diff --git a/data/03/A2/73/03A2732DE05ABF156F03EDC367F8F89C.xml b/data/03/A2/73/03A2732DE05ABF156F03EDC367F8F89C.xml new file mode 100644 index 00000000000..8229e1af673 --- /dev/null +++ b/data/03/A2/73/03A2732DE05ABF156F03EDC367F8F89C.xml @@ -0,0 +1,78 @@ + + + +Leptogenys pujoli, a new amazonian species, and the redescription of Leptogenys famelica Emery, 1896 (Formicidae: Ponerinae) + + + +Author + +Cavalcanti, Joshua Pablo +Universidade Federal do Paraná, Departamento de Zoologia, Curitiba, PR, Brasil. urn: lsid: zoobank. org: act: 6 A 286 AEB- 6924 - 49 DA-B 669 - 36 AACEC 9 F 5 A 3 + + + +Author + +Lattke, John Edwin +Universidade Federal do Paraná, Departamento de Zoologia, Curitiba, PR, Brasil. urn: lsid: zoobank. org: act: 6 A 286 AEB- 6924 - 49 DA-B 669 - 36 AACEC 9 F 5 A 3 + +text + + +Revista Brasileira de Entomologia + + +2024 + +e 20240012 + + +2024-05-27 + + +68 + + +2 + + +1 +9 + + + + +http://dx.doi.org/10.1590/1806-9665-rbent-2024-0012 + +journal article +10.1590/1806-9665-RBENT-2024-0012 +1806-9665 +77BAA24A-F95F-4C16-9C50-C25626E9444B + + + + + + +Leptogenys pujoli +n. sp. + + + + + + +( +Fig. 2 +) + + + +urn:lsid:zoobank.org:act: +6A286AEB-6924-49DA-B669-36AACEC9F5A3 + + + + + \ No newline at end of file diff --git a/data/03/A2/73/03A2732DE05BBF146F21EA2C64EEFE66.xml b/data/03/A2/73/03A2732DE05BBF146F21EA2C64EEFE66.xml new file mode 100644 index 00000000000..242a2753223 --- /dev/null +++ b/data/03/A2/73/03A2732DE05BBF146F21EA2C64EEFE66.xml @@ -0,0 +1,94 @@ + + + +Leptogenys pujoli, a new amazonian species, and the redescription of Leptogenys famelica Emery, 1896 (Formicidae: Ponerinae) + + + +Author + +Cavalcanti, Joshua Pablo +Universidade Federal do Paraná, Departamento de Zoologia, Curitiba, PR, Brasil. urn: lsid: zoobank. org: act: 6 A 286 AEB- 6924 - 49 DA-B 669 - 36 AACEC 9 F 5 A 3 + + + +Author + +Lattke, John Edwin +Universidade Federal do Paraná, Departamento de Zoologia, Curitiba, PR, Brasil. urn: lsid: zoobank. org: act: 6 A 286 AEB- 6924 - 49 DA-B 669 - 36 AACEC 9 F 5 A 3 + +text + + +Revista Brasileira de Entomologia + + +2024 + +e 20240012 + + +2024-05-27 + + +68 + + +2 + + +1 +9 + + + + +http://dx.doi.org/10.1590/1806-9665-rbent-2024-0012 + +journal article +10.1590/1806-9665-RBENT-2024-0012 +1806-9665 +77BAA24A-F95F-4C16-9C50-C25626E9444B + + + + + + +Leptogenys famelica Emery, 1896 + + + + + + +( +Fig. 1 +) + + + + + +Leptogenys famelica Emery, 1896: 91 +, fig.6a-c (w.) +Costa Rica +, +Suerre +at +Jiménez +, + +VII.1895 + +, +A. Alfaro +[ +MCSN +] + +. + + + + \ No newline at end of file diff --git a/data/03/A3/87/03A387853816F11CFFB10907071BDA5C.xml b/data/03/A3/87/03A387853816F11CFFB10907071BDA5C.xml new file mode 100644 index 00000000000..a900970ed51 --- /dev/null +++ b/data/03/A3/87/03A387853816F11CFFB10907071BDA5C.xml @@ -0,0 +1,178 @@ + + + +Rediscovery of Bothynus cribrarius (Fairmaire) (Coleoptera, Melolonthidae, Dynastinae, Pentodontini): description of the male and precise location data + + + +Author + +Duarte, Paulo R. M. + + + +Author + +Grossi, Paschoal C. + +text + + +Revista Brasileira de Entomologia + + +2016 + +2016-07-22 + + +60 + + +4 + + +290 +292 + + + + +http://dx.doi.org/10.1016/j.rbe.2016.07.001 + +journal article +10.1016/j.rbe.2016.07.001 +1806-9665 + + + + + + + + +Scaptophilus cribrarius + +Fairmaire, 1878: 266 + + + + + + + + + +Description: +Male. Total length: 20.0– +21 mm +. Width across humeri 10.5–11.0 mm. Color in dorsal view dark brown, opaque; ventral view darker, densely setose ( +Figs. 1–3 +). Head: Clypeus triangular, strongly rugopunctate, apex contracted to 2 small teeth, sides slightly reflexed. Frontoclypeal suture weak, almost obsolete in smaller male. Frons transverse, moderately arched, strongly rugopunctate, and with 2 setose areas laterally. Mandibles tridentate, apical and middle teeth acuminate, basal tooth smaller, rounded. Ocular canthi slightly rounded, with scattered setae beneath. Mentum short, transverse, triangular, base concave. Pronotum: Shape transverse, about twice as wide as long, surface strongly convex. Pronotal fovea moderately concave, extending to about a third of anterior pronotal width and strongly and transversely wrinkled with some punctures on sides. Surface uniformly punctate, moderate on disk, and dense on sides, with larger, setose punctures; sides rounded, slightly raised. Apical tubercle large, conical, base transverse. Elytra: Surface opaque, moderately and uniformly punctate; punctures setose, moderate in size, some coalescent, becoming denser laterally. Striae distinctly punctate; sutural striae present, removed from suture by about 3–4 puncture diameters. Interstriae indistinct. Apical umbone smooth. Scutellum subtriangular, apex rounded, surface sparsely punctate. Legs: Femora densely setose, setae long, light reddish brown. Protibiae tridentate, apical tooth curved and more acute than others, middle tooth wider, basal tooth smaller. Protarsi with claws different in shape and size; inner claw strongly curved, incised, longer, incision deeply bifurcated ( +Fig. 9 +), outer claws simply curved. Meso- and metatibae with 2 transverse carinae on external surface; mesotibiae distinctly shorter than metatibiae; apex of meso- and metatibiae with 25–40 spinules. Venter: Surface densely setose, setae almost covering thoracic sternites; metathorax with center longitudinally concave, shallow. Abdominal sternites weakly setose on disk, denser on sides; fifth sternite with C-shaped punctures, denser than previous segments; sixth sternite emarginated at apex, surface densely punctate; punctures fine, coalescent. Propygidium completely setose except on disk where punctures coalesce and form weak ridges; stridulatory area confined to disk. Pygidium setose, slightly convex, with strong, transverse, coalescent punctures. Aedeagus: Parameres symmetrical strongly contracted to apex, apex dilated ( +Fig. 7 +). In lateral view with a carina. Surface weakly rugose mainly at middle; basal half with ventral tooth in lateral view; phallobase about 2 times longer than parameres ( +Fig. 8 +). + + + +Figs. 1–9. + +Bothynus cribrarius + +. 1–3, male in dorsal, lateral and ventral views respectively; 4–6, female in dorsal, lateral and ventral views respectively; 7–8, parameres and aedeagus in caudal and lateral views respectively (arrow indicates ventral tooth); 9, male anterior right claws. Scale bars (Figs. 1–6 = 0.5 cm; Figs. 7–9 = 2 mm). + + + +Female. Differs from male in the following aspects: Pronotal surface less punctate; apical tubercle about 1/2 smaller; fovea almost obsolete, flattened, and simply punctate, punctures ocellate. Legs with protarsi simple, claws similar in shape, not incised nor strongly curved.Pygidium less convex, nearly flat and more setose. Metathorax with narrower; abdominal sternites more distinctly punctate, sixth sternite parabolic, completely setose ( +Figs. 4–6 +). + + +Material examined + + +Holotype +female (MNHN). Examined, labeled: “ +Brésil +”. +Endrödi (1969) +designated a +lectotype +for this species, but this was incorrect because +Fairmaire (1878) +specifically stated that there was only +one specimen +. Article 74.2 (ICZN, 1999) stipulates that a unique specimen is to be regarded as a +holotype +. Although +Endrödi (1969) +just below his +lectotype +designation mentioned another female specimen from NHM and also as a +lectotype +what was another mistake that must be disregarded. The +holotype +identification labels are available at the following site: http://coldb.mnhn.fr/catalognumber/mnhn/ec/ec7107. + + +Additional material. + +BRASIL +, +Rio de Janeiro +: +Resende +, +Serrinha do Alambari +, + +ii.2010 + +, +U. Caramaschi +& +H. Niemeyer +legs. [ +1♂ +MNRJ +]. Itatiaia, + +20.iv.1933 + +, +♂ + +, + +Col. J. F. Zikán +, [ +1♂ +FIOC +]; +Itatiaia +, +Parque Nacional do Itatiaia +, +Casa do Pesquisador +, + + +27.ii-01.iii- +2012 + + +, 750 m, +M. Cupello +leg. [ +1♀ +MNRJ +] + +. + + + + \ No newline at end of file diff --git a/data/03/B6/8C/03B68C5BFFDB8A10FC82F9FA9BDDF94D.xml b/data/03/B6/8C/03B68C5BFFDB8A10FC82F9FA9BDDF94D.xml index 0acb470f2b6..668b60dd39e 100644 --- a/data/03/B6/8C/03B68C5BFFDB8A10FC82F9FA9BDDF94D.xml +++ b/data/03/B6/8C/03B68C5BFFDB8A10FC82F9FA9BDDF94D.xml @@ -1,55 +1,56 @@ - - - -Revision of the rare anthidiine bee genus Rhynostelis Moure & Urban (Hymenoptera, Apidae) + + + +Revision of the rare anthidiine bee genus Rhynostelis Moure & Urban (Hymenoptera, Apidae) - - -Author + + +Author -Parizotto, Daniele R. -Universidade Federal Rural de Pernambuco, Departamento de Agronomia, Recife, PE, Brazil -dparizotto@gmail.com +Parizotto, Daniele R. +Universidade Federal Rural de Pernambuco, Departamento de Agronomia, Recife, PE, Brazil +dparizotto@gmail.com - - -Author + + +Author -Melo, Gabriel A. R. -Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biologia Comparada de Hymenoptera, Curitiba, PR, +Melo, Gabriel A. R. +Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biologia Comparada de Hymenoptera, Curitiba, PR, -text - - -Revista Brasileira de Entomologia +text + + +Revista Brasileira de Entomologia - -2020 - -e 20190029 + +2020 + +e 20190029 - -2020-06-01 + +2020-06-01 - -64 + +64 - -2 + +2 - -1 -7 + +1 +7 - -http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029 + +http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029 -journal article -10.1590/1806-9665-RBENT-2019-0029 -1806-9665 -3D06396B-D9E4-48B7-A43E-C845D4C0A145 +journal article +10.1590/1806-9665-RBENT-2019-0029 +1806-9665 +13196367 +3D06396B-D9E4-48B7-A43E-C845D4C0A145 @@ -65,7 +66,7 @@ ( -Figs. 1-5 +Figs. 1-5 ) @@ -73,11 +74,11 @@ Diagnosis. Clypeus and supraclypeal area protuberant, ending in a short medial tubercle on upper margin of clypeus; base of the mandible with broad and strongly-raised laminar projection ( -Figs. 1 and 2 +Figs. 1 and 2 ); axillae projecting posteriorly, somewhat triangular; scutellum distinctly projected posteriorly and forming a strong medial emargination ( -Fig.3 +Fig.3 ); tergal pilosity yellowish ferruginous ( -Fig. 4 +Fig. 4 ). @@ -99,29 +100,29 @@ female. Approximate body length Color . Head integument yellow except: distal margin of mandible and apical tooth blackish; irregular black band above clypeus extending upwards, including ocelli, and connecting with black spot on vertex above compound eyes. Antenna light brown with dorsal surface of scape yellow; apex of pedicel and first flagellomere ferruginous ( -Figs.1 and 2 +Figs.1 and 2 ). Pronotal lobe with a large yellow macula; scutum black with large reverse U-shaped yellow maculae; scutellum with two yellow bands on apex; axilla yellow; metanotum black; propodeum yellow except for the black propodeal spiracle ( -Fig.3 +Fig.3 ). Mesepisternum mostly yellow, only with three irregular black maculae. Metepisternum largely yellow on its dorsal half and black ventrally. Tegula amber and fore wing membrane brown infumated, especially along costal margin ( -Fig. 3 +Fig. 3 ). Legs almost totally yellow; fore coxae with half basal brown; fore and mid tibiae with darkish area on inner surface; hind legs with irregular darkish maculae on inner surface of femur and outer surface of tibia. Terga black with yellow maculae; yellow band on T1 broad, slightly narrower at middle; T2-T5 with even broader yellow band, T2 with two small brown spots medially; T4-T5 with larger translucent ferruginous margin; distal tergum yellow with a median subapical blackish spot ( -Figs. 3 and 4 +Figs. 3 and 4 ). Sterna yellow, with large translucent margin on S1-S5. Pubescence . Yellowish with long hairs (longer than ocellus diameter). Pilosity longer and denser between ocelli, above antennal sockets and on clypeus ( -Fig. 2 +Fig. 2 ). Hairs on mesepisternum and legs longer than those on mesoscutum, slightly curved on pronotal lobe and apex of scutellum. Fore and mid legs with coxae and trochanter covered by denser pilosity. Terga covered by dense yellowish ferruginous pilosity ( -Fig. 4 +Fig. 4 ). S1-S5 with sparse light yellow hairs along posterior margin; S6 with light yellow hairs covering entire tergum. Sculpturing . Head with shallow punctures, sparser on clypeal protuberance and supraclypeal area. Mesosoma with integument microreticulated, mesoscutum with punctures deep and confluent, separated only by their crests, slightly sparser on yellow areas; mesespisternum with larger and sparser punctures, distance between punctures at least one-half of puncture diameter. Scutellum with punctures sparser than those on mesoscutum; with large punctures intercalated with small punctures, separated by least a puncture diameter. Terga microreticulated; punctures on disc of T1-T5 fine and shallow; punctures on yellow bands larger and sparser than those on black areas; distal tergum with deeper and larger punctures. Structure . Mandible with condylar carina simple; antero-basal protuberance, near anterior articulation, broad and strongly raised, spatulate. Supraclypeal area with protuberant medial carina continuing onto clypeus, ending as a short medial protuberance on upper margin of clypeus ( -Figs. 1, 2 and 5 +Figs. 1, 2 and 5 ). Axilla somewhat triangular and separated from scutellum by deep emargination; scutellum with strong medial emargination along posterior margin ( -Fig. 3 +Fig. 3 ). Male unknown. diff --git a/data/03/B6/8C/03B68C5BFFDC8A11FFD2F9629864FEA4.xml b/data/03/B6/8C/03B68C5BFFDC8A11FFD2F9629864FEA4.xml index 0404abb3e25..0f7b8113666 100644 --- a/data/03/B6/8C/03B68C5BFFDC8A11FFD2F9629864FEA4.xml +++ b/data/03/B6/8C/03B68C5BFFDC8A11FFD2F9629864FEA4.xml @@ -1,57 +1,58 @@ - - - -Revision