Add updates up until 2025-02-05 18:22:19

This commit is contained in:
ggserver 2025-02-05 18:28:25 +00:00
parent 0f2d737c66
commit 367ba6bb32
23 changed files with 5455 additions and 291 deletions

View file

@ -0,0 +1,357 @@
<document id="219BAC967FC931C48E1CAFE8E2C8F365" ID-ISSN="0024-4082" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779250452" checkinUser="plazi" docAuthor="Bocxlaer, Bert Van, Strong, Ellen E., Richter, Romy, Stelbrink, Björn &amp; Rintelen, Thomas Von" docDate="2018" docId="039A6736915AFFA8FC8DF8DBFBC491C5" docLanguage="en" docName="zlx014.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Rivularia auriculata" docType="treatment" docVersion="1" lastPageNumber="5" masterDocId="FFA31F4E9158FFACFFD8FFD4FFC19418" masterDocTitle="Anatomical and genetic data reveal that Rivularia Heude, 1890 belongs to Viviparinae (Gastropoda: Viviparidae)" masterLastPageNumber="23" masterPageNumber="1" pageNumber="3" updateTime="1738779347704" updateUser="GgImagineBatch">
<mods:mods id="590B6CDB7E6D16B00228180D512A0E05" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="08001EB5CA70ED38DE19BFB918F24B42">
<mods:title id="244ED305323695089BF5ADC2C2A43D33">Anatomical and genetic data reveal that Rivularia Heude, 1890 belongs to Viviparinae (Gastropoda: Viviparidae)</mods:title>
</mods:titleInfo>
<mods:name id="FA090762774F7260C85CE82F7E8583F4" type="personal">
<mods:role id="46A6B59AA175463D4CFC98AF033BB068">
<mods:roleTerm id="3F522AB51E78AE894BF558D15A71CF73">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="49343BFBA9EC6E3D576B8D0B50D01993">Bocxlaer, Bert Van</mods:namePart>
</mods:name>
<mods:name id="EFF4DF27B812EC4EAE50C3CA425EF2DF" type="personal">
<mods:role id="0A37ED2254A784B87EB3B41E45AD17CB">
<mods:roleTerm id="8704A0E503B2BAFA2D19A5B2E9614B31">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="1229366E376519C647B2C222D0FC1A82">Strong, Ellen E.</mods:namePart>
</mods:name>
<mods:name id="9918E7E25BAE8FD31B660DE47EFA5529" type="personal">
<mods:role id="BCE169414D1B6606D8148D4D8399A470">
<mods:roleTerm id="6936ED504E0E7F5BD087687518F44980">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="1B9BB092328C6F4DA9E1B6F9EE336746">Richter, Romy</mods:namePart>
</mods:name>
<mods:name id="E13C0180880717A03D9AFAD8850B6659" type="personal">
<mods:role id="B4FDBF58F3F2EAD1884637FA0DC3F124">
<mods:roleTerm id="B2BF5323E111A4893EC604181F74BEFC">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="880638E0D8BC45DB8A90E10C0356E4D6">Stelbrink, Björn</mods:namePart>
</mods:name>
<mods:name id="A55548EA9291672BFD34B1C78B2BAAD2" type="personal">
<mods:role id="F7011401DA5B7DFF02572071942EF5CF">
<mods:roleTerm id="575BCE96E9108920F6B25A7F691E2CA7">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="7F597A3BB332B1CF91E39DA82F3320ED">Rintelen, Thomas Von</mods:namePart>
</mods:name>
<mods:typeOfResource id="F62D3660FC0ED4E38013AF186B2CEB2A">text</mods:typeOfResource>
<mods:relatedItem id="6370E3B1B2859321DFC27C4F74BBDB02" type="host">
<mods:titleInfo id="B2CF8FCB39677C2ED73FD3755FF593BC">
<mods:title id="AB627111C28F23CB9C9357287DA32E1B">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="F81094DCD146755F19F68FFD147DC078">
<mods:date id="21BEC4574D9D65E9D00244415EC0FE90">2018</mods:date>
<mods:detail id="A7198EAF4FB738E1B6490CB228A5BA82" type="volume">
<mods:number id="3137D97BEF4AE8A9A1FC733DA5A1F0D7">182</mods:number>
</mods:detail>
<mods:extent id="DF76D277F0C1E79329C6C6F3337BB1A4" unit="page">
<mods:start id="C83F9FFF1EC55A97151436C8CBA4A91B">1</mods:start>
<mods:end id="1794B7DE7C1E233E245AB2D9D456421C">23</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="A7A156623F308A6D67218A2BDC645D94">journal article</mods:classification>
<mods:identifier id="8AAC29C9B581220163E2B9438DCF61C1" type="ISSN">0024-4082</mods:identifier>
</mods:mods>
<treatment id="039A6736915AFFA8FC8DF8DBFBC491C5" LSID="urn:lsid:plazi:treatment:039A6736915AFFA8FC8DF8DBFBC491C5" httpUri="http://treatment.plazi.org/id/039A6736915AFFA8FC8DF8DBFBC491C5" lastPageId="4" lastPageNumber="5" pageId="2" pageNumber="3">
<subSubSection id="C32985AB915AFFAEFC8DF8DBFAA4933F" box="[853,1381,1806,1831]" pageId="2" pageNumber="3" type="nomenclature">
<paragraph id="8B8CD620915AFFAEFC8DF8DBFAA4933F" blockId="2.[853,1381,1806,1831]" box="[853,1381,1806,1831]" pageId="2" pageNumber="3">
<heading id="D0C4614C915AFFAEFC8DF8DBFAA4933F" box="[853,1381,1806,1831]" centered="true" fontSize="9" level="2" pageId="2" pageNumber="3" reason="2">
<taxonomicName id="4C33ADA3915AFFAEFC8DF8DBFAA4933F" ID-CoL="4T7DJ" authority="(VON MARTENS, 1875)" baseAuthorityName="VON MARTENS" baseAuthorityYear="1875" box="[853,1381,1806,1831]" class="Gastropoda" family="Viviparidae" genus="Rivularia" kingdom="Animalia" order="Architaenioglossa" pageId="2" pageNumber="3" phylum="Mollusca" rank="species" species="auriculata">
<emphasis id="B9470A32915AFFAEFC8DF8DBFBA2933E" box="[853,1123,1807,1830]" italics="true" pageId="2" pageNumber="3">
<smallCapsWord id="8D6A40FC915AFFAEFC8DF8DBFC11933E" baselines="1824,1825" box="[853,976,1807,1830]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Rivularia" pageId="2" pageNumber="3">RIVULARIA</smallCapsWord>
<smallCapsWord id="8D6A40FC915AFFAEFC0FF8C6FBA2933E" baselines="1825" box="[983,1123,1810,1830]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="auriculata" pageId="2" pageNumber="3">AURICULATA</smallCapsWord>
</emphasis>
(
<smallCapsWord id="8D6A40FC915AFFAEFBAAF8C6FB60933E" baselines="1825" box="[1138,1185,1810,1830]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="von" pageId="2" pageNumber="3">VON</smallCapsWord>
<smallCapsWord id="8D6A40FC915AFFAEFB70F8DAFAD6933E" baselines="1825,1825" box="[1192,1303,1806,1831]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Martens" pageId="2" pageNumber="3">MARTENS</smallCapsWord>
, 1875)
</taxonomicName>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C32985AB915AFFAFFCF1F8E2FCE79672" lastPageId="3" lastPageNumber="4" pageId="2" pageNumber="3" type="reference_group">
<paragraph id="8B8CD620915AFFAEFCF1F8E2FC179373" blockId="2.[809,1425,1846,1899]" pageId="2" pageNumber="3">
<treatmentCitationGroup id="AB23F10E915AFFAEFCF1F8E2FC179373" pageId="2" pageNumber="3">
<treatmentCitation id="0A92F031915AFFAEFCF1F8E2FC919372" author="von Martens E" page="2" pageId="2" pageNumber="3" year="1875">
<taxonomicName id="4C33ADA3915AFFAEFCF1F8E2FC919372" ID-CoL="4C7N3" authority="von Martens, 1875 a: 2" authorityName="von Martens" authorityPageNumber="2" authorityYear="1875" class="Gastropoda" family="Viviparidae" genus="Paludina" kingdom="Animalia" order="Architaenioglossa" pageId="2" pageNumber="3" phylum="Mollusca" rank="species" species="auriculata" subGenus="Melantho">
<emphasis id="B9470A32915AFFAEFCF1F8E2FB5D9353" box="[809,1180,1846,1867]" italics="true" pageId="2" pageNumber="3">Paludina (Melantho) auriculata</emphasis>
<bibRefCitation id="EFA2ABD1915AFFAEFB7CF8E3FC919372" author="von Martens E" pageId="2" pageNumber="3" pagination="2 - 4" refId="ref15290" refString="von Martens E. 1875 a. Sitzungs-Bericht vom 19. Januar 1875. Sitzungsberichte der Gesellschaft naturforschender Freunde zu Berlin 1875: 2-4." type="journal article" year="1875">von Martens, 1875a: 2</bibRefCitation>
</taxonomicName>
</treatmentCitation>
;
<treatmentCitation id="0A92F031915AFFAEFC84F881FC179373" author="von Martens E" box="[860,982,1877,1899]" page="186" pageId="2" pageNumber="3" year="1875">
<bibRefCitation id="EFA2ABD1915AFFAEFC84F881FC179373" author="von Martens E" box="[860,982,1877,1899]" pageId="2" pageNumber="3" pagination="185 - 188" refId="ref15317" refString="von Martens E. 1875 b. Binnen-mollusken aus dem mittlern China. Malakozoologische Blatter 22: 185-188." type="journal article" year="1875">1875b: 186</bibRefCitation>
</treatmentCitation>
</treatmentCitationGroup>
</paragraph>
<caption id="DF4C86A8915BFFAFFF57FDCEF9DA9628" box="[143,1563,538,560]" pageId="3" pageNumber="4" startId="3.[143,207,538,560]" targetType="table">
<paragraph id="8B8CD620915BFFAFFF57FDCEF9DA9628" blockId="3.[143,1563,538,560]" box="[143,1563,538,560]" pageId="3" pageNumber="4">
<emphasis id="B9470A32915BFFAFFF57FDCEFF289628" bold="true" box="[143,233,538,560]" pageId="3" pageNumber="4">Table 1.</emphasis>
Specimens of
<taxonomicName id="4C33ADA3915BFFAFFE5BFDCEFD9C9628" baseAuthorityName="VON MARTENS" baseAuthorityYear="1875" box="[387,605,538,560]" class="Gastropoda" family="Viviparidae" genus="Rivularia" kingdom="Animalia" order="Architaenioglossa" pageId="3" pageNumber="4" phylum="Mollusca" rank="species" species="auriculata">
<emphasis id="B9470A32915BFFAFFE5BFDCEFD9C9628" box="[387,605,538,560]" italics="true" pageId="3" pageNumber="4">Rivularia auriculata</emphasis>
</taxonomicName>
examined in anatomical studies (all individuals belong to variety a of
<bibRefCitation id="EFA2ABD1915BFFAFFA9DFDCEF9D29628" author="von Martens E" box="[1349,1555,538,560]" pageId="3" pageNumber="4" pagination="185 - 188" refId="ref15317" refString="von Martens E. 1875 b. Binnen-mollusken aus dem mittlern China. Malakozoologische Blatter 22: 185-188." type="journal article" year="1875">von Martens, 1875b</bibRefCitation>
)
</paragraph>
</caption>
<paragraph id="8B8CD620915BFFAFFF57FD80FCE79672" blockId="3.[143,806,596,618]" box="[143,806,596,618]" pageId="3" pageNumber="4">Organ system Specimens examined</paragraph>
</subSubSection>
<subSubSection id="C32985AB915BFFA8FF57FD58FE1D9723" lastPageId="4" lastPageNumber="5" pageId="3" pageNumber="4" type="description">
<paragraph id="8B8CD620915BFFAFFF57FD58F9ED96A7" blockId="3.[143,1836,652,1471]" pageId="3" pageNumber="4">Gross morphology All specimens (116176-1M, 116176-2M, 116176-3F, 116176-4M, 116176-5M, 116176-6F, 116176-7F, 116176-8M, 116176- 9M, 116176-10M, 116176-11M, 192196-1F, 192196-2M, 192196-3F, 192196-4F [BVB, ES, RR])</paragraph>
<paragraph id="8B8CD620915BFFAFFF57FD13FAC296C5" blockId="3.[143,1836,652,1471]" box="[143,1283,711,733]" pageId="3" pageNumber="4">Operculum 116176-3 (RR); 116176-1 (BVB); 116176-6 (BVB); 116176-10 (BVB)</paragraph>
<paragraph id="8B8CD620915BFFAFFF57FD31FADF96E3" blockId="3.[143,1836,652,1471]" box="[143,1310,741,763]" pageId="3" pageNumber="4">Pallial organs (general) 116176-3 (RR); 116176-4 (RR); 116176-7 (BVB, RR); 116176-10 (BVB)</paragraph>
<paragraph id="8B8CD620915BFFAFFF57FCD7F956972E" blockId="3.[143,1836,652,1471]" pageId="3" pageNumber="4">Respiratory system 116176-3 (gill, osphradium [RR]); 116176-4 (gill [BVB]); 116176-5 (gill, gill leaflet [ES]); 116176-7 (gill and osphradium [BVB]); 116176-8 (gill and osphradium [BVB]); 116176-10 (pallial circulatory system; gill leaflet [BVB])</paragraph>
<paragraph id="8B8CD620915BFFAFFF57FCEAFA7A903A" blockId="3.[143,1836,652,1471]" pageId="3" pageNumber="4">Alimentary system 116176-1 (radula [BVB, RR]); 116176-2 (gastric chamber, radula [BVB, RR]; gross morphology visceral alimentary organs [BVB]); 116176-3 (buccal apparatus, exterior and interior, digestive gland, gastric chamber [RR]; style sac, intestine [ES]); 116176-4 (buccal apparatus, exterior and interior, gastric chamber [BVB, RR]; buccal muscles, salivary ducts, radula sac, rectum [BVB]); 116176-5 (gastric chamber, radula [BVB, RR]); 116176-7 (buccal apparatus, exterior and interior [ES, RR]; gastric chamber [RR]; salivary glands [ES]; food groove [BVB]); 116176-8 (general alimentary gross morphology, food groove, buccal apparatus, buccal glands, mid-oesophagus, oesophagus, salivary glands, rectum [BVB]); 116176-10 (digestive gland, gastric chamber [BVB]); 116176-11 (gastric chamber [ES]); 192196-1 (radula [BVB, RR]); 192196-2 (buccal apparatus [RR]; radula [BVB, RR])</paragraph>
<paragraph id="8B8CD620915BFFAFFF57FBFEFB449080" blockId="3.[143,1836,652,1471]" pageId="3" pageNumber="4">Reno-pericardial system 116176-1 (pericardium, rectal blood sinus, kidney, pores, kidney-ureter connection, heart [BVB]); 116176-3 (pericardium [RR]); 116176-5 (kidney, heart [RR]); 116176-7 (pericardium [RR]; kidney [BVB, RR]; ureter, kidney-ureter connection [BVB]); 116176-8 (pericardium, heart, ureter, kidney [BVB]); 116176-10 (pericardium, heart, kidney, circulatory system of the reno-pericardial system, ureter [BVB])</paragraph>
<paragraph id="8B8CD620915BFFAFFF57FB74FB5F90E8" blockId="3.[143,1836,652,1471]" pageId="3" pageNumber="4">
<taxonomicName id="4C33ADA3915BFFAFFF57FB74FEF790AE" box="[143,310,1184,1206]" class="Magsaviricetes" family="Nodaviridae" genus="Nervous" higherTaxonomySource="CoL" kingdom="Orthornavirae" order="Nodamuvirales" pageId="3" pageNumber="4" phylum="Kitrinoviricota" rank="species" species="system">Nervous system</taxonomicName>
116176-4 (nerve ring [BVB, RR]); 116176-7 (nerve ring [ES, RR]; supra- and sub-oesophageal ganglia, visceral ganglion [ES]); 116176-8 (nerve ring and its position compared to the buccal apparatus, buccal ganglia, pedal
<taxonomicName id="4C33ADA3915BFFAFF9A1FB69F8DC90CB" box="[1657,1821,1213,1235]" class="Magsaviricetes" family="Nodaviridae" genus="Nervous" higherTaxonomySource="CoL" kingdom="Orthornavirae" order="Nodamuvirales" pageId="3" pageNumber="4" phylum="Kitrinoviricota" rank="species" species="system">nervous system</taxonomicName>
; supra- and sub-oesophageal ganglea, statocysts [BVB])
</paragraph>
<paragraph id="8B8CD620915BFFAFFF57FB2CFAB4917E" blockId="3.[143,1836,652,1471]" pageId="3" pageNumber="4">Male reproductive system 116176-1 (testis, visceral vas deferens [BVB]); 116176-2 (penis, prostate [RR]); 116176-4 (penis, prostate, pallial vas deferens, testis [BVB, RR]); 116176-5 (general male reproductive anatomy, penis, prostate, proximal pallial vas deferens, testis, visceral vas deferens [RR]); 116176-8 (all pallial reproductive organs [BVB]); 116176-10 (testis [BVB]); 192196-2 (proximal pallial vas deferens, testis, visceral vas deferens [BVB])</paragraph>
<paragraph id="8B8CD620915BFFAFFF57FABAF93391A7" blockId="3.[143,1836,652,1471]" pageId="3" pageNumber="4">Female reproductive system 116176-3 (general female reproductive anatomy [RR, BVB]; juvenile [RR]); 116176-7 (brood pouch, capsule gland, albumen gland, seminal receptacle, renal oviduct [BVB, ES, RR]; visceral oviduct, ovary [BVB, ES]; juvenile [BVB]) 192196-1 (brood pouch, capsule gland, albumen gland, seminal receptacle, renal oviduct, visceral oviduct [BVB])</paragraph>
<paragraph id="8B8CD620915BFFAFFF57FA3CFA789217" blockId="3.[143,1842,1512,1551]" pageId="3" pageNumber="4">Most organ systems were subjected to comparative studies in males and females. Individuals are identified by extending the six digit ZMB museum numbers with unique specimen numbers. On the first row (gross morphology) M or F indicates the sex of each specimen. The investigating author(s) for each organ system are indicated by their initials.</paragraph>
<caption id="DF4C86A8915CFFA8FF49FF10FCEE94C2" box="[145,815,196,218]" pageId="4" pageNumber="5" startId="4.[145,209,196,217]" targetType="table">
<paragraph id="8B8CD620915CFFA8FF49FF10FCEE94C2" blockId="4.[145,815,196,218]" box="[145,815,196,218]" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FF10FF2A94C1" bold="true" box="[145,235,196,217]" pageId="4" pageNumber="5">Table 2.</emphasis>
Primers and PCR conditions used in the present study
</paragraph>
</caption>
<paragraph id="8B8CD620915CFFA8FF49FF2AFA8396BE" pageId="4" pageNumber="5">
<table id="F9332480915C0053FF49FF2AFA5096BE" box="[145,1425,254,678]" gridcols="3" gridrows="12" pageId="4" pageNumber="5">
<tr id="3503D462915C0053FF49FF2AFA50950D" box="[145,1425,254,277]" gridrow="0" pageId="4" pageNumber="5">
<th id="76D2BD1E915C0053FF49FF2AFF38950D" box="[145,249,254,277]" gridcol="0" gridrow="0" pageId="4" pageNumber="5">Gene</th>
<th id="76D2BD1E915C0053FE87FF2AFC18950D" box="[351,985,254,277]" gridcol="1" gridrow="0" pageId="4" pageNumber="5">Primer name Nucleotide sequence (53)</th>
<th id="76D2BD1E915C0053FB98FF2AFA50950D" box="[1088,1425,254,277]" gridcol="2" gridrow="0" pageId="4" pageNumber="5">Source</th>
</tr>
<tr id="3503D462915C0053FF49FEE2FA509554" box="[145,1425,310,332]" gridrow="1" pageId="4" pageNumber="5">
<th id="76D2BD1E915C0053FF49FEE2FF389554" box="[145,249,310,332]" gridcol="0" gridrow="1" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FEE2FF7D9554" box="[145,188,310,332]" italics="true" pageId="4" pageNumber="5">COI</emphasis>
</th>
<td id="76D2BD1E915C0053FE87FEE2FC189554" box="[351,985,310,332]" gridcol="1" gridrow="1" pageId="4" pageNumber="5">LCO1490 GGTCAACAAATCATAAGATATTGG</td>
<td id="76D2BD1E915C0053FB98FEE2FA509554" box="[1088,1425,310,332]" gridcol="2" gridrow="1" pageId="4" pageNumber="5">
<bibRefCitation id="EFA2ABD1915CFFA8FB98FEE2FACA9554" author="Folmer O &amp; Black M &amp; Hoeh W &amp; Lutz R &amp; Vrijenhoek R" box="[1088,1291,310,332]" pageId="4" pageNumber="5" pagination="294 - 299" refId="ref14327" refString="Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299." type="journal article" year="1994">
Folmer
<emphasis id="B9470A32915CFFA8FB48FEE3FB059554" box="[1168,1220,310,332]" italics="true" pageId="4" pageNumber="5">et al.</emphasis>
(1994)
</bibRefCitation>
</td>
</tr>
<tr id="3503D462915C0053FF49FE80FA509572" box="[145,1425,340,362]" gridrow="2" pageId="4" pageNumber="5" rowspan-0="1">
<td id="76D2BD1E915C0053FE87FE80FC189572" box="[351,985,340,362]" gridcol="1" gridrow="2" pageId="4" pageNumber="5">HCO2198var TAWACTTCTGGGTGKCCAAARAAT</td>
<td id="76D2BD1E915C0053FB98FE80FA509572" box="[1088,1425,340,362]" gridcol="2" gridrow="2" pageId="4" pageNumber="5">
<bibRefCitation id="EFA2ABD1915CFFA8FB98FE80FA869572" author="von Rintelen T &amp; Wilson AB &amp; Meyer A &amp; Glaubrecht M" box="[1088,1351,340,362]" pageId="4" pageNumber="5" pagination="2541 - 2549" refId="ref16115" refString="von Rintelen T, Wilson AB, Meyer A, Glaubrecht M. 2004. Escalation and trophic specialization drive adaptive radiation of viviparous freshwater gastropods in the ancient lakes on Sulawesi, Indonesia. Proceedings of the Royal Society of London, Series B 271: 2541-2549." type="journal article" year="2004">
von Rintelen
<emphasis id="B9470A32915CFFA8FB13FE81FB3E9572" box="[1227,1279,340,362]" italics="true" pageId="4" pageNumber="5">et al.</emphasis>
(2004)
</bibRefCitation>
</td>
</tr>
<tr id="3503D462915C0053FF49FEA6FA509590" box="[145,1425,370,392]" gridrow="3" pageId="4" pageNumber="5">
<th id="76D2BD1E915C0053FF49FEA6FF389590" box="[145,249,370,392]" gridcol="0" gridrow="3" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FEA6FF789590" box="[145,185,370,392]" italics="true" pageId="4" pageNumber="5">28S</emphasis>
</th>
<td id="76D2BD1E915C0053FE87FEA6FC189590" box="[351,985,370,392]" gridcol="1" gridrow="3" pageId="4" pageNumber="5">28S-Fmod ACCCGCTGAATTTAAGCATAT</td>
<td id="76D2BD1E915C0053FB98FEA6FA509590" box="[1088,1425,370,392]" gridcol="2" gridrow="3" pageId="4" pageNumber="5">
Modified from
<bibRefCitation id="EFA2ABD1915CFFA8FB01FEA6FA509590" author="Littlewood DTJ" box="[1241,1425,370,392]" pageId="4" pageNumber="5" pagination="221 - 229" refId="ref15205" refString="Littlewood DTJ. 1994. Molecular phylogenetics of cupped oysters based on partial 28 S rRNA gene sequences. Molecular Phylogenetics and Evolution 3: 221-229." type="journal article" year="1994">Littlewood (1994)</bibRefCitation>
</td>
</tr>
<tr id="3503D462915C0053FF49FE44FA5095BE" box="[145,1425,400,422]" gridrow="4" pageId="4" pageNumber="5" rowspan-0="1">
<td id="76D2BD1E915C0053FE87FE44FC1895BE" box="[351,985,400,422]" gridcol="1" gridrow="4" pageId="4" pageNumber="5">28S-Rmod GCTATCCTGACGGAAACTTC</td>
<td id="76D2BD1E915C0053FB98FE44FA5095BE" box="[1088,1425,400,422]" gridcol="2" gridrow="4" pageId="4" pageNumber="5">This study</td>
</tr>
<tr id="3503D462915C0053FF49FE7AFA5095DC" box="[145,1425,430,452]" gridrow="5" pageId="4" pageNumber="5">
<th id="76D2BD1E915C0053FF49FE7AFF3895DC" box="[145,249,430,452]" gridcol="0" gridrow="5" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FE7AFF7095DC" box="[145,177,430,452]" italics="true" pageId="4" pageNumber="5">H3</emphasis>
</th>
<td id="76D2BD1E915C0053FE87FE7AFC1895DC" box="[351,985,430,452]" gridcol="1" gridrow="5" pageId="4" pageNumber="5">H3F ATGGCTCGTACCAAGCAGACVGC</td>
<td id="76D2BD1E915C0053FB98FE7AFA5095DC" box="[1088,1425,430,452]" gridcol="2" gridrow="5" pageId="4" pageNumber="5">
<bibRefCitation id="EFA2ABD1915CFFA8FB98FE7AFA4A95DC" author="Colgan DJ &amp; Ponder WF &amp; Eggler PE" box="[1088,1419,430,452]" pageId="4" pageNumber="5" pagination="29 - 63" refId="ref13989" refString="Colgan DJ, Ponder WF, Eggler PE. 2000. Gastropod evolutionary rates and phylogenetic relationships assessed using partial 28 S rDNA and histone H 3 sequences. Zoologica Scripta 29: 29-63." type="journal article" year="2000">Colgan, Ponder &amp; Eggler (2000)</bibRefCitation>
</td>
</tr>
<tr id="3503D462915C0053FF49FE18FA5095FA" box="[145,1425,460,482]" gridrow="6" pageId="4" pageNumber="5" rowspan-0="1">
<td id="76D2BD1E915C0053FE87FE18FC1895FA" box="[351,985,460,482]" gridcol="1" gridrow="6" pageId="4" pageNumber="5">H3R ATATCCTTRGGCATRATRGTGAC</td>
<td id="76D2BD1E915C0053FB98FE18FA5095FA" box="[1088,1425,460,482]" gridcol="2" gridrow="6" pageId="4" pageNumber="5">
<bibRefCitation id="EFA2ABD1915CFFA8FB98FE18FACA95FA" author="Colgan DJ &amp; Ponder WF &amp; Eggler PE" box="[1088,1291,460,482]" pageId="4" pageNumber="5" pagination="29 - 63" refId="ref13989" refString="Colgan DJ, Ponder WF, Eggler PE. 2000. Gastropod evolutionary rates and phylogenetic relationships assessed using partial 28 S rDNA and histone H 3 sequences. Zoologica Scripta 29: 29-63." type="journal article" year="2000">
Colgan
<emphasis id="B9470A32915CFFA8FB57FE19FB0295FA" box="[1167,1219,460,482]" italics="true" pageId="4" pageNumber="5">et al.</emphasis>
(2000)
</bibRefCitation>
</td>
</tr>
<tr id="3503D462915C0053FF49FDD1FA509603" box="[145,1425,517,539]" gridrow="7" pageId="4" pageNumber="5" rowspan-2="1">
<th id="76D2BD1E915C0053FF49FDD1FF389603" box="[145,249,517,539]" gridcol="0" gridrow="7" pageId="4" pageNumber="5">Fragment</th>
<td id="76D2BD1E915C0053FE87FDD1FC189603" box="[351,985,517,539]" gridcol="1" gridrow="7" pageId="4" pageNumber="5">PCR conditions</td>
</tr>
<tr id="3503D462915C0053FF49FDE3FA509655" box="[145,1425,567,589]" gridrow="8" pageId="4" pageNumber="5">
<th id="76D2BD1E915C0053FF49FDE3FF389655" box="[145,249,567,589]" gridcol="0" gridrow="8" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FDE3FF7D9655" box="[145,188,567,589]" italics="true" pageId="4" pageNumber="5">COI</emphasis>
</th>
<td id="76D2BD1E915C0053FE87FDE3FA509655" box="[351,1425,567,589]" colspan="2" colspanRight="1" gridcol="1" gridrow="8" pageId="4" pageNumber="5">Initial D: 3 min, 94 °C; 35 cycles with D: 30 s, 94 °C; A: 60 s, 40/45 °C; E: 90 s, 72 °C; final E: 5 min.</td>
</tr>
<tr id="3503D462915C0053FF49FD81FA509673" box="[145,1425,597,619]" gridrow="9" pageId="4" pageNumber="5">
<th id="76D2BD1E915C0053FF49FD81FF389673" box="[145,249,597,619]" gridcol="0" gridrow="9" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FD81FF789673" box="[145,185,597,619]" italics="true" pageId="4" pageNumber="5">28S</emphasis>
</th>
<td id="76D2BD1E915C0053FE87FD81FA509673" box="[351,1425,597,619]" colspan="2" colspanRight="1" gridcol="1" gridrow="9" pageId="4" pageNumber="5">Initial D: 3 min, 94 °C; 35 cycles with D: 30 s, 94 °C; A: 60 s, 60-52 °C (1 °C/cycle); E: 120 s, 72 °C; final</td>
</tr>
<tr id="3503D462915C0053FF49FDA6FA509690" box="[145,1425,626,648]" gridrow="10" pageId="4" pageNumber="5" rowspan-0="1" rowspan-2="1">
<td id="76D2BD1E915C0053FE87FDA6FC189690" box="[351,985,626,648]" gridcol="1" gridrow="10" pageId="4" pageNumber="5">E: 5 min.</td>
</tr>
<tr id="3503D462915C0053FF49FD44FA5096BE" box="[145,1425,656,678]" gridrow="11" pageId="4" pageNumber="5">
<th id="76D2BD1E915C0053FF49FD44FF3896BE" box="[145,249,656,678]" gridcol="0" gridrow="11" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FD44FF7096BE" box="[145,177,656,678]" italics="true" pageId="4" pageNumber="5">H3</emphasis>
</th>
<td id="76D2BD1E915C0053FE87FD44FA5096BE" box="[351,1425,656,678]" colspan="2" colspanRight="1" gridcol="1" gridrow="11" pageId="4" pageNumber="5">Initial D: 3 min, 94 °C; 40 cycles with D: 30 s, 94 °C; A: 60 s, 50 °C; E: 60 s, 72 °C; final E: 5 min.</td>
</tr>
</table>
</paragraph>
<paragraph id="8B8CD620915CFFA8FF49FD04FCBA96F9" blockId="4.[145,891,720,737]" box="[145,891,720,737]" pageId="4" pageNumber="5">Abbreviations for PCR conditions: D = denaturation, A = amplification, E = elongation.</paragraph>
<paragraph id="8B8CD620915CFFA8FF49FCD3FE1D9723" blockId="4.[145,761,775,950]" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FCD3FE3D9704" box="[145,508,775,796]" italics="true" pageId="4" pageNumber="5">
<taxonomicName id="4C33ADA3915CFFA8FF49FCD3FEB89704" authorityName="von Martens" authorityYear="1875" box="[145,377,775,796]" class="Gastropoda" family="Viviparidae" genus="Paludina" kingdom="Animalia" order="Architaenioglossa" pageId="4" pageNumber="5" phylum="Mollusca" rank="species" species="auriculata">Paludina auriculata</taxonomicName>
(Melantho)
</emphasis>
<bibRefCitation id="EFA2ABD1915CFFA8FDC0FCD3FD2B9704" author="von Martens E" box="[536,746,775,796]" pageId="4" pageNumber="5" pagination="155 - 156" refId="ref15234" refString="von Martens E. 1870 - 1876. Paludina auriculata (Melantho) Martens. In: Pfeiffer L, ed. Novitates conchologicae. Series Prima - Mollusca extramarina. Descriptions et figures de coquilles extramarines nouvelles ou peu connues. Cassel: Theodore Fischer, 155-156 (+ 1 Plate)." type="book chapter" year="1870">von Martens, 1870</bibRefCitation>
1876: 155, pl. 135, figs 46.
