStatus="paratype">21 paratype males</specimenCount>
</materialsCitation>
,
<materialsCitation id="80D28A2A863EFFB0FFC3C43F02D9D5F3" collectingDate="1998-04-07" collectionCode="MZFS" country="Brazil" location="Barao de Melgaco" pageId="3" pageNumber="206" specimenCount="1" specimenCount-male="1" stateProvince="Mato Grosso" typeStatus="paratype">
<collectingRegion id="F27E4E95863EFFB0FFC3C43F039BD5EF" box="[85,217,1136,1156]" country="Brazil" name="Mato Grosso" pageId="3" pageNumber="206">Mato Grosso</collectingRegion>
,
<location id="3565D6AC863EFFB0FF73C43F02DCD5EF" LSID="urn:lsid:plazi:treatment:B8133161863EFFB0FFC3C19C010DD7E7:3565D6AC863EFFB0FF73C43F02DCD5EF" box="[229,414,1136,1156]" country="Brazil" name="Barao de Melgaco" pageId="3" pageNumber="206" stateProvince="Mato Grosso">Barão de Melgaço</location>
,
<date id="4404A6B7863EFFB0FE3CC43E0149D5EF" box="[426,523,1136,1155]" pageId="3" pageNumber="206" value="1998-04-07">
<collectingDate id="54405F5F863EFFB0FE3CC43E0149D5EF" box="[426,523,1136,1155]" pageId="3" pageNumber="206" value="1998-04-07">7.IV.1998</collectingDate>
</date>
, without name of collector (
<collectionCode id="56AB18B2863EFFB0FF08C4C2039CD5F3" box="[158,222,1164,1183]" pageId="3" pageNumber="206">MZFS</collectionCode>
);
<specimenCount id="26BC4BFE863EFFB0FF66C4C202D9D5F3" box="[240,411,1164,1184]" count="1" pageId="3" pageNumber="206" type="male" typeStatus="paratype">1 paratype male</specimenCount>
</materialsCitation>
,
<materialsCitation id="80D28A2A863EFFB0FE31C4C302C6D5D7" collectingDate="1998-04-10" collectionCode="INPA, R" collectorName="Pantanal" country="Brazil" location="Barao de Melgaco" pageId="3" pageNumber="206" specimenCount="1" stateProvince="Mato Grosso" typeStatus="paratype">
<collectingRegion id="F27E4E95863EFFB0FE31C4C30169D5F3" box="[423,555,1164,1184]" country="Brazil" name="Mato Grosso" pageId="3" pageNumber="206">Mato Grosso</collectingRegion>
,
<location id="3565D6AC863EFFB0FDA0C4C301B2D5F3" LSID="urn:lsid:plazi:treatment:B8133161863EFFB0FFC3C19C010DD7E7:3565D6AC863EFFB0FDA0C4C301B2D5F3" box="[566,752,1164,1184]" country="Brazil" name="Barao de Melgaco" pageId="3" pageNumber="206" stateProvince="Mato Grosso">Barão de Melgaço</location>
,
<collectorName id="9D4FE5A1863EFFB0FFC3C4E603EDD5D7" box="[85,175,1192,1211]" pageId="3" pageNumber="206">Pantanal</collectorName>
,
<date id="4404A6B7863EFFB0FF2AC4E60268D5D7" box="[188,298,1192,1211]" pageId="3" pageNumber="206" value="1998-04-10">
<collectingDate id="54405F5F863EFFB0FF2AC4E60268D5D7" box="[188,298,1192,1211]" pageId="3" pageNumber="206" value="1998-04-10">10.IV.1998</collectingDate>
</date>
,
<collectionCode id="56AB18B2863EFFB0FEAEC4E60228D5D7" box="[312,362,1192,1211]" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="3" pageNumber="206">INPA</collectionCode>
<collectionCode id="56AB18B2863EFFB0FEE5C4E602C6D5D7" box="[371,388,1192,1211]" country="Chile" name="Departamento de Geologia, Universidad de Chile" pageId="3" pageNumber="206">R</collectionCode>
</materialsCitation>
.Q., R.N./P.E. legs., without name of collector.