of the rare anthidiine bee genus Rhynostelis Moure & Urban (Hymenoptera, Apidae) + + + +Revision of the rare anthidiine bee genus Rhynostelis Moure & Urban (Hymenoptera, Apidae) - - -Author + + +Author -Parizotto, Daniele R. -Universidade Federal Rural de Pernambuco, Departamento de Agronomia, Recife, PE, Brazil -dparizotto@gmail.com +Parizotto, Daniele R. +Universidade Federal Rural de Pernambuco, Departamento de Agronomia, Recife, PE, Brazil +dparizotto@gmail.com - - -Author + + +Author -Melo, Gabriel A. R. -Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biologia Comparada de Hymenoptera, Curitiba, PR, +Melo, Gabriel A. R. +Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biologia Comparada de Hymenoptera, Curitiba, PR, -text - - -Revista Brasileira de Entomologia +text + + +Revista Brasileira de Entomologia - -2020 - -e 20190029 + +2020 + +e 20190029 - -2020-06-01 + +2020-06-01 - -64 + +64 - -2 + +2 - -1 -7 + +1 +7 - -http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029 + +http://dx.doi.org/10.1590/1806-9665-rbent-2019-0029 -journal article -10.1590/1806-9665-RBENT-2019-0029 -1806-9665 -3D06396B-D9E4-48B7-A43E-C845D4C0A145 +journal article +10.1590/1806-9665-RBENT-2019-0029 +1806-9665 +13196367 +3D06396B-D9E4-48B7-A43E-C845D4C0A145 - + @@ -65,7 +66,7 @@ ( -Figs. 6-10 +Figs. 6-10 ) @@ -114,18 +115,18 @@ as This new species is more similar to R. multiplicata by the color pattern; the axillae rounded; scutellum with shallow posterior emargination ( -Fig.8 +Fig.8 ) and tergal pilosity brown to black ( -Figs. 9 +Figs. 9 and -14 +14 ). The females of R. plesiognatha sp. nov. can be easily distinguished by their less modified clypeus, provided only with a short tubercle on the upper margin and lacking the strongly raised beak-like projection of R. multiplicata , and by its simpler mandible, with a short truncate projection near the anterior articulation ( -Figs. 6 and 7 +Figs. 6 and 7 ). @@ -146,27 +147,27 @@ female. Approximate body length Color. Head integument yellow except: distal margin of mandible and apical tooth blackish; black band on supraclyeal area extending upward to vertex ( -Figs. 6 and 7 +Figs. 6 and 7 ). Pronotal lobe yellow; scutum black with reverse U-shaped yellow maculae almost reaching the scutoscutellar suture; scutellum with two large subapical yellow bands; axilla yellow. Mesepisternum yellow, with a little black spot medially. Tegula reddish brown, with a yellow spot anteriorly; fore wing membrane brown infumated throughout. Legs predominantly yellow ( -Figs. 8 and 10 +Figs. 8 and 10 ). Terga black with yellow maculae; yellow band on T1 angled at middle; yellow band on T2-T5 wider and slightly interrupted medially; T6 with two large yellow spots ( -Fig. 9 +Fig. 9 ). Three basal sterna yellow, with large translucent margin; S4 yellow with dark infuscated area medially; S6 black with two lateral yellow spots. Pubescence . Head and mesosoma with mostly light yellowish ferruginous pilosity, shorter than ocellar diameter.Pubescence longer and denser between ocelli, above antennal sockets and lower margin of clypeus. Hairs of mesepisternum slightly longer and denser than those on mesoscutum ( -Fig. 8 +Fig. 8 ). Pilosity of terga as in R. multiplicata . Sculpturing . Head with shallow and coalescent punctures; smaller and fine on disc of clypeus. Mesoscutum with deeper and smaller punctures than those on head. Gibbous area of mesepisternum with punctures sparser than on mesoscutum. Punctures of terga fine and shallow; punctures on yellow bands larger and sparser than those on black areas ( -Fig. 9 +Fig. 9 ); distal tergum with larger punctures. Structure . Mandible with bifurcated condylar carina, antero-basal projection short and truncate; supraclypeal area not raised, except for the medial carina; clypeus with a small medial tubercle on its upper margin ( -Figs. 6 and 7 +Figs. 6 and 7 ). diff --git a/data/03/C8/87/03C8878DFF8F132CFFC1ABEAFD6739CA.xml b/data/03/C8/87/03C8878DFF8F132CFFC1ABEAFD6739CA.xml new file mode 100644 index 00000000000..e2f4c917ad2 --- /dev/null +++ b/data/03/C8/87/03C8878DFF8F132CFFC1ABEAFD6739CA.xml @@ -0,0 +1,111 @@ + + + +Two new species of Hanshumba from Southeastern Brazil and a key to males of the genus (Insecta: Hemiptera: Cicadellidae: Cicadellini) + + + +Author + +Froza, Joyce A. +Universidade de São Paulo, Escola Superior de Agricultura “ Luiz de Queiroz ”, Departamento de Entomologia e Acarologia, Piracicaba, SP, Brazil + + + +Author + +Cavichioli, Rodney R. +Universidade Federal do Paraná, Setor de Ciências Biológicas, Departamento de Zoologia, Curitiba, PR, Brazil + + + +Author + +Costa, Luiz A. A. +Universidade Federal do Rio de Janeiro, Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brazil + + + +Author + +Mejdalani, Gabriel +Universidade Federal do Rio de Janeiro, Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brazil + +text + + +Revista Brasileira de Entomologia + + +2018 + +Rev. Bras. Entomol. + + +2018-09-10 + + +62 + + +4 + + +315 +318 + + + + +http://dx.doi.org/10.1016/j.rbe.2018.08.005 + +journal article +10.1016/j.rbe.2018.08.005 +1806-9665 +1BBF8CCE-AD22-4A02-8551-D9B24D4BAFB3 + + + + + + +Hanshumba setifera + +sp. nov. + + + + + +( +Figs. 1–5 +) + + +Diagnosis. + +Hanshumba setifera + +sp. nov. +can be readily distinguished from the other four known species of the genus by the following combination of features: (1) apical portions of male pygofer ( +Fig. 2 +) and segment X (anal tube) ( +Figs. 4, 5 +) with conspicuous process bearing numerous setae; (2) style ( +Fig. 3 +) with apex obliquely truncate, foot-shaped; (3) aedeagal shaft ( +Figs. 4, 5 +) with distal half curved dorsally and with pair of dentiform processes on median portion; (4) paraphyses ( +Fig. 3 +) with two pairs of rami, anterior one directed anterad, thick, and obtuse apically, whereas posterior one directed posterad, slender, and acute apically. + + +Length of male +holotype +5.6 mm; male +paratype +5.1 mm. + + + + \ No newline at end of file diff --git a/data/03/C8/87/03C8878DFF8F132FFCF0A9C8FD0438EE.xml b/data/03/C8/87/03C8878DFF8F132FFCF0A9C8FD0438EE.xml new file mode 100644 index 00000000000..9719d62c635 --- /dev/null +++ b/data/03/C8/87/03C8878DFF8F132FFCF0A9C8FD0438EE.xml @@ -0,0 +1,117 @@ + + + +Two new species of Hanshumba from Southeastern Brazil and a key to males of the genus (Insecta: Hemiptera: Cicadellidae: Cicadellini) + + + +Author + +Froza, Joyce A. +Universidade de São Paulo, Escola Superior de Agricultura “ Luiz de Queiroz ”, Departamento de Entomologia e Acarologia, Piracicaba, SP, Brazil + + + +Author + +Cavichioli, Rodney R. +Universidade Federal do Paraná, Setor de Ciências Biológicas, Departamento de Zoologia, Curitiba, PR, Brazil + + + +Author + +Costa, Luiz A. A. +Universidade Federal do Rio de Janeiro, Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brazil + + + +Author + +Mejdalani, Gabriel +Universidade Federal do Rio de Janeiro, Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brazil + +text + + +Revista Brasileira de Entomologia + + +2018 + +Rev. Bras. Entomol. + + +2018-09-10 + + +62 + + +4 + + +315 +318 + + + + +http://dx.doi.org/10.1016/j.rbe.2018.08.005 + +journal article +10.1016/j.rbe.2018.08.005 +1806-9665 +1BBF8CCE-AD22-4A02-8551-D9B24D4BAFB3 + + + + + + +Hanshumba teresa + +sp. nov. + + + + + +( +Figs. 6–12 +) + + +Diagnosis. This new species can be recognized by the following combination of features: (1) apical portion of male pygofer ( +Figs. 7, 7a +) with small inner process bearing apical setae and segment X (anal tube) ( +Figs. 9, 10 +) without such process; (2) style ( +Fig. 8 +) with apex transversely truncate, not foot-shaped; (3) aedeagal shaft ( +Figs. 9–12 +) with three pairs of longitudinal flanges, two of them elongate and forming spiniform processes at apex; (4) paraphyses ( +Fig.8 +) with two pairs of rami, anterior one directed anterad, + + + +Figs. 6–10. + +Hanshumba teresa + +sp. nov. +, male. 6, body, dorsal view, length 5.9 mm (antennae and legs not depicted). Terminalia: 7, pygofer lobe, lateral view (inner setose process illustrated in Fig. 7a); 8, subgenital plates, connective, styles, and paraphyses, dorsal view; 9, aedeagus and anal tube, lateral view; 10, aedeagus and anal tube, ventral view (red arrows indicate the aedeagal shaft).APR, anterior ramus of paraphyses; EJB,ejaculatory bulb; PPR, posterior ramus of paraphyses; SPR, setose process. + + +elongate, slender, and with subacute apex, whereas posterior one directed posterad, fused to each other for most of their length, and with obtuse apex. + +Length of male +holotype +5.9 mm; male +paratype +5.8 mm. + + + + \ No newline at end of file diff --git a/data/03/C8/87/03C887EA0611FFD09925F931FBB1F96C.xml b/data/03/C8/87/03C887EA0611FFD09925F931FBB1F96C.xml index 563cc9d18a1..c4078b210da 100644 --- a/data/03/C8/87/03C887EA0611FFD09925F931FBB1F96C.xml +++ b/data/03/C8/87/03C887EA0611FFD09925F931FBB1F96C.xml @@ -1,59 +1,60 @@ - - - -A new species of the sharpshooter genus Onega Distant, 1908 (Hemiptera: Cicadellidae: Cicadellini) from Ecuador and Peru + + + +A new species of the sharpshooter genus Onega Distant, 1908 (Hemiptera: Cicadellidae: Cicadellini) from Ecuador and Peru - - -Author + + +Author -Ferreira, André Luis Diniz -Universidade Federal do Rio de Janeiro, Instituto de Biologia, Departamento de Zoologia, Rio de Janeiro, RJ, Brazil +Ferreira, André Luis Diniz +Universidade Federal do Rio de Janeiro, Instituto de Biologia, Departamento de Zoologia, Rio de Janeiro, RJ, Brazil - - -Author + + +Author -Lozada, Pedro W. -Universidad Nacional Mayor de San Marcos, Museo de Historia Natural, Departamento de Entomología, Lima, Peru +Lozada, Pedro W. +Universidad Nacional Mayor de San Marcos, Museo de Historia Natural, Departamento de Entomología, Lima, Peru - - -Author + + +Author -Takiya, Daniela Maeda -Universidade Federal do Rio de Janeiro, Instituto de Biologia, Departamento de Zoologia, Rio de Janeiro, RJ, Brazil +Takiya, Daniela Maeda +Universidade Federal do Rio de Janeiro, Instituto de Biologia, Departamento de Zoologia, Rio de Janeiro, RJ, Brazil -text - - -Revista Brasileira de Entomologia +text + + +Revista Brasileira de Entomologia - -2018 - -2018-10-06 + +2018 + +2018-10-06 - -62 + +62 - -4 + +4 - -324 -327 + +324 +327 - -http://dx.doi.org/10.1016/j.rbe.2018.09.005 + +http://dx.doi.org/10.1016/j.rbe.2018.09.005 -journal article -10.1016/j.rbe.2018.09.005 -1806-9665 +journal article +10.1016/j.rbe.2018.09.005 +1806-9665 +13195986 - + @@ -63,7 +64,7 @@ sp. nov. Ferreira, Lozada & Takiya ( -Figs. 1–12 +Figs. 1–12 ) @@ -83,37 +84,37 @@ Ferreira, Lozada & Takiya ( Coloration : Crown yellow; margins besides eyes dark brown; median macula dark-brown ( -Fig. 1 +Fig. 1 ). Face yellow, except pairs of maculae on frons at bases of antennae and on genae, light brown ( -Fig. 2 +Fig. 2 ). Pronotum reddish-brown ( -Fig. 1 +Fig. 1 ) with five spots mostly confluent arranged as a “V” on disc and two semi-circular maculae on posterior margin, bright yellow ( -Fig. 1 +Fig. 1 ). Mesonotum bright yellow; lateral basal angles and apical spot, reddish-brown ( -Figs. 1–3 +Figs. 1–3 ). Forewing mostly bright yellow, with several irregular reddish-brown ( -Figs. 1 and 2 +Figs. 1 and 2 ) areas; apex translucent ( -Figs. 1–3 +Figs. 1–3 ). Hind wing translucent white ( -Figs. 1–4 +Figs. 1–4 ). Thoracic pleura mostly yellow with few light brown maculae. Legs mostly dark brown ( -Figs. 2–4 +Figs. 2–4 ). Abdomen mostly red. External morphology : Crown with median length 3/5 interocular and slightly less than 2/5 transocular width; apical and lateral concave areas on crown not confluent ( -Fig. 1 +Fig. 1 ). Frons mostly flattened, concave only on superior fourth ( -Fig. 2 +Fig. 2 ). Pronotum with posterior margin slightly concave ( -Fig. 1 +Fig. 1 ) or straight ( -Fig. 3 +Fig. 3 ). Forewing with most of corium with plexus of veins, absent on apical, brachial, and costal cells; clavus with crossveins between claval veins ( -Figs.1 and 2 +Figs.1 and 2 ). Hind legs with femoral setal formula 2:1:1; first tarsomeres with length approximately equal to combined length of distal ones. Other external characters as in generic description ( Young, 1977 ). @@ -121,36 +122,36 @@ Ferreira, Lozada & Takiya ( Male genitalia : Pygofer moderately produced; posterior margin rounded and serrate; without processes; macrosetae dispersed throughout posterior 2/3; long microsetae restricted to basiventral margin ( -Fig. 5 +Fig. 5 ). Subgenital plate extending slightly posterior to midlength of pygofer; fused basally; with uniseriate macrosetae and fine setae basiventrally ( -Fig. 6 +Fig. 6 ). Connective approximately Vshaped; dorsal keel strongly sclerotized and elongate, extending anteriorly. Style extending posteriorly beyond apex of connective; apex broad and foot-shaped ( -Fig. 7 +Fig. 7 ). Aedeagus with dorsal apodemes robust; shaft elongate and bisinuate, in lateral view, with a non-bifurcated dorsoapical process above the gonopore ( -Fig. 8 +Fig. 8 ); apex with apical acute sinuous process extending beyond gonopore. Paraphyses absent ( -Fig. 8 +Fig. 8 ). Female genitalia : Sternite VII with posterior margin with shallow median emargination; transverse striations on disc ( -Fig. 10 +Fig. 10 ). Internal abdominal sternite VIII forming simple membranous plate. Pygofer with few macrosetae distributed dorsally on apical third ( -Fig. 11 +Fig. 11 ). First valvula, in ventral view, with base truncate and lateral preapical concavities ( -Fig. 12 +Fig. 12 ). Second valvula bearing 38 non-contiguous teeth ( -Fig. 14 +Fig. 14 ); teeth with