</paragraph>
</subSubSection>
<subSubSection id="C32985AB915CFFA8FF49FC90FEEA97AE" pageId="4" pageNumber="5" type="reference_group">
<paragraph id="8B8CD620915CFFA8FF49FC90FED69761" blockId="4.[145,761,775,950]" pageId="4" pageNumber="5">
<treatmentCitationGroup id="AB23F10E915CFFA8FF49FC90FED69761" pageId="4" pageNumber="5">
<taxonomicName id="4C33ADA3915CFFA8FF49FC90FE4A9741" ID-CoL="7T2QV" authorityName="Heude" authorityYear="1890" box="[145,395,836,857]" class="Gastropoda" family="Viviparidae" genus="Rivularia" kingdom="Animalia" order="Architaenioglossa" pageId="4" pageNumber="5" phylum="Mollusca" rank="species" species="auricularis">
<emphasis id="B9470A32915CFFA8FF49FC90FE4A9741" box="[145,395,836,857]" italics="true" pageId="4" pageNumber="5">Rivularia auricularis</emphasis>
</taxonomicName>
<treatmentCitation id="0A92F031915CFFA8FE71FC90FDB49741" author="Heude PM" box="[425,629,836,858]" page="178" pageId="4" pageNumber="5" year="1890">
<bibRefCitation id="EFA2ABD1915CFFA8FE71FC90FDB49741" author="Heude PM" box="[425,629,836,858]" pageId="4" pageNumber="5" refId="ref14764" refString="Heude PM. 1890. Memoires concernant l'histoire naturelle de l'Empiire Chinois par des Peres de la Compagnie de Jesus. Tome 1. Notes sur les mollusques terrestres de la vallee du Fleuve Bleu. (Published in parts, the relevant section in 1890). Chang-Hai: Mission Catholique." type="book" year="1890">Heude, 1890: 178</bibRefCitation>
</treatmentCitation>
, pl. 40, figs 16 &amp; 16a.
</treatmentCitationGroup>
</paragraph>
<paragraph id="8B8CD620915CFFA8FF49FC55FEEA97AE" blockId="4.[145,761,775,950]" pageId="4" pageNumber="5">
<treatmentCitationGroup id="AB23F10E915CFFA8FF49FC55FEEA97AE" pageId="4" pageNumber="5">
<taxonomicName id="4C33ADA3915CFFA8FF49FC55FE44978E" ID-CoL="4T7DJ" baseAuthorityName="VON MARTENS" baseAuthorityYear="1875" box="[145,389,897,918]" class="Gastropoda" family="Viviparidae" genus="Rivularia" kingdom="Animalia" order="Architaenioglossa" pageId="4" pageNumber="5" phylum="Mollusca" rank="species" species="auriculata">
<emphasis id="B9470A32915CFFA8FF49FC55FE44978E" box="[145,389,897,918]" italics="true" pageId="4" pageNumber="5">Rivularia auriculata</emphasis>
</taxonomicName>
<treatmentCitation id="0A92F031915CFFA8FE7CFC55FDB3978E" author="Kobelt W" box="[420,626,897,919]" page="178" pageId="4" pageNumber="5" year="1909">
<bibRefCitation id="EFA2ABD1915CFFA8FE7CFC55FDB3978E" author="Kobelt W" box="[420,626,897,919]" pageId="4" pageNumber="5" pagination="97 - 430" refId="ref15089" refString="Kobelt W. 1909. Die Gattung Paludina Lam. (Vivipara Montfort) Neue Folge. In: Kuster HC, Kobelt W, eds. Systematisches Conchylien-Cabinet von Martini und Chemnitz, Vol. 1, Nurnberg: Bauer &amp; Raspe; 97-430 (+ 63 plates)." type="book chapter" year="1909">Kobelt, 1909: 178</bibRefCitation>
</treatmentCitation>
, pl. 35, figs 17; 1216.
</treatmentCitationGroup>
</paragraph>
</subSubSection>
<subSubSection id="C32985AB915CFFA8FF49FC3BFBC491C5" pageId="4" pageNumber="5" type="materials_examined">
<paragraph id="8B8CD620915CFFA8FF49FC3BFEFA901E" blockId="4.[145,315,1006,1030]" box="[145,315,1006,1030]" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FC3BFEFA901E" box="[145,315,1006,1030]" italics="true" pageId="4" pageNumber="5">Type material</emphasis>
</paragraph>
<paragraph id="8B8CD620915CFFA8FF49FBC3FD9A9052" blockId="4.[145,760,1047,1099]" pageId="4" pageNumber="5">
<typeStatus id="54886882915CFFA8FF49FBC3FEC39034" box="[145,258,1047,1068]" pageId="4" pageNumber="5" type="lectotype">Lectotype</typeStatus>
ZMB 31048c, here designated (
<figureCitation id="1308CAA5915CFFA8FDABFBC3FD079034" box="[627,710,1047,1069]" captionStart="Figure 2" captionStartId="6.[144,222,1089,1111]" captionTargetBox="[342,1228,195,1049]" captionTargetId="figure-343@6.[342,1228,195,1049]" captionTargetPageId="6" captionText="Figure 2. Specimens of Rivularia auriculata. (A, D) Type specimens from the collection of von Martens (A: Lectotype, here designated, ZMB 31048c; D: paralectotype, ZMB 31048b). (B) ZMB 116176-1, male; (C) ZMB 116176-3, female; (E) USNM 471879 from Pai-Siang, Honan, China (Siang River, Hunan); (F) ZMB 192026 from Nan-ho, Hunan, China. (AC) display von Martens (1875b) variety a, (DF) display variety b." pageId="4" pageNumber="5">Fig. 2A</figureCitation>
);
<specimenCount id="9D351DA9915CFFA8FD05FBC3FEF69053" count="14" pageId="4" pageNumber="5" type="generic" typeStatus="paralectotype">14 paralectotypes</specimenCount>
ZMB 31048a, b (
<figureCitation id="1308CAA5915CFFA8FE21FBE1FD8A9052" box="[505,587,1077,1099]" captionStart="Figure 2" captionStartId="6.[144,222,1089,1111]" captionTargetBox="[342,1228,195,1049]" captionTargetId="figure-343@6.[342,1228,195,1049]" captionTargetPageId="6" captionText="Figure 2. Specimens of Rivularia auriculata. (A, D) Type specimens from the collection of von Martens (A: Lectotype, here designated, ZMB 31048c; D: paralectotype, ZMB 31048b). (B) ZMB 116176-1, male; (C) ZMB 116176-3, female; (E) USNM 471879 from Pai-Siang, Honan, China (Siang River, Hunan); (F) ZMB 192026 from Nan-ho, Hunan, China. (AC) display von Martens (1875b) variety a, (DF) display variety b." pageId="4" pageNumber="5">Fig. 2D</figureCitation>
).
</paragraph>
<paragraph id="8B8CD620915CFFA8FF49FB50FEED9083" blockId="4.[145,300,1155,1179]" box="[145,300,1155,1179]" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FB50FEED9083" box="[145,300,1155,1179]" italics="true" pageId="4" pageNumber="5">Type locality</emphasis>
</paragraph>
<paragraph id="8B8CD620915CFFA8FF49FB78FDA490DA" blockId="4.[145,613,1196,1218]" box="[145,613,1196,1218]" pageId="4" pageNumber="5">
Siangkiang [Xiang] River,
<collectingRegion id="49F718C2915CFFA8FE64FB78FDCC90D9" box="[444,525,1196,1217]" country="China" name="Hunan" pageId="4" pageNumber="5">Hunan</collectingRegion>
,
<collectingCountry id="F32496B0915CFFA8FDC1FB78FDA390DA" box="[537,610,1196,1218]" name="China" pageId="4" pageNumber="5">China</collectingCountry>
.
</paragraph>
<paragraph id="8B8CD620915CFFA8FF49FB2EFE369366" blockId="4.[145,254,1274,1298]" lastBlockId="4.[145,761,1314,1919]" pageId="4" pageNumber="5">
<emphasis id="B9470A32915CFFA8FF49FB2EFF3F910A" box="[145,254,1274,1298]" italics="true" pageId="4" pageNumber="5">Remarks</emphasis>
<bibRefCitation id="EFA2ABD1915CFFA8FF49FAF7FE4B9120" author="von Martens E" box="[145,394,1314,1336]" pageId="4" pageNumber="5" pagination="2 - 4" refId="ref15290" refString="von Martens E. 1875 a. Sitzungs-Bericht vom 19. Januar 1875. Sitzungsberichte der Gesellschaft naturforschender Freunde zu Berlin 1875: 2-4." type="journal article" year="1875">von Martens (1875a)</bibRefCitation>
did not report where the type material had been deposited in the original description; however, ZMB 31048 was part of von Martens collection, was collected by von Richthofen, the collector of the type material and is from the reported type locality. Furthermore, it was split into ZMB 31048a and b, which correspond to the two varieties into which
<bibRefCitation id="EFA2ABD1915CFFA8FECDFA2EFD839217" author="von Martens E" box="[277,578,1529,1551]" pageId="4" pageNumber="5" pagination="185 - 188" refId="ref15317" refString="von Martens E. 1875 b. Binnen-mollusken aus dem mittlern China. Malakozoologische Blatter 22: 185-188." type="journal article" year="1875">von Martens (1875b: 186)</bibRefCitation>
subdivided the species. These lots also contain specimens that seem to have been used for the first illustrations of the species [
<bibRefCitation id="EFA2ABD1915CFFA8FF11F982FE5D9273" author="von Martens E" box="[201,412,1621,1643]" pageId="4" pageNumber="5" pagination="155 - 156" refId="ref15234" refString="von Martens E. 1870 - 1876. Paludina auriculata (Melantho) Martens. In: Pfeiffer L, ed. Novitates conchologicae. Series Prima - Mollusca extramarina. Descriptions et figures de coquilles extramarines nouvelles ou peu connues. Cassel: Theodore Fischer, 155-156 (+ 1 Plate)." type="book chapter" year="1870">von Martens (1870</bibRefCitation>
1876: pl. 135, figs 46);
<bibRefCitation id="EFA2ABD1915CFFA8FD76F981FF139291" author="Heude PM" pageId="4" pageNumber="5" refId="ref14764" refString="Heude PM. 1890. Memoires concernant l'histoire naturelle de l'Empiire Chinois par des Peres de la Compagnie de Jesus. Tome 1. Notes sur les mollusques terrestres de la vallee du Fleuve Bleu. (Published in parts, the relevant section in 1890). Chang-Hai: Mission Catholique." type="book" year="1890">Heude (1890</bibRefCitation>
: pl. 40, figs 16, 16a) and reproduced by
<bibRefCitation id="EFA2ABD1915CFFA8FD73F9A0FF1192B0" author="Kobelt W" pageId="4" pageNumber="5" pagination="97 - 430" refId="ref15089" refString="Kobelt W. 1909. Die Gattung Paludina Lam. (Vivipara Montfort) Neue Folge. In: Kuster HC, Kobelt W, eds. Systematisches Conchylien-Cabinet von Martini und Chemnitz, Vol. 1, Nurnberg: Bauer &amp; Raspe; 97-430 (+ 63 plates)." type="book chapter" year="1909">Kobelt (1909</bibRefCitation>
: pl. 35, fig. 1)]. Furthermore, the measurements reported by von Martens for
<specimenCount id="9D351DA9915CFFA8FE2CF966FD6492DF" box="[500,677,1713,1735]" count="2" pageId="4" pageNumber="5" type="generic">two specimens</specimenCount>
match individuals from lot ZMB 31048a and b. Therefore, the largest specimen reported by von Martens is designated as the
<typeStatus id="54886882915CFFA8FEE6F8D9FE67933B" box="[318,422,1805,1827]" pageId="4" pageNumber="5" type="lectotype">lectotype</typeStatus>
(from variety a;
<figureCitation id="1308CAA5915CFFA8FDB2F8D9FD7C933A" box="[618,701,1805,1827]" captionStart="Figure 2" captionStartId="6.[144,222,1089,1111]" captionTargetBox="[342,1228,195,1049]" captionTargetId="figure-343@6.[342,1228,195,1049]" captionTargetPageId="6" captionText="Figure 2. Specimens of Rivularia auriculata. (A, D) Type specimens from the collection of von Martens (A: Lectotype, here designated, ZMB 31048c; D: paralectotype, ZMB 31048b). (B) ZMB 116176-1, male; (C) ZMB 116176-3, female; (E) USNM 471879 from Pai-Siang, Honan, China (Siang River, Hunan); (F) ZMB 192026 from Nan-ho, Hunan, China. (AC) display von Martens (1875b) variety a, (DF) display variety b." pageId="4" pageNumber="5">Fig. 2A</figureCitation>
) and is numbered ZMB 31048c. ZMB 31048a and b contain 14 additional specimens which then become
<typeStatus id="54886882915CFFA8FD5FF89EFF0F9367" pageId="4" pageNumber="5" type="paralectotype">paralectotypes</typeStatus>
(
<collectionCode id="ED224EE5915CFFA8FF03F8BDFED59366" box="[219,276,1897,1918]" country="Germany" httpUri="http://grbio.org/cool/8syf-d21i" name="Museum für Naturkunde Berlin (Zoological Collections)" pageId="4" pageNumber="5" type="Museum">ZMB</collectionCode>
31048a, b;
<figureCitation id="1308CAA5915CFFA8FE4DF8BDFE299366" box="[405,488,1897,1919]" captionStart="Figure 2" captionStartId="6.[144,222,1089,1111]" captionTargetBox="[342,1228,195,1049]" captionTargetId="figure-343@6.[342,1228,195,1049]" captionTargetPageId="6" captionText="Figure 2. Specimens of Rivularia auriculata. (A, D) Type specimens from the collection of von Martens (A: Lectotype, here designated, ZMB 31048c; D: paralectotype, ZMB 31048b). (B) ZMB 116176-1, male; (C) ZMB 116176-3, female; (E) USNM 471879 from Pai-Siang, Honan, China (Siang River, Hunan); (F) ZMB 192026 from Nan-ho, Hunan, China. (AC) display von Martens (1875b) variety a, (DF) display variety b." pageId="4" pageNumber="5">Fig. 2D</figureCitation>
).
</paragraph>
<paragraph id="8B8CD620915CFFA8FC99FCD3FBCE911E" blockId="4.[809,1426,774,1502]" pageId="4" pageNumber="5">
As mentioned von Martens subdivided
<taxonomicName id="4C33ADA3915CFFA8FAC1FCD3FC969722" baseAuthorityName="VON MARTENS" baseAuthorityYear="1875" class="Gastropoda" family="Viviparidae" genus="Rivularia" kingdom="Animalia" order="Architaenioglossa" pageId="4" pageNumber="5" phylum="Mollusca" rank="species" species="auriculata">
<emphasis id="B9470A32915CFFA8FAC1FCD3FC969722" italics="true" pageId="4" pageNumber="5">R. auriculata</emphasis>
</taxonomicName>
into two varieties: variety a with obsolete spiral sculpture and variety b with distinct spiral sculpture. Under Art. 72.4.1 of the
<emphasis id="B9470A32915CFFA8FB8BFCB6FB4C976F" box="[1107,1165,866,887]" italics="true" pageId="4" pageNumber="5">Code</emphasis>
, reference to distinct varieties could exclude specimens from the type series of a new nominal taxon. As all the specimens known to von Martens at the time were attributed to one of the two varieties, with no nominotypical form, the type series of
<taxonomicName id="4C33ADA3915CFFA8FC15FC28FBAB9009" baseAuthorityName="VON MARTENS" baseAuthorityYear="1875" box="[973,1130,1020,1041]" class="Gastropoda" family="Viviparidae" genus="Rivularia" kingdom="Animalia" order="Architaenioglossa" pageId="4" pageNumber="5" phylum="Mollusca" rank="species" species="auriculata">
<emphasis id="B9470A32915CFFA8FC15FC28FBAB9009" box="[973,1130,1020,1041]" italics="true" pageId="4" pageNumber="5">R. auriculata</emphasis>
</taxonomicName>
comprises all the material mentioned and, hence, is eligible for
<typeStatus id="54886882915CFFA8FB2BFBCEFA9A9028" box="[1267,1371,1050,1072]" pageId="4" pageNumber="5" type="lectotype">lectotype</typeStatus>
designation. The
<typeStatus id="54886882915CFFA8FC13FBEDFBF59057" box="[971,1076,1081,1103]" pageId="4" pageNumber="5" type="lectotype">lectotype</typeStatus>
and
<typeStatus id="54886882915CFFA8FBB7FBEDFACF9057" box="[1135,1294,1081,1103]" pageId="4" pageNumber="5" type="paralectotype">paralectotype</typeStatus>
illustrated here span the morphological variation of the sample (see Shell morphology). Further variations have been described in the literature, as forms (
<bibRefCitation id="EFA2ABD1915CFFA8FB28FB41FA4090B2" author="Smith EA" box="[1264,1409,1173,1195]" pageId="4" pageNumber="5" pagination="157 - 161" refId="ref16474" refString="Smith EA. 1900. A list of a small collection of shells from China. Journal of Malacology 7: 157-161." type="journal article" year="1900">Smith, 1900</bibRefCitation>
), or subspecies (
<bibRefCitation id="EFA2ABD1915CFFA8FC0DFB60FBA890D1" author="Kobelt W" box="[981,1129,1204,1226]" pageId="4" pageNumber="5" pagination="97 - 430" refId="ref15089" refString="Kobelt W. 1909. Die Gattung Paludina Lam. (Vivipara Montfort) Neue Folge. In: Kuster HC, Kobelt W, eds. Systematisches Conchylien-Cabinet von Martini und Chemnitz, Vol. 1, Nurnberg: Bauer &amp; Raspe; 97-430 (+ 63 plates)." type="book chapter" year="1909">Kobelt, 1909</bibRefCitation>
). A number of additional species have also been assigned to
<taxonomicName id="4C33ADA3915CFFA8FB67FB06FAEE90FF" authorityName="Heude" authorityYear="1890" box="[1215,1327,1234,1255]" class="Gastropoda" family="Viviparidae" genus="Rivularia" kingdom="Animalia" order="Architaenioglossa" pageId="4" pageNumber="5" phylum="Mollusca" rank="genus">
<emphasis id="B9470A32915CFFA8FB67FB06FAEE90FF" box="[1215,1327,1234,1255]" italics="true" pageId="4" pageNumber="5">Rivularia</emphasis>
</taxonomicName>
(
<bibRefCitation id="EFA2ABD1915CFFA8FA98FB06FCA0911E" author="Heude PM" pageId="4" pageNumber="5" refId="ref14764" refString="Heude PM. 1890. Memoires concernant l'histoire naturelle de l'Empiire Chinois par des Peres de la Compagnie de Jesus. Tome 1. Notes sur les mollusques terrestres de la vallee du Fleuve Bleu. (Published in parts, the relevant section in 1890). Chang-Hai: Mission Catholique." type="book" year="1890">Heude, 1890</bibRefCitation>
;
<bibRefCitation id="EFA2ABD1915CFFA8FCB6FB25FBC1911E" author="Kobelt W" box="[878,1024,1265,1287]" pageId="4" pageNumber="5" pagination="97 - 430" refId="ref15089" refString="Kobelt W. 1909. Die Gattung Paludina Lam. (Vivipara Montfort) Neue Folge. In: Kuster HC, Kobelt W, eds. Systematisches Conchylien-Cabinet von Martini und Chemnitz, Vol. 1, Nurnberg: Bauer &amp; Raspe; 97-430 (+ 63 plates)." type="book chapter" year="1909">Kobelt, 1909</bibRefCitation>
).