</paragraph>
<paragraph id="30058077863EFFB0FFE3C4AE0114D463" blockId="3.[85,756,523,1351]" pageId="3" pageNumber="206">
Etymology. The epithet
<taxonomicName id="F7BAFBF4863EFFB0FEF6C4910297D59F" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[352,469,1247,1267]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="pantanensis">
<emphasis id="02CE5C65863EFFB0FEF6C4910297D59F" box="[352,469,1247,1267]" italics="true" pageId="3" pageNumber="206">pantanensis</emphasis>
</taxonomicName>
refers to the region (the Pantanal) in which the new species commonly occurs.
</paragraph>
<paragraph id="30058077863EFFB0FFE3C55603E3D42B" blockId="3.[85,756,523,1351]" pageId="3" pageNumber="206">
Distribution. Known from Poconé in the Brazilian state,
<collectingRegion id="F27E4E95863EFFB0FD29C55603DFD42B" country="Brazil" name="Mato Grosso" pageId="3" pageNumber="206">Mato Grosso</collectingRegion>
.
</paragraph>
</subSubSection>
<subSubSection id="78A0D3FC863EFFB0FFC3C52F010DD7E7" pageId="3" pageNumber="206" type="discussion">
<paragraph id="30058077863EFFB0FFC3C52F010DD7E7" blockId="3.[85,756,1376,1675]" pageId="3" pageNumber="206">
<emphasis id="02CE5C65863EFFB0FFC3C52F03FBD418" bold="true" box="[85,185,1377,1396]" pageId="3" pageNumber="206">Remarks.</emphasis>
<taxonomicName id="F7BAFBF4863EFFB0FF59C52E02F5D418" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[207,439,1376,1396]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="pantanensis">
<emphasis id="02CE5C65863EFFB0FF59C52E02F5D418" box="[207,439,1376,1396]" italics="true" pageId="3" pageNumber="206">Trichomyia pantanensis</emphasis>
</taxonomicName>
is placed in the subgenus
<taxonomicName id="F7BAFBF4863EFFB0FD56C52E020CD4FC" authority="Bravo, 2001" authorityName="Bravo" authorityYear="2001" pageId="3" pageNumber="206" rank="subGenus" subGenus="Opistotrichomyia">
<emphasis id="02CE5C65863EFFB0FD56C52E0390D4FC" italics="true" pageId="3" pageNumber="206">Opistotrichomyia</emphasis>
<bibRefCitation id="542BFD86863EFFB0FF41C533020CD4FC" author="Bravo, F." box="[215,334,1405,1424]" pageId="3" pageNumber="206" pagination="50 - 55" refId="ref2494" refString="Bravo, F., 2001. Opisthotrichomyia, subgenero novo de Trichomyiinae (Diptera, Psychodidae) e descricao de tres novas especies do Brasil. Sitientibus 1, 50 - 55." type="journal article" year="2001">Bravo, 2001</bibRefCitation>
</taxonomicName>
because it has the palpus four-segmented with the first two partially fused, the gonocoxite projected ventrally with an internal lobe having elongated bristles and gonostylus articulate apically to the gonocoxite. However, its aedeagus is shorter than that of
<taxonomicName id="F7BAFBF4863EFFB0FEB6C5A5015DD493" authority="(Rapp, 1945)" baseAuthorityName="Rapp" baseAuthorityYear="1945" box="[288,543,1515,1536]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="brevitarsa">
<emphasis id="02CE5C65863EFFB0FEB6C5A502DAD493" box="[288,408,1515,1535]" italics="true" pageId="3" pageNumber="206">T. brevitarsa</emphasis>
(Rapp, 1945)
</taxonomicName>
and longer than that of
<taxonomicName id="F7BAFBF4863EFFB0FFE6C649010DD770" authority="Alexander, Freitas &amp; Quate, 2001" authorityName="Alexander, Freitas &amp; Quate" authorityYear="2001" box="[112,591,1543,1564]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="riodocensis">
<emphasis id="02CE5C65863EFFB0FFE6C64903B7D777" box="[112,245,1543,1563]" italics="true" pageId="3" pageNumber="206">T. riodocensis</emphasis>
Alexander, Freitas &amp; Quate, 2001
</taxonomicName>