denticles distributed on anterior and posterior margin ( -Fig. 13 +Fig. 13 ); apex broadly rounded ( -Fig. 15 +Fig. 15 ). Gonoplac with apex narrowly round; few microsetae on apical margin ( -Fig. 11 +Fig. 11 ). - + Figs. 5–15. @@ -168,11 +169,11 @@ Variation of : The general coloration of the Ecuadorian paratype varies in having the yellow tone much brighter; dorsal areas darker brown; median crown macula reddish-brown; frons completely yellow; and pronotum discal spots not confluent ( -Figs. 3 and 4 +Figs. 3 and 4 ). In the male genitalia, the Ecuadorian paratype have subgenital plates with lateral macrosetae absent at basal third and aedeagus with dorsoapical process bifurcate and shorter apical process ( -Fig. 9 +Fig. 9 ). Peruvian paratypes may also have bifurcate dorsoapical process. Furthermore, the Ecuadorian diff --git a/data/06/3A/87/063A87885E67F54D9958BF29FE853CED.xml b/data/06/3A/87/063A87885E67F54D9958BF29FE853CED.xml index 21b2207e628..3594376d91a 100644 --- a/data/06/3A/87/063A87885E67F54D9958BF29FE853CED.xml +++ b/data/06/3A/87/063A87885E67F54D9958BF29FE853CED.xml @@ -1,56 +1,57 @@ - - - -Taxonomic revision of the Neotropical stalk-eyed fly Plagiocephalus Wiedemann (Diptera, Ulidiidae, Ulidiinae) + + + +Taxonomic revision of the Neotropical stalk-eyed fly Plagiocephalus Wiedemann (Diptera, Ulidiidae, Ulidiinae) - - -Author + + +Author -Vasconcelos, Ana Caroline O. +Vasconcelos, Ana Caroline O. - - -Author + + +Author -Wendt, Lisiane D. +Wendt, Lisiane D. - - -Author + + +Author -de Carvalho, Claudio J. B. +de Carvalho, Claudio J. B. -text - - -Revista Brasileira de Entomologia +text + + +Revista Brasileira de Entomologia - -2019 - -2018-12-31 + +2019 + +2018-12-31 - -63 + +63 - -1 + +1 - -80 -90 + +80 +90 - -http://dx.doi.org/10.1016/j.rbe.2018.12.002 + +http://dx.doi.org/10.1016/j.rbe.2018.12.002 -journal article -10.1016/j.rbe.2018.12.002 -1806-9665 +journal article +10.1016/j.rbe.2018.12.002 +1806-9665 +13196000 - + @@ -66,9 +67,9 @@ ( -Figs. 2G–I +Figs. 2G–I , -3E, F +3E, F ) @@ -350,19 +351,19 @@ and shorter than in P. latifrons (3.00–7.00 mm); female parafacialia yellow ( -Fig. 2G +Fig. 2G ); radial-medial band with base wider than apex, at most barely touching the discal band ( -Fig. 3E, F +Fig. 3E, F ). The species can also be distinguished by male face yellowish white; male scape, pedicel and first flagellomere entirely yellow, and female scape, pedicel and first flagellomere gold with apex darker ( -Fig. 2G +Fig. 2G ); palpus yellow; proboscis reddish yellow, with brown and yellow setulae. Male wing of normal outline, without posterior lobes ( -Fig. 3E +Fig. 3E ); crossvein r-m located distinctly before the apex of vein R 1 ( -Fig. 3E, F +Fig. 3E, F ); male subapical band curved and narrower when touching the apical band ( -Fig. 3E +Fig. 3E ); male apical band wider than in P. lobularis @@ -372,9 +373,9 @@ and P. latifrons ( -Fig. 3E +Fig. 3E ). Male fore and mid legs entirely yellow, and hind leg yellow to gold; female legs brown with tarsi lighter, and fore femur yellowish on the apex ( -Fig. 2I +Fig. 2I ). @@ -420,7 +421,7 @@ and Distribution. Costa Rica ( -Fig. 6 +Fig. 6 ). diff --git a/data/09/02/87/090287EBFF83BF04FCF806EAC325FE68.xml b/data/09/02/87/090287EBFF83BF04FCF806EAC325FE68.xml new file mode 100644 index 00000000000..38e94cadb5d --- /dev/null +++ b/data/09/02/87/090287EBFF83BF04FCF806EAC325FE68.xml @@ -0,0 +1,266 @@ + + + +A new species of the sharpshooter genus Balacha from an alpine field in southeastern Brazil (Insecta: Hemiptera: Cicadellidae: Cicadellini) + + + +Author + +Mejdalani, Gabriel +Universidade Federal do Rio de Janeiro (UFRJ), Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brasil. + + + +Author + +Silva, Adriane Pereira +Universidade Federal do Rio de Janeiro (UFRJ), Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brasil. + + + +Author + +Froza, Joyce Adriana +Universidade de São Paulo (USP), Escola Superior de Agricultura “ Luiz de Queiroz ”, Departamento de Entomologia e Acarologia, + + + +Author + +Carvalho, Stéphanie Riehl +Universidade Federal do Rio de Janeiro (UFRJ), Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brasil. + + + +Author + +Pecly, Nathalia Hiluy +Universidade Federal do Rio de Janeiro (UFRJ), Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brasil. + + + +Author + +Quintas, Victor Cordeiro +Universidade Federal do Rio de Janeiro (UFRJ), Museu Nacional, Departamento de Entomologia, Rio de Janeiro, RJ, Brasil. + +text + + +Revista Brasileira de Entomologia + + +2024 + +e 20240008 + + +2024-04-26 + + +68 + + +2 + + +1 +7 + + + + +http://dx.doi.org/10.1590/1806-9665-rbent-2024-0008 + +journal article +10.1590/1806-9665-RBENT-2024-0008 +1806-9665 + + + + + + +Balacha caledonia +sp. nov. +( +Figs. 1-3 +) + + + + + +urn:lsid:zoobank.org:act: +76E543D0-06E6-42B4-AEFB-7FF2335424FF + + + + + +Total length. Male +holotype +8.2 mm +; female +paratypes +8.5-8.8 mm +(n = 3). + + +Head ( +Figs. 1 +a-c). Crown, in dorsal view, well produced anteriorly, its median length approximately 6/10 of interocular width and 4/10 of transocular width; surface smooth, glabrous, with transverse concavity at interocellar area; anterior margin rounded; without carina at transition from crown to face. Ocelli located on imaginary transverse line between anterior angles of compound eyes, each ocellus equidistant from median line of crown and adjacent anterior eye angle. Coronal suture distinct. Frontogenal suture distinct, extending onto crown to near ocellus. Temporal suture indistinct. Antennal ledge, in dorsal view, slightly protuberant; in lateral view, not carinate dorsally and with anterior margin oblique and convex. Face with frons flattened medially; texture of disc finely granular; muscle impressions distinct. Epistomal suture obsolete. Clypeus robust, contour of its inferior portion, in lateral view, forming distinct angle with superior portion; apex convex. + + +Thorax ( +Figs. 1a, b +). Pronotum, in dorsal view, with width slightly smaller than transocular width of head; lateral margins parallel; posterior margin distinctly concave medially; dorsolateral carina complete, rectilinear, slightly declivous anterad; disc glabrous, its posterior half distinctly rugose medially. Mesonotum, in dorsal view, with scutellum finely transversely striated. Forewing without well-defined apical membrane;texture coriaceous and smooth;venation elevated and mostly distinct; without anteapical plexus of veins; with three closed anteapical cells, their bases located more proximally than claval apex; with four apical cells, base of fourth more proximal than base of third. Hind wing with vein R2+3 incomplete. Hind leg with femoral apical setal formula 2:1:1; first tarsomere longer than combined length of two more distal tarsomeres, its plantar surface with two parallel rows of small setae. + + +Coloration ( +Figs. 1 +a-c, 3a, b). Ground color of anterior dorsum dark brown to black.Crown with four orange maculae along posterior margin; antennal ledge tinged with orange. Pronotum with distinct, medially constricted orange transverse stripe. Forewing dark brown to black; with four contrasting yellow markings: (1) basalmost one forming slightly curved stripe over base of corium and clavus, (2) second one from claval sulcus to outer margin of first discal cell, oblique, directed anteriorly, (3) third one forming transcommissural stripe originating at apex of clavus and almost reaching costal margin, (4) fourth one a spot located close to base of fourth apical cell, distinctly smaller than the others. Ground color of face and lateral and ventral areas of thorax dark brown to black; frons with orange stripe along frontogenal suture; clypeus with pair of large lateral orange areas connected to frontal stripe; + + + +Figure 1 +Balacha caledonia +sp. nov. +(a) Female, dorsal habitus (scale bar = 4mm); (b) female, lateral habitus; (c) female, face. (d-i) Male terminalia: (d) pygofer, lateral view (scale bar = 1mm); (e) pygofer, ventral view; (f) valve and subgenital plate, ventral view; (g) connective and style, dorsal view; (h) ejaculatory bulb and aedeagus, lateral view; (i) paraphyses, dorsal view. + + +lorum orange; gena with few small orange or brown markings; labium dark brown to black; additional small irregular orange spots may also be present on face. Legs dark brown to black; setal rows of hind tibia (AD, PD, AV, PV) contrasting brown. Abdomen dark brown to black; posterior portions of sternites and laterotergites orange. + +Male terminalia. Pygofer ( +Figs. 1d, e +), in lateral view, well produced posteriorly; without processes; posterior margin mostly truncate; surface with macrosetae distributed mainly on posterior half; in ventral view, ventral margin with distinct emargination on median portion. Valve ( +Fig. 1f +), in ventral view, subrectangular, short, slightly constricted medially. Subgenital plate ( +Fig.1f +), in ventral view, triangular, narrowing gradually toward apex; with few macrosetae located close to outer margin; microsetae also present; plates linked basally to each other and to valve by large membranous area; in lateral view, plate extending almost as far posteriorly as pygofer apex. Connective ( + +Fig. +1g + +), in dorsal view, T-shaped; stem narrow and elongate, with median keel. Style ( + +Fig. +1g + +), in dorsal view, very elongate, extending much farther posteriorly than connective; without preapical lobe; apical portion digitiform, curved outward; apex obtuse. Aedeagus ( +Fig. 1h +) symmetrical; shaft, in lateral view, elongate, tubular, arcuate dorsally, not curved at its base; without processes; basal half with dorsal lobe; apical portion without ventral lobe; gonopore located apically; ejaculatory bulb strongly developed in comparison with size of shaft. Paraphyses ( +Fig. 1i +), in dorsal view, with stalk elongate, triangular, connected to stem of connective; rami very elongate, slightly convergent apically; each ramus with basal portion directed anteriorly, then with sharp turn posteriorly, apex acute. + + +Female terminalia.Sternite VII ( +Fig.2a +), in ventral view, with posterior margin sinuous, including deep median emargination. “Internal” sternite VIII ( +Fig.2b +), in dorsal view, with pair of distinct ovoid sclerites connected to each other by transverse bar.Pygofer ( +Fig.2c +), in lateral view, moderately produced posteriorly; posterior margin triangularly produced; apex obtuse; macrosetae distributed mostly on posterior half and extending anteriorly along ventral margin.Valvifer I ( +Fig.2d +), in lateral view,expanded posteriorly; posterior margin with small dentiform projection. Valvula I ( +Figs. 2e, f +), in ventral view, with basal portion broadened; blade, in lateral view, approximately rectilinear beyond basal curvature; apical portion with ventral and dorsal margins serrated; apex acute; ventral interlocking device located on basiventral half of blade; dorsal sculptured area extending from basal portion to apex of blade, formed mostly by scale-like processes arranged in oblique lines; ventral sculptured area restricted to apical portion, formed by scale-like processes; basal portion of valvula with scattered setae/pores also extending posteriorly along area below ramus. Valvula II ( + +Figs. +2g +, h + +), in lateral view, expanded beyond basal curvature; dorsal margin regularly convex; blade with about 25 continuous, sclerotized subtriangular teeth, those at ascending basal portion small, followed by about eight elongate ones (with flat, low posterior area) and then becoming smaller, at descending portion, toward apex; denticles distributed on teeth and on dorsal and ventral apical portions of valvula, except on apex (dorsal and ventral dentate apical areas with similar sizes); ventral margin of blade approximately rectilinear; basidorsal hyaline area distinct; preapical prominence small but distinct; apex obtuse; blade with ducts extending toward teeth and apex. Gonoplac extending slightly beyond pygofer apex; in lateral view, with basal half narrow and apical half distinctly expanded; apex obtuse; surface with denticuli and few setae distributed on apical portion and extending anteriorly along ventral margin (apical setae distinctly larger than more basal ones). + + + +Figure 2 +Balacha caledonia +sp.nov. +Female terminalia: (a) sternite VII,ventral view;(b) “internal” sternite VIII,dorsal view; (c) pygofer,lateral view (scale bar = 1mm); (d) valvifer I, lateral view; (e) valvula I, lateral view; (f) apical portion of ramus and dorsal sculptured area of valvula I, lateral view; (g) valvula II,lateral view; (h) teeth, denticles, and ducts of valvulae II, lateral view (sections of two blades shown in photograph). + + + +Etymology.The specific epithet, +caledonia +, refers to the +type +locality of the new taxon (Pico do Caledônia, municipality of Nova Friburgo, state of +Rio de Janeiro +, southeastern +Brazil +). It is a noun in apposition. + + +Known host plant: +Eryngium sp. +( +Apiaceae +). + + +Type material. + +Southeastern +Brazil +, state of +Rio de Janeiro +. +Male +holotype +: “RJ [state of +Rio de Janeiro +] Nova Friburgo \ Arredores [do] Pico [do] Caledônia [ + +2,257m +a.s.l. + +] \ + +22/V/2022 + +\ Mejdalani, Pecly, \ Quintas, Oliveira, Alves” ( +MNRJ-ENT3-2394 +). +Paratypes +: +four females +, same data as the holotype ( +DZUP +, +MELQ-ESALQENT001775 +, +MNRJ-ENT3-2393 +, +2396 +); +one female +: “ +RJ Nova Friburgo +\ +Pico do Caledônia +\ + +22/ +VI + + + +/2019 \ +Mejdalani +, +Pecly +, +Quintas +, +Ferreira +( +MNRJ-ENT3-1860 +) + +. + + + + \ No newline at