</paragraph>
<paragraph id="8B8CD620915CFFA8FC99FAC4FBC491C5" blockId="4.[809,1426,774,1502]" pageId="4" pageNumber="5">
Because of its characteristic shell morphology,
<taxonomicName id="4C33ADA3915CFFA8FCF1FAFAFC5A915B" authorityName="Heude" authorityYear="1890" box="[809,923,1326,1347]" class="Gastropoda" family="Viviparidae" genus="Rivularia" kingdom="Animalia" order="Architaenioglossa" pageId="4" pageNumber="5" phylum="Mollusca" rank="genus">
<emphasis id="B9470A32915CFFA8FCF1FAFAFC5A915B" box="[809,923,1326,1347]" italics="true" pageId="4" pageNumber="5">Rivularia</emphasis>
</taxonomicName>
is a relatively well-defined genus (
<bibRefCitation id="EFA2ABD1915CFFA8FAE7FAFAFCA0917A" author="Heude PM" pageId="4" pageNumber="5" refId="ref14764" refString="Heude PM. 1890. Memoires concernant l'histoire naturelle de l'Empiire Chinois par des Peres de la Compagnie de Jesus. Tome 1. Notes sur les mollusques terrestres de la vallee du Fleuve Bleu. (Published in parts, the relevant section in 1890). Chang-Hai: Mission Catholique." type="book" year="1890">Heude, 1890</bibRefCitation>
) that has been maintained as distinct by most authors (
<bibRefCitation id="EFA2ABD1915CFFA8FC4FFAB8FBED9199" author="Heude PM" box="[919,1068,1388,1410]" pageId="4" pageNumber="5" refId="ref14764" refString="Heude PM. 1890. Memoires concernant l'histoire naturelle de l'Empiire Chinois par des Peres de la Compagnie de Jesus. Tome 1. Notes sur les mollusques terrestres de la vallee du Fleuve Bleu. (Published in parts, the relevant section in 1890). Chang-Hai: Mission Catholique." type="book" year="1890">Heude, 1890</bibRefCitation>
;
<bibRefCitation id="EFA2ABD1915CFFA8FBE3FAB8FB719199" author="Yen T-C" box="[1083,1200,1388,1409]" pageId="4" pageNumber="5" pagination="124 - 130" refId="ref17087" refString="Yen T-C. 1943. A preliminary revision of the recent species of Chinese Viviparidae. The Nautilus 56: 124-130." type="journal article" year="1943">Yen, 1943</bibRefCitation>
), although assignments to
<taxonomicName id="4C33ADA3915CFFA8FC4AFA5FFC3491B8" box="[914,1013,1419,1440]" class="Gastropoda" family="Viviparidae" genus="Vivipara" kingdom="Animalia" order="Architaenioglossa" pageId="4" pageNumber="5" phylum="Mollusca" rank="genus">
<emphasis id="B9470A32915CFFA8FC4AFA5FFC3491B8" box="[914,1013,1419,1440]" italics="true" pageId="4" pageNumber="5">Vivipara</emphasis>
</taxonomicName>
,
<taxonomicName id="4C33ADA3915CFFA8FBD9FA5EFBAB9187" box="[1025,1130,1418,1439]" class="Gastropoda" family="Viviparidae" genus="Paludina" kingdom="Animalia" order="Architaenioglossa" pageId="4" pageNumber="5" phylum="Mollusca" rank="genus">
<emphasis id="B9470A32915CFFA8FBD9FA5EFBAB9187" box="[1025,1130,1418,1439]" italics="true" pageId="4" pageNumber="5">Paludina</emphasis>
</taxonomicName>
and other taxa were commonplace in the early literature (
<bibRefCitation id="EFA2ABD1915CFFA8FB44FA7DFCA191C5" author="Bachmann O &amp; Gredler V" pageId="4" pageNumber="5" pagination="415 - 429" refId="ref13557" refString="Bachmann O, Gredler V. 1894. Zur Conchylienfauna von China. Annalen des Naturhistorischen Museums in Wien 9: 415-429." type="book chapter" year="1894">Bachmann &amp; Gredler, 1894</bibRefCitation>
;
<bibRefCitation id="EFA2ABD1915CFFA8FCB4FA1CFC3791C5" author="Smith EA" box="[876,1014,1480,1502]" pageId="4" pageNumber="5" pagination="157 - 161" refId="ref16474" refString="Smith EA. 1900. A list of a small collection of shells from China. Journal of Malacology 7: 157-161." type="journal article" year="1900">Smith, 1900</bibRefCitation>
).
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,88 @@
<document id="B2F70666F17451231987701304D64075" ID-ISSN="0024-4082" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779250452" checkinUser="plazi" docAuthor="Bocxlaer, Bert Van, Strong, Ellen E., Richter, Romy, Stelbrink, Björn &amp; Rintelen, Thomas Von" docDate="2018" docId="039A6736915AFFAEFC79F9BFFA8892D1" docLanguage="en" docName="zlx014.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Rivularia Heude 1890" docType="treatment" docVersion="2" lastPageNumber="3" masterDocId="FFA31F4E9158FFACFFD8FFD4FFC19418" masterDocTitle="Anatomical and genetic data reveal that Rivularia Heude, 1890 belongs to Viviparinae (Gastropoda: Viviparidae)" masterLastPageNumber="23" masterPageNumber="1" pageNumber="3" updateTime="1738779656809" updateUser="ExternalLinkService">
<mods:mods id="6804B853282D2F84B0285BEE5BABBAF1" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="ECA0C01F2A62E353CA2A2EB93E3A9386">
<mods:title id="52F1B3D15D4892FC99D145B7DB138582">Anatomical and genetic data reveal that Rivularia Heude, 1890 belongs to Viviparinae (Gastropoda: Viviparidae)</mods:title>
</mods:titleInfo>
<mods:name id="F55AB234067B604EE5C1B6075F0CF773" type="personal">
<mods:role id="80347FC8100D3A73BD132BD295A2ABA4">
<mods:roleTerm id="8FF1A6329E5B202F77F3D7795A58F607">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="A7BA3CBAF6937EB4DD57977E0FCC390E">Bocxlaer, Bert Van</mods:namePart>
</mods:name>
<mods:name id="178E72C05A1FB5DA0D91E42F8A474B53" type="personal">
<mods:role id="646C6F4208866E9A40CDE046FCF1101A">
<mods:roleTerm id="E8169AEC8E675D087FBF581F81F7FD00">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="A96EF42EE5933B3C3C0E671FC7437F66">Strong, Ellen E.</mods:namePart>
</mods:name>
<mods:name id="E1839F63AF7C46D8154BF16C42A43470" type="personal">
<mods:role id="3CCD7F0800764F23266F1E2F1174AEA9">
<mods:roleTerm id="AB2A4282C77F6DE6EF3F84DA51261497">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="7CA103FDDB91D9804C0CCE3C4F443BDA">Richter, Romy</mods:namePart>
</mods:name>
<mods:name id="9BF940571CADDAE2F5A3206B68C704A1" type="personal">
<mods:role id="F3A7AE2EE420D667B280CAB2D1DAA190">
<mods:roleTerm id="6CA93B7B34BB82B2B9714D20C8662858">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="824A435BB8F8DD12C55A055CE4FB3FAB">Stelbrink, Björn</mods:namePart>
</mods:name>
<mods:name id="18E4DFD9A243271000C080DD56F6FF4B" type="personal">
<mods:role id="212315FDE9E43D213F3EB2B4DA051F46">
<mods:roleTerm id="945C7C534946E2AFF22311711C4963C3">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="81EEE6BD7C8D33E3E4C0EFE51DD2CADE">Rintelen, Thomas Von</mods:namePart>
</mods:name>
<mods:typeOfResource id="38DA944B07C149E8143C39C2CB336270">text</mods:typeOfResource>
<mods:relatedItem id="13EF5652C3FB42A0E5ED1B5FB65DD3D0" type="host">
<mods:titleInfo id="12402A19EF5948E69681021B5A05A3E3">
<mods:title id="30CDC8C257AAEEECFB8DD122C549DE0B">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="6D7CC3557D16285498361CA3E65460C6">
<mods:date id="76E3DB04373075F89519BBA0EC304B11">2018</mods:date>
<mods:detail id="4F7468157C386199629E06F6611619DD" type="volume">
<mods:number id="9605CC0E677A3BE8AC60AA47AFD2DD33">182</mods:number>
</mods:detail>
<mods:extent id="B8DF1E0681182B8ECB5901DCC01D8CC7" unit="page">
<mods:start id="13B27A40969C003513E79EAE370AEC1B">1</mods:start>
<mods:end id="DC1EA06A2928E8BA33FEB02DB1D29E83">23</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="CBC4D6329331200354F6C16C02A7038F">journal article</mods:classification>
<mods:identifier id="A9F855FB8CFBE018DBE36DD6105C34BF" type="ISSN">0024-4082</mods:identifier>
</mods:mods>
<treatment id="039A6736915AFFAEFC79F9BFFA8892D1" ID-DOI="http://doi.org/10.5281/zenodo.14812568" ID-Zenodo-Dep="14812568" LSID="urn:lsid:plazi:treatment:039A6736915AFFAEFC79F9BFFA8892D1" httpUri="http://treatment.plazi.org/id/039A6736915AFFAEFC79F9BFFA8892D1" lastPageNumber="3" pageId="2" pageNumber="3">
<subSubSection id="C32985AB915AFFAEFC79F9BFFAD3929C" box="[929,1298,1643,1668]" pageId="2" pageNumber="3" type="nomenclature">
<paragraph id="8B8CD620915AFFAEFC79F9BFFAD3929C" blockId="2.[929,1298,1643,1668]" box="[929,1298,1643,1668]" pageId="2" pageNumber="3">
<heading id="D0C4614C915AFFAEFC79F9BFFAD3929C" box="[929,1298,1643,1668]" centered="true" fontSize="9" level="2" pageId="2" pageNumber="3" reason="2">
<smallCapsWord id="8D6A40FC915AFFAEFC79F9BFFC30929B" baselines="1662,1662" box="[929,1009,1643,1668]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Genus" pageId="2" pageNumber="3">GENUS</smallCapsWord>
<taxonomicName id="4C33ADA3915AFFAEFC21F9B8FAD3929C" ID-CoL="7PFVR" authority="HEUDE, 1890" authorityName="Heude" authorityYear="1890" box="[1017,1298,1643,1668]" class="Gastropoda" family="Viviparidae" genus="Rivularia" kingdom="Animalia" order="Architaenioglossa" pageId="2" pageNumber="3" phylum="Mollusca" rank="genus">
<smallCapsWord id="8D6A40FC915AFFAEFC21F9B8FBB2929B" baselines="1661,1662" box="[1017,1139,1644,1667]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Rivularia" pageId="2" pageNumber="3">
<emphasis id="B9470A32915AFFAEFC21F9B8FBB2929B" box="[1017,1139,1644,1667]" italics="true" pageId="2" pageNumber="3">RIVULARIA</emphasis>
</smallCapsWord>
<bibRefCitation id="EFA2ABD1915AFFAEFBA3F9BFFAD3929C" author="Heude PM" box="[1147,1298,1643,1668]" pageId="2" pageNumber="3" refId="ref14764" refString="Heude PM. 1890. Memoires concernant l'histoire naturelle de l'Empiire Chinois par des Peres de la Compagnie de Jesus. Tome 1. Notes sur les mollusques terrestres de la vallee du Fleuve Bleu. (Published in parts, the relevant section in 1890). Chang-Hai: Mission Catholique." type="book" year="1890">
<smallCapsWord id="8D6A40FC915AFFAEFBA3F9BFFB0F929B" baselines="1662,1662" box="[1147,1230,1643,1668]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Heude" pageId="2" pageNumber="3">HEUDE</smallCapsWord>
, 1890
</bibRefCitation>
</taxonomicName>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C32985AB915AFFAEFCF1F940FA8892D1" pageId="2" pageNumber="3" type="materials_examined">
<paragraph id="8B8CD620915AFFAEFCF1F940FA8892D1" blockId="2.[809,1358,1684,1738]" pageId="2" pageNumber="3">
<emphasis id="B9470A32915AFFAEFCF1F940FC0592B3" box="[809,964,1684,1707]" italics="true" pageId="2" pageNumber="3">
<typeStatus id="54886882915AFFAEFCF1F940FCA392B3" box="[809,866,1684,1707]" pageId="2" pageNumber="3">Type</typeStatus>
species:
</emphasis>
<taxonomicName id="4C33ADA3915AFFAEFC13F941FCA392D2" authority="von Martens, 1875" authorityName="von Martens" authorityYear="1875" class="Gastropoda" family="Viviparidae" genus="Paludina" kingdom="Animalia" order="Architaenioglossa" pageId="2" pageNumber="3" phylum="Mollusca" rank="species" species="auriculata">
<emphasis id="B9470A32915AFFAEFC13F941FB7292B2" box="[971,1203,1685,1706]" italics="true" pageId="2" pageNumber="3">Paludina auriculata</emphasis>
von Martens, 1875
</taxonomicName>
, by subsequent designation (
<bibRefCitation id="EFA2ABD1915AFFAEFB72F960FAFB92D1" author="Crosse H" box="[1194,1338,1716,1737]" pageId="2" pageNumber="3" pagination="380 - 383" refId="ref14051" refString="Crosse H. 1891. Memoires concernant l'histoire naturelle de l'Empire Chinois, par des Peres de la Compagnie de Jesus - Notes sur les mollusques terrestres de la valee du Fleuve Bleu. Par le R. P. M. Heude. Journal de Conchyliologie 38: 380-383." type="journal article" year="1891">Crosse, 1891</bibRefCitation>
).
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,392 @@
<document id="A845BC18098C53AACBE718C4E3BF2175" ID-ISSN="0024-4082" ID-ZooBank="B2DCFB0-BF1A-47A1-911C-726876890892" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779474141" checkinUser="plazi" docAuthor="Riva, Ignacio De La, Chaparro, Juan C., Castroviejo-Fisher, Santiago &amp; Padial, José M." docDate="2018" docId="03AD2972A941FFF7FC010FA9F6E7B18E" docLanguage="en" docName="zlx020.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Microkayla chilina Riva, Chaparro, Castroviejo-Fisher &amp; Padial, 2018, SP. NOV." docType="treatment" docVersion="1" lastPageNumber="154" masterDocId="FF94510AA956FFEEFFB90E47F51DB73A" masterDocTitle="Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)" masterLastPageNumber="172" masterPageNumber="129" pageNumber="152" updateTime="1738779668666" updateUser="GgImagineBatch">
<mods:mods id="37DAFEF33BF83DC6DEEFDFA96EAE7964" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="9645A3BC6320ACE929197BD5DC63635E">
<mods:title id="8303E831CDCEBA02F0E912018E148512">Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)</mods:title>
</mods:titleInfo>
<mods:name id="EE064F4A83973DE2C704454D5246004A" type="personal">
<mods:role id="948A778F851838329FE0F0730BCF646D">
<mods:roleTerm id="5AB1FE2BEED316464E090A611F83AD2A">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="17304DB0F0EE1874FAA761424443861C">Riva, Ignacio De La</mods:namePart>
</mods:name>
<mods:name id="415C7197DB4B78EB695F753832A47378" type="personal">
<mods:role id="D55749F232ACA32CABE3E2487A7DB01B">
<mods:roleTerm id="CD33C4E5E0EEBFAE689C773C75F08982">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="C14915D017801345FF5A4D79EAD3C28B">Chaparro, Juan C.</mods:namePart>
</mods:name>
<mods:name id="9D1A3C44689D3657A5FDF4106C900DFB" type="personal">
<mods:role id="D9758F2FF109F3F80E6C0688F9CF023C">
<mods:roleTerm id="57BF6AD32932B57C465F5628A28CFFC4">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="CD9592801A11BB1348C922B83C736405">Castroviejo-Fisher, Santiago</mods:namePart>
</mods:name>
<mods:name id="AB2051193F24067427EABE0A4C930B05" type="personal">
<mods:role id="89D7E5D85456C8C9CE555BC656CF91D4">
<mods:roleTerm id="7C8A54EDABB9593F1471BD30B49C0487">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="0CED45DD6C6436024F43DF03EDECA28C">Padial, José M.</mods:namePart>
</mods:name>
<mods:typeOfResource id="4E0333B848D055808C88CD8A505E2C4E">text</mods:typeOfResource>
<mods:relatedItem id="2E18D59FD08D1A34676649882A0DBDA4" type="host">
<mods:titleInfo id="1E32501D7E388F6DC04AF6AD9E999077">
<mods:title id="3826725407E931B6A9AD629686402389">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="47B5FC0845A569D58AD751A1282C2964">
<mods:date id="7E63ABF736740DA3D0E06511EA4253C5">2018</mods:date>
<mods:detail id="24EBA01D4A31AE1585845C4C4211881D" type="volume">
<mods:number id="507E63C71B38363BCA87E9284BC049E7">182</mods:number>
</mods:detail>
<mods:extent id="7D34E1903076632287C04D936D153001" unit="page">
<mods:start id="F26151B63594E8C79109BF1A53E10A36">129</mods:start>
<mods:end id="00A6275C5436AC9028A9DB09707EF4B5">172</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="7D01F1ABFE8B5A0109FC4C27C62BF71F">journal article</mods:classification>
<mods:identifier id="57301FE0889FBA99175E21568C6BF55A" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="CD1E99B96335A6075DB03A99A5B7A86E" type="ZooBank">B2DCFB0-BF1A-47A1-911C-726876890892</mods:identifier>
</mods:mods>
<treatment id="03AD2972A941FFF7FC010FA9F6E7B18E" LSID="urn:lsid:plazi:treatment:03AD2972A941FFF7FC010FA9F6E7B18E" httpUri="http://treatment.plazi.org/id/03AD2972A941FFF7FC010FA9F6E7B18E" lastPageId="25" lastPageNumber="154" pageId="23" pageNumber="152">
<subSubSection id="C31ECBEFA941FFF9FC010FA9F038B53C" box="[952,1317,494,518]" pageId="23" pageNumber="152" type="nomenclature">
<paragraph id="8BBB9864A941FFF9FC010FA9F038B53C" blockId="23.[952,1317,494,518]" box="[952,1317,494,518]" pageId="23" pageNumber="152">
<heading id="D0F32F08A941FFF9FC010FA9F038B53C" box="[952,1317,494,518]" centered="true" fontSize="9" level="2" pageId="23" pageNumber="152" reason="2">
<taxonomicName id="4C04E3E7A941FFF9FC010FA9F1A1B53F" ID-CoL="42XF2" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[952,1212,494,517]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="23" pageNumber="152" phylum="Chordata" rank="species" species="chilina" status="sp. nov.">
<smallCapsWord id="8D5D0EB8A941FFF9FC010FA9F14FB53F" baselines="511,512" box="[952,1106,494,517]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Microkayla" pageId="23" pageNumber="152">MICROKAYLA</smallCapsWord>
<smallCapsWord id="8D5D0EB8A941FFF9FBE30FB5F1A1B53F" baselines="512" box="[1114,1212,498,517]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="chilina" pageId="23" pageNumber="152">CHILINA</smallCapsWord>
</taxonomicName>
<emphasis id="B9704476A941FFF9FB7B0FB6F038B53C" bold="true" box="[1218,1317,494,518]" pageId="23" pageNumber="152">
<taxonomicNameLabel id="A243F90DA941FFF9FB7B0FB6F038B53C" box="[1218,1317,494,518]" pageId="23" pageNumber="152" rank="species">
<smallCapsWord id="8D5D0EB8A941FFF9FB7B0FB6F1C2B53E" baselines="511" box="[1218,1247,497,516]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="sp" pageId="23" pageNumber="152">SP</smallCapsWord>
.
<smallCapsWord id="8D5D0EB8A941FFF9FB540FB6F003B53E" baselines="511" box="[1261,1310,497,516]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="nov" pageId="23" pageNumber="152">NOV</smallCapsWord>
.
</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C31ECBEFA941FFF7FB840C52F6E7B18E" lastPageId="25" lastPageNumber="154" pageId="23" pageNumber="152" type="description">
<paragraph id="8BBB9864A941FFF9FB840C52F1BDB514" blockId="23.[1085,1184,533,558]" box="[1085,1184,533,558]" pageId="23" pageNumber="152">
(
<figureCitation id="133F84E1A941FFF9FBFF0C52F185B514" box="[1094,1176,533,558]" captionStart="Figure 13" captionStartId="24.[146,225,877,899]" captionTargetBox="[305,1265,195,837]" captionTargetId="figure-527@24.[305,1265,195,837]" captionTargetPageId="24" captionText="Figure 13. Live specimens of Microkayla chilina sp. nov. from the confluence of rivers Sayaco and Huacuyo, Sandia, Peru. (A) Adult female (MUBI 5351; SVL 24.3 mm); (B) Adult male holotype (MUBI 5355, SVL 24.3 mm). (CD) Adult male (MNCN 43775, SVL 23.6 mm) from the type locality." pageId="23" pageNumber="152">
<smallCapsWord id="8D5D0EB8A941FFF9FBFF0C52F173B516" baselines="552,551" box="[1094,1134,533,558]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Fig" pageId="23" pageNumber="152">FIG</smallCapsWord>
. 13
</figureCitation>
)
</paragraph>
<paragraph id="8BBB9864A941FFF9FC820C79F080B548" blockId="23.[827,1443,573,626]" pageId="23" pageNumber="152">
u r n: l s i d: z o o b a n k. org:act:
<uuid id="FFA2A2B1A941FFF9FC300C1BF080B548" box="[905,1437,604,626]" pageId="23" pageNumber="152">95C71601-FCC2-46A9-9A9B-6E7DDEB9B340</uuid>
</paragraph>
<paragraph id="8BBB9864A941FFF9FC820CDDF1D3B470" blockId="23.[827,1443,666,842]" pageId="23" pageNumber="152">
<materialsCitation id="3B6C9239A941FFF9FC820CDDF1D3B470" collectingDate="2006-02-14" collectionCode="MUBI" collectorName="I. De la Riva &amp; J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro &amp; J. Bosch." country="Peru" county="De la Riva" elevation="3792" latitude="-14.445056" location="Sayaco" longLatPrecision="1" longitude="-69.56986" municipality="Sandia" pageId="23" pageNumber="152" specimenCode="MUBI 5355" specimenCount="1" stateProvince="Puno" typeStatus="holotype">
<emphasis id="B9704476A941FFF9FC820CDDF682B595" box="[827,927,666,687]" italics="true" pageId="23" pageNumber="152">
<typeStatus id="54BF26C6A941FFF9FC820CDDF682B595" box="[827,927,666,687]" pageId="23" pageNumber="152" type="holotype">Holotype</typeStatus>
</emphasis>
:
<specimenCode id="DBA2301FA941FFF9FC150CDCF12CB58A" box="[940,1073,666,688]" collectionCode="MUBI" pageId="23" pageNumber="152">MUBI 5355</specimenCode>
(field number 4580), adult male from the joint of rivers
<location id="8EDBCEBFA941FFF9FBE30CFEF1B0B5F4" LSID="urn:lsid:plazi:treatment:03AD2972A941FFF7FC010FA9F6E7B18E:8EDBCEBFA941FFF9FBE30CFEF1B0B5F4" box="[1114,1197,697,718]" country="Peru" county="De la Riva" latitude="-14.445056" longLatPrecision="1" longitude="-69.56986" municipality="Sandia" name="Sayaco" pageId="23" pageNumber="152" stateProvince="Puno">Sayaco</location>
and
<location id="8EDBCEBFA941FFF9FB550CFDF04AB5F5" LSID="urn:lsid:plazi:treatment:03AD2972A941FFF7FC010FA9F6E7B18E:8EDBCEBFA941FFF9FB550CFDF04AB5F5" box="[1260,1367,698,719]" country="Peru" county="De la Riva" latitude="-14.445056" longLatPrecision="1" longitude="-69.56986" municipality="Sandia" name="Huacuyo" pageId="23" pageNumber="152" stateProvince="Puno">Huacuyo</location>
, province
<collectingMunicipality id="6BDF021EA941FFF9FCCC0C9FF6D6B5D4" box="[885,971,728,750]" pageId="23" pageNumber="152">Sandia</collectingMunicipality>
, department
<collectingRegion id="49C05686A941FFF9FBD60C9FF1B3B5D7" box="[1135,1198,728,749]" country="Peru" name="Puno" pageId="23" pageNumber="152">Puno</collectingRegion>
,
<collectingCountry id="F313D8F4A941FFF9FB050C9FF1EBB5D7" box="[1212,1270,728,749]" name="Peru" pageId="23" pageNumber="152">Peru</collectingCountry>
,
<geoCoordinate id="EE30FEA3A941FFF9FABD0C9FF083B5D7" box="[1284,1438,727,750]" degrees="14" direction="south" minutes="26" orientation="latitude" pageId="23" pageNumber="152" precision="1" seconds="42.2" value="-14.445056">
14°26
<emphasis id="B9704476A941FFF9FAF00C90F052B5D4" box="[1353,1359,727,750]" italics="true" pageId="23" pageNumber="152"></emphasis>
42.2
<emphasis id="B9704476A941FFF9FA3A0C90F090B5D4" box="[1411,1421,727,750]" italics="true" pageId="23" pageNumber="152"></emphasis>
S
</geoCoordinate>
,
<geoCoordinate id="EE30FEA3A941FFF9FC820CB1F6C9B436" box="[827,980,757,780]" degrees="69" direction="west" minutes="34" orientation="longitude" pageId="23" pageNumber="152" precision="1" seconds="11.5" value="-69.56986">
69°34
<emphasis id="B9704476A941FFF9FCC20CB2F69CB436" box="[891,897,757,780]" italics="true" pageId="23" pageNumber="152"></emphasis>
11.5
<emphasis id="B9704476A941FFF9FC0B0CB2F6A1B436" box="[946,956,757,780]" italics="true" pageId="23" pageNumber="152"></emphasis>
W
</geoCoordinate>
,
<quantity id="4CFC3581A941FFF9FC620CB0F131B436" box="[987,1068,759,780]" metricMagnitude="3" metricUnit="m" metricValue="3.792" pageId="23" pageNumber="152" unit="m" value="3792.0">
<elevation id="00297F57A941FFF9FC620CB0F131B436" box="[987,1068,759,780]" metricMagnitude="3" metricUnit="m" metricValue="3.792" pageId="23" pageNumber="152" unit="m" value="3792.0">3792 m</elevation>
</quantity>
(
<figureCitation id="133F84E1A941FFF9FB810CB1F19FB436" box="[1080,1154,758,780]" captionStart="Figure 10" captionStartId="21.[163,244,1615,1637]" captionTargetBox="[325,1283,196,1574]" captionTargetId="figure-29@21.[323,1283,195,1575]" captionTargetPageId="21" captionText="Figure 10. Map of south-eastern Peru and central Bolivia showing the distribution (type localities only) of the three nominal species of Psychrophrynella (squares), and 24 nominal and four unnamed species of Microkayla gen. nov. (circles). Psychrophrynella: (1) P. usurpator; (2) P. chirihampatu; (3) P. bagrecito. Microkayla: (1) M. boettgeri; (2) M. chilina sp. nov.; (3) M. chapi sp. nov.; (4) M. katantika; (5) M. chaupi; (6) M. colla; (7) M. melanocheira; (8) M. kallawaya; (9) M. guillei; (10) M. saltator; (11) M. iani; (12) M. illampu; (13) M. ankohuma; (14) M. condoriri; (15) M. teqta; (16) M. sp. Coscapa; (17) M. chacaltaya; (18) M. aff. chacaltaya; (19) M. wettsteini; (20) M. illimani; (21) M. pinguis; (22) M. quimsacruzis; (23) M. sp. Khatu River; (24) M. harveyi; (25) M. iatamasi; (26) M. sp. Utururo; (27) M. adenopleura; (28) M. kempffi." pageId="23" pageNumber="152">Fig. 10</figureCitation>
), collected on
<date id="FFBABEA4A941FFF9FAA30CB0F669B411" pageId="23" pageNumber="152" value="2006-02-14">
<collectingDate id="EFFE474CA941FFF9FAA30CB0F669B411" pageId="23" pageNumber="152" value="2006-02-14">14 February 2006</collectingDate>
</date>
by
<collectorName id="26F1FDB2A941FFF9FC1A0D51F15CB411" box="[931,1089,789,811]" pageId="23" pageNumber="152">
I.