. The gonostylus is bifurcated as in
<taxonomicName id="F7BAFBF4863EFFB0FE87C66D02A5D75B" authority="Bravo, 2001" authorityName="Bravo" authorityYear="2001" box="[273,487,1571,1592]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="festiva">
<emphasis id="02CE5C65863EFFB0FE87C66D022AD75B" box="[273,360,1571,1591]" italics="true" pageId="3" pageNumber="206">T. festiva</emphasis>
<bibRefCitation id="542BFD86863EFFB0FEF8C66B02A5D75B" author="Bravo, F." box="[366,487,1572,1592]" pageId="3" pageNumber="206" pagination="50 - 55" refId="ref2494" refString="Bravo, F., 2001. Opisthotrichomyia, subgenero novo de Trichomyiinae (Diptera, Psychodidae) e descricao de tres novas especies do Brasil. Sitientibus 1, 50 - 55." type="journal article" year="2001">Bravo, 2001</bibRefCitation>
</taxonomicName>
and
<taxonomicName id="F7BAFBF4863EFFB0FD8DC66D01DDD75B" authorityName="Alexander, Freitas &amp; Quate" authorityYear="2001" box="[539,671,1571,1591]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="riodocensis">
<emphasis id="02CE5C65863EFFB0FD8DC66D01DDD75B" box="[539,671,1571,1591]" italics="true" pageId="3" pageNumber="206">T. riodocensis</emphasis>
</taxonomicName>
, but the gonostylus of
<taxonomicName id="F7BAFBF4863EFFB0FF76C6710277D73F" authorityName="Bravo" authorityYear="2001" box="[224,309,1599,1619]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="festiva">
<emphasis id="02CE5C65863EFFB0FF76C6710277D73F" box="[224,309,1599,1619]" italics="true" pageId="3" pageNumber="206">T. festiva</emphasis>
</taxonomicName>
has truncate apex.
<taxonomicName id="F7BAFBF4863EFFB0FE62C67101B6D73F" authority="Bravo, 2001" authorityName="Bravo" authorityYear="2001" box="[500,756,1599,1620]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="fluminensis">
<emphasis id="02CE5C65863EFFB0FE62C671013AD73F" box="[500,632,1599,1619]" italics="true" pageId="3" pageNumber="206">T. fluminensis</emphasis>
<bibRefCitation id="542BFD86863EFFB0FDEBC60F01B6D73F" author="Bravo, F." box="[637,756,1600,1620]" pageId="3" pageNumber="206" pagination="50 - 55" refId="ref2494" refString="Bravo, F., 2001. Opisthotrichomyia, subgenero novo de Trichomyiinae (Diptera, Psychodidae) e descricao de tres novas especies do Brasil. Sitientibus 1, 50 - 55." type="journal article" year="2001">Bravo, 2001</bibRefCitation>
</taxonomicName>
and
<taxonomicName id="F7BAFBF4863EFFB0FF16C615022AD703" authority="Bravo, 2001" authorityName="Bravo" authorityYear="2001" box="[128,360,1627,1648]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="nocturna">
<emphasis id="02CE5C65863EFFB0FF16C61503AFD703" box="[128,237,1627,1647]" italics="true" pageId="3" pageNumber="206">T. nocturna</emphasis>
<bibRefCitation id="542BFD86863EFFB0FF67C613022AD703" author="Bravo, F." box="[241,360,1628,1648]" pageId="3" pageNumber="206" pagination="50 - 55" refId="ref2494" refString="Bravo, F., 2001. Opisthotrichomyia, subgenero novo de Trichomyiinae (Diptera, Psychodidae) e descricao de tres novas especies do Brasil. Sitientibus 1, 50 - 55." type="journal article" year="2001">Bravo, 2001</bibRefCitation>
</taxonomicName>
have not gonostylus bifurcated and the internal lobe is shorter than that of
<emphasis id="02CE5C65863EFFB0FE28C639010DD7E7" box="[446,591,1655,1675]" italics="true" pageId="3" pageNumber="206">
<taxonomicName id="F7BAFBF4863EFFB0FE28C6390109D7E7" authorityName="Araújo &amp; Bravo &amp; Carvalho" authorityYear="2017" box="[446,587,1655,1675]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="pantanensis">T. pantanensis</taxonomicName>
.