end of file diff --git a/data/32/7E/87/327E87E1D879FFEDFCC0FAEFFF44B0C5.xml b/data/32/7E/87/327E87E1D879FFEDFCC0FAEFFF44B0C5.xml new file mode 100644 index 00000000000..1965a9f0f96 --- /dev/null +++ b/data/32/7E/87/327E87E1D879FFEDFCC0FAEFFF44B0C5.xml @@ -0,0 +1,503 @@ + + + +A new key for the species of Ateuchus Weber (Coleoptera: Scarabaeidae: Scarabaeinae) occurring in Mexico, with a description of the first North American inquiline species from a rodent burrow (Rodentia: Geomydae) and new distribution records + + + +Author + +Kohlmann, Bert +EARTH University, San José, Costa Rica + + + +Author + +Vaz-de-Mello, Fernando Z. +Universidade Federal de Mato Grosso, Instituto de Biociências, Departamento de Biologia e Zoologia, Cuiabá, MT, Brazil + +text + + +Revista Brasileira de Entomologia + + +2018 + +2018-02-13 + + +62 + + +2 + + +131 +134 + + + + +http://dx.doi.org/10.1016/j.rbe.2018.01.002 + +journal article +10.1016/j.rbe.2018.01.002 +1806-9665 + + + + + + + +Ateuchus tuza +Kohlmann and Vaz de Mello + +, +sp. nov. + + + + + + +( +Figs. 1–4 +) + + + + +Type locality: + +MEXICO +: +VERACRUZ +, +Dos Amates +( +Catemaco +), elev. + +300–600 m + +(18 + +◦ + +29 + +Ɩ + +21 + +ƖƖ + + +N +, 95 + +◦ + +03 + +Ɩ + +35 + +ƖƖ + +W) + + + + +Diagnosis. +This species is distinguished from other + +Ateuchus +species + +by the following combination of characters: Long and slender body; dorsum glossy; clypeus bidentate; head simply convex, lacking carina or tubercle; base of the head with a small wrinkled area in the center; anterior border of pronotum continuous, posterior border of pronotum with an area of dense and coarse punctures medially; elytral lateral portion rounded; sternellum forming a carina in the middle; pygidium slightly convex, lightly shagreen, and inconspicuously punctate. + + + + +Description. +Holotype +male ( +Figs. 1–4 +). +Body. +Elongate ( +Figs. 1–2 +), convex dorsally ( +Fig. 1 +). +Size. +Total length 10.0 mm. Maximum width 5.5 mm. +Color. +Dark reddish brown to black, lacking metallic sheen. +Head. +Clypeal margin anteriorly broadly V-shaped ( +Figs. 1–2 +); anterior margin slightly upturned, gena and frons coarsely wrinkled, vertex coarsely punctate, base of head with a small wrinkled area in the center ( +Fig. 3 +), eyes viewed from above six times longer than wide. +Pronotum. +Transverse, strongly convex, surface glossy; anterior pronotal margin complete; midline weakly impressed at base; pronotal surface punctate throughout, a group of coarse punctures at the center of the pronotal base ( +Fig. 1 +); lateral pronotal fossae shallow. +Elytra. +( +Fig. 1 +). Striae fine, shallowly impressed on disk, becoming well defined and deeply impressed on apical declivity; strial punctures elongatecrenulate, slightly wider than stria, separated by 2–3 diameters on disk and apical declivity. Interstriae slightly convex on disk, surface minutely punctate throughout. +Thoracic sterna. +( +Fig. 2 +). Proepisternum excavate anteriorly, surface of excavated portion granulate, with fine and rather long setae, bordered posteriorly by a well-defined keel. Proepimeron finely wrinkled. Sternellum glabrous and forming a keel at its center. Mesometasternal suture arched medially, marginal bead fine. Mesosternum coarsely punctured forming rugulae. Mesepisternum flat, surface-forming rugulae. Metasternum evenly convex, disk evidently punctate, surface glossy between punctures, lateral lobes forming rugulae; midline clearly impressed along three fourths of its length. +Legs. +( +Figs. 1–2 +). Foretibia with four teeth on outer margin, the basal one weakly developed; foretibial spur expanded and truncate apically; foretibiae and forefemora long and slender; forefemur smooth, finely punctate throughout. Metatibiae obliquely truncate apically; apical spur spiniform. +Abdomen. +( +Fig. 2 +). Sternites 3–7 crenulately punctate along their anterior borders. Last abdominal segment slender. Pygidium slightly convex and lightly shagreen with indistinct punctuation; basal sulcus fine and deep throughout; marginal bead continuous. +Male genitalia. +Parameres simple, tapering to apex in lateral view, apical portion rounded in dorsal view. The internal sac of the aedeagus with three hooks, two spine-like and one spoon-like ( +Fig. 4 +). + + + +Allotype +: + +Female. Total length 9.5 mm. Maximum width 5.0 mm. Same as male with the following sexual differences: clypeal margin anteriorly, not so broadly V-shaped; lateral pronotal margin not arched; last abdominal segment broader medially; foretibiae and forefemora shorter and foretibial spurs slender and slightly bent at tip; pygidium not as long. + + + +Figures 4–5. + +A. tuza + +sp. nov. +; 4, drawing of the internal sac, line equals 1 mm; 5, + +A. hornai +( +Balthasar, 1939 +) + +, dorsal habitus of the female holotype. + + + +Variation: + +Total +length 9.5– +10 mm +. +Maximum +width 5.0–5.5 mm. + +Material +examined + +( +34 specimens +): + +Holotype +. + +Male +: +México +: +Veracruz +: + +Dos Amates + +( +Catemaco +), +8– + +V–1968, + +P. Reyes +, +M. Cabrera +cols. +Nido +de tuza. +Cámara +de desechos ( +CEMT +). + +Allotype +. + +Female +: +ibidem +, +one female +. + +Paratypes +. + +ibidem +, +six males +, +four females +( +three males +and +three females +at +CEMT +; +one male +, +Gonzalo Halffter +personal collection, +Coatepec +, +Mexico +; +one male +and +one female +at +Bert Kohlmann +personal collection, +Las Mercedes de Guácimo +, +Costa Rica +; +one male +to be deposited at +Canadian Museum of Nature +, +Ottawa +, +Canada +) + +; + +one male +, +one female +, +Entomological Collection +at the +Institute of Ecology +, +Xalapa +, +Mexico +( +IEXA +), +México +: +Oaxaca +, +Sta. María Chimalapas +, + +12-VI-2015 + + +, colecta directa, dentro de madriguera de +tuza, J. Luis S. Huerta +col.; +five males +, +seven females +, ibidem, +16-VI-2015 +; +two males +, +two females +, ibidem, +18-VI-2015 +; +one male +, +one female +, ibidem, +19-VI-2015 +; +two females +, ibidem, +22-VI-2015 +. + + + + +Remarks: +This is the first North American inquiline + +Ateuchus +species + +collected from a pocket gopher burrow. + + + + +Etymology: +The name + +tuza + +, a name in apposition, is the hispanized common name of the indigenous nahuatl word tozan, given to the beaver-looking subterranean rodent, where the new + +Ateuchus +species + +was found. + + +Geographical distribution: + +The new species is so far only known from the locality of +Dos Amates +, Catemaco, in the state of +Veracruz + +, + +and the locality of Santa María Chimalapas, +Oaxaca +, +Mexico + +. + + +Habitat: +The new species was collected in the waste chamber of a pocket gopher ( +Rodentia +: Geomydae) burrow during the month of May. Although the rodent of the original collection site was not identified at the time, it is most likely that the specimens were found inside the nest of + +Orthogeomys hispidus +(Le Conte) + +. + + +Chorological affinities: +Interestingly, this new + +Ateuchus +species + +is found under similar ecological conditions, a lowland tropical area, as + +Ateuchus cujuchi +Génier + +, the other known inquiline rodent burrow + +Ateuchus +species + +from +Bolivia +( +Génier, 2015 +). + +A. cujuchi + +was collected in a + +Ctenomys + +burrow, a rodent belonging to a different family, Ctenomydae, as the one collected in +Mexico +. + + +Taxonomic relationships: +The shape of the body of this species resembles the South American species + +apicatum +(Harold, 1867) + +and is clearly not related to the known body shape of the North or Central American + +Ateuchus +species. + +The new species will key to couplet 23/24 ( + +apicatum + +) in +Balthasar’s (1939) +key. It can be easily separated from + +A. apicatum + +because of the presence of the small rugose area at the center of the base of the head and the presence of coarse punctures at the middle of the pronotal base. This taxonomic relationship would suggest that + +Ateuchus +species + +derived of South American lines have adapted to and colonized lowland gopher nests in North America; whereas, in the mountainous areas of North America it is species of the genus + +Onthophagus + +, which has adapted to colonizing gopher nests ( +Anduaga and Halffter, 1991 +; +Lobo and Halffter, 1994 +; +Zunino and Halffter, 2007 +). + + +This new species shows adaptations to living in an environment devoid of light, like the subterranean gopher nest. First, the dorsal eye area is very small. Second, the aforementioned rugose area at the base of the head is a stridulation mechanism, similar to those found at the base of the head of + +Uroxys + +, as found in + +U. microcularis +Howden and Young + +, + +U. micros +Bates + +and + +U. platypyga +Howden and Young + +( +Delgado and Kohlmann, 2007 +; +Solís and Kohlmann, 2013 +), and most probably helps in the communication process of this species. + + + + \ No newline at end of file diff --git a/data/32/7E/87/327E87E1D87BFFEDFFB1FED9FD66B338.xml b/data/32/7E/87/327E87E1D87BFFEDFFB1FED9FD66B338.xml new file mode 100644 index 00000000000..74105b4f62e --- /dev/null +++ b/data/32/7E/87/327E87E1D87BFFEDFFB1FED9FD66B338.xml @@ -0,0 +1,166 @@ + + + +A new key for the species of Ateuchus Weber (Coleoptera: Scarabaeidae: Scarabaeinae) occurring in Mexico, with a description of the first North American inquiline species from a rodent burrow (Rodentia: Geomydae) and new distribution records + + + +Author + +Kohlmann, Bert +EARTH University, San José, Costa Rica + + + +Author + +Vaz-de-Mello, Fernando Z. +Universidade Federal de Mato Grosso, Instituto de Biociências, Departamento de Biologia e Zoologia, Cuiabá, MT, Brazil + +text + + +Revista Brasileira de Entomologia + + +2018 + +2018-02-13 + + +62 + + +2 + + +131 +134 + + + + +http://dx.doi.org/10.1016/j.rbe.2018.01.002 + +journal article +10.1016/j.rbe.2018.01.002 +1806-9665 + + + + + + + +Ateuchus guatemalensis +(Bates), 1887 + + + + + +This species has been recorded from Chiapas, +Guatemala +and +Honduras +. It is here recorded for the first time from +Nicaragua +. + + + + + +Nicaragua +: +Jinotega +: +Cerro Kilambe +, +Camp +5, +Las Torres +, UTM–16P–1500283–0639500, + +1200 m + +, 23/ + +30-IV-2001 + +, col. +J. Sunyer +y +B. Hernández +( +5 specimens +at +CEMT +); +Masaya +: Las + + +Flores +, + +VII–1998 + +, col. +J. Téllez +( +1 specimen +at +CEMT +) + +. + + + + + +Ateuchus hornai +( +Balthasar, 1939 +) + +, + +new combination + +(valid species) + + +( +Fig. 5 +) + + + + +This species was previously considered a synonym of + +A. illaesum + +based on the original description, since the +holotype +was not available for study at the time ( +Kohlmann, 1984 +). The examination of the female +holotype +found in the Natural History Museum in +Prague +, +Czech Republic +( +Bezdek and Hajek, 2011 +), allowed us to consider it a valid species, distinguishable by the characters in the key presented herein. We suspect the type locality (Necaxa, +Puebla +, +México +) to be wrong, and we hope that a male will be collected in order to prepare a more thorough description of this interesting species. + + + + \ No newline at end of file diff --git a/data/37/2C/87/372C8782FFF0FFCBFC81FB316C4CF997.xml b/data/37/2C/87/372C8782FFF0FFCBFC81FB316C4CF997.xml new file mode 100644 index 00000000000..7ee6946fedd --- /dev/null +++ b/data/37/2C/87/372C8782FFF0FFCBFC81FB316C4CF997.xml @@ -0,0 +1,507 @@ + + + +Male and female association in Trichomyia Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil + + + +Author + +Araújo, Maíra Xavier +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Aragão, Marcos +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Cordeiro, Danilo +Instituto Nacional de Pesquisa da Amazônia, Coordenação de Biodiversidade, Manaus, AM, Brazil + + + +Author + +Bravo, Freddy +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Carvalho, Claudio José Barros de +Universidade Federal do Paraná, Departamento de Zoologia, Programa de Pós-graduação em Entomologia, Curitiba, PR, Brazil + + + +Author + +Andena, Sergio R. +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + +text + + +Revista Brasileira de Entomologia + + +2018 + +2018-09-05 + + +62 + + +4 + + +283 +287 + + + + +http://dx.doi.org/10.1016/j.rbe.2018.08.004 + +journal article +10.1016/j.rbe.2018.08.004 +1806-9665 + + + + + + +Trichomyia pseudoannae +Araújo & Bravo + +sp. nov. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
PrimerSequence (5l → 3l)References
LCO1490GGTCAACAAATCATAAAGATATTGG +Folmer et al. (1994) +
HCO2198TAAACTTCAGGGTGACCAAAAAATCA +Folmer et al. (1994) +
MtD6GGAGGATTTGGAAATTGATTAGTTCC +Simon et al. (1994) +
MtD9CCCGGTAAAATTAAAATATAAACTTC +Simon et al. (1994) +
+ + + +( +Figs. 1.1 +–9 and 2.1–3) + +Diagnosis.Head with one row of supraocular alveoli and one row of occipital alveoli. Palpus with three segments. Male terminalia with hypandrium fused to gonocoxites and expanded posteriorly as a apically slightly bifucate plate covering the aedeagus, gonocoxite with two pairs of arms.Female with the subgenital plate trapezoidal and bifurcated apically, cerci elongated. + + +Table 2 + +Specimens analyzed in this work, including the species names; BR, Brazil; gender (M, male; F, female); code, primer, pair base sequence, GenBank accession numbers and locality. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
SpeciesGenderDNA extractionPrimerSequenceGenBank accessionLocality
code(pb)numbers
+ +T. cerdosa +Araújo + +& +MT15lco/hco657MH042537BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada
Bravo, 2016Grande, 15.VI.2013 (light trap), M. Aragão & E. Menezes leg.