<collectingCounty id="62DAE0E8A941FFF9FC070D51F15CB411" box="[958,1089,789,811]" pageId="23" pageNumber="152">De la Riva</collectingCounty>
</collectorName>
,
<collectorName id="26F1FDB2A941FFF9FBE90D51F1FEB411" box="[1104,1251,789,811]" pageId="23" pageNumber="152">J. M. Padial</collectorName>
,
<collectorName id="26F1FDB2A941FFF9FB4B0D52F699B470" pageId="23" pageNumber="152">S. Castroviejo-Fisher</collectorName>
,
<collectorName id="26F1FDB2A941FFF9FC360D73F12FB470" box="[911,1074,820,842]" pageId="23" pageNumber="152">J. C. Chaparro</collectorName>
and
<collectorName id="26F1FDB2A941FFF9FBD20D73F1D3B470" box="[1131,1230,820,842]" pageId="23" pageNumber="152">J. Bosch.</collectorName>
</materialsCitation>
</paragraph>
<paragraph id="8BBB9864A941FFF9FC820D34F034B339" blockId="23.[827,1443,882,1027]" pageId="23" pageNumber="152">
<materialsCitation id="3B6C9239A941FFF9FC820D34F083B4B2" box="[827,1438,882,904]" collectionCode="MUBI" pageId="23" pageNumber="152" specimenCode="MUBI 5352" specimenCount="1" typeStatus="Paratopotypes">
<emphasis id="B9704476A941FFF9FC820D34F6C7B4B2" box="[827,986,883,904]" italics="true" pageId="23" pageNumber="152">
<typeStatus id="54BF26C6A941FFF9FC820D34F6C7B4B2" box="[827,986,883,904]" pageId="23" pageNumber="152" type="paratopotype">Paratopotypes</typeStatus>
</emphasis>
:
<specimenCode id="DBA2301FA941FFF9FC5F0D34F177B4B2" box="[998,1130,882,904]" collectionCode="MUBI" pageId="23" pageNumber="152">MUBI 5352</specimenCode>
(field number 4573) (male)
</materialsCitation>
;
<materialsCitation id="3B6C9239A941FFF9FC820DD5F67BB4FC" collectionCode="MUBI" pageId="23" pageNumber="152" specimenCode="MUBI 5350-51, 5353" specimenCount="1" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA941FFF9FC820DD5F6F8B49D" box="[827,997,913,935]" collectionCode="MUBI" pageId="23" pageNumber="152">MUBI 5350-51</specimenCode>
,
<specimenCode id="DBA2301FA941FFF9FC480DD6F135B49D" box="[1009,1064,913,935]" collectionCode="MUBI" pageId="23" pageNumber="152">5353</specimenCode>
(field numbers 4569, 4572, 4574) and
</materialsCitation>
<materialsCitation id="3B6C9239A941FFF9FCD20DF7F16FB4DE" collectionCode="MNCN" pageId="23" pageNumber="152" specimenCode="MNCN 43770-75" specimenCount="1" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA941FFF9FCD20DF7F12DB4FC" box="[875,1072,944,966]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="23" pageNumber="152" type="Museum">MNCN 4377075</specimenCode>
(field numbers 4570, 4571, 4575, 4577, 4578, 4579) (females)
</materialsCitation>
;
<materialsCitation id="3B6C9239A941FFF9FBC40D88F038B339" collectingDate="2006-02-14" collectionCode="MUBI" collectorName="I. De la Riva &amp; J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro &amp; J. Bosch." country="Peru" county="De la Riva" elevation="3792" latitude="-14.445056" location="Sayaco" longLatPrecision="1" longitude="-69.56986" municipality="Sandia" pageId="23" pageNumber="152" specimenCode="MUBI 5354" specimenCount="1" stateProvince="Puno" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA941FFF9FBC40D88F01FB4DE" box="[1149,1282,974,996]" collectionCode="MUBI" pageId="23" pageNumber="152">MUBI 5354</specimenCode>
(field number 4576) (juvenile), same data as the holotype
</materialsCitation>
.
</paragraph>
<paragraph id="8BBB9864A941FFF6FC820A6BF4C7B10D" blockId="23.[827,1443,1068,1396]" lastBlockId="24.[145,763,1018,1898]" lastPageId="24" lastPageNumber="153" pageId="23" pageNumber="152">
<emphasis id="B9704476A941FFF9FC820A6BF6B0B37B" box="[827,941,1068,1089]" italics="true" pageId="23" pageNumber="152">Diagnosis</emphasis>
:
<taxonomicName id="4C04E3E7A941FFF9FC030A6BF188B37B" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[954,1173,1068,1089]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="23" pageNumber="152" phylum="Chordata" rank="species" species="chilina">
<emphasis id="B9704476A941FFF9FC030A6BF188B37B" box="[954,1173,1068,1089]" italics="true" pageId="23" pageNumber="152">Microkayla chilina</emphasis>
</taxonomicName>
is characterized by: (1) skin on dorsum warty to coarsely warty (warts round, low, subconical to conical), with slightly larger warts on flanks; conspicuous and incomplete dorsolateral ridges; belly, throat, groin and chest coarsely areolate; (2) tympanic membrane and annulus not discernible beneath the skin, tympanic fold prominent; (3) snout short, rounded in dorsal and lateral views; (4) upper eyelid lacking tubercles, bearing conical warts, cranial crests absent; (5) dentigerous processes of vomers absent; (6) vocal slits present, vocal sac subgular, nuptial pads absent; (7) Finger I slightly shorter than Finger II, tips of digits rounded, lacking circumferential grooves and ungual flap; (8) fingers lacking lateral fringes; (9) ulnar region bearing warts, sometimes coalescing in an irregular ridge; (10) heel lacking tubercles; tarsus warty, lacking tubercles and folds; (11) two metatarsal tubercles, inner slightly larger than outer; supernumerary plantar tubercles low, numerous; (12) toes markedly short, lacking lateral fringes; webbing absent; Toe III longer than V, tips of digits rounded, lacking circumferential grooves and ungual flap; (13) dorsal coloration from reddish-brown to dark brown or black, sometimes with scattered yellow irregular blotches; ventral coloration dark grey to black with greyish-white and orange irregular blotches; groin, axillae, shanks and distal portions of hands and feet with orange flash marks; (14) females larger than males, SVL
<quantity id="4CFC3581A94EFFF6FEA50844F476B123" box="[284,363,1539,1561]" metricMagnitude="-1" metricUnit="m" metricValue="6.476999999999999" pageId="24" pageNumber="153" unit="in" value="25.5">25.5 in</quantity>
an adult female,
<quantity id="4CFC3581A94EFFF6FD8E0844F7C7B123" box="[567,730,1539,1561]" metricMagnitude="-2" metricUnit="m" metricValue="2.375" metricValueMax="2.43" metricValueMin="2.32" pageId="24" pageNumber="153" unit="mm" value="23.75" valueMax="24.3" valueMin="23.2">23.224.3 mm</quantity>
in adult males (
<emphasis id="B9704476A94EFFF6FE9F0864F428B102" box="[294,309,1571,1592]" italics="true" pageId="24" pageNumber="153">n</emphasis>
= 4) (
<tableCitation id="C686ADDFA94EFFF6FECE0865F4D7B10D" box="[375,458,1570,1592]" captionStart="Table 3" captionStartId="12.[142,206,698,720]" captionText="Table 3. Morphometrics for new Peruvian species of Bryophryne and Microkayla (range, in parenthesis, follows mean; AM, adult males; AF, adult females)" pageId="24" pageNumber="153">Table 3</tableCitation>
).
</paragraph>
<caption id="DF7BC8ECA941FFF9FF1A0B43F784B248" pageId="23" pageNumber="152" startId="23.[163,245,1284,1306]" targetBox="[168,775,484,1243]" targetPageId="23" targetType="figure">
<paragraph id="8BBB9864A941FFF9FF1A0B43F784B248" blockId="23.[163,779,1284,1394]" pageId="23" pageNumber="152">
<emphasis id="B9704476A941FFF9FF1A0B43F43CB223" bold="true" box="[163,289,1284,1306]" pageId="23" pageNumber="152">Figure 12.</emphasis>
Oscillogram and sound spectrogram of the advertisement call of
<emphasis id="B9704476A941FFF9FE3F0B66F7AFB20C" bold="true" box="[390,690,1313,1335]" pageId="23" pageNumber="152">
<taxonomicName id="4C04E3E7A941FFF9FE3F0B66F749B20D" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[390,596,1313,1335]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="23" pageNumber="152" phylum="Chordata" rank="species" species="chapi" status="sp. nov.">
<emphasis id="B9704476A941FFF9FE3F0B66F749B20D" bold="true" box="[390,596,1313,1335]" italics="true" pageId="23" pageNumber="152">Microkayla chapi</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA941FFF9FDE20B66F7AFB20C" box="[603,690,1313,1334]" pageId="23" pageNumber="152" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
(MNCN 43764), recorded on 10 February 2006 at Hirigache river valley, Sina, Puno, Peru. Air temperature, 10 °C.
</paragraph>
</caption>
<caption id="DF7BC8ECA941FFF9FF1A0BD9F187B289" box="[163,1178,1437,1459]" pageId="23" pageNumber="152" startId="23.[163,227,1438,1459]" targetType="table">
<paragraph id="8BBB9864A941FFF9FF1A0BD9F187B289" blockId="23.[163,1178,1437,1459]" box="[163,1178,1437,1459]" pageId="23" pageNumber="152">
<emphasis id="B9704476A941FFF9FF1A0BD9F5E1B288" bold="true" box="[163,252,1437,1459]" pageId="23" pageNumber="152">Table 4.</emphasis>
Numerical parameters of the advertisement calls of two Peruvian species of
<taxonomicName id="4C04E3E7A941FFF9FB9D0BDAF187B289" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1060,1178,1437,1459]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="23" pageNumber="152" phylum="Chordata" rank="genus">Microkayla</taxonomicName>
</paragraph>
</caption>
<paragraph id="8BBB9864A941FFF9FE9C0B9FF088B06D" pageId="23" pageNumber="152">
<table id="F9046AC4A9410011FF1A0B9FF088B06D" box="[163,1429,1496,1879]" gridcols="9" gridrows="3" pageId="23" pageNumber="152">
<tr id="35349A26A9410011FF1A0B9FF088B119" box="[163,1429,1496,1571]" gridrow="0" pageId="23" pageNumber="152" rowspan-0="1">
<th id="76E5F35AA9410011FE9C0B9FF486B119" box="[293,411,1496,1571]" gridcol="1" gridrow="0" pageId="23" pageNumber="152">Sample size (specimens, calls)</th>
<th id="76E5F35AA9410011FE100B9FF727B119" box="[425,570,1496,1571]" gridcol="2" gridrow="0" pageId="23" pageNumber="152">Call/min</th>
<th id="76E5F35AA9410011FDF00B9FF7FBB119" box="[585,742,1496,1571]" gridcol="3" gridrow="0" pageId="23" pageNumber="152">Note duration (ms)</th>
<th id="76E5F35AA9410011FD4D0B9FF6BEB119" box="[756,931,1496,1571]" gridcol="4" gridrow="0" pageId="23" pageNumber="152">Dominant frequency (Hz)</th>
<th id="76E5F35AA9410011FC080B9FF124B119" box="[945,1081,1496,1571]" gridcol="5" gridrow="0" pageId="23" pageNumber="152">Change in intensity (Hz)</th>
<th id="76E5F35AA9410011FBF10B9FF1AEB119" box="[1096,1203,1496,1571]" gridcol="6" gridrow="0" pageId="23" pageNumber="152">°C Air (substrate)</th>
<th id="76E5F35AA9410011FB7B0B9FF03CB119" box="[1218,1313,1496,1571]" gridcol="7" gridrow="0" pageId="23" pageNumber="152">SVL</th>
<th id="76E5F35AA9410011FA890B9FF088B119" box="[1328,1429,1496,1571]" gridcol="8" gridrow="0" pageId="23" pageNumber="152">Vouchers</th>
</tr>
<tr id="35349A26A9410011FF1A0801F088B1F0" box="[163,1429,1606,1738]" gridrow="1" pageId="23" pageNumber="152">
<th id="76E5F35AA9410011FF1A0801F40AB1F0" box="[163,279,1606,1738]" gridcol="0" gridrow="1" pageId="23" pageNumber="152">
<taxonomicName id="4C04E3E7A941FFF9FF1A0800F40AB160" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[163,279,1607,1626]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="23" pageNumber="152" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A941FFF9FF1A0800F40AB160" box="[163,279,1607,1626]" italics="true" pageId="23" pageNumber="152">M. boettgeri</emphasis>
</taxonomicName>
</th>
<td id="76E5F35AA9410011FE9C0801F486B1F0" box="[293,411,1606,1738]" gridcol="1" gridrow="1" pageId="23" pageNumber="152">5, 27</td>
<td id="76E5F35AA9410011FE100801F727B1F0" box="[425,570,1606,1738]" gridcol="2" gridrow="1" pageId="23" pageNumber="152">8.321.6 (13.4)</td>
<td id="76E5F35AA9410011FDF00801F7FBB1F0" box="[585,742,1606,1738]" gridcol="3" gridrow="1" pageId="23" pageNumber="152">102145 (120.4)</td>
<td id="76E5F35AA9410011FD4D0801F6BEB1F0" box="[756,931,1606,1738]" gridcol="4" gridrow="1" pageId="23" pageNumber="152">26593043 (2793)</td>
<td id="76E5F35AA9410011FC080801F124B1F0" box="[945,1081,1606,1738]" gridcol="5" gridrow="1" pageId="23" pageNumber="152">0231 (44.7)</td>
<td id="76E5F35AA9410011FBF10801F1AEB1F0" box="[1096,1203,1606,1738]" gridcol="6" gridrow="1" pageId="23" pageNumber="152">8 ()</td>
<td id="76E5F35AA9410011FB7B0801F03CB1F0" box="[1218,1313,1606,1738]" gridcol="7" gridrow="1" pageId="23" pageNumber="152">17.919.2</td>
<td id="76E5F35AA9410011FA890801F088B1F0" box="[1328,1429,1606,1738]" gridcol="8" gridrow="1" pageId="23" pageNumber="152">One from the series MNCN 43776-8</td>
</tr>
<tr id="35349A26A9410011FF1A0893F088B06D" box="[163,1429,1748,1879]" gridrow="2" pageId="23" pageNumber="152">
<th id="76E5F35AA9410011FF1A0893F40AB06D" box="[163,279,1748,1879]" gridcol="0" gridrow="2" pageId="23" pageNumber="152">
<taxonomicName id="4C04E3E7A941FFF9FF1A0893F5E5B1DD" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[163,248,1748,1767]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="23" pageNumber="152" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A941FFF9FF1A0893F5E5B1DD" box="[163,248,1748,1767]" italics="true" pageId="23" pageNumber="152">M. chapi</emphasis>
</taxonomicName>
</th>
<td id="76E5F35AA9410011FE9C0893F486B06D" box="[293,411,1748,1879]" gridcol="1" gridrow="2" pageId="23" pageNumber="152">5, 14</td>
<td id="76E5F35AA9410011FE100893F727B06D" box="[425,570,1748,1879]" gridcol="2" gridrow="2" pageId="23" pageNumber="152">2.610.4 (6.8)</td>
<td id="76E5F35AA9410011FDF00893F7FBB06D" box="[585,742,1748,1879]" gridcol="3" gridrow="2" pageId="23" pageNumber="152">7291 (83.4)</td>
<td id="76E5F35AA9410011FD4D0893F6BEB06D" box="[756,931,1748,1879]" gridcol="4" gridrow="2" pageId="23" pageNumber="152">30863171 (3146)</td>
<td id="76E5F35AA9410011FC080893F124B06D" box="[945,1081,1748,1879]" gridcol="5" gridrow="2" pageId="23" pageNumber="152"></td>
<td id="76E5F35AA9410011FBF10893F1AEB06D" box="[1096,1203,1748,1879]" gridcol="6" gridrow="2" pageId="23" pageNumber="152">10 (12)</td>
<td id="76E5F35AA9410011FB7B0893F03CB06D" box="[1218,1313,1748,1879]" gridcol="7" gridrow="2" pageId="23" pageNumber="152">16.319.1</td>
<td id="76E5F35AA9410011FA890893F088B06D" box="[1328,1429,1748,1879]" gridcol="8" gridrow="2" pageId="23" pageNumber="152">One from the series MNCN 43763-9</td>
</tr>
</table>
</paragraph>
<caption id="DF7BC8ECA94EFFF6FF2B0D2AF7A8B484" pageId="24" pageNumber="153" startId="24.[146,225,877,899]" targetBox="[305,1265,195,837]" targetPageId="24" targetType="figure">
<paragraph id="8BBB9864A94EFFF6FF2B0D2AF7A8B484" blockId="24.[145,1425,877,958]" pageId="24" pageNumber="153">
<emphasis id="B9704476A94EFFF6FF2B0D2AF414B4B8" bold="true" box="[146,265,877,899]" pageId="24" pageNumber="153">Figure 13.</emphasis>
Live specimens of
<emphasis id="B9704476A94EFFF6FE6E0D2AF604B4B8" bold="true" box="[471,793,877,899]" pageId="24" pageNumber="153">
<taxonomicName id="4C04E3E7A94EFFF6FE6E0D2AF7A4B4B9" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[471,697,877,899]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chilina" status="sp. nov.">
<emphasis id="B9704476A94EFFF6FE6E0D2AF7A4B4B9" bold="true" box="[471,697,877,899]" italics="true" pageId="24" pageNumber="153">Microkayla chilina</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA94EFFF6FD780D2AF604B4B8" box="[705,793,877,898]" pageId="24" pageNumber="153" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
from the confluence of rivers Sayaco and Huacuyo, Sandia, Peru. (A) Adult female (MUBI 5351; SVL 24.3 mm); (B) Adult male holotype (MUBI 5355, SVL 24.3 mm). (CD) Adult male (MNCN 43775, SVL 23.6 mm) from the type locality.
</paragraph>
</caption>
<paragraph id="8BBB9864A94EFFF6FF100807F05CB2E6" blockId="24.[145,763,1018,1898]" lastBlockId="24.[809,1426,1018,1500]" pageId="24" pageNumber="153">
The sister and geographically closest species to
<taxonomicName id="4C04E3E7A94EFFF6FD620806F5FDB14E" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chilina">
<emphasis id="B9704476A94EFFF6FD620806F5FDB14E" italics="true" pageId="24" pageNumber="153">M. chilina</emphasis>
</taxonomicName>
is
<taxonomicName id="4C04E3E7A94EFFF6FEB80827F70BB14E" authority="(Lehr, 2006)" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[257,534,1631,1653]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94EFFF6FEB80827F49AB14E" box="[257,391,1631,1653]" italics="true" pageId="24" pageNumber="153">M. boettgeri</emphasis>
(
<bibRefCitation id="EF95E595A94EFFF6FE2F0818F712B14F" author="Lehr E" box="[406,527,1631,1653]" pageId="24" pageNumber="153" pagination="331 - 347" refId="ref24796" refString="Lehr E. 2006. Taxonomic status of some species of Peruvian Phrynopus (Anura: Leptodactylidae) with the description of a new species from the Andes of southern Peru. Herpetologica 62: 331-347." type="journal article" year="2006">Lehr, 2006</bibRefCitation>
)
</taxonomicName>
(
<typeStatus id="54BF26C6A94EFFF6FD9C0818F74AB14E" box="[549,599,1631,1652]" pageId="24" pageNumber="153">type</typeStatus>
localities separated by
<quantity id="4CFC3581A94EFFF6FEBF0839F47EB1AE" box="[262,355,1662,1684]" metricMagnitude="4" metricUnit="m" metricValue="3.66" pageId="24" pageNumber="153" unit="km" value="36.6">36.6 km</quantity>
straight line distance).
<taxonomicName id="4C04E3E7A94EFFF6FDCE0839F5E8B18B" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94EFFF6FDCE0839F5E8B18B" italics="true" pageId="24" pageNumber="153">Microkayla boettgeri</emphasis>
</taxonomicName>
possesses a protruding snout, a sharp ulnar ridge formed by small conical granules, and sharp and protruding eyelids.
<taxonomicName id="4C04E3E7A94EFFF6FED3089DF723B1D5" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[362,574,1754,1775]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chilina">
<emphasis id="B9704476A94EFFF6FED3089DF723B1D5" box="[362,574,1754,1775]" italics="true" pageId="24" pageNumber="153">Microkayla chilina</emphasis>
</taxonomicName>
has a more slen- der body than
<taxonomicName id="4C04E3E7A94EFFF6FE8708BEF4D4B037" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[318,457,1784,1806]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94EFFF6FE8708BEF4D4B037" box="[318,457,1784,1806]" italics="true" pageId="24" pageNumber="153">M. boettgeri</emphasis>
</taxonomicName>
, which has globular body shape (
<figureCitation id="133F84E1A94EFFF6FF5A0950F42DB016" box="[227,304,1815,1837]" captionStart="Figure 14" captionStartId="25.[163,243,879,901]" captionTargetBox="[323,1283,195,839]" captionTargetId="figure-507@25.[323,1283,195,839]" captionTargetPageId="25" captionText="Figure 14. Live specimens of Microkayla boettgeri from the type locality, Phara, Puno, Peru. (AB) Adult male (MNCN 43778, SVL 18.6 mm); (CD) Adult male (MNCN 43776, SVL 19.0 mm)." pageId="24" pageNumber="153">Fig. 14</figureCitation>
). In
<taxonomicName id="4C04E3E7A94EFFF6FEDF095FF4C4B016" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[358,473,1815,1837]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chilina">
<emphasis id="B9704476A94EFFF6FEDF095FF4C4B016" box="[358,473,1815,1837]" italics="true" pageId="24" pageNumber="153">M. chilina</emphasis>
</taxonomicName>
the tympanic membrane and annulus are not discernible, while they are in
<taxonomicName id="4C04E3E7A94EFFF6FD650971F5EEB053" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94EFFF6FD650971F5EEB053" italics="true" pageId="24" pageNumber="153">M. boettgeri</emphasis>
</taxonomicName>
, in which the tympanic membrane reaches
<emphasis id="B9704476A94EFFF6FD510912F7EEB050" box="[744,755,1877,1898]" italics="true" pageId="24" pageNumber="153">c</emphasis>
. 50% of eye length in diameter. Some differences are also evident in coloration.