</emphasis>
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,147 @@
<document id="2D1A5EF6BA4C44A41FFEA4F3914AE649" ID-DOI="10.1016/j.rbe.2017.04.002" ID-ISSN="1806-9665" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1722639565813" checkinUser="felipe" docAuthor="Araújo, Maíra Xavier, Bravo, Freddy &amp; Carvalho, Claudio José Barros de" docDate="2017" docId="B8133161863EFFB0FFC3C6F90769D002" docLanguage="en" docName="RevBrasEntomol.61.3.203-207.pdf" docOrigin="Revista Brasileira de Entomologia 61 (3)" docSource="http://dx.doi.org/10.1016/j.rbe.2017.04.002" docStyle="DocumentStyle:0303D37C566E4E2A42C6591146119864.3:RevBrasEntomol.2015-.journal_article" docStyleId="0303D37C566E4E2A42C6591146119864" docStyleName="RevBrasEntomol.2015-.journal_article" docStyleVersion="3" docTitle="Trichomyia hispida Araujo &amp; Bravo 2016" docType="treatment" docVersion="2" lastPageNumber="206" masterDocId="442A4919863DFFB3FF96C04E0342D16C" masterDocTitle="Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil" masterLastPageNumber="207" masterPageNumber="203" pageNumber="206" updateTime="1722684407175" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0">
<mods:mods id="62FB10F82358B458A4977C890408A563" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="6E6F5BDFADD99EC9E4AC68815CECC9F6">
<mods:title id="452B700534DDB559C53CC073DED828CC">Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil</mods:title>
</mods:titleInfo>
<mods:name id="22D1C9217C05834782374F4078D90C20" type="personal">
<mods:role id="23FD43CB3AC6A99F04398C90E8D84AED">
<mods:roleTerm id="74DA4ED473C339636C5AD6902867BE59">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="41799D464BE5B3FD579C35A2AF74E2CF">Araújo, Maíra Xavier</mods:namePart>
<mods:affiliation id="4E8EB13CA70F7F1657881A9E0EEBCBA4">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:name id="A15AB305EA8B4670620917D8E371D163" type="personal">
<mods:role id="E5DA4B3067A6DB5B86A3CC1226D78C17">
<mods:roleTerm id="528AA16E1B069ED90B8A15F874F5BC2C">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="A150357B9FA4689931362DF0EEF0BDCB">Bravo, Freddy</mods:namePart>
<mods:affiliation id="5561026F6E972A4F3F757339063803B9">Universidade Estadual de Feira de Santana, Programa de Pós-graduação em Zoologia, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil</mods:affiliation>
</mods:name>
<mods:name id="EE2F4029C6FF441A2B2F90B39EB0E025" type="personal">
<mods:role id="D7B321B1E3C09BFE18411CD4A5D392F7">
<mods:roleTerm id="E0AB22CF76EC0F993729FF9072CA2E72">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="BF94D230BCF8C4A50274B84801BA6457">Carvalho, Claudio José Barros de</mods:namePart>
<mods:affiliation id="B77988C6DC2631E6AC2614FC62D3B6D1">Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil</mods:affiliation>
</mods:name>
<mods:typeOfResource id="BDEA2A56AEC4779D9F800B5683D2D9C7">text</mods:typeOfResource>
<mods:relatedItem id="9BA1DE548919C39957E22B58D10C4A7B" type="host">
<mods:titleInfo id="61BEAB7B06350A7C71B892A80932447B">
<mods:title id="358F03CF68F154DDC69D5EDB05564456">Revista Brasileira de Entomologia</mods:title>
</mods:titleInfo>
<mods:part id="E55399E7A8CC3C469A395C3325023993">
<mods:date id="F0704BB5D48CF94E596D15AB844162E3">2017</mods:date>
<mods:detail id="AE028A390EB8913831E17A4D2005908C" type="pubDate">