+ +T. cerdosa +Araújo + +& +MP4mtd6/mtd9480MH042535BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada
Bravo, 2016Grande, 15.VI.2013 (light trap), M. Aragão & E. Menezes leg.
+ +T. pseudoannae + +sp. nov. +MP28lco/hco468MH042538BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada
Grande, 18.V.2013 (light trap), M. Aragão & E. Menezes leg.
+ +T. ituberensis +Araújo + +& +MP21mtd6/mtd9480MH042540BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Vila 5,
Bravo, 201628.IV–19.V.2013 (Malaise), M. Aragão & E. Menezes leg.
+ +T. pseudoannae + +sp. nov. +FP46lco/hco657MH042536BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada
Grande, 22.IX.2012 (light trap), M. Aragão & E. Menezes leg.
+ +Trichomyia +sp1 + +FP29mtd6/mtd9467MH042539BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada
Grande, 18.V.2013 (light trap), M. Aragão & E. Menezes leg.
+ +Trichomyia +sp2 + +FP44lco/hco633MH042541BR, Bahia, Igrapiuna, Reserva Ecológica Michelin, Pancada
Grande, 24.III.2013 (light trap), E. Mota, M. Aragão & E.
Menezes leg.
+ + + +Fig. 1. +1–9 + +Trichomyia pseudoannae + +sp. nov. +1. Scape, pedicel and flagellomeres 1 and 2; 2. Right wing; 3. Head, dorsal view; 4. Head, ventral view; 5. Palpus; 6. Male terminalia, lateral, arrow in projection in the gonocoxal apodeme; 7. Cerci, epandrium, hypoproct; 8. Male terminalia, ventral; 9. Aedeagus and parameres (agv, ventral arm of gonocoxite; agd, dorsal arm of gonocoxite; cer, cercus; aed, aedeagus; hyp, hypoproct; pm, paramere; php, post-hypandrial plate). + + + + +Fig. 2. +1–3 + +Trichomyia pseudoannae + +sp. nov. +1. Female terminalia, ventral; 2. Median apodeme and spermathecae; 3. Female terminalia, dorsal (map, median apodeme; cer, cercus; spm, spermathecae; subp, subgenital plate). + + +Description. + +Male. Head subcircular, eyes rounded. Supraocular setae in single row ( +Fig. 1.3 +). Occipital setae arranged in single row ( +Fig. 1.4 +). Antennal pit subtriangular, short distance between antennae (less than 1/3 of the width of the pits and with sclerotic fold). Scape subcylindrical and pedicel subespherical, basal flagellomeres pyriform and eccentric; with a pair of mediobasal digitiform and S-shaped ascoids, first and second flagellomere equal in length, ascoids 1.4 times length of flagellomere ( +Fig. 1.1 +). Palpus three-segmented; first segment with sensilla in depressed pit on inner side; palpus formula: 1.0:0.6:0.9 ( +Fig. 1.5 +). Wing ( +Fig. 1.2 +). Sc-r sclerotized but not microsetose, r-m present, radial fork distal of apices of CuA +2 +and medial fork, base of M +2 +sclerotized but without microsetae. Male terminalia. Hypandrium fused with gonocoxites and expanded posteriorly as an apically slightly bifucate plate covering the aedeagus. Two pairs of arms of gonocoxite ( +Fig. 1.8 +: agd, agv), one dorsal, directed to apical region and with fine bristles distributed irregularly and a ventral pair, longer than dorsal one, directed to internal region of genitalia at an angle of 60 +◦ +. Pair of dorsal arms digitiform, with row of rod-like setae at apex and simple bristles distributed irregularly. Gonostylus sub-circular, slightly sclerotized and with fine bristles, articulated with ventral region of gonocoxite ( +Fig. 1.8 +). Gonocoxal apodeme with medium, narrow and sclerotized projection directed to dorsal region of genitalia ( +Fig.1.6 and 1.8 +). Aedeagus bifid; two pairs of parameres, dorsal lanciform and ventral digitiform, ejaculatory apodeme long, 1.75 times length of parameres ( +Fig. 1.9 +). Cercus cuneiform with bristles distributed irregularly. Hypoproct with micropilosity and apex rounded. Epandrium trapezoidal and pilose, with alveoli distributed in two lateral patches ( +Fig. 1.7 +). + + +Female.Head, antennae, mouthparts, palpi and wings as in male. Female terminalia. subgenital plate trapezoidal bifurcated apically. Cerci elongate, about 5.2 times longer than wide; sclerotized arch between cerci acuminate and with microseate, 0.4 as long as cerci ( +Fig. 2.1 and 2.3 +). Spermathecae with ducts annulated, inflated apically, apex slightly truncated. Median apodeme with two sclerotized projections anteriorly and three posteriorly; median posterior projection three times longer than other projections ( +Fig. 2.2 +). + + +Material examined: Voucher #m and +holotype +# + +m ( +MZFS +) +Brazil +, +Bahia +, +Igrapiuna +, +Reserva Ecológica da Michelin +, +Pancada Grande +, + +18.V.2013 + +, +M. Aragão +& +E. Menezes +cols.; +1 paratype +#m ( +MZFS +) the same locality and collector as +holotype + +, + + +15.VI.2013 + +; +22 paratypes +#m ( +MZFS +) +Brazil +, +Bahia +, Igrapiuna, +Reserva Ecológica da Michelin +, +Pacangê, M +. Aragão & +E. Menezes +cols. + +27–28.X.2012 + +( +1 paratype +); + +22.IX–28.X.2012 + +( +5 paratypes +); + +16.XII–20.I.2013 + +( +11 paratypes +); + +24.II–31.III.2013 + +( +1 paratype +); + +21–22.VII.2012 + +( +1 paratype +); + +27–28.IV.2013 + +( +2 paratypes +); + +30–31.III.2013 + +( +1 paratype +); +1 paratype +#m ( +MZFS +) +Brazil +, +Bahia +, Igrapiuna, +Reserva Ecológica da Michelin +, Vila 5, + +24.II–31.III.2013 + +, +M. Aragão +& +E. Menezes +cols.; Voucher #f ( +MZFS +) +Brazil +, +Bahia +, Igrapiuna, +Reserva Ecológica da Michelin +, Pancada Grande, + +22.IX.2012 + +, +M. Aragão +& +E. Menezes +cols.; +1 paratype +#f ( +MZFS +) the same locality and collector as +allotype + +. + + +Etymology. The epithet refers to morphological similarity with + +Trichomyia annae +Bravo, 2001 + +. + + +Distribution. Known only from the +type +locality. + + +Comments. The new species is morphologically similar to + +Trichomyia annae + +. The differences are in the male terminalia, the plate expanded posteriorly of hypandrium and gonocoxites has a small bifurcation apically with projections on rounded apex and not lanciform as in + +T. annae +. + +Both species, to date, have not been included in any subgenus. + + + + \ No newline at end of file diff --git a/data/37/2C/87/372C8782FFF2FFCAFFB0FAD8698CFA1A.xml b/data/37/2C/87/372C8782FFF2FFCAFFB0FAD8698CFA1A.xml new file mode 100644 index 00000000000..bfe1ffc0a60 --- /dev/null +++ b/data/37/2C/87/372C8782FFF2FFCAFFB0FAD8698CFA1A.xml @@ -0,0 +1,135 @@ + + + +Male and female association in Trichomyia Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil + + + +Author + +Araújo, Maíra Xavier +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Aragão, Marcos +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Cordeiro, Danilo +Instituto Nacional de Pesquisa da Amazônia, Coordenação de Biodiversidade, Manaus, AM, Brazil + + + +Author + +Bravo, Freddy +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Carvalho, Claudio José Barros de +Universidade Federal do Paraná, Departamento de Zoologia, Programa de Pós-graduação em Entomologia, Curitiba, PR, Brazil + + + +Author + +Andena, Sergio R. +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + +text + + +Revista Brasileira de Entomologia + + +2018 + +2018-09-05 + + +62 + + +4 + + +283 +287 + + + + +http://dx.doi.org/10.1016/j.rbe.2018.08.004 + +journal article +10.1016/j.rbe.2018.08.004 +1806-9665 + + + + + + + + +Trichomyia cerdosa +Araújo & Bravo, 2016: 39–40 + + +, figs. 20A–H. + + + + + + +Comments. Males of + +T. cerdosa + +are recognized by the genitalia, with an elongate arm of gonocoxite with elongate apical bristles. The cercus has four apical bristles rod-like. + + + +Material examined. +Brazil +, +Bahia +, Igrapiuna, Reserva Ecológica Michelin, Pancada Grande, + +15. +VI + + + +.2013 ( +light trap +), +M. Aragão +& +E. Menezes +cols., 2 #m ( +MZFS +) + +. + + +Distribution. +Brazil +( +Bahia +). + + + + \ No newline at end of file diff --git a/data/37/2C/87/372C8782FFF3FFCAFCA5F97B68E5FBF2.xml b/data/37/2C/87/372C8782FFF3FFCAFCA5F97B68E5FBF2.xml new file mode 100644 index 00000000000..9b06c52b9c4 --- /dev/null +++ b/data/37/2C/87/372C8782FFF3FFCAFCA5F97B68E5FBF2.xml @@ -0,0 +1,347 @@ + + + +Male and female association in Trichomyia Haliday in Curtis, 1839 using a molecular approach (Diptera, Psychodidae, Trichomyiinae), and description of new species from Brazil + + + +Author + +Araújo, Maíra Xavier +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Aragão, Marcos +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Cordeiro, Danilo +Instituto Nacional de Pesquisa da Amazônia, Coordenação de Biodiversidade, Manaus, AM, Brazil + + + +Author + +Bravo, Freddy +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Carvalho, Claudio José Barros de +Universidade Federal do Paraná, Departamento de Zoologia, Programa de Pós-graduação em Entomologia, Curitiba, PR, Brazil + + + +Author + +Andena, Sergio R. +Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + +text + + +Revista Brasileira de Entomologia + + +2018 + +2018-09-05 + + +62 + + +4 + + +283 +287 + + + + +http://dx.doi.org/10.1016/j.rbe.2018.08.004 + +journal article +10.1016/j.rbe.2018.08.004 +1806-9665 + + + + + + + + +Trichomyia ituberensis +Araújo & Bravo, 2016: 30–31 + + +, figs. 13A–I. + + + + + + +Comments. Males of + +T. ituberensis + +are recognized by the genitalia, with a hypandrium fused with gonocoxites and expanded posteriorly as an apically strongly bifucate plate covering the aedeagus. There are two pairs of parameres and rod-like setae in the arm of gonocoxite. + + + +Material examined. +Brazil +, +Bahia +, Igrapiuna, Reserva Ecológica Michelin, Vila 5, + +28.IV–19. +V + + + +.2013 (Malaise), +M. Aragão +& +E. Menezes +cols., 1 #m ( +MZFS +) + +. + + +Distribution. +Brazil +( +Bahia +). + + + +Table 3 + + +Matrix of p-distances among males and females of specimens of + +Trichomyia +. + +Bold denotes shortest distances; F, female. + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+#P4 +T. + +#P46 +T. + +#T15 +T. + +#P28 +T. + +#P29 + +Trichomyia + + +#P21 +T. + +#P44 + +Trichomyia + +
+cerdosa + + +pseudoannae + +(F) + + +cerdosa + + + +pseudoannae + +sp1 (F) + +ituberensis + +sp2 (F)
+#P4 + +T. cerdosa + +0.156 +0.010 +0.1620.1970.2160.276
+#P46 +T. +0.1560.166 +0.002 +0.1880.1390.287
+ +pseudoannae + +(F) +
+#T15 + +T. cerdosa + + +0.010 +0.1660.1680.2010.2200.294
+#P28 +T. +0.162 +0.002 +0.1680.2020.1540.304
+ +pseudoannae + +
+#P29 + +Trichomyia + +0.1970.1880.2010.2020.2180.388
sp.1 (F)
+#P21 + +T. ituberensis + +0.2160.1390.2200.1540.2180.314
+#P44 + +Trichomyia + +0.2760.2870.2940.3040.3880.314
sp.2 (F)
+ + +P46 +T. pseudoannae +(F) P21 +T. ituberensis + + +P44 +Trichomyia sp2 +(F) + +0.050 + + + \ No newline at end of file diff --git a/data/55/58/D3/5558D340FFC10869FC8AF9B4B069F9F3.xml b/data/55/58/D3/5558D340FFC10869FC8AF9B4B069F9F3.xml index 37f15c3321a..c7b68407edc 100644 --- a/data/55/58/D3/5558D340FFC10869FC8AF9B4B069F9F3.xml +++ b/data/55/58/D3/5558D340FFC10869FC8AF9B4B069F9F3.xml @@ -1,42 +1,43 @@ - - - -Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae) + + + +Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae) - - -Author + + +Author -Silveira, Orlando Tobias +Silveira, Orlando Tobias -text - - -Revista Brasileira de Entomologia +text + + +Revista Brasileira de Entomologia - -2019 - -2018-12-11 + +2019 + +2018-12-11 - -63 + +63 - -1 + +1 - -53 -72 + +53 +72 - -http://dx.doi.org/10.1016/j.rbe.2018.11.004 + +http://dx.doi.org/10.1016/j.rbe.2018.11.004 -journal article -10.1016/j.rbe.2018.11.004 -1806-9665 +journal article +10.1016/j.rbe.2018.11.004 +1806-9665 +13196034 @@ -52,9 +53,9 @@ Richards 1978 ( -Figs. 6; 9; 11; 13 +Figs. 6; 9; 11; 13 ; -31; 32 +31; 32 ) @@ -123,7 +124,7 @@ Vestiture: eyes bare; clypeus covered by fine appressed shining (silvery) pubesc Color (see -Figs. 31; 32 +Figs. 31; 32 ): Black; mandible anteriorly and basally mostly yellow gradually turning to reddish brown at apex; antennal articles 9–12 yellowish to light reddish beneath; apical area of clypeus reddish yellow to light reddish brown (in north of Mexico specimens, the ventral half of clypeus and a dorsal spot are yellow, separated by a blackish area); inner orbits to about center of ocular sinus, genal stripe (outer orbit), yellow to reddish yellow, sometimes interrupted or blurred below; small mark on pronotum ventral corner (sometimes reddish, or entirely absent), tubercle (sometimes reddish, or entirely absent), carina (sometimes discontinuously), and hind margin of pronotum (sometimes indistinct or reddish), front margin of metanotum narrowly (sometimes absent), propodeal valves (sometimes dark), and paired propodeal posterior dorsal spots (sometimes only small dots, or fading reddish, or entirely absent), one dorsolateral stripe on mid coxa (sometimes just a dot, or absent), one outer dorsal stripe on hind coxae (sometimes absent), none inner stripe on hind coxa; small apical mark on all femora; distal lateral marks on metasomal sternum 1 (sometimes absent), narrow distal bands on metasomal terga l-2 (or -4, somewhat indistinctly, or without any tergal bands) and sterna 2 (or -4, somewhat indistinctly, or without any sternal bands), yellow; axillar spot and most of disc of scutellum light reddish brown; other red suffused areas on lateral (sometimes hind margin) of pronotum, mesepisternum and upper and lower metapleural plate; posterior margin of meso and