<taxonomicName id="4C04E3E7A94EFFF6FBF70A5FF03EB317" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1102,1315,1048,1069]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chilina">
<emphasis id="B9704476A94EFFF6FBF70A5FF03EB317" box="[1102,1315,1048,1069]" italics="true" pageId="24" pageNumber="153">Microkayla chilina</emphasis>
</taxonomicName>
often has irregular yellowish-cream blotches on dorsum, which are not present in
<taxonomicName id="4C04E3E7A94EFFF6FBB30A11F18BB351" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[1034,1174,1110,1131]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94EFFF6FBB30A11F18BB351" box="[1034,1174,1110,1131]" italics="true" pageId="24" pageNumber="153">M. boettgeri</emphasis>
</taxonomicName>
; this species usually has some reddish-orange coloration on venter, digits, axillae, and groins, while in
<taxonomicName id="4C04E3E7A94EFFF6FBD00AD3F1C1B392" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1129,1244,1171,1193]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chilina">
<emphasis id="B9704476A94EFFF6FBD00AD3F1C1B392" box="[1129,1244,1171,1193]" italics="true" pageId="24" pageNumber="153">M. chilina</emphasis>
</taxonomicName>
these areas are yellowish-orange. To the east,
<taxonomicName id="4C04E3E7A94EFFF6FBC30AF5F1C6B3FD" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1146,1243,1202,1223]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chapi" status="sp. nov.">
<emphasis id="B9704476A94EFFF6FBC30AF5F1C6B3FD" box="[1146,1243,1202,1223]" italics="true" pageId="24" pageNumber="153">M. chapi</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA94EFFF6FB580AF5F02FB3FD" box="[1249,1330,1202,1223]" pageId="24" pageNumber="153" rank="species">sp. nov.</taxonomicNameLabel>
is found at
<quantity id="4CFC3581A94EFFF6FCF10A96F6B8B3DC" box="[840,933,1232,1254]" metricMagnitude="4" metricUnit="m" metricValue="3.37" pageId="24" pageNumber="153" unit="km" value="33.7">33.7 km</quantity>
(straight line) from the
<typeStatus id="54BF26C6A94EFFF6FB780A96F1EEB3DC" box="[1217,1267,1233,1254]" pageId="24" pageNumber="153">type</typeStatus>
locality of
<taxonomicName id="4C04E3E7A94EFFF6FACA0A96F665B23E" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chilina">
<emphasis id="B9704476A94EFFF6FACA0A96F665B23E" italics="true" pageId="24" pageNumber="153">M. chilina</emphasis>
</taxonomicName>
and is sister to the clade formed by
<taxonomicName id="4C04E3E7A94EFFF6FAB50AB7F08CB23E" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[1292,1425,1263,1285]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94EFFF6FAB50AB7F08CB23E" box="[1292,1425,1263,1285]" italics="true" pageId="24" pageNumber="153">M. boettgeri</emphasis>
</taxonomicName>
and
<taxonomicName id="4C04E3E7A94EFFF6FCE40B49F6C8B219" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[861,981,1294,1315]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chilina">
<emphasis id="B9704476A94EFFF6FCE40B49F6C8B219" box="[861,981,1294,1315]" italics="true" pageId="24" pageNumber="153">M. chilina</emphasis>
</taxonomicName>
.
<taxonomicName id="4C04E3E7A94EFFF6FC5C0B49F1D9B219" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[997,1220,1294,1315]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chilina">
<emphasis id="B9704476A94EFFF6FC5C0B49F1D9B219" box="[997,1220,1294,1315]" italics="true" pageId="24" pageNumber="153">Microkayla chilina</emphasis>
</taxonomicName>
is readily distinguished from
<taxonomicName id="4C04E3E7A94EFFF6FC760B6AF12BB27B" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[975,1078,1324,1346]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A94EFFF6FC760B6AF12BB27B" box="[975,1078,1324,1346]" italics="true" pageId="24" pageNumber="153">M. chapi</emphasis>
</taxonomicName>
by having incomplete dorsolateral ridges (sharp and well-developed dorsolateral folds in
<taxonomicName id="4C04E3E7A94EFFF6FC310B2DF6F0B245" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[904,1005,1386,1407]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="24" pageNumber="153" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A94EFFF6FC310B2DF6F0B245" box="[904,1005,1386,1407]" italics="true" pageId="24" pageNumber="153">M. chapi</emphasis>
</taxonomicName>
), tympanic membrane and annulus not discernible beneath the skin (a large and conspicuous tympanic membrane), and shorter toes, more areolate belly, and warty skin (smooth to granular).
</paragraph>
<paragraph id="8BBB9864A94EFFF7FC900842F611B16E" blockId="24.[809,1425,1540,1900]" lastBlockId="25.[163,780,985,1896]" lastPageId="25" lastPageNumber="154" pageId="24" pageNumber="153">
<emphasis id="B9704476A94EFFF6FC900842F17EB123" box="[809,1123,1540,1562]" italics="true" pageId="24" pageNumber="153">
Description of the
<typeStatus id="54BF26C6A94EFFF6FBBB0843F17EB123" box="[1026,1123,1540,1561]" pageId="24" pageNumber="153" type="holotype">holotype</typeStatus>
</emphasis>
: An adult male,
<quantity id="4CFC3581A94EFFF6FA920843F08CB120" box="[1323,1425,1540,1562]" metricMagnitude="-2" metricUnit="m" metricValue="2.43" pageId="24" pageNumber="153" unit="mm" value="24.3">24.3 mm</quantity>
SVL. Body robust; dorsal skin warty, with small irregular warts scattered all over; ventral skin areolate; dorsolateral folds present, incomplete, running from above ocular region to level of midbody, from where they continue as interrupted ridges of warts; two oblique and inconspicuous middorsal folds on central part of dorsum; pectoral fold absent; head wider than long, HW 33.7% of SVL, HL 32.9% of SVL; snout moderately short, rounded in dorsal view and in profile; nostrils not prominent, closer to snout than to eyes; canthus rostralis straight in dorsal view, concave in profile; eyenostril distance 74.2% of eye length; loreal region concave; cranial crests absent; tympanic membrane and tympanic annulus not visible externally; supratympanic fold barely visible; tongue large, oval; choanae small, rounded, broadly separated; dentigerous process of vomers absent; vocal slits present; a subgular vocal sac; ulnar tubercle and fold absent (a ridge formed by connected warts); inner palmar tubercle nearly oval, slightly smaller than round outer; no nuptial pads; fingers moderately short, not fringed, lacking circumferential grooves and ungual flap; subarticular tubercles round, bulky; supernumerary tubercles round, of variable sizes; first finger approximately equal or slightly shorter than second, relative length of fingers 1 ≤ 2 = 4 &lt;3; limbs short; tibia length 30.0% of SVL; tarsal fold absent; two metatarsal tubercles, oval inner slightly larger than round outer; supernumerary and subarticular tubercles low, irregular; toes lacking basal webbing or lateral fringes, toe tips round, lacking circumferential grooves and ungual flap; relative length of toes 1 &lt;2 &lt;3 = 5 &lt;4; foot length 37.4% of SVL.
</paragraph>
<caption id="DF7BC8ECA94FFFF7FF1A0D28F692B498" pageId="25" pageNumber="154" startId="25.[163,243,879,901]" targetBox="[323,1283,195,839]" targetPageId="25" targetType="figure">
<paragraph id="8BBB9864A94FFFF7FF1A0D28F692B498" blockId="25.[163,1441,879,930]" pageId="25" pageNumber="154">
<emphasis id="B9704476A94FFFF7FF1A0D28F406B4BE" bold="true" box="[163,283,879,901]" pageId="25" pageNumber="154">Figure 14.</emphasis>
Live specimens of
<taxonomicName id="4C04E3E7A94FFFF7FE520D28F7DBB4BF" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[491,710,879,901]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="25" pageNumber="154" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94FFFF7FE520D28F7DBB4BF" box="[491,710,879,901]" italics="true" pageId="25" pageNumber="154">Microkayla boettgeri</emphasis>
</taxonomicName>
from the type locality, Phara, Puno, Peru. (AB) Adult male (MNCN 43778, SVL 18.6 mm); (CD) Adult male (MNCN 43776, SVL 19.0 mm).
</paragraph>
</caption>
<paragraph id="8BBB9864A94FFFF7FF020819F7F5B052" blockId="25.[163,780,985,1896]" pageId="25" pageNumber="154">In preservative, dorsal surfaces uniformly grey, venter and throat brownish-grey with an irregular beige area in central part of venter; palmar and plantar surfaces and inner surface of forelimbs mostly brown, digits pale cream. In life, the dorsum was mostly uniformly brown above; there were small orange irregular blotches on axillae and groins; the venter was greyish-brown with an irregular dirty-yellow pattern; the digits were yellowish-orange; the iris was dark brown.</paragraph>
<paragraph id="8BBB9864A94FFFF7FC820D9DF0B9B337" blockId="25.[827,1444,985,1037]" pageId="25" pageNumber="154">
<emphasis id="B9704476A94FFFF7FC820D9DF1F0B4D4" box="[827,1261,985,1007]" italics="true" pageId="25" pageNumber="154">
Measurements (in mm) of the
<typeStatus id="54BF26C6A94FFFF7FB360D9EF1F0B4D4" box="[1167,1261,985,1006]" pageId="25" pageNumber="154" type="holotype">holotype</typeStatus>
</emphasis>
: SVL, 24.3; HL, 8.0; HW, 8.2; IND, 2.4; END, 2.3; ED, 3.1; TL, 7.3; FL, 9.1.
</paragraph>
<paragraph id="8BBB9864A94FFFF7FC820A70F1D7B27B" blockId="25.[827,1443,1078,1346]" pageId="25" pageNumber="154">
<emphasis id="B9704476A94FFFF7FC820A70F6B4B376" box="[827,937,1079,1100]" italics="true" pageId="25" pageNumber="154">Variation</emphasis>
: All specimens are nearly identical in skin texture and overall colour pattern. MNCN 43773, 43774, and, especially, 43775, have some small, irregular pale grey blotches on dorsum (dirty-yellowish in life); a dark brown spot can be present on the anterior surface of the forearm (e.g. MUBI 5351, MNCN 43771) and/or the inner surface of the shank (MNCN 43772). Males are small and lack vocal slits, external vocal sac and nuptial excrescences.
</paragraph>
<paragraph id="8BBB9864A94FFFF7FC820B2DF174B2C1" blockId="25.[827,1443,1386,1531]" pageId="25" pageNumber="154">
<emphasis id="B9704476A94FFFF7FC820B2DF1B7B245" box="[827,1194,1386,1407]" italics="true" pageId="25" pageNumber="154">Distribution and natural history</emphasis>
: Known only from the
<typeStatus id="54BF26C6A94FFFF7FC820BCEF673B2A4" box="[827,878,1417,1438]" pageId="25" pageNumber="154">type</typeStatus>
locality. Individuals were found during the day under stones in open wet puna. They were not common; almost two hours of collecting by five persons yielded only
<specimenCount id="9D0253EDA94FFFF7FC720BA2F178B2C1" box="[971,1125,1509,1531]" count="12" pageId="25" pageNumber="154" type="generic">12 specimens</specimenCount>
.
</paragraph>
<paragraph id="8BBB9864A94FFFF7FC820863F6E7B18E" blockId="25.[827,1443,1572,1716]" pageId="25" pageNumber="154">
<emphasis id="B9704476A94FFFF7FC820863F6A7B103" box="[827,954,1572,1593]" italics="true" pageId="25" pageNumber="154">Etymology</emphasis>
: The species epithet is used as a name in apposition, and derives from the Quechua word chilina, meaning the colour of a ripe orange (reddishyellow), and refers to the spots of this colour present in this new species.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,548 @@
<document id="ED4E5E3B0005D70FE1DAD8E5CD62EDF8" ID-ISSN="0024-4082" ID-ZooBank="B2DCFB0-BF1A-47A1-911C-726876890892" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779474141" checkinUser="plazi" docAuthor="Riva, Ignacio De La, Chaparro, Juan C., Castroviejo-Fisher, Santiago &amp; Padial, José M." docDate="2018" docId="03AD2972A945FFF9FC7C0A0BF143B688" docLanguage="en" docName="zlx020.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Microkayla chapi Riva, Chaparro, Castroviejo-Fisher &amp; Padial, 2018, SP. NOV." docType="treatment" docVersion="1" lastPageNumber="152" masterDocId="FF94510AA956FFEEFFB90E47F51DB73A" masterDocTitle="Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)" masterLastPageNumber="172" masterPageNumber="129" pageNumber="148" updateTime="1738779668666" updateUser="GgImagineBatch">
<mods:mods id="D5D06FEDB336B6B98BFD21DD15460734" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="D7CD195EEFB5A55C2544DA350B99AC5C">
<mods:title id="334674F51AA512AB2BF927E2F24D19F7">Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)</mods:title>
</mods:titleInfo>
<mods:name id="1CF2157FC9ACB6CA69F9598F8A672959" type="personal">
<mods:role id="F5FD24DFF59DE44D3A33102D19B53AA8">
<mods:roleTerm id="1E80296FF10B2F75D740E201A62DB93F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3EBFA34AE4F52BF07375774B62519EE0">Riva, Ignacio De La</mods:namePart>
</mods:name>
<mods:name id="0A5C9670C3B5A5D7E6326190C46EB393" type="personal">
<mods:role id="FBE510E0AFC3DECFA9794CBD63E9703A">
<mods:roleTerm id="2A67BE0F48F2C48E7A160FB640D35A3D">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="25F2A354302FCA242BEB8FFE8B7A66C7">Chaparro, Juan C.</mods:namePart>
</mods:name>
<mods:name id="BB37333A56F109D02B1962925ABC7482" type="personal">
<mods:role id="99A6FFC85CDC993AB2209223014832CC">
<mods:roleTerm id="1AC176335351865DF43AF940DB18DDC4">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="D47D3893BBE0C7825A782D2B7DC90EC2">Castroviejo-Fisher, Santiago</mods:namePart>
</mods:name>
<mods:name id="33F2DC727BD284FD79700C592F9F8101" type="personal">
<mods:role id="18A90F73CC5887B19481A1EA6A62129C">
<mods:roleTerm id="4C47655AE40343775AFE358DF8547A1F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="BD7B5D1D338BE8E20AC30D9BEAF7214F">Padial, José M.</mods:namePart>
</mods:name>
<mods:typeOfResource id="984C7CE7951A261A4AFF9F6B446255F0">text</mods:typeOfResource>
<mods:relatedItem id="B145BF2DBA9FC2B3E145A818AD51899D" type="host">
<mods:titleInfo id="3C17ED2D7CCF0EBDDA22EE49FB48AA06">
<mods:title id="71ABED8669E83172DDC83BB29B55B328">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="9CBA7FC61856C04A309E73502F607D45">
<mods:date id="FF6D580B4EC7AB484EB087AFCD1170C4">2018</mods:date>
<mods:detail id="279C1023086477D028587AA856B23A35" type="volume">
<mods:number id="929EEDC1B91CF765C5A57E6E579ED113">182</mods:number>
</mods:detail>
<mods:extent id="F4D50FBAFB53240B7D3EC5D4A7222421" unit="page">
<mods:start id="145A2E54FD529037FAE9902CD5D7865E">129</mods:start>
<mods:end id="E977BD239A4FE48408D4832212EC87F6">172</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="A2E0E70007F439A16E5E736DC7DA3EB7">journal article</mods:classification>
<mods:identifier id="3EC58F0E66A0B9243DF7534CA27821E1" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="A5333BDF4FE5D4379B461C0D266F855E" type="ZooBank">B2DCFB0-BF1A-47A1-911C-726876890892</mods:identifier>
</mods:mods>
<treatment id="03AD2972A945FFF9FC7C0A0BF143B688" LSID="urn:lsid:plazi:treatment:03AD2972A945FFF9FC7C0A0BF143B688" httpUri="http://treatment.plazi.org/id/03AD2972A945FFF9FC7C0A0BF143B688" lastPageId="23" lastPageNumber="152" pageId="19" pageNumber="148">
<subSubSection id="C31ECBEFA945FFFDFC7C0A0BF004B359" box="[965,1305,1099,1123]" pageId="19" pageNumber="148" type="nomenclature">
<paragraph id="8BBB9864A945FFFDFC7C0A0BF004B359" blockId="19.[965,1305,1099,1123]" box="[965,1305,1099,1123]" pageId="19" pageNumber="148">
<heading id="D0F32F08A945FFFDFC7C0A0BF004B359" box="[965,1305,1099,1123]" centered="true" fontSize="9" level="2" pageId="19" pageNumber="148" reason="2">
<taxonomicName id="4C04E3E7A945FFFDFC7C0A0BF1B3B358" ID-CoL="6RH33" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[965,1198,1100,1123]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="19" pageNumber="148" phylum="Chordata" rank="species" species="chapi" status="sp. nov.">
<smallCapsWord id="8D5D0EB8A945FFFDFC7C0A0BF142B358" baselines="1117,1117" box="[965,1119,1100,1123]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Microkayla" pageId="19" pageNumber="148">MICROKAYLA</smallCapsWord>
<smallCapsWord id="8D5D0EB8A945FFFDFBDF0A08F1B3B358" baselines="1117" box="[1126,1198,1103,1122]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="chapi" pageId="19" pageNumber="148">CHAPI</smallCapsWord>
</taxonomicName>
<emphasis id="B9704476A945FFFDFB0F0A08F004B359" bold="true" box="[1206,1305,1099,1123]" pageId="19" pageNumber="148">
<taxonomicNameLabel id="A243F90DA945FFFDFB0F0A08F004B359" box="[1206,1305,1099,1123]" pageId="19" pageNumber="148" rank="species">
<smallCapsWord id="8D5D0EB8A945FFFDFB0F0A08F1CEB358" baselines="1117" box="[1206,1235,1103,1122]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="sp" pageId="19" pageNumber="148">SP</smallCapsWord>
.
<smallCapsWord id="8D5D0EB8A945FFFDFB590A08F00CB358" baselines="1117" box="[1248,1297,1103,1122]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="nov" pageId="19" pageNumber="148">NOV</smallCapsWord>
.
</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C31ECBEFA945FFF9FBFD0A35F143B688" lastPageId="23" lastPageNumber="152" pageId="19" pageNumber="148" type="description">
<paragraph id="8BBB9864A945FFFDFBFD0A35F184B3B1" blockId="19.[1092,1177,1138,1163]" box="[1092,1177,1138,1163]" pageId="19" pageNumber="148">
(
<figureCitation id="133F84E1A945FFFDFBF40A35F18CB3B1" box="[1101,1169,1138,1163]" captionStart="Figure 9" captionStartId="20.[145,223,877,899]" captionTargetBox="[305,1265,195,837]" captionTargetId="figure-566@20.[305,1265,195,837]" captionTargetPageId="20" captionText="Figure 9. Live specimens of Microkayla chapi sp. nov. from the type locality in Sina, Peru. (AB) Adult female holotype (MUBI 5326, SVL 19.9 mm). (CD) Adult male (MNCN 43767, SVL 17.3 mm)." pageId="19" pageNumber="148">
<smallCapsWord id="8D5D0EB8A945FFFDFBF40A35F168B3B0" baselines="1157,1157" box="[1101,1141,1138,1163]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Fig" pageId="19" pageNumber="148">FIG</smallCapsWord>
. 9
</figureCitation>
)
</paragraph>
<paragraph id="8BBB9864A945FFFDFC820ADDF6ECB3F5" blockId="19.[827,1443,1178,1231]" pageId="19" pageNumber="148">
<uri id="FF959466A945FFFDFC820ADDF6ECB3F5" pageId="19" pageNumber="148">
urn:lsid:zoobank.org:act:
<uuid id="FFA2A2B1A945FFFDFBF50ADDF6ECB3F5" pageId="19" pageNumber="148">A11DB6F2-E959-4570-A369- 00A7D64C8E13</uuid>
</uri>
</paragraph>
<paragraph id="8BBB9864A945FFFDFC820ABFF065B29D" blockId="19.[827,1442,1272,1447]" pageId="19" pageNumber="148">
<materialsCitation id="3B6C9239A945FFFDFC820ABFF065B29D" collectingDate="2006-02-10" collectionCode="MUBI" collectorName="I. De la Riva &amp; J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro &amp; J. Bosch." country="Peru" elevation="3504" latitude="-14.502694" location="Sandia" longLatPrecision="1" longitude="-69.26231" municipality="De la Riva" pageId="19" pageNumber="148" specimenCode="MUBI 5326" specimenCount="1" stateProvince="Puno" typeStatus="holotype">
<emphasis id="B9704476A945FFFDFC820ABFF6BAB237" box="[827,935,1272,1293]" italics="true" pageId="19" pageNumber="148">
<typeStatus id="54BF26C6A945FFFDFC820ABFF6BAB237" box="[827,935,1272,1293]" pageId="19" pageNumber="148" type="holotype">Holotype</typeStatus>
</emphasis>
:
<specimenCode id="DBA2301FA945FFFDFC000ABFF154B234" box="[953,1097,1272,1294]" collectionCode="MUBI" pageId="19" pageNumber="148">MUBI 5326</specimenCode>
(field number 4516), adult female from
<quantity id="4CFC3581A945FFFDFC580B50F125B216" box="[993,1080,1302,1324]" metricMagnitude="3" metricUnit="m" metricValue="3.7" pageId="19" pageNumber="148" unit="km" value="3.7">3.7 km</quantity>
from
<taxonomicName id="4C04E3E7A945FFFDFB330B51F0BCB216" authority=", Hirigache River" authorityName="Hirigache River" box="[1162,1441,1302,1324]" class="Insecta" family="Nolidae" genus="Sina" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" order="Lepidoptera" pageId="19" pageNumber="148" phylum="Arthropoda" rank="genus">Sina, Hirigache River</taxonomicName>
valley, province
<location id="8EDBCEBFA945FFFDFBB30B72F17EB271" LSID="urn:lsid:plazi:treatment:03AD2972A945FFF9FC7C0A0BF143B688:8EDBCEBFA945FFFDFBB30B72F17EB271" box="[1034,1123,1333,1355]" country="Peru" latitude="-14.502694" longLatPrecision="1" longitude="-69.26231" municipality="De la Riva" name="Sandia" pageId="19" pageNumber="148" stateProvince="Puno">Sandia</location>
, department
<collectingRegion id="49C05686A945FFFDFAA90B71F04CB271" box="[1296,1361,1334,1355]" country="Peru" name="Puno" pageId="19" pageNumber="148">Puno</collectingRegion>
,
<collectingCountry id="F313D8F4A945FFFDFADB0B71F080B271" box="[1378,1437,1334,1355]" name="Peru" pageId="19" pageNumber="148">Peru</collectingCountry>
,
<geoCoordinate id="EE30FEA3A945FFFDFC820B13F6D1B253" box="[827,972,1363,1386]" degrees="14" direction="south" minutes="30" orientation="latitude" pageId="19" pageNumber="148" precision="1" seconds="09.7" value="-14.502694">
14°30
<emphasis id="B9704476A945FFFDFCC20B14F69CB250" box="[891,897,1363,1386]" italics="true" pageId="19" pageNumber="148"></emphasis>
09.7
<emphasis id="B9704476A945FFFDFC0B0B14F6A1B250" box="[946,956,1363,1386]" italics="true" pageId="19" pageNumber="148"></emphasis>
S
</geoCoordinate>
,
<geoCoordinate id="EE30FEA3A945FFFDFC6E0B13F16DB253" box="[983,1136,1363,1386]" degrees="69" direction="west" minutes="15" orientation="longitude" pageId="19" pageNumber="148" precision="1" seconds="44.3" value="-69.26231">
69°15
<emphasis id="B9704476A945FFFDFBA10B14F103B250" box="[1048,1054,1363,1386]" italics="true" pageId="19" pageNumber="148"></emphasis>
44.3
<emphasis id="B9704476A945FFFDFBF70B14F145B250" box="[1102,1112,1363,1386]" italics="true" pageId="19" pageNumber="148"></emphasis>
W
</geoCoordinate>
,
<quantity id="4CFC3581A945FFFDFBC20B13F1D2B253" box="[1147,1231,1364,1386]" metricMagnitude="3" metricUnit="m" metricValue="3.504" pageId="19" pageNumber="148" unit="m" value="3504.0">
<elevation id="00297F57A945FFFDFBC20B13F1D2B253" box="[1147,1231,1364,1386]" metricMagnitude="3" metricUnit="m" metricValue="3.504" pageId="19" pageNumber="148" unit="m" value="3504.0">3504 m</elevation>
</quantity>
(
<figureCitation id="133F84E1A945FFFDFB670B13F036B253" box="[1246,1323,1364,1386]" captionStart="Figure 10" captionStartId="21.[163,244,1615,1637]" captionTargetBox="[325,1283,196,1574]" captionTargetId="figure-29@21.[323,1283,195,1575]" captionTargetPageId="21" captionText="Figure 10. Map of south-eastern Peru and central Bolivia showing the distribution (type localities only) of the three nominal species of Psychrophrynella (squares), and 24 nominal and four unnamed species of Microkayla gen. nov. (circles). Psychrophrynella: (1) P. usurpator; (2) P. chirihampatu; (3) P. bagrecito. Microkayla: (1) M. boettgeri; (2) M. chilina sp. nov.; (3) M. chapi sp. nov.; (4) M. katantika; (5) M. chaupi; (6) M. colla; (7) M. melanocheira; (8) M. kallawaya; (9) M. guillei; (10) M. saltator; (11) M. iani; (12) M. illampu; (13) M. ankohuma; (14) M. condoriri; (15) M. teqta; (16) M. sp. Coscapa; (17) M. chacaltaya; (18) M. aff. chacaltaya; (19) M. wettsteini; (20) M. illimani; (21) M. pinguis; (22) M. quimsacruzis; (23) M. sp. Khatu River; (24) M. harveyi; (25) M. iatamasi; (26) M. sp. Utururo; (27) M. adenopleura; (28) M. kempffi." pageId="19" pageNumber="148">Fig. 10</figureCitation>
), collected on
<date id="FFBABEA4A945FFFDFCD90B34F128B2B2" box="[864,1077,1394,1416]" pageId="19" pageNumber="148" value="2006-02-10">
<collectingDate id="EFFE474CA945FFFDFCD90B34F128B2B2" box="[864,1077,1394,1416]" pageId="19" pageNumber="148" value="2006-02-10">10 February 2006</collectingDate>
</date>
by
<collectorName id="26F1FDB2A945FFFDFBDD0B34F01DB2B2" box="[1124,1280,1394,1416]" pageId="19" pageNumber="148">
I.