<mods:number id="04CB68B20A5446EBD410032C9347327A">2017-04-22</mods:number>
</mods:detail>
<mods:detail id="B7D66955988670210646A47525C0288A" type="volume">
<mods:number id="A364309E89F7351D4B4DDB817B28C4E0">61</mods:number>
</mods:detail>
<mods:detail id="65F183B1E1298E53C3B0DACD504BD175" type="issue">
<mods:number id="D961596F150808CB9CCB2C44596AB329">3</mods:number>
</mods:detail>
<mods:extent id="70B05128ED707726D51A214C83BDF5EC" unit="page">
<mods:start id="06AD951E557FBA91D9760F7091FBA6F7">203</mods:start>
<mods:end id="EA970A3559D53C138336A7A44A4AE305">207</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="FFADB1816B2683FA4B63AD7C31FDE80A">
<mods:url id="95024BA6E7BD9A591B73F2D521F8CAEA">http://dx.doi.org/10.1016/j.rbe.2017.04.002</mods:url>
</mods:location>
<mods:classification id="332AA117E0DD80D9003BC3B5D4ADAB1B">journal article</mods:classification>
<mods:identifier id="FD924DC70B0F2347280ADD80ECFEDF41" type="DOI">10.1016/j.rbe.2017.04.002</mods:identifier>
<mods:identifier id="6D8A91CBCACF91B30125A3BADB7A1F1E" type="ISSN">1806-9665</mods:identifier>
</mods:mods>
<treatment id="B8133161863EFFB0FFC3C6F90769D002" ID-DOI="http://doi.org/10.5281/zenodo.13196453" ID-Zenodo-Dep="13196453" LSID="urn:lsid:plazi:treatment:B8133161863EFFB0FFC3C6F90769D002" httpUri="http://treatment.plazi.org/id/B8133161863EFFB0FFC3C6F90769D002" lastPageNumber="206" pageId="3" pageNumber="206">
<subSubSection id="78A0D3FC863EFFB0FFC3C6F901EFD7A7" box="[85,685,1719,1739]" pageId="3" pageNumber="206" type="nomenclature">
<paragraph id="30058077863EFFB0FFC3C6F901EFD7A7" blockId="3.[85,685,1719,1739]" box="[85,685,1719,1739]" pageId="3" pageNumber="206">
<heading id="6B4D371B863EFFB0FFC3C6F901EFD7A7" box="[85,685,1719,1739]" fontSize="8" level="2" pageId="3" pageNumber="206" reason="6">
<treatmentCitationGroup id="10AAA759863EFFB0FFC3C6F901EFD7A7" box="[85,685,1719,1739]" pageId="3" pageNumber="206">
<emphasis id="02CE5C65863EFFB0FFC3C6F901EFD7A7" box="[85,685,1719,1739]" italics="true" pageId="3" pageNumber="206">
<treatmentCitation id="B11BA666863EFFB0FFC3C6F90173D7A7" ID-DOI="http://doi.org/10.5281/zenodo.6080107" ID-Zenodo-Dep="6080107" author="Araujo, M. X. &amp; Bravo, F." box="[85,561,1719,1739]" httpUri="http://treatment.plazi.org/id/03A7ED58F8766C226B98FA80B978AF37" page="50" pageId="3" pageNumber="206" year="2016">
<taxonomicName id="F7BAFBF4863EFFB0FFC3C6F90173D7A7" ID-CoL="8FHM2" authority="Araujo &amp; Bravo, 2016: 49 - 50" authorityName="Araujo &amp; Bravo" authorityPageNumber="49 - 50" authorityYear="2016" box="[85,561,1719,1739]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="hispida">
Trichomyia hispida
<bibRefCitation id="542BFD86863EFFB0FE82C6F90173D7A7" author="Araujo, M. X. &amp; Bravo, F." box="[276,561,1719,1739]" pageId="3" pageNumber="206" pagination="1 - 76" refId="ref2448" refString="Araujo, M. X., Bravo, F., 2016. Description of fourty four new species, taxonomic notes and identification key to Neotropical Trichomyia Haliday in Curtis (Diptera Psychodidae, Trichomyiinae). Zootaxa 4130, 1 - 76." type="journal article" year="2016">Araújo &amp; Bravo, 2016: 4950</bibRefCitation>
</taxonomicName>
</treatmentCitation>
, Figs. 28AH
</emphasis>
</treatmentCitationGroup>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="78A0D3FC863EFFB0FFC3C74F0769D002" pageId="3" pageNumber="206" type="discussion">