metasternum extending laterally to border of coxal articulation (sometimes indistinct), anterior ventral face of fore and mid coxae (hind coxae only distally very narrowly), and all trochanters, elongate marks on anterior face of all femora (interrupted on fore femur) and tibiae, light reddish brown @@ -144,7 +145,7 @@ Distribution Mexico and Central America: ; Panamá ( -Fig. 46 +Fig. 46 ) Remarks diff --git a/data/55/58/D3/5558D340FFC60873FFDCFBFFB5EBFC05.xml b/data/55/58/D3/5558D340FFC60873FFDCFBFFB5EBFC05.xml index 7ca538f67a3..debec52e9bc 100644 --- a/data/55/58/D3/5558D340FFC60873FFDCFBFFB5EBFC05.xml +++ b/data/55/58/D3/5558D340FFC60873FFDCFBFFB5EBFC05.xml @@ -1,44 +1,45 @@ - - - -Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae) + + + +Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae) - - -Author + + +Author -Silveira, Orlando Tobias +Silveira, Orlando Tobias -text - - -Revista Brasileira de Entomologia +text + + +Revista Brasileira de Entomologia - -2019 - -2018-12-11 + +2019 + +2018-12-11 - -63 + +63 - -1 + +1 - -53 -72 + +53 +72 - -http://dx.doi.org/10.1016/j.rbe.2018.11.004 + +http://dx.doi.org/10.1016/j.rbe.2018.11.004 -journal article -10.1016/j.rbe.2018.11.004 -1806-9665 +journal article +10.1016/j.rbe.2018.11.004 +1806-9665 +13196034 - + @@ -52,11 +53,11 @@ ( -Figs. 15d +Figs. 15d ; -21; 22 +21; 22 ; -35 +35 ) @@ -96,9 +97,9 @@ Length of fore wing 10–10.5 mm ; clypeus distinctly wider than high, H/WCLP 0.89, apex narrowly truncate ( -Fig. 35 +Fig. 35 ), clypeus not so extensively in contact with eye, free upper part of lateral margin relatively long, about 0.35 times the clypeus height at middle; malar space narrow; tentorial pit almost as close to eye margin than to antennal socket; oceli as in a nearly equilateral triangle; occiput rounded, carina absent; gena a little narrower than the upper lobe of the eye; pronotum with lateral fovea, central part of the anterior margin of pronotum with the lamella wide and rather raised but not reflexed, region immediately behind produced into a secondary margin which is acute and projecting over the lamella; humeral angle poorly developed, total humeral width nearly equal to that of mesoscutum, sides of the pronotum as seen from above distinctly converging; pronotal carina completely absent at center, poorly salient at sides, not forming true lobes and not at all reflexed, with a very narrow translucent lamellar portion at the extremity, mesoscutum about as long as wide, L/WMS around 1.0, lateral margin adjacent to tegula well demarcated and prominent; fore wing relatively more elongate for this group, LDIS/HMP about 2.50 (see -Fig. 44 +Fig. 44 ); basal inner (posterior side) margin of fore coxa raised and strongly reflexed; inner claw of hind tarsus with the apex narrowly pointed, but not acute; propodeal dorsal cavity shorter and deep, triangular in shape, propodeal valve relatively narrow, shaped as a high triangle, lamellar margin behind distinctly oblique; first segment of metasoma only moderately elongate, its length hardly larger than 1.30× height of mesopleuron, and about 3.30× width at apex, about 2.20× wider at apex than at base, spiracles scarcely prominent. @@ -125,12 +126,12 @@ mm Vestiture: eyes bare; most body parts covered by fine appressed shining pubescence, not so dense to the point of obscuring the pattern of micropunctures underneath; clypeus with sparser erect longer setae especially near apical margin, shorter erect setae also on frons and vertex, setae on pronotum and mesoscutum erect and outstanding; gena beneath with distinctly longer hairs; propodeum dorsolaterally with very long fine hairs with recurved tip. Color (see -Figs. 21; 22 +Figs. 21; 22 ; -35 +35 ): Black on most parts, relatively few areas reddish brown on sides of head, mesosoma and some of metasomal terga and sterna; mandibles reddish, with yellow area near apical teeth and a variably large proximal mark; clypeus reddish to darker brown, except for yellow ventral area close to apical margin (sometimes whole clypeus dark brown); antennal segments 1–2 beneath black; antennal flagellum beneath (or only articles 8–12) reddish; part of subspherical radicle of antennal scape and part of dorsal margin of antennal socket yellow to yellowish brown; diffuse marks on proximal half of femora (gradually connecting to distal yellow counterparts), reddish brown; mid and hind tibiae ventrolaterally light yellowish brown gradually changing to a subapical yellow mark (dorsal surface darker brown), hind tibia distal pad light orange brown; inner orbits to vertex, fusing with the postocellary marks (these sometimes as separate spots), malar space and genal stripe (sometimes interrupted or absent below), mark on pronotum tubercle (sometimes indistinct), pronotal carina and hind margin of pronotum, discal stripes on mesoscutum, part of axillae, anterior transversal stripe on scutellum (sometimes absent), side plates and anterior margin of metanotum; valves (sometimes dark) and two elongate spots on propodeum, large scrobal spot, rather large spot on upper metapleural plate, large posterior area and margin of mesosternum and hind margin of metasternum (in both cases extending to coxal articulation), large spot on apex of fore coxa (almost the distal half), large ventral mark and one dorsolateral stripe on mid coxa, two stripes on hind coxa, distal margin of all trochanters, triple pattern of distal longitudinal marks on fore femur (sometimes obscured), double pattern of distal longitudinal marks on mid and hind femora, narrow posterior distal bands on gastral terga 1–2 (or -3) extending forward at sides, but sometimes indistinct; rather wide areas near distal margin of sterna 2–4 (or -5), yellow; also yellow is most of fore tibia (except for an anterior dorsal dark mark) and all of fore tarsus including claws; mid and hind tarsi with articles 1–4 largely yellowish (only tarsomere 5 entirely dark brown or black); tegula brown with a small posterior yellow spot (sometimes absent); wings hyaline, venation brown. - + Figs. 35–43. 35–38: frontal view of female head (35: @@ -172,7 +173,7 @@ do Jordão, MPEG; 42: (MG, Barroso; MPEG); all scales = 0.50 mm, except Figs. 39 and 42 (= 1.0 mm); scales in figs. (37–38), (40) are estimates. - + Fig. 44. Scattergram of ratio variables for species of the group of @@ -221,7 +222,7 @@ Distribution : Minas Gerais ( -Fig. 47 +Fig. 47 ). Etymology diff --git a/data/55/58/D3/5558D340FFCD087FFFFBF8B7B48EF9DD.xml b/data/55/58/D3/5558D340FFCD087FFFFBF8B7B48EF9DD.xml index fd2c8467b48..9829174f4dc 100644 --- a/data/55/58/D3/5558D340FFCD087FFFFBF8B7B48EF9DD.xml +++ b/data/55/58/D3/5558D340FFCD087FFFFBF8B7B48EF9DD.xml @@ -1,42 +1,43 @@ - - - -Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae) + + + +Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae) - - -Author + + +Author -Silveira, Orlando Tobias +Silveira, Orlando Tobias -text - - -Revista Brasileira de Entomologia +text + + +Revista Brasileira de Entomologia - -2019 - -2018-12-11 + +2019 + +2018-12-11 - -63 + +63 - -1 + +1 - -53 -72 + +53 +72 - -http://dx.doi.org/10.1016/j.rbe.2018.11.004 + +http://dx.doi.org/10.1016/j.rbe.2018.11.004 -journal article -10.1016/j.rbe.2018.11.004 -1806-9665 +journal article +10.1016/j.rbe.2018.11.004 +1806-9665 +13196034 @@ -52,9 +53,9 @@ ( -Figs. 7; 10; 12; 15a; 17 +Figs. 7; 10; 12; 15a; 17 ; -19; 20 +19; 20 ) @@ -163,18 +164,18 @@ by Length of fore wing 8–10.5 mm ; clypeus wider than high, H/WCLP about 0.93 (min–max: 0.88–0.96), apex narrowly truncate, clypeus not so extensively in contact with eye, free upper part of lateral margin relatively long, a little more than 0.3 times the clypeus height at middle; malar space narrow; tentorial pit a little closer to eye margin than to antennal socket; ocelli as in an equilateral triangle; occiput rounded, carina absent; gena just narrower than the upper lobe of the eye; pronotum with lateral fovea, central part of the anterior margin of pronotum with the lamella wide and rather raised but not reflexed, region immediately behind produced into a secondary margin which is acute and projecting over the lamella ( -Figs. 7; 10 +Figs. 7; 10 ); humeral angle poorly developed, total humeral width nearly equal to that of mesoscutum, sides of the pronotum as seen from above distinctly converging; pronotal carina completely absent at center, poorly salient at sides, not forming true lobes and not at all reflexed, with a very narrow translucent lamellar portion at the extremity, mesoscutum about as long as wide, L/WMS around 1.0, lateral margin adjacent to tegula well demarcated and prominent; fore wing comparatively short for this group, LDIS/HMP nearly always below 2.20 (only one of fifteen specimens above this value) (mean 2.12; min–max: 2.00–2.27); basal inner (posterior side) margin of fore coxa raised and strongly reflexed ( -Fig. 12 +Fig. 12 ); inner claw of hind tarsus with the apex narrowly pointed, but not acute; propodeal dorsal cavity comparatively deep and elongate, almost reaching propodeal anterior margin, propodeal valve rather broadly round, lamellar margin behind not distinctly oblique, not conferring to valve a triangular shape; first segment of metasoma very elongate and slender ( -Figs. 19; 20 +Figs. 19; 20 ), its length always larger than 1.3× height of mesopleuron (mean LSI/HMP 1.39; min–max: 1.34–1.50), and nearly always more than 3.30× width at apex (except in two of 15 examined specimens), about 2.12× wider at apex than at base (min–max: 2.00–2.25), spiracles moderate to distinctly prominent ( -Fig. 20 +Fig. 20 ). - + Figs. 19–26. General dorsal and lateral body views (females; all from Brazil). 19–20: @@ -221,7 +222,7 @@ mm Vestiture: eyes bare; most body parts covered by fine appressed shining pubescence, dense to the point of obscuring the pattern of micropunctures underneath; clypeus with sparser erect longer setae especially near apical margin, shorter erect setae also on frons and vertex, setae on pronotum and mesoscutum strongly decumbent and often not outstanding at all; gena beneath with distinctly longer hairs; propodeum dorsolaterally with very long fine hairs with recurved tip. Color (see -Figs. 19 and 20 +Figs. 19 and 20 ): Black, largely suffused with dark reddish brown (but propodeum dorsum distinctly darker, blackish to black); mandibles pitchy red with a yellow longitudinal mark (sometimes indistinct); antennae with segments 3 and 9–12 reddish (to pale yellowish) beneath (but sometimes indistinct); clypeus (except actual ventral margins, black dorsal sides and large discal red brown spot) [sometimes practically whole clypeus brown, leaving only the ventral marginal area yellow], inner orbits to top of eye, antennal segments 1–2 beneath (sometimes indistinct), small spots above and below antennal sockets (sometimes indistinct), malar space and narrow genal stripe (outer orbit) [often interrupted or absent below], two dots behind ocelli, pronotum ventral corner (near fovea) and tubercle [sometimes indistinct], pronotal carina and hind margin of pronotum, pair of discal streaks on mesoscutum (sometimes evanescent), axillae and scutellum except disk, anterior margin of metanotum, valves and two elongate spots on propodeum, scrobal spot (sometimes very small), spot on upper metapleural plate, hind margin of mesosternum (sometimes only around coxal articulation), apex of fore coxa (sometimes indistinct), one dorsolateral stripe on mid coxa, and two stripes on hind coxa, posterior spot at apex of fore femur (sometimes indistinct), distal spots on mid and hind femora, narrow posterior bands on gastral terga 1–2 (or -4) extending forward at sides (sometimes indistinct), on sterna 2–3 (or -4) [but often indistinct], yellow; tibiae and tarsi brown, hind tarsus articles 2–4 blackish; inner side of hind tibia darker before apical pad which is paler; tegula brown; wings hyaline, venation brown. Male @@ -238,7 +239,7 @@ are remarkably homogeneous in color, even when comparing representatives of popu and Rio Grande do Sul . The length of the first metasomal segment, while varying to considerable extent, remains always above a certain lower limit (i.e. larger than 1.30× height of mesopleuron), longer than most of the specimens examined of the remaining species in this group (see -Fig. 44 +Fig. 44 ). Nest @@ -273,7 +274,7 @@ emerged of the cells until 5/iii . Zikán (1949, fig. 381) also presents a photo of a nest of this species, showing an elongated comb with the irregular profile described above, and it has a very eccentric pedicel. -Fig. 17 +Fig. 17 presents two views of a nest from Caraguatatuba ( São Paulo ) which was mentioned in Richards (1978). It has suffered a little damage, but the comb preserves an elongated shape as mentioned in published descriptions. @@ -291,7 +292,7 @@ presents two views of a nest from Caraguatatuba ( ; Rio Grande do Sul (see -Fig. 47 +Fig. 47 ) . @@ -316,7 +317,7 @@ is also undoubtedly correct. All records of this species come from localities in extend the range of this species for nearly 1000 km southward ( -Figs. 46–47 +Figs. 46–47 ). @@ -460,7 +461,7 @@ of O.T. Silveira / Revista Brasileira de Entomologia 63 (2019) 53–72 59 - + Figs. 27–34. General dorsal and lateral body views (females). 