<collectingMunicipality id="6BDF021EA945FFFDFBC70B34F01DB2B2" box="[1150,1280,1394,1416]" pageId="19" pageNumber="148">De la Riva</collectingMunicipality>
</collectorName>
,
<collectorName id="26F1FDB2A945FFFDFAB40B34F083B2B2" box="[1293,1438,1394,1416]" pageId="19" pageNumber="148">J. M. Padial</collectorName>
,
<collectorName id="26F1FDB2A945FFFDFC820BD6F135B29D" box="[827,1064,1425,1447]" pageId="19" pageNumber="148">S. Castroviejo-Fisher</collectorName>
,
<collectorName id="26F1FDB2A945FFFDFB8A0BD5F1C5B29D" box="[1075,1240,1425,1447]" pageId="19" pageNumber="148">J. C. Chaparro</collectorName>
, and
<collectorName id="26F1FDB2A945FFFDFAAD0BD5F065B29D" box="[1300,1400,1425,1447]" pageId="19" pageNumber="148">J. Bosch.</collectorName>
</materialsCitation>
</paragraph>
<paragraph id="8BBB9864A945FFFDFC820B97F6F3B1A4" blockId="19.[827,1442,1488,1694]" pageId="19" pageNumber="148">
<materialsCitation id="3B6C9239A945FFFDFC820B97F1D5B13E" collectionCode="MUBI" pageId="19" pageNumber="148" specimenCode="MUBI 5325, 5327, 5330, 5331" specimenCount="1" typeStatus="Paratopotypes">
<emphasis id="B9704476A945FFFDFC820B97F6FEB2DF" box="[827,995,1488,1509]" italics="true" pageId="19" pageNumber="148">
<typeStatus id="54BF26C6A945FFFDFC820B97F6FEB2DF" box="[827,995,1488,1509]" pageId="19" pageNumber="148" type="paratopotype">Paratopotypes</typeStatus>
</emphasis>
:
<specimenCode id="DBA2301FA945FFFDFC4A0B97F19CB2DC" box="[1011,1153,1488,1510]" collectionCode="MUBI" pageId="19" pageNumber="148">MUBI 5325</specimenCode>
,
<specimenCode id="DBA2301FA945FFFDFB360B97F1D7B2DC" box="[1167,1226,1488,1510]" collectionCode="MUBI" pageId="19" pageNumber="148">5327</specimenCode>
,
<specimenCode id="DBA2301FA945FFFDFB610B97F009B2DC" box="[1240,1300,1488,1510]" collectionCode="MUBI" pageId="19" pageNumber="148">5330</specimenCode>
,
<specimenCode id="DBA2301FA945FFFDFA9B0B97F046B2DC" box="[1314,1371,1488,1510]" collectionCode="MUBI" pageId="19" pageNumber="148">5331</specimenCode>
(field numbers 4514, 4519, 4524, 4527)
</materialsCitation>
,
<materialsCitation id="3B6C9239A945FFFDFB6C0BA8F15FB178" collectionCode="MNCN" pageId="19" pageNumber="148" specimenCode="MNCN 43763-65" specimenCount="1" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA945FFFDFB6C0BA8F0BFB13E" box="[1237,1442,1518,1540]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="19" pageNumber="148" type="Museum">MNCN 4376365</specimenCode>
and 4376769 (males) (field numbers 4515, 4517, 4518, 4522, 4525, 4526)
</materialsCitation>
;
<materialsCitation id="3B6C9239A945FFFDFBF5086BF011B15A" collectionCode="MNCN" pageId="19" pageNumber="148" specimenCode="MNCN 43762" specimenCount="1" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA945FFFDFBF5086BF1F5B178" box="[1100,1256,1580,1602]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="19" pageNumber="148" type="Museum">MNCN 43762</specimenCode>
and 43766 (field numbers 5183 and 5191) (females); and
</materialsCitation>
<materialsCitation id="3B6C9239A945FFFDFAAD080CF6F7B1A4" collectingDate="2006-02-10" collectionCode="MUBI" collectorName="I. De la Riva &amp; J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro &amp; J. Bosch." country="Peru" elevation="3504" latitude="-14.502694" location="Sandia" longLatPrecision="1" longitude="-69.26231" municipality="De la Riva" pageId="19" pageNumber="148" specimenCode="MUBI 5328, 5329" specimenCount="1" stateProvince="Puno" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA945FFFDFAAD080CF082B15A" box="[1300,1439,1610,1632]" collectionCode="MUBI" pageId="19" pageNumber="148">MUBI 5328</specimenCode>
,
<specimenCode id="DBA2301FA945FFFDFC82082EF66FB145" box="[827,882,1641,1663]" collectionCode="MUBI" pageId="19" pageNumber="148">5329</specimenCode>
(field numbers 4520, 4523) (juveniles), same data as the holotype
</materialsCitation>
.
</paragraph>
<paragraph id="8BBB9864A945FFFAFC820880F782B1F6" blockId="19.[827,1443,1734,1910]" lastBlockId="20.[145,762,983,1925]" lastPageId="20" lastPageNumber="149" pageId="19" pageNumber="148">
<emphasis id="B9704476A945FFFDFC820880F6A8B1E6" box="[827,949,1735,1756]" italics="true" pageId="19" pageNumber="148">Diagnosis</emphasis>
:
<taxonomicName id="4C04E3E7A945FFFDFC7E0881F1BCB1E1" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[967,1185,1734,1755]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="19" pageNumber="148" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A945FFFDFC7E0881F1BCB1E1" box="[967,1185,1734,1755]" italics="true" pageId="19" pageNumber="148">Microkayla chapi</emphasis>
</taxonomicName>
is characterized by: (1) skin on dorsum shagreen with large scattered sharp warts and short folds, sometimes coalescing into a pair of dorsolateral folds and/or incomplete middorsal and occipital folds; dorsal surface of extremities warty; flanks uniformly warty; ventral skin areolate, throat areolate; (2) tympanic membrane and tympanic annulus evident beneath the skin, supratympanic fold conspicuous; (3) snout short, rounded in dorsal and lateral views; (4) upper eyelid lacking tubercles, bearing small conical warts; (5) dentigerous process of vomers absent; (6) vocal slits and sac present, subgular; nuptial pads absent; (7) Finger I slightly shorter than Finger II; tips of digits rounded, lacking circumferential grooves and ungual flap; (8) fingers lacking lateral fringes; (9) ulnar region bearing warts, sometimes coalescing into a sharp ridge; (10) heel lacking tubercles, tarsus lacking tubercles and folds; (11) plantar surfaces of feet bearing two metatarsal tubercles, inner slightly larger than outer; supernumerary plantar tubercles low, inconspicuous; (12) toes lacking lateral fringes; webbing absent; Toe III slightly longer than V, tips of digits rounded, lacking circumferential grooves and ungual flap; (13) dorsal coloration with various shades of reddish-brown to dark brown or grey with metallic tones; ventral coloration variable, from grey with shades of red to dark grey with yellow spots; distal portions of hands and feet orange to red; groin with orange or red flash marks; (14) females slightly larger than males, SVL
<quantity id="4CFC3581A942FFFAFEE608DFF4ECB194" box="[351,497,1688,1710]" metricMagnitude="-1" metricUnit="m" metricValue="5.2705" metricValueMax="5.4864" metricValueMin="5.0546" pageId="20" pageNumber="149" unit="in" value="20.75" valueMax="21.6" valueMin="19.9">19.921.6 in</quantity>
adult females (
<emphasis id="B9704476A942FFFAFD1408DEF7A1B194" box="[685,700,1689,1710]" italics="true" pageId="20" pageNumber="149">n</emphasis>
= 3),
<quantity id="4CFC3581A942FFFAFF2808F0F42CB1F7" box="[145,305,1719,1741]" metricMagnitude="-2" metricUnit="m" metricValue="1.7700000000000002" metricValueMax="1.9100000000000001" metricValueMin="1.6300000000000001" pageId="20" pageNumber="149" unit="mm" value="17.7" valueMax="19.1" valueMin="16.3">16.319.1 mm</quantity>
in adult males (
<emphasis id="B9704476A942FFFAFE5208FFF4E7B1F7" box="[491,506,1720,1741]" italics="true" pageId="20" pageNumber="149">n</emphasis>
= 9) (
<tableCitation id="C686ADDFA942FFFAFD8508F0F792B1F6" box="[572,655,1719,1741]" captionStart="Table 3" captionStartId="12.[142,206,698,720]" captionText="Table 3. Morphometrics for new Peruvian species of Bryophryne and Microkayla (range, in parenthesis, follows mean; AM, adult males; AF, adult females)" pageId="20" pageNumber="149">Table 3</tableCitation>
).
</paragraph>
<caption id="DF7BC8ECA942FFFAFF280D2AF6A2B49A" pageId="20" pageNumber="149" startId="20.[145,223,877,899]" targetBox="[305,1265,195,837]" targetPageId="20" targetType="figure">
<paragraph id="8BBB9864A942FFFAFF280D2AF6A2B49A" blockId="20.[145,1425,877,928]" pageId="20" pageNumber="149">
<emphasis id="B9704476A942FFFAFF280D2AF5E4B4B8" bold="true" box="[145,249,877,899]" pageId="20" pageNumber="149">Figure 9.</emphasis>
Live specimens of
<emphasis id="B9704476A942FFFAFE7B0D2AF7F6B4B8" bold="true" box="[450,747,877,899]" pageId="20" pageNumber="149">
<taxonomicName id="4C04E3E7A942FFFAFE7B0D2AF792B4B9" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[450,655,877,899]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chapi" status="sp. nov.">
<emphasis id="B9704476A942FFFAFE7B0D2AF792B4B9" bold="true" box="[450,655,877,899]" italics="true" pageId="20" pageNumber="149">Microkayla chapi</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA942FFFAFD2C0D2AF7F6B4B8" box="[661,747,877,898]" pageId="20" pageNumber="149" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
from the type locality in Sina, Peru. (AB) Adult female holotype (MUBI 5326, SVL 19.9 mm). (CD) Adult male (MNCN 43767, SVL 17.3 mm).
</paragraph>
</caption>
<paragraph id="8BBB9864A942FFFAFF100891F003B2E2" blockId="20.[145,762,983,1925]" lastBlockId="20.[809,1426,983,1496]" pageId="20" pageNumber="149">
<taxonomicName id="4C04E3E7A942FFFAFF100891F46AB1D1" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[169,375,1750,1771]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chapi" status="sp. nov.">
<emphasis id="B9704476A942FFFAFF100891F46AB1D1" box="[169,375,1750,1771]" italics="true" pageId="20" pageNumber="149">Microkayla chapi</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA942FFFAFE390891F4CAB1D1" box="[384,471,1750,1771]" pageId="20" pageNumber="149" rank="species">sp. nov.</taxonomicNameLabel>
is readily distinguished from both
<taxonomicName id="4C04E3E7A942FFFAFEBE08B2F493B033" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[263,398,1780,1802]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A942FFFAFEBE08B2F493B033" box="[263,398,1780,1802]" italics="true" pageId="20" pageNumber="149">M. boettgeri</emphasis>
</taxonomicName>
and
<taxonomicName id="4C04E3E7A942FFFAFE7E08B2F726B033" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[455,571,1780,1802]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chilina" status="sp. nov.">
<emphasis id="B9704476A942FFFAFE7E08B2F726B033" box="[455,571,1780,1802]" italics="true" pageId="20" pageNumber="149">M. chilina</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA942FFFAFDFB08B2F788B030" box="[578,661,1781,1802]" pageId="20" pageNumber="149" rank="species">sp. nov.</taxonomicNameLabel>
(the two other Peruvian species) by having sharp and well-developed dorsolateral folds, occipital and sacral sharp warts and folds, a large and conspicuous tympanic membrane that is longer than 50% of eye length, and longer toes, less areolate belly, and smooth to granular skin. On the Bolivian side of the Cordillera of Apolobamba, the species
<taxonomicName id="4C04E3E7A942FFFAFCE40A52F6CCB313" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Aparicio" baseAuthorityYear="2016" box="[861,977,1044,1066]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chaupi">
<emphasis id="B9704476A942FFFAFCE40A52F6CCB313" box="[861,977,1044,1066]" italics="true" pageId="20" pageNumber="149">M. chaupi</emphasis>
</taxonomicName>
and
<taxonomicName id="4C04E3E7A942FFFAFBB40A52F1B9B313" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Martinez-Solano" baseAuthorityYear="2007" box="[1037,1188,1044,1066]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="katantika">
<emphasis id="B9704476A942FFFAFBB40A52F1B9B313" box="[1037,1188,1044,1066]" italics="true" pageId="20" pageNumber="149">M. katantika</emphasis>
</taxonomicName>
occur 37.6 and
<quantity id="4CFC3581A942FFFAFAD90A52F653B373" metricMagnitude="4" metricUnit="m" metricValue="3.9799999999999995" pageId="20" pageNumber="149" unit="km" value="39.8">39.8 km</quantity>
straight line distance, respectively, from
<taxonomicName id="4C04E3E7A942FFFAFA910A73F097B372" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1320,1418,1075,1097]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A942FFFAFA910A73F097B372" box="[1320,1418,1075,1097]" italics="true" pageId="20" pageNumber="149">M. chapi</emphasis>
</taxonomicName>
.
<taxonomicName id="4C04E3E7A942FFFAFC900A15F6F7B35D" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[809,1002,1106,1127]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A942FFFAFC900A15F6F7B35D" box="[809,1002,1106,1127]" italics="true" pageId="20" pageNumber="149">Microkayla chapi</emphasis>
</taxonomicName>
differs from
<taxonomicName id="4C04E3E7A942FFFAFBC00A15F1F5B35D" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Aparicio" baseAuthorityYear="2016" box="[1145,1256,1106,1127]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chaupi">
<emphasis id="B9704476A942FFFAFBC00A15F1F5B35D" box="[1145,1256,1106,1127]" italics="true" pageId="20" pageNumber="149">M. chaupi</emphasis>
</taxonomicName>
mostly by having conspicuous dorsolateral folds (absent in
<taxonomicName id="4C04E3E7A942FFFAFAA70A36F09EB3BF" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Aparicio" baseAuthorityYear="2016" box="[1310,1411,1136,1158]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chaupi">
<emphasis id="B9704476A942FFFAFAA70A36F09EB3BF" box="[1310,1411,1136,1158]" italics="true" pageId="20" pageNumber="149">P. chaupi</emphasis>
</taxonomicName>
), ventral coloration variable from grey with shades of red to dark grey with yellow spots (uniformly greyish-brown) and ventral skin areolate (finely granular).
<taxonomicName id="4C04E3E7A942FFFAFC900AACF6EEB23A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[809,1011,1259,1280]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A942FFFAFC900AACF6EEB23A" box="[809,1011,1259,1280]" italics="true" pageId="20" pageNumber="149">Microkayla chapi</emphasis>
</taxonomicName>
differs from
<taxonomicName id="4C04E3E7A942FFFAFB370AABF038B23A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Martinez-Solano" baseAuthorityYear="2007" box="[1166,1317,1259,1281]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="katantika">
<emphasis id="B9704476A942FFFAFB370AABF038B23A" box="[1166,1317,1259,1281]" italics="true" pageId="20" pageNumber="149">M. katantika</emphasis>
</taxonomicName>
by being smaller (maximum SVL in
<taxonomicName id="4C04E3E7A942FFFAFBE30B4DF1A6B225" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1114,1211,1290,1311]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A942FFFAFBE30B4DF1A6B225" box="[1114,1211,1290,1311]" italics="true" pageId="20" pageNumber="149">M. chapi</emphasis>
</taxonomicName>
<quantity id="4CFC3581A942FFFAFB780B4DF039B225" box="[1217,1316,1290,1312]" metricMagnitude="-2" metricUnit="m" metricValue="2.16" pageId="20" pageNumber="149" unit="mm" value="21.6">21.6 mm</quantity>
,
<quantity id="4CFC3581A942FFFAFA960B4DF08CB225" box="[1327,1425,1290,1311]" metricMagnitude="-2" metricUnit="m" metricValue="2.77" pageId="20" pageNumber="149" unit="mm" value="27.7">27.7 mm</quantity>
in
<taxonomicName id="4C04E3E7A942FFFAFCF00B6EF6F9B207" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Martinez-Solano" baseAuthorityYear="2007" box="[841,996,1320,1342]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="katantika">
<emphasis id="B9704476A942FFFAFCF00B6EF6F9B207" box="[841,996,1320,1342]" italics="true" pageId="20" pageNumber="149">M. katantika</emphasis>
</taxonomicName>
), having dorsolateral folds (absent) and dorsal and ventral coloration variable (uniformly dark brown or grey). In addition,
<taxonomicName id="4C04E3E7A942FFFAFB130B21F013B241" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1194,1294,1382,1403]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A942FFFAFB130B21F013B241" box="[1194,1294,1382,1403]" italics="true" pageId="20" pageNumber="149">M. chapi</emphasis>
</taxonomicName>
can be distinguished from all other species of
<taxonomicName id="4C04E3E7A942FFFAFB710BC3F054B2A3" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1224,1353,1412,1433]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="20" pageNumber="149" phylum="Chordata" rank="genus">
<emphasis id="B9704476A942FFFAFB710BC3F054B2A3" box="[1224,1353,1412,1433]" italics="true" pageId="20" pageNumber="149">Microkayla</emphasis>
</taxonomicName>
by its sharp dorsal ridges and warts, a conspicuous tympanic membrane, and red flash marks in the groin.
</paragraph>
<paragraph id="8BBB9864A942FFF8FC900BB9F7DBB5FF" blockId="20.[809,1425,1534,1924]" lastBlockId="22.[145,761,197,1108]" lastPageId="22" lastPageNumber="151" pageId="20" pageNumber="149">
<emphasis id="B9704476A942FFFAFC900BB9F144B129" box="[809,1113,1534,1555]" italics="true" pageId="20" pageNumber="149">
Description of the
<typeStatus id="54BF26C6A942FFFAFC430BB9F144B129" box="[1018,1113,1534,1555]" pageId="20" pageNumber="149" type="holotype">holotype</typeStatus>
</emphasis>
: An adult female,
<quantity id="4CFC3581A942FFFAFA940BB9F08CB129" box="[1325,1425,1534,1555]" metricMagnitude="-2" metricUnit="m" metricValue="1.9899999999999998" pageId="20" pageNumber="149" unit="mm" value="19.9">19.9 mm</quantity>
SVL. Body robust; dorsal skin shagreen, with irregular warts scattered all over, and a pair of dorsolateral folds becoming inconspicuous ridges at level of midbody; ventral skin areolate pectoral fold absent; head wider than long, HW 34.7% of SVL, HL 31.1% of SVL; snout moderately short, rounded in dorsal view and in profile; nostrils not prominent, slightly closer to snout than to eyes; canthus rostralis sharp, straight in dorsal view and lateral profile; eye-nostril distance 58.3% of eye length; loreal region faintly concave; cranial crests absent; tympanic membrane and tympanic annulus perceptible beneath skin; supratympanic fold prominent; tongue large, oval; choanae small, broadly separated; dentigerous processes of vomers absent; limbs short; fingers short, lacking fringes, tips of digits round, lacking circumferential grooves and ungual flap; ulnar tubercle and fold absent, but a row of low warts forming a ridge; inner palmar tubercle oval, smaller than round outer; fingers moderately short, not fringed; subarticular tubercles of the base of fingers large, round, swollen; supernumerary tubercles round, barely visible; relative length of fingers 1 &lt;2 &lt;4 &lt;3; tibia length 30.1% of SVL; tarsal fold absent; two metatarsal tubercles, oval inner slightly smaller than round outer; supernumerary tubercles round, poorly marked; subarticular tubercles round; toes lacking basal webbing or lateral fringes, toe tips round, lacking circumferential groves and ungual flap; relative length of toes 1 &lt;2 &lt;3 = 5 &lt;4; foot length 36.2% of SVL.
</paragraph>
<caption id="DF7BC8ECA943FFFBFF1A0808F400B009" pageId="21" pageNumber="150" startId="21.[163,244,1615,1637]" targetBox="[325,1283,196,1574]" targetPageId="21" targetType="figure">
<paragraph id="8BBB9864A943FFFBFF1A0808F400B009" blockId="21.[163,1444,1615,1843]" pageId="21" pageNumber="150">
<emphasis id="B9704476A943FFFBFF1A0808F401B15E" bold="true" box="[163,284,1615,1637]" pageId="21" pageNumber="150">Figure 10.</emphasis>
Map of south-eastern Peru and central Bolivia showing the distribution (type localities only) of the three nominal species of
<taxonomicName id="4C04E3E7A943FFFBFED5082AF73AB1B9" authorityName="HEDGES, DUELLMAN, &amp; HEINICKE" authorityYear="2008" box="[364,551,1645,1667]" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="genus">
<emphasis id="B9704476A943FFFBFED5082AF73AB1B9" box="[364,551,1645,1667]" italics="true" pageId="21" pageNumber="150">Psychrophrynella</emphasis>
</taxonomicName>
(squares), and 24 nominal and four unnamed species of
<emphasis id="B9704476A943FFFBFBC4082BF06FB1B8" bold="true" box="[1149,1394,1644,1666]" pageId="21" pageNumber="150">
<taxonomicName id="4C04E3E7A943FFFBFBC4082BF019B1B8" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1149,1284,1644,1666]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="genus" status="gen. nov.">
<emphasis id="B9704476A943FFFBFBC4082BF019B1B8" bold="true" box="[1149,1284,1644,1666]" italics="true" pageId="21" pageNumber="150">Microkayla</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA943FFFBFAB3082AF06FB1B8" box="[1290,1394,1645,1666]" pageId="21" pageNumber="150" rank="genus">gen. nov.</taxonomicNameLabel>
</emphasis>
(circles).
<taxonomicName id="4C04E3E7A943FFFBFF6708CDF484B19A" authorityName="HEDGES, DUELLMAN, &amp; HEINICKE" authorityYear="2008" box="[222,409,1674,1696]" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="genus">
<emphasis id="B9704476A943FFFBFF6708CDF484B19A" box="[222,409,1674,1696]" italics="true" pageId="21" pageNumber="150">Psychrophrynella</emphasis>
</taxonomicName>
: (1)
<taxonomicName id="4C04E3E7A943FFFBFE7108CCF757B19A" authorityName="De la Riva, Chaparro &amp; Padial" authorityYear="2008" box="[456,586,1675,1696]" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="usurpator">
<emphasis id="B9704476A943FFFBFE7108CCF757B19A" box="[456,586,1675,1696]" italics="true" pageId="21" pageNumber="150">P. usurpator</emphasis>
</taxonomicName>
; (2)
<taxonomicName id="4C04E3E7A943FFFBFDC108CCF63EB19A" authorityName="Catenazzi &amp; Ttito" authorityYear="2016" box="[632,803,1674,1696]" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="chirihampatu">
<emphasis id="B9704476A943FFFBFDC108CCF63EB19A" box="[632,803,1674,1696]" italics="true" pageId="21" pageNumber="150">P. chirihampatu</emphasis>
</taxonomicName>
; (3)
<emphasis id="B9704476A943FFFBFCEB08CCF14DB19A" box="[850,1104,1674,1696]" italics="true" pageId="21" pageNumber="150">
<taxonomicName id="4C04E3E7A943FFFBFCEB08CCF6D0B19A" baseAuthorityName="Lynch" baseAuthorityYear="1986" box="[850,973,1674,1696]" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="bagrecito">P. bagrecito</taxonomicName>
.