<paragraph id="30058077863EFFB0FFC3C74F0257D6D0" blockId="3.[85,756,1792,1980]" pageId="3" pageNumber="206">
<emphasis id="02CE5C65863EFFB0FFC3C74F03FBD678" bold="true" box="[85,185,1793,1812]" pageId="3" pageNumber="206">Remarks.</emphasis>
Males of
<taxonomicName id="F7BAFBF4863EFFB0FEB0C74E02C2D678" authorityName="Araujo &amp; Bravo" authorityYear="2016" box="[294,384,1792,1812]" class="Insecta" family="Psychodidae" genus="Trichomyia" kingdom="Animalia" order="Diptera" pageId="3" pageNumber="206" phylum="Arthropoda" rank="species" species="hispida">
<emphasis id="02CE5C65863EFFB0FEB0C74E02C2D678" box="[294,384,1792,1812]" italics="true" pageId="3" pageNumber="206">T. hispida</emphasis>
</taxonomicName>
can be recognized by the few bristles on the posterior arm of the gonocoxites, two pairs of parameres with the first dorsal pair being subtriangular with pointed apex, and the second pair with sharp apex and longer than the dorsal paramere, jointed apically by a ventral parameral sheath. Epandrium subrectangular and cercus bottle-shaped in lateral view with two apical bristles.
</paragraph>
<paragraph id="30058077863EFFB0FCD2C0D607C5D1AB" blockId="3.[804,1475,152,367]" pageId="3" pageNumber="206">
<materialsCitation id="80D28A2A863EFFB0FCD2C0D607C5D1AB" collectingDate="2004-01-28" collectionCode="MZFS" collectorName="de Maria &amp; F. Bravo" country="Brazil" location="Coracao de Maria" municipality="Material" pageId="3" pageNumber="206" specimenCount="1" stateProvince="Bahia" typeStatus="holotype">
<collectingMunicipality id="D0611A0D863EFFB0FCD2C0D600D8D1C7" box="[836,922,152,171]" pageId="3" pageNumber="206">Material</collectingMunicipality>
examined.
<collectingCountry id="48ADC0E7863EFFB0FB84C0D6070CD1C7" box="[1042,1102,152,171]" name="Brazil" pageId="3" pageNumber="206">Brazil</collectingCountry>
,
<collectingRegion id="F27E4E95863EFFB0FBCFC0D607D1D1C7" box="[1113,1171,152,171]" country="Brazil" name="Bahia" pageId="3" pageNumber="206">Bahia</collectingRegion>
,
<location id="3565D6AC863EFFB0FB08C0D60616D1C7" LSID="urn:lsid:plazi:treatment:B8133161863EFFB0FFC3C6F90769D002:3565D6AC863EFFB0FB08C0D60616D1C7" box="[1182,1364,152,171]" country="Brazil" municipality="Material" name="Coracao de Maria" pageId="3" pageNumber="206" stateProvince="Bahia">
Coração
<collectorName id="9D4FE5A1863EFFB0FB61C0D60616D1C7" box="[1271,1364,152,171]" pageId="3" pageNumber="206">de Maria</collectorName>
</location>
,
<date id="4404A6B7863EFFB0FAC9C0D606FDD1C7" box="[1375,1471,152,171]" pageId="3" pageNumber="206" value="2004-01-28">
<collectingDate id="54405F5F863EFFB0FAC9C0D606FDD1C7" box="[1375,1471,152,171]" pageId="3" pageNumber="206" value="2004-01-28">28.I.2004</collectingDate>
</date>
,
<typeStatus id="EF013ED5863EFFB0FCB2C0FA003CD1AB" box="[804,894,180,199]" pageId="3" pageNumber="206" type="holotype">holotype</typeStatus>
male,
<collectorName id="9D4FE5A1863EFFB0FC56C0FA0752D1AB" box="[960,1040,180,199]" pageId="3" pageNumber="206">F. Bravo</collectorName>
leg. (
<collectionCode id="56AB18B2863EFFB0FBD3C0FA07C3D1AB" box="[1093,1153,180,199]" pageId="3" pageNumber="206">MZFS</collectionCode>
)
</materialsCitation>
</paragraph>
<paragraph id="30058077863EFFB0FCD2C09E00DDD077" blockId="3.[804,1475,152,367]" pageId="3" pageNumber="206">
Other material examined.