27–28: diff --git a/data/55/58/D3/5558D340FFDE086BFCEFF9F9B5EEFA18.xml b/data/55/58/D3/5558D340FFDE086BFCEFF9F9B5EEFA18.xml index 5cf06b578d3..08a314572db 100644 --- a/data/55/58/D3/5558D340FFDE086BFCEFF9F9B5EEFA18.xml +++ b/data/55/58/D3/5558D340FFDE086BFCEFF9F9B5EEFA18.xml @@ -1,42 +1,43 @@ - - - -Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae) + + + +Taxonomic notes on social wasps of the groups of Mischocyttarus wagneri (Buysson 1908) and M. barbatus Richards 1945 (Hymenoptera, Vespidae, Polistinae) - - -Author + + +Author -Silveira, Orlando Tobias +Silveira, Orlando Tobias -text - - -Revista Brasileira de Entomologia +text + + +Revista Brasileira de Entomologia - -2019 - -2018-12-11 + +2019 + +2018-12-11 - -63 + +63 - -1 + +1 - -53 -72 + +53 +72 - -http://dx.doi.org/10.1016/j.rbe.2018.11.004 + +http://dx.doi.org/10.1016/j.rbe.2018.11.004 -journal article -10.1016/j.rbe.2018.11.004 -1806-9665 +journal article +10.1016/j.rbe.2018.11.004 +1806-9665 +13196034 @@ -52,9 +53,9 @@ Zikán 1949 ( -Figs. 33; 34 +Figs. 33; 34 ; -37; 38; 40; 41 +37; 38; 40; 41 ) @@ -96,7 +97,7 @@ Length of fore wing 9.5 mm ; clypeus a little wider than high, H/WCLP about 0.94, apex very narrowly truncate (more rounded in the Bolivian specimen), not so extensively in contact with eye, free upper part of lateral margin relatively long, more than 0.3 times the clypeus height at middle; malar space not so narrow; tentorial pit distinctly closer to eye margin than to antennal socket, the first distance only about 60% of the second; ocelli nearly as in a equilateral triangle, posterior ocelli only slightly more spaced; occiput rounded, carina absent; gena distinctly narrower than the upper lobe of the eye; pronotum with lateral fovea, central part of the anterior margin of pronotum with the lamella not so wide and poorly raised, not at all reflexed, region immediately behind produced into a secondary margin which is fairly acute but does not strongly project itself over the lamella; humeral angle poorly developed and not strongly projecting laterally, total humeral width about equal that of mesoscutum, sides of the pronotum as seen from above distinctly converging; pronotal carina absent at center, and very low at sides having a narrow translucent lamellar portion, mesoscutum about as wide as long, lateral margin adjacent to tegula poorly developed; fore wing relatively well elongate LDIS/HMP ca. 2.3; basal inner (posterior side) margin of fore coxa raised but less reflexed; inner claw of hind tarsus with the apex pointed but not definitely acute; propodeal dorsal cavity considerably deep and wide, developed along ca. two-thirds of length of dorsal face at middle; propodeal valve well developed on top and bottom, uniformly expanded, but rather angular below; first segment of metasoma well elongate, its length more than 1.3× height of mesopleuron (LSI/HMP about 1.4 or slightly more), and distinctly slender, only about 1.86–2.00× wider at apex than at base, spiracles not strongly prominent. - + Fig. 47. Map detail of southeastern South America (with partial view of some Brazilian states) with species distributions for the @@ -118,16 +119,16 @@ Vestiture: (following Richards, 1978) “ Color (see -Figs. 33; 34 +Figs. 33; 34 ; -37; 38 +37; 38 ): Black; most of mandible anteriorly yellow, gradually turning to reddish at apex; antennal articles 9–12 yellowish to light reddish beneath; antennal scape (including radicle) beneath, reddish yellow; clypeus largely (except for large discal area and, sometimes, a narrow area adjacent to upper lateral margin), sometimes diffuse marks on supra-clypeal area, narrow streak adjacent to dorsal margin of antennal socket, malar space and inner orbits to top of ocular sinus, genal stripe (outer orbit), sometimes (nearly continuous to orbital mark) two paired very small dots on vertex by the inner side of eye upper lobe, small mark on pronotum ventral corner, tubercle, carina, and hind margin of pronotum, axillar mark, anterior transversal stripe and side plates of scutellum, anterior transversal stripe and side areas of metanotum, propodeal valves, and paired propodeal posterior dorsal spots (sometimes reduced), one dorsolateral stripe on mid coxa, two dorsal stripes on hind coxae; apical mark on all femora; distal bands on metasomal terga l-3 (-4, somewhat indistinctly), and sterna 2–3 (-4, somewhat indistinctly), yellow (somewhat reddish hue); reddish suffused areas on lateral of pronotum, mesepisternum and upper and lower metapleural plate, and disc of metasomal tergum 2; base of mid and hind femora with a reddish anterior spot ; elongate mark on anterior face of hind tibiae, reddish brown; first article of all tarsi light reddish brown, remaining articles black; tegula light brown; wings hyaline, venation brown. Male (see -Figs. 40; 41 +Figs. 40; 41 ) (largely following Richards, 1978) @@ -158,9 +159,9 @@ from (also in NHM ) ( -Figs. 34 +Figs. 34 ; -38 +38 ). Richards identified this specimen as M. imeldai @@ -177,7 +178,7 @@ near ) and agrees with the holotype female in most characters, except for a somewhat trivial difference in the length of the first metasomal tergum (relatively shorter), and for a small difference in the shape of the apex of the clypeus which seems narrower (compare -Figs. 37 and 38 +Figs. 37 and 38 ) . @@ -189,7 +190,7 @@ Distribution and Bolivia ( -Fig. 46 +Fig. 46 ) Remarks diff --git a/data/9A/75/D4/9A75D465FF8BFF80C344FBBD7ACCFB5E.xml b/data/9A/75/D4/9A75D465FF8BFF80C344FBBD7ACCFB5E.xml new file mode 100644 index 00000000000..a83322eb6f1 --- /dev/null +++ b/data/9A/75/D4/9A75D465FF8BFF80C344FBBD7ACCFB5E.xml @@ -0,0 +1,181 @@ + + + +Eighty-five years awaiting for description: a new species of Tabanus Linnaeus (Diptera: Tabanidae) from the Paraná State, in Brazil + + + +Author + +Carmo, Daniel Dias Dornelas do +Universidade de São Paulo, Faculdade de Filosofia, Ciências e Letras, Departamento de Biologia, Ribeirão Preto, SP, Brasil. +dandorndias@gmail.com + + + +Author + +Henriques, Augusto Loureiro +Instituto Nacional de Pesquisas da Amazônia, Manaus, AM, Brasil. + +text + + +Revista Brasileira de Entomologia + + +2024 + +e 20230091 + + +2024-04-19 + + +68 + + +1 + + +1 +5 + + + + +http://dx.doi.org/10.1590/1806-9665-rbent-2023-0091 + +journal article +10.1590/1806-9665-RBENT-2023-0091 +1806-9665 + + + + + + +Tabanus argentistrigatus +sp.n. + + + + + + + + +Figs. 1 +A-H + + + +urn:lsid:zoobank.org:act: +32B003E4-0750-4832-8B4B-0DDAEB687267 + + + + + +Diagnosis: +The new species differ from the other Neotropical +Tabanus +by the following combination of characters: large size, about +20 mm +, reddish brown integument, with a single prominent middorsal abdominal stripe of golden setulae. Additionally, the wing, including calypters, is yellowish fumose,with a narrow,yellow, nearly indiscernible pterostigma.The flagellum is light yellow with sparse black setulae, basal plate slender, shorter to the same size of style. Frons broad and parallel. + + + + + +Holotype +female ( + +Figs. 1 +A-D, F +): +Length +19 mm +, reddish brown integument. Frons moderately broad (FI = 3.6) and parallel (DI = 1.2), with brown integument covered with yellow pruinosity, white near vertex, and with mixed black and golden setulae. Vertex slightly sunken, with shiny brown area, no vestiges of ocelli. Occiput with mostly golden setulae, a few black near the eye margin. Frontal callus drop shaped, yellowish brown, not touching the eyes margins. Median callus a dorsal extension of the frontal callus, narrow and almost reaching the eye triangle. Subcallus and clypeus yellowish pruinose, gena darker, both clypeus and gena covered with short dark brown setulae. Palpi enlarged at base, yellowish pruinose with black setulae. Both proboscis and stylets shorter than half the head height, prementum yellow, labella dark brown with sparse black setulae and wholly pruinose. Antennae wholly yellow, scape with black setulae. Pedicel with a short spike, not surpassing scape height. Basal plate slender, with similar size to the style. Style with four segments, with short, sparse black setulae, some golden setulae at the apex of the fourth. Mesonotum reddish brown with gray pruinosity and mixed black and golden setulae. Notopleuron concolorous, mostly with black setulae, but some golden dorsally. Scutellum mostly with black setulae, golden at the apex. Pleura light brown, yellow pruinose, mostly with dark brown setulae with a light brown tuft dorsally at anepisternum near to the axillary sclerites. Legs mostly yellowish brown, except by the darker tarsi. All coxae and femora with black setulae. Fore tibia with golden setulae ventrally. Mid and hind tibia with mixed black and golden setulae. Wings including calypters, yellowish fumose, pterostigma yellow, almost inconspicuous. Abdomen very long, nearly twice the length of the mesonotum, reddish brown, with black setulae, golden setulae laterally and on a dorsomedial stripe from segments 1 to 7, paler on the last segments. Sternites with black setulae, with few golden setulae at the middle of segments 1 to 7. + + +Male. +Unknown. + + +Type material. + + +Holotype +female + +: [ +Brazil +]• +Paraná +, +Curityba +( +Sic +), ( +Parolim +) [ +25°27’39”S +, +49°16’02”W +]; XI.938 [1938]; +Coll. Claretiano +; +Tabanus argentistrigatus Fairchild + + +Holotype +[Handwritten]; +MZ01411 + +; +Holótipo +[on lateral] +Tabanus argentistrigatus Carmo & Henriques +[red label]. + +Paratype +: +1♀ +; Same data as holotype; +Tabanus argentistrigatus Fairchild + +Paratype +[Handwritten]; This sp. never published GBF 1959 [On verse, handwritten]; +Parátipo +[on lateral] +Tabanus argentistrigatus Carmo & Henriques +[yellow label]. + + + + +Paratype +variations: + +Length = +18.3 mm +. Frontal index = 3.3. Divergence Index = 1.1. Basal plate broader than +holotype +. +R4 +with a very short appendix + +. + + + + +Etymology. +From Latin,argentum (silver) + strigatus (color band). The name refers to the abdominal stripe with light setulae, contrasting with the brown integument of the specimens.This is the name intended by Fairchild, as indicated by his labels left in the specimens ( +Figs. 1F and G +). Despite observing that the setulae on the abdominal stripe are not silver, we decided to keep the name as intended by Fairchild, since the setulae on the stripe are paler on the last segments. Also, it is possible to see a flash of silver depending to the incidence of light. We decided to keep the name as a way to honoring this researcher, who was the first to recognize the new species, although without describing it. + + + + \ No newline at end of file diff --git a/data/9D/0A/6F/9D0A6F1B0445FFB7FF5DCC73FB1F8AB9.xml b/data/9D/0A/6F/9D0A6F1B0445FFB7FF5DCC73FB1F8AB9.xml index 09aba0c464d..f70ccb60d31 100644 --- a/data/9D/0A/6F/9D0A6F1B0445FFB7FF5DCC73FB1F8AB9.xml +++ b/data/9D/0A/6F/9D0A6F1B0445FFB7FF5DCC73FB1F8AB9.xml @@ -1,63 +1,64 @@ - - - -Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species + + + +Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species - - -Author + + +Author -Gonzalez, Patricia -Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología -mopagon2004@yahoo.com.ar +Gonzalez, Patricia +Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología +mopagon2004@yahoo.com.ar - - -Author + + +Author -Claps, Lucia -Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología +Claps, Lucia +Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología - - -Author + + +Author -Juarez, Andrea -Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología +Juarez, Andrea +Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología -text - - -Revista Brasileira de Entomologia +text + + +Revista Brasileira de Entomologia - -2020 - -e 2018131 + +2020 + +e 2018131 - -2020-03-23 + +2020-03-23 - -64 + +64 - -1 + +1 - -1 -9 + +1 +9 - -http://dx.doi.org/10.1590/1806-9665-rbent-2018-131 + +http://dx.doi.org/10.1590/1806-9665-rbent-2018-131 -journal article -10.1590/1806-9665-RBENT-2018-131 -1806-9665 +journal article +10.1590/1806-9665-RBENT-2018-131 +1806-9665 +13196379 - + @@ -67,7 +68,7 @@ Neotectococcus lenticularis Hempel, 1937 ( -Fig. 4 +Fig. 4 ) diff --git a/data/9D/0A/6F/9D0A6F1B0447FFB4FCAFCD78FD478D58.xml b/data/9D/0A/6F/9D0A6F1B0447FFB4FCAFCD78FD478D58.xml index 2b7edbc73a9..3f52f5cd5a2 100644 --- a/data/9D/0A/6F/9D0A6F1B0447FFB4FCAFCD78FD478D58.xml +++ b/data/9D/0A/6F/9D0A6F1B0447FFB4FCAFCD78FD478D58.xml @@ -1,61 +1,62 @@ - - - -Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species + + + +Review of Brazilian Eriococcidae (Hemiptera: Coccomorpha) with redescription of a Neotectococcus and two Acanthococcus species and description of a new species - - -Author + + +Author -Gonzalez, Patricia -Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología -mopagon2004@yahoo.com.ar +Gonzalez, Patricia +Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología +mopagon2004@yahoo.com.ar - - -Author + + +Author -Claps, Lucia -Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología +Claps, Lucia +Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología - - -Author + + +Author -Juarez, Andrea -Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología +Juarez, Andrea +Universidad Nacional de Tucumán. Facultad de Ciencias Naturales e Instituto Miguel Lillo, Instituto Superior de Entomología -text - - -Revista Brasileira de Entomologia +text + + +Revista Brasileira de Entomologia - -2020 - -e 2018131 + +2020 + +e 2018131 - -2020-03-23 + +2020-03-23 - -64 + +64 - -1 + +1 - -1 -9 + +1 +9 - -http://dx.doi.org/10.1590/1806-9665-rbent-2018-131 + +http://dx.doi.org/10.1590/1806-9665-rbent-2018-131 -journal article -10.1590/1806-9665-RBENT-2018-131 -1806-9665 +journal article +10.1590/1806-9665-RBENT-2018-131 +1806-9665 +13196379 @@ -65,7 +66,7 @@ Acanthococcus papaveroi González, Claps & Juarez sp. nov. ( -Fig 3 +Fig 3 ). @@ -104,7 +105,7 @@ in life. Unknown. - + Figure 3: Acanthococcus papaveroi González, Claps & Juárez diff --git a/data/B8/13/31/B8133161863DFFB0FCD7C5E50282D0CA.xml b/data/B8/13/31/B8133161863DFFB0FCD7C5E50282D0CA.xml new file mode 100644 index 00000000000..1f24f174f8b --- /dev/null +++ b/data/B8/13/31/B8133161863DFFB0FCD7C5E50282D0CA.xml @@ -0,0 +1,241 @@ + + + +Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil + + + +Author + +Araújo, Maíra Xavier +Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil + + + +Author + +Bravo, Freddy +Universidade Estadual de Feira de Santana, Programa de Pós-graduação em Zoologia, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Carvalho, Claudio José Barros de +Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil + +text + + +Revista Brasileira de Entomologia + + +2017 + +2017-04-22 + + +61 + + +3 + + +203 +207 + + + + +http://dx.doi.org/10.1016/j.rbe.2017.04.002 + +journal article +10.1016/j.rbe.2017.04.002 +1806-9665 + + + + + + +Trichomyia lamasi +sp. nov. + + + + + +Diagnosis. Apex of gonocoxites rounded and with bristles. One pair of parameres fused basally and involved by a membranous parameral sheath. Hypoproct pyriform with setulae. + +Description. Male. Head ellipsoidal ( +Fig. 1 +). Antenna incomplete in the studied specimens; scape the same length as subspherical pedicel; flagellomeres pyriform and eccentric ( +Fig. 6 +); ascoids 1.75 times flagellomere length. Palpus formula 1.0:0.5:0.7; 1st segment with sensilla in depressed pit on inner side ( +Fig. 3 +). Wing. R +4+5 +complete at base; r-m present and m-cu absent ( +Fig. 2 +). + + +Male terminalia: Hypandrium fused with gonocoxites, with medial posterior expansion, bifurcate ( +Fig. 9 +), each pair of arm of gonocoxite with rounded apex and elongated bristles along the internal margin ( +Figs. 4, 5, 9 +). Gonostylus elongated and straight in dorsal view. One pair of parameres present, with apical setae, enclosed in a membranous parameral sheath ( +Figs. 7, 8 +). Aedeagus bifid. Ejaculatory apodeme 0.75 times the length of parameres ( +Fig. 9 +). Epandrium trapezoidal and pilose, with some alveoli concentrated at the apicolateral margins. Cercus rounded and pilose. Hypoproct pyriform with setulae and apical micropilosity ( +Fig. 10 +). + + + +Figs. 1–10. + +Trichomyia lamasi + +sp. nov. +1. Head; 2. Left wing; 3. Palpus; 4. Arm of gonocoxite; 5. Male terminalia, lateral; 6. Scape, pedicel and basal flagellomeres; 7. Aedeagus and parameres, dorsal; 8. Parameres, ventral view; 9. Male terminalia, dorsal; 10. Cerci, epandrium and hypropoct (abbreviations: aed = aedeagus, ag = arm of gonocoxite, bri = gonocoxal bridge, cer = cercus, gst = gonostylus, hyp = hypoproct, pm = paramere, she = parameral sheath). + + + + +Figs. 11–19. + +Trichomyia pantanensis + +sp. nov. +11. Head; 12. Left wing; 13. Last flagellomeres, 14. Palpus; 15. Male terminalia, lateral; 16. Parameres and aedeagus; 17. Scape, pedicel and basal flagellomeres; 18. Cerci, epandrium and hypropoct; 19. Male terminalia, dorsal (abbreviations:aed = aedeagus, cer = cercus, gst = gonostylus, hyp = hypoproct, il = internal lobe, pm = paramere). + + + +Material examined. +Brazil +, +Mato Grosso +, Poconé, +15-17.VII.2012 +, +holotype +male, A.M. Silva-Neto leg. (MZFS); +2 paratypes +: + +1 male +, +Mato Grosso +, +Chapada dos Guimarães +, + +5.X.1997 + +, without name of collector. ( +MZSP +) + +; + +1 male +, +Mato Grosso +, +Chapada dos Guimarães +, + +17.XI.1998 + +, without name of collector ( +MZSP +) + +. + + +Etymology. The species is named in honor of Dr. Carlos José Einicker Lamas, curator of +Diptera +in the Museu de Zoologia da Universidade de +São Paulo +, and general coordinator of the SISBIOTA +Diptera +project under which specimens were collected. + + +Distribution. Known from Poconé in the Brazilian state of +Mato Grosso +. + + + + +Remarks. + +Trichomyia lamasi + +sp. nov. +does not have any diagnostic characteristics of the currently named subgenus of + +Trichomyia + +. The species does resemble those identified in the +“truncata +group” described in +Araújo and Bravo (2016) +. The shape of the arm of gonocoxite of + +T. lamasi + +is similar to those in + +T. truncata +Araújo & Bravo, 2016 + +, + +T. manacapurensis +Araújo & Bravo, 2016 + +and + +T. cinthiae +Araújo & Bravo, 2016 + +. However, the gonostylus is more elongate and thinner in + +T. lamasi +. + +On the other hand, the shape of paramere is similar as + +T. nortensis +Araújo & Bravo, 2016 + +(=projections of aedeagal complex, according +Araújo and Bravo, 2016 +), a species not included in the +“truncata +group”. The setulae of the hypoproct, which is one of the diagnostic characters of + +T. lamasi + +, is also found in + +T. manacapurensis + +, + +T. truncata + +and + +T. nortensis + +. + + + + \ No newline at end of file diff --git a/data/B8/13/31/B8133161863EFFB0FCB2C1D70036D272.xml b/data/B8/13/31/B8133161863EFFB0FCB2C1D70036D272.xml new file mode 100644 index 00000000000..0a4fb911eed --- /dev/null +++ b/data/B8/13/31/B8133161863EFFB0FCB2C1D70036D272.xml @@ -0,0 +1,145 @@ + + + +Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil + + + +Author + +Araújo, Maíra Xavier +Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil + + + +Author + +Bravo, Freddy +Universidade Estadual de Feira de Santana, Programa de Pós-graduação em Zoologia, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Carvalho, Claudio José Barros de +Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil + +text + + +Revista Brasileira de Entomologia + + +2017 + +2017-04-22 + + +61 + + +3 + + +203 +207 + + + + +http://dx.doi.org/10.1016/j.rbe.2017.04.002 + +journal article +10.1016/j.rbe.2017.04.002 +1806-9665 + + + + + + + + + +Trichomyia spinicauda +Araújo & Bravo, 2016: 68–69 + + +, fig. 42A–F + + + + + + + +Remarks. +Male + +T. spinicauda + +can be recognized by the medial posterior expansion of hypandrium/gonocoxites, rounded apically; the arm of the gonocoxites with rod-like bristles apically and thick bristles basally; two pairs of parameres and bifid aedeagus. + + + +Material +examined. +Brazil +, +Bahia +, + +Coração +de Maria + +, +holotype +male, + +14.VIII.2002 + +, +F. Bravo +leg. ( +MZFS +) + + + +Other material examined. + +Brazil +, +Mato Grosso +, +Poconé +, +1 male +, + +15–17.VII.2012 + +, +Silva-Neto, A.M. +col. +A.M. Silva-Neto +leg. ( +MZFS +) + +. + + +Distribution. Known from the +type +locality in +Brazil +, state of +Bahia +(Coração de Maria) and state of +Mato Grosso +(Poconé – new record). + + + + \ No newline at end of file diff --git a/data/B8/13/31/B8133161863EFFB0FFC3C19C010DD7E7.xml b/data/B8/13/31/B8133161863EFFB0FFC3C19C010DD7E7.xml new file mode 100644 index 00000000000..8037de895ec --- /dev/null +++ b/data/B8/13/31/B8133161863EFFB0FFC3C19C010DD7E7.xml @@ -0,0 +1,223 @@ + + + +Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil + + + +Author + +Araújo, Maíra Xavier +Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil + + + +Author + +Bravo, Freddy +Universidade Estadual de Feira de Santana, Programa de Pós-graduação em Zoologia, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Carvalho, Claudio José Barros de +Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil + +text + + +Revista Brasileira de Entomologia + + +2017 + +2017-04-22 + + +61 + + +3 + + +203 +207 + + + + +http://dx.doi.org/10.1016/j.rbe.2017.04.002 + +journal article +10.1016/j.rbe.2017.04.002 +1806-9665 + + + + + + +Trichomyia pantanensis +sp. nov. + + + + + +Diagnosis. Palpus four-segmented. Gonocoxite with pilose internal lobe. Gonostylus bifurcated and aedeagus bifid. + +Description. Male. Head subcircular ( +Fig. 11 +). Antenna with subcylindrical scape shorter than subspherical pedicel; flagellomeres pyriform and eccentric ( +Fig. 17 +); 13th flagellomere subcylindrical with terminal apiculus separated by suture ( +Fig. 13 +); ascoids 1.35 times flagellomere length. Palpus four-segmented, with first two segments partially fused; palpus formula 1.0:0.5:0.8:1.5, first and second segment with sensilla in depressed pits on the inner side ( +Fig. 14 +). Wing. Apex of Sc sclerotized; R +4+5 +complete at base; rm and m-cu absent ( +Fig. 12 +). Male terminalia: Hypandrium fused with gonocoxites ( +Fig. 19 +). Gonocoxite projects ventrally with a pilose internal lobe ( +Figs. 15, 19 +). Gonostylus bifurcated apically, slightly sclerotized, articulated to the apex of the gonocoxite, bare, curved and with pointed apices. Aedeagus bifid. One pair of membranous parameres ( +Fig. 19 +). Epandrium wider than long in dorsal view and bare ( +Fig. 18 +). Cercus pilose, abruptly constricted before apex in lateral view ( +Fig. 15 +). Hypoproct with apical micropilosity ( +Fig. 18 +). + + + +Material +examined. +Brazil +, +Mato Grosso +, +Poconé +, + +15–17.VII.2012 + +, +holotype +male, +A.M. Silva-Neto +leg. ( +MZFS +); +7 paratypes male + +, + +same locality, date and collector as +holotype +( +MZSP +); +21 paratype males + +, + +Mato Grosso +, +Barão de Melgaço +, + +7.IV.1998 + +, without name of collector ( +MZFS +); +1 paratype male + +, + +Mato Grosso +, +Barão de Melgaço +, +Pantanal +, + +10.IV.1998 + +, +INPA +R + +.Q., R.N./P.E. legs., without name of collector. + + +Etymology. The epithet + +pantanensis + +refers to the region (the Pantanal) in which the new species commonly occurs. + + +Distribution. Known from Poconé in the Brazilian state, +Mato Grosso +. + + + + +Remarks. + +Trichomyia pantanensis + +is placed in the subgenus + +Opistotrichomyia +Bravo, 2001 + +because it has the palpus four-segmented with the first two partially fused, the gonocoxite projected ventrally with an internal lobe having elongated bristles and gonostylus articulate apically to the gonocoxite. However, its aedeagus is shorter than that of + +T. brevitarsa +(Rapp, 1945) + +and longer than that of + +T. riodocensis +Alexander, Freitas & Quate, 2001 + +. The gonostylus is bifurcated as in + +T. festiva +Bravo, 2001 + +and + +T. riodocensis + +, but the gonostylus of + +T. festiva + +has truncate apex. + +T. fluminensis +Bravo, 2001 + +and + +T. nocturna +Bravo, 2001 + +have not gonostylus bifurcated and the internal lobe is shorter than that of + +T. pantanensis +. + + + + + \ No newline at end of file diff --git a/data/B8/13/31/B8133161863EFFB0FFC3C6F90769D002.xml b/data/B8/13/31/B8133161863EFFB0FFC3C6F90769D002.xml new file mode 100644 index 00000000000..ed8b0f40b93 --- /dev/null +++ b/data/B8/13/31/B8133161863EFFB0FFC3C6F90769D002.xml @@ -0,0 +1,147 @@ + + + +Two new species of Trichomyia Haliday 1839 (Diptera, Psychodidae, Trichomyiinae) from the Pantanal of Mato Grosso, Brazil + + + +Author + +Araújo, Maíra Xavier +Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil + + + +Author + +Bravo, Freddy +Universidade Estadual de Feira de Santana, Programa de Pós-graduação em Zoologia, Departamento de Ciências Biológicas, Feira de Santana, BA, Brazil + + + +Author + +Carvalho, Claudio José Barros de +Universidade Federal do Paraná, Departamento de Zoologia, Laboratório de Biodiversidade e Biogeografia de Diptera, Curitiba, PR, Brazil + +text + + +Revista Brasileira de Entomologia + + +2017 + +2017-04-22 + + +61 + + +3 + + +203 +207 + + + + +http://dx.doi.org/10.1016/j.rbe.2017.04.002 + +journal article +10.1016/j.rbe.2017.04.002 +1806-9665 + + + + + + + + + +Trichomyia hispida +Araújo & Bravo, 2016: 49–50 + + +, Figs. 28A–H + + + + + + + +Remarks. +Males of + +T. hispida + +can be recognized by the few bristles on the posterior arm of the gonocoxites, two pairs of parameres with the first dorsal pair being subtriangular with pointed apex, and the second pair with sharp apex and longer than the dorsal paramere, jointed apically by a ventral parameral sheath. Epandrium subrectangular and cercus bottle-shaped in lateral view with two apical bristles. + + + +Material +examined. +Brazil +, +Bahia +, + +Coração +de Maria + +, + +28.I.2004 + +, +holotype +male, +F. Bravo +leg. ( +MZFS +) + + + +Other material examined. + +Brazil +, +Mato Grosso +, +Chapada dos Guimarães +, + +Vale +da Benção + +, +1 male +, + +15–17.I.2013 + +, leg. +Silva-Neto, A.M. +( +MZFS +) + + + +Distribution. Known from the +type +locality in +Brazil +, state of +Bahia +(Coração de Maria) and state of +Mato Grosso +(Chapada dos Guimarães – new record). + + + + \ No newline at end of file