<taxonomicName id="4C04E3E7A943FFFBFC6E08CDF14DB19A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[983,1104,1674,1696]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="genus">Microkayla</taxonomicName>
</emphasis>
: (1)
<taxonomicName id="4C04E3E7A943FFFBFBC708CCF1E1B19A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[1150,1276,1674,1696]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A943FFFBFBC708CCF1E1B19A" box="[1150,1276,1674,1696]" italics="true" pageId="21" pageNumber="150">M. boettgeri</emphasis>
</taxonomicName>
; (2)
<emphasis id="B9704476A943FFFBFA9308CDF5E1B187" bold="true" pageId="21" pageNumber="150">
<taxonomicName id="4C04E3E7A943FFFBFA9308CDF0BFB19A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1322,1442,1674,1696]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="chilina" status="sp. nov.">
<emphasis id="B9704476A943FFFBFA9308CDF0BFB19A" bold="true" box="[1322,1442,1674,1696]" italics="true" pageId="21" pageNumber="150">M. chilina</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA943FFFBFF1A08EFF5E1B187" box="[163,252,1704,1725]" pageId="21" pageNumber="150" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
; (3)
<emphasis id="B9704476A943FFFBFE9408EFF4E9B187" bold="true" box="[301,500,1703,1725]" pageId="21" pageNumber="150">
<taxonomicName id="4C04E3E7A943FFFBFE9408EFF48EB187" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[301,403,1703,1725]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="chapi" status="sp. nov.">
<emphasis id="B9704476A943FFFBFE9408EFF48EB187" bold="true" box="[301,403,1703,1725]" italics="true" pageId="21" pageNumber="150">M. chapi</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA943FFFBFE2208EFF4E9B187" box="[411,500,1704,1725]" pageId="21" pageNumber="150" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
; (4)
<taxonomicName id="4C04E3E7A943FFFBFD9C08EFF7B2B187" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Martinez-Solano" baseAuthorityYear="2007" box="[549,687,1703,1725]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="katantika">
<emphasis id="B9704476A943FFFBFD9C08EFF7B2B187" box="[549,687,1703,1725]" italics="true" pageId="21" pageNumber="150">M. katantika</emphasis>
</taxonomicName>
; (5)
<taxonomicName id="4C04E3E7A943FFFBFD5808EFF651B187" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Aparicio" baseAuthorityYear="2016" box="[737,844,1703,1725]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="chaupi">
<emphasis id="B9704476A943FFFBFD5808EFF651B187" box="[737,844,1703,1725]" italics="true" pageId="21" pageNumber="150">M. chaupi</emphasis>
</taxonomicName>
; (6)
<taxonomicName id="4C04E3E7A943FFFBFCC408EFF6CFB187" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva, Aparicio, Soto &amp; Rios" baseAuthorityYear="2016" box="[893,978,1703,1725]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="colla">
<emphasis id="B9704476A943FFFBFCC408EFF6CFB187" box="[893,978,1703,1725]" italics="true" pageId="21" pageNumber="150">M. colla</emphasis>
</taxonomicName>
; (7)
<taxonomicName id="4C04E3E7A943FFFBFBBA08EFF1ABB187" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva, Rios &amp; Aparicio" baseAuthorityYear="2016" box="[1027,1206,1703,1725]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="melanocheira">
<emphasis id="B9704476A943FFFBFBBA08EFF1ABB187" box="[1027,1206,1703,1725]" italics="true" pageId="21" pageNumber="150">M. melanocheira</emphasis>
</taxonomicName>
; (8)
<taxonomicName id="4C04E3E7A943FFFBFB5E08EFF064B187" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Martinez-Solano" baseAuthorityYear="2007" box="[1255,1401,1703,1725]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="kallawaya">
<emphasis id="B9704476A943FFFBFB5E08EFF064B187" box="[1255,1401,1703,1725]" italics="true" pageId="21" pageNumber="150">M. kallawaya</emphasis>
</taxonomicName>
; (9)
<taxonomicName id="4C04E3E7A943FFFBFF1A0882F414B1E0" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva" baseAuthorityYear="2007" box="[163,265,1733,1754]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="guillei">
<emphasis id="B9704476A943FFFBFF1A0882F414B1E0" box="[163,265,1733,1754]" italics="true" pageId="21" pageNumber="150">M. guillei</emphasis>
</taxonomicName>
; (10)
<taxonomicName id="4C04E3E7A943FFFBFEFE0882F4A1B1E0" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva, Reichle &amp; Bosch" baseAuthorityYear="2007" box="[327,444,1733,1754]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="saltator">
<emphasis id="B9704476A943FFFBFEFE0882F4A1B1E0" box="[327,444,1733,1754]" italics="true" pageId="21" pageNumber="150">M. saltator</emphasis>
</taxonomicName>
; (11)
<taxonomicName id="4C04E3E7A943FFFBFE430882F75AB1E0" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva, Reichle &amp; Cortez" baseAuthorityYear="2007" box="[506,583,1733,1754]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="iani">
<emphasis id="B9704476A943FFFBFE430882F75AB1E0" box="[506,583,1733,1754]" italics="true" pageId="21" pageNumber="150">M. iani</emphasis>
</taxonomicName>
; (12)
<taxonomicName id="4C04E3E7A943FFFBFD3C0882F7E1B1E0" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva, Reichle &amp; Padial" baseAuthorityYear="2007" box="[645,764,1733,1754]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="illampu">
<emphasis id="B9704476A943FFFBFD3C0882F7E1B1E0" box="[645,764,1733,1754]" italics="true" pageId="21" pageNumber="150">M. illampu</emphasis>
</taxonomicName>
; (13)
<taxonomicName id="4C04E3E7A943FFFBFC800882F6D3B1E0" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Padial &amp; De la Riva" baseAuthorityYear="2007" box="[825,974,1733,1754]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="ankohuma">
<emphasis id="B9704476A943FFFBFC800882F6D3B1E0" box="[825,974,1733,1754]" italics="true" pageId="21" pageNumber="150">M. ankohuma</emphasis>
</taxonomicName>
; (14)
<taxonomicName id="4C04E3E7A943FFFBFBB20882F18DB1E0" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva, Aguayo &amp; Padial" baseAuthorityYear="2007" box="[1035,1168,1733,1754]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="condoriri">
<emphasis id="B9704476A943FFFBFBB20882F18DB1E0" box="[1035,1168,1733,1754]" italics="true" pageId="21" pageNumber="150">M. condoriri</emphasis>
</taxonomicName>
; (15)
<taxonomicName id="4C04E3E7A943FFFBFB740882F038B1E0" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Burrowes" baseAuthorityYear="2014" box="[1229,1317,1733,1754]" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="teqta">
<emphasis id="B9704476A943FFFBFB740882F038B1E0" box="[1229,1317,1733,1754]" italics="true" pageId="21" pageNumber="150">M. teqta</emphasis>
</taxonomicName>
; (16)
<emphasis id="B9704476A943FFFBFADB0882F062B1E0" box="[1378,1407,1733,1754]" italics="true" pageId="21" pageNumber="150">M.</emphasis>
sp. Coscapa; (17)
<taxonomicName id="4C04E3E7A943FFFBFEFA08A4F4C4B1C2" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva, Padial &amp; Cortez" baseAuthorityYear="2007" box="[323,473,1762,1784]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="chacaltaya">
<emphasis id="B9704476A943FFFBFEFA08A4F4C4B1C2" box="[323,473,1762,1784]" italics="true" pageId="21" pageNumber="150">M. chacaltaya</emphasis>
</taxonomicName>
; (18)
<taxonomicName id="4C04E3E7A943FFFBFDAF08A4F7CBB1C2" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva, Padial &amp; Cortez" baseAuthorityYear="2007" box="[534,726,1762,1784]" class="Amphibia" family="Craugastoridae" genus="Microkayla" isUncertain="true" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="chacaltaya">
<emphasis id="B9704476A943FFFBFDAF08A4F72EB1C2" box="[534,563,1763,1784]" italics="true" pageId="21" pageNumber="150">M.</emphasis>
aff.
<emphasis id="B9704476A943FFFBFDDB08A5F7CBB1C2" box="[610,726,1762,1784]" italics="true" pageId="21" pageNumber="150">chacaltaya</emphasis>
</taxonomicName>
; (19)
<taxonomicName id="4C04E3E7A943FFFBFCAA08A4F680B1C2" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Parker" baseAuthorityYear="1932" box="[787,925,1762,1784]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="wettsteini">
<emphasis id="B9704476A943FFFBFCAA08A4F680B1C2" box="[787,925,1762,1784]" italics="true" pageId="21" pageNumber="150">M. wettsteini</emphasis>
</taxonomicName>
; (20)
<taxonomicName id="4C04E3E7A943FFFBFC6308A4F149B1C2" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Padial" baseAuthorityYear="2007" box="[986,1108,1762,1784]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="illimani">
<emphasis id="B9704476A943FFFBFC6308A4F149B1C2" box="[986,1108,1762,1784]" italics="true" pageId="21" pageNumber="150">M. illimani</emphasis>
</taxonomicName>
; (21)
<taxonomicName id="4C04E3E7A943FFFBFB2808A4F019B1C2" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Harvey &amp; Ergueta" baseAuthorityYear="1998" box="[1169,1284,1762,1784]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="pinguis">
<emphasis id="B9704476A943FFFBFB2808A4F019B1C2" box="[1169,1284,1762,1784]" italics="true" pageId="21" pageNumber="150">M. pinguis</emphasis>
</taxonomicName>
; (22)
<taxonomicName id="4C04E3E7A943FFFBFAF808A4F5E1B02F" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva, Reichle &amp; Bosch" baseAuthorityYear="2007" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="quimsacruzis">
<emphasis id="B9704476A943FFFBFAF808A4F5E1B02F" italics="true" pageId="21" pageNumber="150">M. quimsacruzis</emphasis>
</taxonomicName>
; (23)
<emphasis id="B9704476A943FFFBFE850947F444B02F" box="[316,345,1792,1813]" italics="true" pageId="21" pageNumber="150">M.</emphasis>
sp. Khatu River; (24)
<taxonomicName id="4C04E3E7A943FFFBFDE00947F7D0B02F" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Munoz, Aguayo &amp; De la Riva" baseAuthorityYear="2007" box="[601,717,1791,1813]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="harveyi">
<emphasis id="B9704476A943FFFBFDE00947F7D0B02F" box="[601,717,1791,1813]" italics="true" pageId="21" pageNumber="150">M. harveyi</emphasis>
</taxonomicName>
; (25)
<taxonomicName id="4C04E3E7A943FFFBFCB40947F68FB02F" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Aguayo-Vedia &amp; Harvey" baseAuthorityYear="2001" box="[781,914,1791,1813]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="iatamasi">
<emphasis id="B9704476A943FFFBFCB40947F68FB02F" box="[781,914,1791,1813]" italics="true" pageId="21" pageNumber="150">M. iatamasi</emphasis>
</taxonomicName>
; (26)
<emphasis id="B9704476A943FFFBFC6B0947F6F2B02F" box="[978,1007,1792,1813]" italics="true" pageId="21" pageNumber="150">M.</emphasis>
sp. Utururo; (27)
<taxonomicName id="4C04E3E7A943FFFBFB060947F076B02F" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Aguayo-Vedia &amp; Harvey" baseAuthorityYear="2001" box="[1215,1387,1791,1813]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="adenopleura">
<emphasis id="B9704476A943FFFBFB060947F076B02F" box="[1215,1387,1791,1813]" italics="true" pageId="21" pageNumber="150">M. adenopleura</emphasis>
</taxonomicName>
; (28)
<taxonomicName id="4C04E3E7A943FFFBFF1A095AF404B009" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva" baseAuthorityYear="1992" box="[163,281,1821,1843]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="21" pageNumber="150" phylum="Chordata" rank="species" species="kempffi">M. kempffi</taxonomicName>
.
</paragraph>
</caption>
<paragraph id="8BBB9864A940FFF8FF100C88F794B36E" blockId="22.[145,761,197,1108]" pageId="22" pageNumber="151">In preservative, dorsum brown with a pale middorsal thin line; venter and throat mostly cream with irregular brown areas; a pair of large and conspicuous bold black lumbar spots surrounded by a thin white line; a white thin line along posterior surface of thigh, from cloaca to level of shanks; axillae, groins and inner surface of forearms and shanks cream. In life, the dorsum was mostly uniformly brown above, with some pale areas; it had small reddish-orange irregular areas on axillae and groins; the venter was pale brown with irregular darker areas; the digits were reddish-orange; the iris was dark brown below and greenish-yellow in the upper third, with fine black reticulation.</paragraph>
<paragraph id="8BBB9864A940FFF8FC900E81F69DB62D" blockId="22.[809,1424,197,280]" pageId="22" pageNumber="151">
<emphasis id="B9704476A940FFF8FC900E81F01CB7E0" box="[809,1281,197,219]" italics="true" pageId="22" pageNumber="151">
Measurements (in mm) of the
<typeStatus id="54BF26C6A940FFF8FB250E82F01CB7E0" box="[1180,1281,197,218]" pageId="22" pageNumber="151" type="holotype">holotype</typeStatus>
</emphasis>
: SVL, 19.9; HL, 6.2; HW, 6.9; IND, 1.6; END, 1.4; ED, 2.4; TL, 6.0; FL, 7.2.
</paragraph>
<paragraph id="8BBB9864A940FFF8FC900F05F1EBB43E" blockId="22.[809,1425,321,772]" pageId="22" pageNumber="151">
<emphasis id="B9704476A940FFF8FC900F05F689B66D" box="[809,916,322,343]" italics="true" pageId="22" pageNumber="151">Variation</emphasis>
:
<materialsCitation id="3B6C9239A940FFF8FC260F06F090B689" collectionCode="MUBI" pageId="22" pageNumber="151" specimenCode="MUBI 5327, 5328" specimenCount="2" typeStatus="holotype">
The
<typeStatus id="54BF26C6A940FFF8FC680F06F12FB66D" box="[977,1074,321,343]" pageId="22" pageNumber="151" type="holotype">holotype</typeStatus>
has less warty dorsal skin, but
<typeStatus id="54BF26C6A940FFF8FC900F27F6F5B64C" box="[809,1000,352,374]" isOtherTypeStatus="true" pageId="22" pageNumber="151">other specimens</typeStatus>
have larger and sharper warts and short folds, sometimes forming short discontinuous dorsolateral or middorsal ridges (
<specimenCode id="DBA2301FA940FFF8FB0B0FDAF020B689" box="[1202,1341,413,435]" collectionCode="MUBI" pageId="22" pageNumber="151">MUBI 5327</specimenCode>
,
<specimenCode id="DBA2301FA940FFF8FAF30FDAF098B689" box="[1354,1413,413,435]" collectionCode="MUBI" pageId="22" pageNumber="151">5328</specimenCode>
)
</materialsCitation>
.
<materialsCitation id="3B6C9239A940FFF8FC900FFBF185B535" collectionCode="MUBI" pageId="22" pageNumber="151" specimenCode="MUBI 5331" specimenCount="1" typeStatus="holotype">
The overall coloration is more or less similar in all specimens examined, while venter varies from almost uniformly cream (
<specimenCode id="DBA2301FA940FFF8FBBB0FBEF18DB535" box="[1026,1168,505,527]" collectionCode="MUBI" pageId="22" pageNumber="151">MUBI 5331</specimenCode>
)
</materialsCitation>
<materialsCitation id="3B6C9239A940FFF8FB180FBEF1E8B517" collectionCode="MUBI" pageId="22" pageNumber="151" specimenCode="MUBI 5325, 5330" specimenCount="1" typeStatus="holotype">
to almost uniformly dark greenish-brown (
<specimenCode id="DBA2301FA940FFF8FB9D0C5FF1B1B517" box="[1060,1196,535,557]" collectionCode="MUBI" pageId="22" pageNumber="151">MUBI 5325</specimenCode>
,
<specimenCode id="DBA2301FA940FFF8FB0E0C50F1F2B517" box="[1207,1263,535,557]" collectionCode="MUBI" pageId="22" pageNumber="151">5330</specimenCode>
)
</materialsCitation>
<materialsCitation id="3B6C9239A940FFF8FB450C5FF67AB551" collectionCode="MUBI" pageId="22" pageNumber="151" specimenCode="MUBI 5329" specimenCount="1" typeStatus="holotype">
and all intermediate patterns; the throat varies from cream (
<specimenCode id="DBA2301FA940FFF8FAF00C71F67CB551" collectionCode="MUBI" pageId="22" pageNumber="151">MUBI 5329</specimenCode>
)
</materialsCitation>
<materialsCitation id="3B6C9239A940FFF8FCD60C12F16CB551" box="[879,1137,597,619]" collectionCode="MUBI" pageId="22" pageNumber="151" specimenCode="MUBI 5330" specimenCount="1" typeStatus="holotype">
to brown (
<specimenCode id="DBA2301FA940FFF8FC580C12F174B551" box="[993,1129,597,619]" collectionCode="MUBI" pageId="22" pageNumber="151">MUBI 5330</specimenCode>
)
</materialsCitation>
;
<materialsCitation id="3B6C9239A940FFF8FBC50C12F091B5B3" collectionCode="MUBI" pageId="22" pageNumber="151" specimenCode="MUBI 5330" specimenCount="1" typeStatus="holotype">
the pale lines of the posterior surface of thighs can be absent (
<specimenCode id="DBA2301FA940FFF8FB4F0C33F099B5B3" box="[1270,1412,627,649]" collectionCode="MUBI" pageId="22" pageNumber="151">MUBI 5330</specimenCode>
)
</materialsCitation>
;
<materialsCitation id="3B6C9239A940FFF8FC900CD4F6D4B5FD" collectionCode="MNCN" pageId="22" pageNumber="151" specimenCode="MNCN 43765, 43766" specimenCount="1" typeStatus="holotype">
some specimens have an inguinal dark spot (
<specimenCode id="DBA2301FA940FFF8FA840CD5F672B5FD" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="22" pageNumber="151" type="Museum">MNCN 43765</specimenCode>
,
<specimenCode id="DBA2301FA940FFF8FCC30CF6F6DCB5FD" box="[890,961,689,711]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="22" pageNumber="151" type="Museum">43766</specimenCode>
)
</materialsCitation>
;
<materialsCitation id="3B6C9239A940FFF8FC6D0CF6F1B5B5DF" collectionCode="MUBI" pageId="22" pageNumber="151" specimenCode="MUBI 5330" specimenCount="1" typeStatus="holotype">
the tympanic annulus can be appreciable beneath the skin (
<specimenCode id="DBA2301FA940FFF8FBA20C97F1BCB5DF" box="[1051,1185,719,741]" collectionCode="MUBI" pageId="22" pageNumber="151">MUBI 5330</specimenCode>
)
</materialsCitation>
<materialsCitation id="3B6C9239A940FFF8FB170C97F093B5DF" box="[1198,1422,719,741]" collectionCode="MUBI" pageId="22" pageNumber="151" specimenCode="MUBI 5327" specimenCount="1" typeStatus="holotype">
or not (
<specimenCode id="DBA2301FA940FFF8FB470C97F09BB5DF" box="[1278,1414,719,741]" collectionCode="MUBI" pageId="22" pageNumber="151">MUBI 5327</specimenCode>
)
</materialsCitation>
. For morphometric variation, see
<tableCitation id="C686ADDFA940FFF8FB250CA9F1EDB439" box="[1180,1264,750,772]" captionStart="Table 3" captionStartId="12.[142,206,698,720]" captionText="Table 3. Morphometrics for new Peruvian species of Bryophryne and Microkayla (range, in parenthesis, follows mean; AM, adult males; AF, adult females)" pageId="22" pageNumber="151">Table 3</tableCitation>
.
</paragraph>
<paragraph id="8BBB9864A940FFF9FC900D6AF777B60C" blockId="22.[809,1425,813,1111]" lastBlockId="23.[163,779,197,311]" lastPageId="23" lastPageNumber="152" pageId="22" pageNumber="151">
<emphasis id="B9704476A940FFF8FC900D6AF1ACB478" box="[809,1201,813,834]" italics="true" pageId="22" pageNumber="151">Distribution and natural history</emphasis>
: Known only from the
<typeStatus id="54BF26C6A940FFF8FCEC0D0BF69BB45B" box="[853,902,844,865]" pageId="22" pageNumber="151">type</typeStatus>
locality. Individuals were found by day under stones, in highly humid wet puna/elfin forest, and were common in only a very small area (
<emphasis id="B9704476A940FFF8FB470DCDF012B4A5" box="[1278,1295,906,927]" italics="true" pageId="22" pageNumber="151">c.</emphasis>
3 has), but no individuals were found beyond that point, despite the same kind of habitat being found over a larger area (
<figureCitation id="133F84E1A940FFF8FC880DA2F663B4C0" box="[817,894,997,1019]" captionStart="Figure 11" captionStartId="22.[145,223,1848,1870]" captionTargetBox="[305,1265,1171,1809]" captionTargetId="figure-537@22.[305,1265,1171,1809]" captionTargetPageId="22" captionText="Figure 11. Habitat at the type locality of Microkayla chapi sp. nov. near Sina, Hirigache River valley, province Sandia, department Puno, Peru, 3504 m a.s.l." pageId="22" pageNumber="151">Fig. 11</figureCitation>
). At night, with mist and full moon and an air temperature of 10 °C, males called with low intensity from inside moss on the ground and on stones. The call consisted of a single non-pulsed note, modulated in amplitude, with most intensity distributed between 3000 and 3300 Hz, a duration of 7291 ms, emitted at a rate of 2.610.4 notes/minute (
<figureCitation id="133F84E1A941FFF9FDA30F45F774B622" box="[538,617,258,280]" captionStart="Figure 12" captionStartId="23.[163,245,1284,1306]" captionTargetBox="[168,775,484,1243]" captionTargetId="figure-398@23.[167,775,483,1244]" captionTargetPageId="23" captionText="Figure 12. Oscillogram and sound spectrogram of the advertisement call of Microkayla chapi sp. nov. (MNCN 43764), recorded on 10 February 2006 at Hirigache river valley, Sina, Puno, Peru. Air temperature, 10 °C." pageId="23" pageNumber="152">Fig. 12</figureCitation>
,
<tableCitation id="C686ADDFA941FFF9FDCC0F45F7D7B622" box="[629,714,258,280]" captionStart="Table 4" captionStartId="23.[163,227,1438,1459]" captionText="Table 4. Numerical parameters of the advertisement calls of two Peruvian species of Microkayla" pageId="23" pageNumber="152">Table 4</tableCitation>
) (call record number 8217, www.fonozoo.com).
</paragraph>
<caption id="DF7BC8ECA940FFF8FF28097FF709B056" pageId="22" pageNumber="151" startId="22.[145,223,1848,1870]" targetBox="[305,1265,1171,1809]" targetPageId="22" targetType="figure">
<paragraph id="8BBB9864A940FFF8FF28097FF709B056" blockId="22.[145,1425,1848,1900]" pageId="22" pageNumber="151">
<emphasis id="B9704476A940FFF8FF28097FF41AB077" bold="true" box="[145,263,1848,1870]" pageId="22" pageNumber="151">Figure 11.</emphasis>
Habitat at the type locality of
<emphasis id="B9704476A940FFF8FDF4097FF66BB074" bold="true" box="[589,886,1848,1870]" pageId="22" pageNumber="151">
<taxonomicName id="4C04E3E7A940FFF8FDF4097FF604B074" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[589,793,1848,1870]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="22" pageNumber="151" phylum="Chordata" rank="species" species="chapi" status="sp. nov.">
<emphasis id="B9704476A940FFF8FDF4097FF604B074" bold="true" box="[589,793,1848,1870]" italics="true" pageId="22" pageNumber="151">Microkayla chapi</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA940FFF8FC99097EF66BB074" box="[800,886,1849,1870]" pageId="22" pageNumber="151" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
near
<taxonomicName id="4C04E3E7A940FFF8FC0A097EF188B075" authority=", Hirigache River" authorityName="Hirigache River" box="[947,1173,1849,1871]" class="Insecta" family="Nolidae" genus="Sina" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" order="Lepidoptera" pageId="22" pageNumber="151" phylum="Arthropoda" rank="genus">Sina, Hirigache River</taxonomicName>
valley, province Sandia, department Puno, Peru, 3504 m a.s.l.