<materialsCitation id="80D28A2A863EFFB0FBC8C09E00DDD077" collectingDate="2013-01-15" collectingDateMax="2013-01-17" collectingDateMin="2013-01-15" collectionCode="MZFS" collectorName="Chapada dos Guimaraes &amp; da Bencao &amp; Silva-Neto, A. M." country="Brazil" location="Vale da Bencao" pageId="3" pageNumber="206" specimenCount="1" specimenCount-male="1" stateProvince="Mato Grosso">
<collectingCountry id="48ADC0E7863EFFB0FBC8C09E07D8D18F" box="[1118,1178,208,227]" name="Brazil" pageId="3" pageNumber="206">Brazil</collectingCountry>
,
<collectingRegion id="F27E4E95863EFFB0FB3EC09E066CD18F" box="[1192,1326,208,227]" country="Brazil" name="Mato Grosso" pageId="3" pageNumber="206">Mato Grosso</collectingRegion>
,
<collectorName id="9D4FE5A1863EFFB0FAABC09E00D1D193" pageId="3" pageNumber="206">Chapada dos Guimarães</collectorName>
,
<location id="3565D6AC863EFFB0FC08C0A2077ED193" LSID="urn:lsid:plazi:treatment:B8133161863EFFB0FFC3C6F90769D002:3565D6AC863EFFB0FC08C0A2077ED193" box="[926,1084,236,255]" country="Brazil" name="Vale da Bencao" pageId="3" pageNumber="206" stateProvince="Mato Grosso">
Vale
<collectorName id="9D4FE5A1863EFFB0FC47C0A2077ED193" box="[977,1084,236,255]" pageId="3" pageNumber="206">da Benção</collectorName>
</location>
,
<specimenCount id="26BC4BFE863EFFB0FBD0C0A207CCD193" box="[1094,1166,236,255]" count="1" pageId="3" pageNumber="206" type="male">1 male</specimenCount>
,
<date id="4404A6B7863EFFB0FB0EC0A5065FD192" box="[1176,1309,235,254]" pageId="3" pageNumber="206" value="2013-01-15" valueMax="2013-01-17" valueMin="2013-01-15">
<collectingDate id="54405F5F863EFFB0FB0EC0A5065FD192" box="[1176,1309,235,254]" pageId="3" pageNumber="206" value="2013-01-15" valueMax="2013-01-17" valueMin="2013-01-15">1517.I.2013</collectingDate>
</date>
, leg.
<collectorName id="9D4FE5A1863EFFB0FAC5C0A20010D077" pageId="3" pageNumber="206">Silva-Neto, A.M.</collectorName>
(
<collectionCode id="56AB18B2863EFFB0FCCBC14600DBD077" box="[861,921,264,283]" pageId="3" pageNumber="206">MZFS</collectionCode>
)
</materialsCitation>
</paragraph>
<paragraph id="30058077863EFFB0FCD2C16D0769D002" blockId="3.[804,1475,152,367]" pageId="3" pageNumber="206">
Distribution. Known from the
<typeStatus id="EF013ED5863EFFB0FB12C16A07F3D05B" box="[1156,1201,292,311]" pageId="3" pageNumber="206">type</typeStatus>
locality in
<collectingCountry id="48ADC0E7863EFFB0FABAC16D062AD05A" box="[1324,1384,291,310]" name="Brazil" pageId="3" pageNumber="206">Brazil</collectingCountry>
, state of
<collectingRegion id="F27E4E95863EFFB0FCB2C171001ED03E" box="[804,860,319,338]" country="Brazil" name="Bahia" pageId="3" pageNumber="206">Bahia</collectingRegion>
(Coração de Maria) and state of
<collectingRegion id="F27E4E95863EFFB0FB39C10E0673D03E" box="[1199,1329,319,339]" country="Brazil" name="Mato Grosso" pageId="3" pageNumber="206">Mato Grosso</collectingRegion>
(Chapada dos Guimarães new record).
</paragraph>
</subSubSection>
</treatment>
</document>