</paragraph>
</caption>
<paragraph id="8BBB9864A941FFF9FF1A0F27F143B688" blockId="23.[163,780,352,435]" lastBlockId="23.[827,1443,197,434]" pageId="23" pageNumber="152">
<emphasis id="B9704476A941FFF9FF1A0F27F403B64F" box="[163,286,352,373]" italics="true" pageId="23" pageNumber="152">Etymology</emphasis>
: The species epithet is used as a name in apposition, and derives from the word chapi, meaning tin in Quechua, or Ch
<emphasis id="B9704476A941FFF9FE260FDBF4B8B689" box="[415,421,412,435]" italics="true" pageId="23" pageNumber="152"></emphasis>
api, meaning thorn in Aymara. We use the two meanings of chapi to refer to the thorns in the skin of the new species and to the tin roofs of the miners shacks in La Rinconada (
<quantity id="4CFC3581A941FFF9FAF90F45F08AB622" box="[1344,1431,258,280]" metricMagnitude="3" metricUnit="m" metricValue="5.1" pageId="23" pageNumber="152" unit="m" value="5100.0">5100 m</quantity>
), a gold mine and the highest village in the world, close to the
<typeStatus id="54BF26C6A941FFF9FC300F07F6A1B66F" box="[905,956,320,341]" pageId="23" pageNumber="152">type</typeStatus>
locality of this species. Chapi is also the name of a mountain (
<quantity id="4CFC3581A941FFF9FB8D0F19F191B64E" box="[1076,1164,350,372]" metricMagnitude="3" metricUnit="m" metricValue="5.4" pageId="23" pageNumber="152" unit="m" value="5400.0">5400 m</quantity>
) near La Rinconada, on the border of the districts of Ananea and Sina, in the cordillera of Apolobamba.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,197 @@
<document id="E7765C0F05B78D3F140AEE1E544224E7" ID-ISSN="0024-4082" ID-ZooBank="B2DCFB0-BF1A-47A1-911C-726876890892" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779474141" checkinUser="plazi" docAuthor="Riva, Ignacio De La, Chaparro, Juan C., Castroviejo-Fisher, Santiago &amp; Padial, José M." docDate="2018" docId="03AD2972A94FFFF5FC2D08ABF7C2B60D" docLanguage="en" docName="zlx020.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Microkayla boettgeri Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial 2018" docType="treatment" docVersion="1" lastPageNumber="155" masterDocId="FF94510AA956FFEEFFB90E47F51DB73A" masterDocTitle="Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)" masterLastPageNumber="172" masterPageNumber="129" pageNumber="154" updateTime="1738779668666" updateUser="GgImagineBatch">
<mods:mods id="81EF3942AB5A25FB3783BB36A027C677" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="4E5D10AEA9834E11282AF1827CCAAFAF">
<mods:title id="F4BBDD97859B4971FA15A245D526233D">Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)</mods:title>
</mods:titleInfo>
<mods:name id="7D2807688B149BD3E877CB0E1BE31903" type="personal">
<mods:role id="7900341D2372C4E66000EE906816706C">
<mods:roleTerm id="AD413882E7F7670B30B32CCEE8EDE896">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="BE44D8E507D971223BA1D56BC0E84BC2">Riva, Ignacio De La</mods:namePart>
</mods:name>
<mods:name id="AFDEFF1E434FC0063872451112719BFB" type="personal">
<mods:role id="8866050DC8E1D0B11DAD3D3FA8F936EE">
<mods:roleTerm id="083AB4F1B7BE88494E1ACBF832DFD757">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="32B9AB3DE70ACB6BECB9471171D71289">Chaparro, Juan C.</mods:namePart>
</mods:name>
<mods:name id="58D1D7CDD7659A82A024D52E209270E2" type="personal">
<mods:role id="7097F68F6124AD0A9D677CA28DD18851">
<mods:roleTerm id="C886FA1EC6F111FA0986B6BD1633901E">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="905F8CD451D12FC4A0541441B762BDAB">Castroviejo-Fisher, Santiago</mods:namePart>
</mods:name>
<mods:name id="44C0FF4680C89A961654960CF06B59DF" type="personal">
<mods:role id="C5F1354723949BE3DAB1FB30046DE768">
<mods:roleTerm id="C57E64D76D3CF24BB59C6BFC7DE7E211">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="4197C498286E45683E9597BE824F97CC">Padial, José M.</mods:namePart>
</mods:name>
<mods:typeOfResource id="F85999B9BCDD05274D6C91321EB95C3F">text</mods:typeOfResource>
<mods:relatedItem id="18656F65A221F0AA580173F837C3DFDB" type="host">
<mods:titleInfo id="F77EA43231D74CD5261023773001C3E5">
<mods:title id="430AE41387F1E70463954206A99B9CEA">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="F1A097CF456F5CA26187D54B00F07583">
<mods:date id="381CCD07970BC47AC404EB263F4C8B73">2018</mods:date>
<mods:detail id="E7D19C35D683C311F428F8914E237171" type="volume">
<mods:number id="E6CE9C4D7A78476BEB2B9A522451F82F">182</mods:number>
</mods:detail>
<mods:extent id="E65E85D2CE2FA9EA537BD566804C417A" unit="page">
<mods:start id="1726C198179FAB480BEDF382835C2871">129</mods:start>
<mods:end id="5D974176677EDDCDD04A9E152B2EBA3C">172</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="7497ABAE4C68574529B8E89A3863D2C6">journal article</mods:classification>
<mods:identifier id="7F8993CC072D2650D0E0913889F4114B" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="C8223635ABE9EA1B5AC0DCF5567C40DC" type="ZooBank">B2DCFB0-BF1A-47A1-911C-726876890892</mods:identifier>
</mods:mods>
<treatment id="03AD2972A94FFFF5FC2D08ABF7C2B60D" LSID="urn:lsid:plazi:treatment:03AD2972A94FFFF5FC2D08ABF7C2B60D" httpUri="http://treatment.plazi.org/id/03AD2972A94FFFF5FC2D08ABF7C2B60D" lastPageId="27" lastPageNumber="155" pageId="25" pageNumber="154">
<subSubSection id="C31ECBEFA94FFFF7FC2D08ABF057B03E" box="[916,1354,1771,1796]" pageId="25" pageNumber="154" type="nomenclature">
<paragraph id="8BBB9864A94FFFF7FC2D08ABF057B03E" blockId="25.[916,1354,1771,1796]" box="[916,1354,1771,1796]" pageId="25" pageNumber="154">
<heading id="D0F32F08A94FFFF7FC2D08ABF057B03E" box="[916,1354,1771,1796]" centered="true" fontSize="9" level="2" pageId="25" pageNumber="154" reason="2">
<taxonomicName id="4C04E3E7A94FFFF7FC2D08ABF057B03E" ID-CoL="6RGQR" authority="(LEHR, 2006)" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[916,1354,1771,1796]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="25" pageNumber="154" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94FFFF7FC2D08ABF1B1B039" box="[916,1196,1772,1795]" italics="true" pageId="25" pageNumber="154">
<smallCapsWord id="8D5D0EB8A94FFFF7FC2D08ABF135B039" baselines="1789,1790" box="[916,1064,1772,1795]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Microkayla" pageId="25" pageNumber="154">MICROKAYLA</smallCapsWord>
<smallCapsWord id="8D5D0EB8A94FFFF7FB9708A8F1B1B039" baselines="1790" box="[1070,1196,1775,1795]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="boettgeri" pageId="25" pageNumber="154">BOETTGERI</smallCapsWord>
</emphasis>
(
<bibRefCitation id="EF95E595A94FFFF7FB0508ACF05FB03E" author="Lehr E" box="[1212,1346,1771,1796]" pageId="25" pageNumber="154" pagination="331 - 347" refId="ref24796" refString="Lehr E. 2006. Taxonomic status of some species of Peruvian Phrynopus (Anura: Leptodactylidae) with the description of a new species from the Andes of southern Peru. Herpetologica 62: 331-347." type="journal article" year="2006">
<smallCapsWord id="8D5D0EB8A94FFFF7FB0508ACF1E6B039" baselines="1790,1790" box="[1212,1275,1771,1796]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Lehr" pageId="25" pageNumber="154">LEHR</smallCapsWord>
, 2006
</bibRefCitation>
)
</taxonomicName>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C31ECBEFA94FFFF5FC820953F7C2B60D" lastPageId="27" lastPageNumber="156" pageId="25" pageNumber="154" type="discussion">
<paragraph id="8BBB9864A94FFFF4FC820953F7BCB534" blockId="25.[827,1443,1812,1895]" lastBlockId="26.[145,762,197,1630]" lastPageId="26" lastPageNumber="155" pageId="25" pageNumber="154">
<emphasis id="B9704476A94FFFF7FC820953F6BFB013" box="[827,930,1812,1833]" italics="true" pageId="25" pageNumber="154">Remarks</emphasis>
: On
<date id="FFBABEA4A94FFFF7FC650953F1B3B010" box="[988,1198,1812,1834]" pageId="25" pageNumber="154" value="2006-02-16">16 February 2006</date>
we sampled the wet puna around the village of Phara (district of Limbani, province Sandia, department
<collectingRegion id="49C05686A94FFFF7FB0B0916F1E9B05C" box="[1202,1268,1873,1894]" country="Peru" name="Puno" pageId="25" pageNumber="154">Puno</collectingRegion>
), and found a population of
<taxonomicName id="4C04E3E7A94CFFF4FE800E82F4DDB7E0" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[313,448,197,218]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="genus">
<emphasis id="B9704476A94CFFF4FE800E82F4DDB7E0" box="[313,448,197,218]" italics="true" pageId="26" pageNumber="155">Microkayla</emphasis>
</taxonomicName>
that corresponds to what was originally named as
<taxonomicName id="4C04E3E7A94CFFF4FE080EA3F78AB7C3" authorityName="Lehr" authorityYear="2006" box="[433,663,228,249]" class="Amphibia" family="Craugastoridae" genus="Phrynopus" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94CFFF4FE080EA3F78AB7C3" box="[433,663,228,249]" italics="true" pageId="26" pageNumber="155">Phrynopus boettgeri</emphasis>
</taxonomicName>
by
<bibRefCitation id="EF95E595A94CFFF4FD780EA3F5C0B622" author="Lehr E" pageId="26" pageNumber="155" pagination="331 - 347" refId="ref24796" refString="Lehr E. 2006. Taxonomic status of some species of Peruvian Phrynopus (Anura: Leptodactylidae) with the description of a new species from the Andes of southern Peru. Herpetologica 62: 331-347." type="journal article" year="2006">Lehr (2006)</bibRefCitation>
based on specimens collected in 2004 by J. Boettger at the very same locality. Specimens were found under rocks during the day and calling at night from within moss on the ground or on stones. Among the specimens we collected (MUBI 5363-5, MNCN 43776-78; 14), some characters are observed that complement those described by
<bibRefCitation id="EF95E595A94CFFF4FDB20FFDF78BB6EA" author="Lehr E" box="[523,662,442,464]" pageId="26" pageNumber="155" pagination="331 - 347" refId="ref24796" refString="Lehr E. 2006. Taxonomic status of some species of Peruvian Phrynopus (Anura: Leptodactylidae) with the description of a new species from the Andes of southern Peru. Herpetologica 62: 331-347." type="journal article" year="2006">Lehr (2006)</bibRefCitation>
, and we provide a brief description of those as well as of the undescribed advertisement call of this species.
</paragraph>
<paragraph id="8BBB9864A94CFFF4FF100C51F7CCB3F5" blockId="26.[145,762,197,1630]" pageId="26" pageNumber="155">
<bibRefCitation id="EF95E595A94CFFF4FF100C51F425B516" author="Lehr E" box="[169,312,534,556]" pageId="26" pageNumber="155" pagination="331 - 347" refId="ref24796" refString="Lehr E. 2006. Taxonomic status of some species of Peruvian Phrynopus (Anura: Leptodactylidae) with the description of a new species from the Andes of southern Peru. Herpetologica 62: 331-347." type="journal article" year="2006">Lehr (2006)</bibRefCitation>
mentioned the lack of vocal sac and vocal slits, but male specimens collected by us do have a vocal sac and vocal slits. Also, several specimens possess a protruding, translucent callosity on the tip of the snout, that covers the anterior area of the snout and part of the upper lip. So far, in
<taxonomicName id="4C04E3E7A94CFFF4FDF50CF7F7EEB5FC" box="[588,755,688,710]" class="Amphibia" family="Craugastoridae" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="subFamily" subFamily="Holoadeninae">Holoadeninae</taxonomicName>
, this structure has been only described in males of the Bolivian species
<taxonomicName id="4C04E3E7A94CFFF4FEC40CA9F5C8B41B" authority="(De la Riva &amp; Burrowes, 2014)" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="De la Riva &amp; Burrowes" baseAuthorityYear="2014" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="species" species="teqta">
<emphasis id="B9704476A94CFFF4FEC40CA9F4C4B439" box="[381,473,750,771]" italics="true" pageId="26" pageNumber="155">M. teqta</emphasis>
(
<bibRefCitation id="EF95E595A94CFFF4FE500CA9F5D6B41B" author="De la Riva I &amp; Burrowes PA" pageId="26" pageNumber="155" pagination="459 - 470" refId="ref23949" refString="De la Riva I, Burrowes PA. 2014. A new species of Psychrophrynella (Anura: Craugastoridae) from the Cordillera Real, Department La Paz, Bolivia. Zootaxa 3887: 459-470." type="journal article" year="2014">De la Riva &amp; Burrowes, 2014</bibRefCitation>
)
</taxonomicName>
. Those males were guarding egg clutches in subterranean chambers under stones; thus, the mentioned peculiar rostral morphology is probably a structure for digging (
<bibRefCitation id="EF95E595A94CFFF4FEE10D2FF7B6B447" author="De la Riva I &amp; Burrowes PA" box="[344,683,872,894]" pageId="26" pageNumber="155" pagination="459 - 470" refId="ref23949" refString="De la Riva I, Burrowes PA. 2014. A new species of Psychrophrynella (Anura: Craugastoridae) from the Cordillera Real, Department La Paz, Bolivia. Zootaxa 3887: 459-470." type="journal article" year="2014">De la Riva &amp; Burrowes, 2014</bibRefCitation>
). Also, we found colour variants lacking in those described by
<bibRefCitation id="EF95E595A94CFFF4FF280DE2F407B481" author="Lehr E" box="[145,282,933,955]" pageId="26" pageNumber="155" pagination="331 - 347" refId="ref24796" refString="Lehr E. 2006. Taxonomic status of some species of Peruvian Phrynopus (Anura: Leptodactylidae) with the description of a new species from the Andes of southern Peru. Herpetologica 62: 331-347." type="journal article" year="2006">Lehr (2006)</bibRefCitation>
.
<specimenCount id="9D0253EDA94CFFF4FE9E0DE2F4D6B481" box="[295,459,933,955]" count="1" pageId="26" pageNumber="155" type="generic">One specimen</specimenCount>
(MNCN 43778;
<figureCitation id="133F84E1A94CFFF4FD300DE2F5BEB4E3" captionStart="Figure 14" captionStartId="25.[163,243,879,901]" captionTargetBox="[323,1283,195,839]" captionTargetId="figure-507@25.[323,1283,195,839]" captionTargetPageId="25" captionText="Figure 14. Live specimens of Microkayla boettgeri from the type locality, Phara, Puno, Peru. (AB) Adult male (MNCN 43778, SVL 18.6 mm); (CD) Adult male (MNCN 43776, SVL 19.0 mm)." pageId="26" pageNumber="155">Fig. 14A B</figureCitation>
) has a bright orange to bright red belly reticulated with black and metallic blue. The underside of thighs and shanks also posses metallic blue blotches. Orange and red flash marks also extend to the groin, axillae, and hands and feet. Another specimen (MNCN 43776;
<figureCitation id="133F84E1A94CFFF4FF280A1AF412B348" box="[145,271,1117,1139]" captionStart="Figure 14" captionStartId="25.[163,243,879,901]" captionTargetBox="[323,1283,195,839]" captionTargetId="figure-507@25.[323,1283,195,839]" captionTargetPageId="25" captionText="Figure 14. Live specimens of Microkayla boettgeri from the type locality, Phara, Puno, Peru. (AB) Adult male (MNCN 43778, SVL 18.6 mm); (CD) Adult male (MNCN 43776, SVL 19.0 mm)." pageId="26" pageNumber="155">Fig. 14C, D</figureCitation>
), is mostly white ventrally, with bold black reticulations and spots, shades of bright orange to red in the posterior part of the belly, and a few blue blotches on the ventral sides of shanks and thighs.
</paragraph>
<caption id="DF7BC8ECA94CFFF4FC900D9CF153B373" pageId="26" pageNumber="155" startId="26.[809,891,987,1009]" targetBox="[814,1421,196,946]" targetPageId="26" targetType="figure">
<paragraph id="8BBB9864A94CFFF4FC900D9CF153B373" blockId="26.[809,1425,987,1097]" pageId="26" pageNumber="155">
<emphasis id="B9704476A94CFFF4FC900D9CF6BBB4CA" bold="true" box="[809,934,987,1009]" pageId="26" pageNumber="155">Figure 15.</emphasis>
Oscillogram and sound spectrogram of the advertisement call of
<taxonomicName id="4C04E3E7A94CFFF4FBAD0DBFF1EFB334" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[1044,1266,1016,1038]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94CFFF4FBAD0DBFF1EFB334" box="[1044,1266,1016,1038]" italics="true" pageId="26" pageNumber="155">Microkayla boettgeri</emphasis>
</taxonomicName>
(specimen nor collected), recorded on 16 February 2006 at Phara, Puno, Peru. Air temperature, 8 °C.
</paragraph>
</caption>
<paragraph id="8BBB9864A94CFFF4FF100A9FF7C1B164" blockId="26.[145,762,197,1630]" pageId="26" pageNumber="155">
We recorded the call of
<taxonomicName id="4C04E3E7A94CFFF4FE130A9FF731B3D7" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[426,556,1240,1261]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94CFFF4FE130A9FF731B3D7" box="[426,556,1240,1261]" italics="true" pageId="26" pageNumber="155">M. boettgeri</emphasis>
</taxonomicName>
at its
<typeStatus id="54BF26C6A94CFFF4FDCB0A9FF7BFB3D7" box="[626,674,1240,1261]" pageId="26" pageNumber="155">type</typeStatus>
locality on
<date id="FFBABEA4A94CFFF4FF0A0AB1F466B236" box="[179,379,1270,1292]" pageId="26" pageNumber="155" value="2006-02-16">16 February 2006</date>
, at 19:40 h, at an air temperature of 8 °C. The call consists of a single non-pulsed note with duration of 102145 ms, emitted at a rate of 8.321.6 notes/minute (
<tableCitation id="C686ADDFA94CFFF4FE850B15F48EB25D" box="[316,403,1362,1384]" captionStart="Table 4" captionStartId="23.[163,227,1438,1459]" captionText="Table 4. Numerical parameters of the advertisement calls of two Peruvian species of Microkayla" pageId="26" pageNumber="155">Table 4</tableCitation>
;
<figureCitation id="133F84E1A94CFFF4FE1B0B15F4EEB252" box="[418,499,1362,1384]" captionStart="Figure 15" captionStartId="26.[809,891,987,1009]" captionTargetBox="[814,1421,196,946]" captionTargetId="figure-722@26.[813,1421,195,947]" captionTargetPageId="26" captionText="Figure 15. Oscillogram and sound spectrogram of the advertisement call of Microkayla boettgeri (specimen nor collected), recorded on 16 February 2006 at Phara, Puno, Peru. Air temperature, 8 °C." pageId="26" pageNumber="155">Fig. 15</figureCitation>
) (call record numbers 822728, www.fonozoo.com). It is modulated in amplitude, with most intensity distributed between 2500 and 3000 Hz. There was a weak modulation in intensity (increasing to the end) in one of the specimens recorded. The difference in intensity reached 231 Hz from the beginning to the end of the call. The call of
<taxonomicName id="4C04E3E7A94CFFF4FDCC084CF7E4B125" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" baseAuthorityName="Lehr" baseAuthorityYear="2006" box="[629,761,1546,1568]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="species" species="boettgeri">
<emphasis id="B9704476A94CFFF4FDCC084CF7E4B125" box="[629,761,1546,1568]" italics="true" pageId="26" pageNumber="155">M. boettgeri</emphasis>
</taxonomicName>
differs from that of
<taxonomicName id="4C04E3E7A94CFFF4FEDB086DF4DDB104" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[354,448,1577,1599]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A94CFFF4FEDB086DF4DDB104" box="[354,448,1577,1599]" italics="true" pageId="26" pageNumber="155">M. chapi</emphasis>
</taxonomicName>
by having a longer note with higher repetition rate and lower dominant frequency.
</paragraph>
<paragraph id="8BBB9864A94CFFF4FF5508F5F7AEB1D2" blockId="26.[214,691,1714,1770]" pageId="26" pageNumber="155">
<smallCapsWord id="8D5D0EB8A94CFFF4FF5508F5F421B1F0" baselines="1733,1733" box="[236,316,1714,1739]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Genus" pageId="26" pageNumber="155">GENUS</smallCapsWord>
<taxonomicName id="4C04E3E7A94CFFF4FEFA08F4F725B1D0" authority="HEDGES, DUELLMAN, &amp; HEINICKE, 2008" authorityName="HEDGES, DUELLMAN, &amp; HEINICKE" authorityYear="2008" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="genus">
<smallCapsWord id="8D5D0EB8A94CFFF4FEFA08F4F72CB1F0" baselines="1732,1733" box="[323,561,1715,1738]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Psychrophrynella" pageId="26" pageNumber="155">
<emphasis id="B9704476A94CFFF4FEFA08F4F72CB1F0" box="[323,561,1715,1738]" italics="true" pageId="26" pageNumber="155">PSYCHROPHRYNELLA</emphasis>
</smallCapsWord>
<smallCapsWord id="8D5D0EB8A94CFFF4FD8108F5F785B1F0" baselines="1733,1733" box="[568,664,1714,1739]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Hedges" pageId="26" pageNumber="155">HEDGES</smallCapsWord>
,
<smallCapsWord id="8D5D0EB8A94CFFF4FF6F0896F44BB1D2" baselines="1764,1763" box="[214,342,1745,1770]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Duellman" pageId="26" pageNumber="155">DUELLMAN</smallCapsWord>
, &amp;
<smallCapsWord id="8D5D0EB8A94CFFF4FEC60896F4EFB1D2" baselines="1764,1763" box="[383,498,1745,1770]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Heinicke" pageId="26" pageNumber="155">HEINICKE</smallCapsWord>
, 2008
</taxonomicName>
,
<smallCapsWord id="8D5D0EB8A94CFFF4FDFD0893F7AEB1D2" baselines="1763" box="[580,691,1748,1768]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="emended" pageId="26" pageNumber="155">EMENDED</smallCapsWord>
</paragraph>
<paragraph id="8BBB9864A94CFFF4FF2808BEF438B050" blockId="26.[145,761,1785,1899]" pageId="26" pageNumber="155">
<emphasis id="B9704476A94CFFF4FF2808BEF452B035" box="[145,335,1785,1807]" italics="true" pageId="26" pageNumber="155">Included species</emphasis>
:
<taxonomicName id="4C04E3E7A94CFFF4FEE408BEF5CEB014" authority="(Lynch, 1986)" baseAuthorityName="Lynch" baseAuthorityYear="1986" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="species" species="bagrecito">
<emphasis id="B9704476A94CFFF4FEE408BEF787B034" box="[349,666,1785,1806]" italics="true" pageId="26" pageNumber="155">Psychrophrynella bagrecito</emphasis>
(
<bibRefCitation id="EF95E595A94CFFF4FD1308BEF5D6B014" author="Lynch JD" pageId="26" pageNumber="155" pagination="423 - 431" refId="ref25263" refString="Lynch JD. 1986. New species of minute leptodactylid frogs from the Andes of Ecuador and Peru. Journal of Herpetology 20: 423-431." type="journal article" year="1986">Lynch, 1986</bibRefCitation>
)
</taxonomicName>
(
<typeStatus id="54BF26C6A94CFFF4FF5C095FF407B017" box="[229,282,1816,1837]" pageId="26" pageNumber="155">type</typeStatus>
species),
<taxonomicName id="4C04E3E7A94CFFF4FE2D095EF40CB076" authority="Catenazzi &amp; Ttito, 2016" authorityName="Catenazzi &amp; Ttito" authorityYear="2016" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="species" species="chirihampatu">
<emphasis id="B9704476A94CFFF4FE2D095EF745B017" box="[404,600,1816,1838]" italics="true" pageId="26" pageNumber="155">P. chirihampatu</emphasis>
<bibRefCitation id="EF95E595A94CFFF4FDDB095FF40CB076" author="Catenazzi A &amp; Ttito A" pageId="26" pageNumber="155" refId="ref23734" refString="Catenazzi A, Ttito A. 2016. A new species of Psychrophrynella (Amphibia, Anura, Craugastoridae) from the humid montane forests of Cusco, eastern slopes of the Peruvian Andes. PeerJ 4: e 1807." type="journal volume" year="2016">Catenazzi &amp; Ttito, 2016</bibRefCitation>
</taxonomicName>
, and
<taxonomicName id="4C04E3E7A94CFFF4FEE90970F43DB050" authority="De la Riva, Chaparro &amp; Padial, 2008" authorityName="De la Riva, Chaparro &amp; Padial" authorityYear="2008" class="Amphibia" family="Craugastoridae" genus="Psychrophrynella" kingdom="Animalia" order="Anura" pageId="26" pageNumber="155" phylum="Chordata" rank="species" species="usurpator">
<emphasis id="B9704476A94CFFF4FEE90970F4C3B076" box="[336,478,1847,1868]" italics="true" pageId="26" pageNumber="155">P. usurpator</emphasis>
De la Riva, Chaparro &amp; Padial, 2008
</taxonomicName>
.
</paragraph>
<paragraph id="8BBB9864A94CFFF5FC900A31F7C2B60D" blockId="26.[809,1426,1141,1899]" lastBlockId="27.[163,779,197,311]" lastPageId="27" lastPageNumber="156" pageId="26" pageNumber="155">
<emphasis id="B9704476A94CFFF4FC900A31F6BEB3B1" box="[809,931,1142,1163]" italics="true" pageId="26" pageNumber="155">Diagnosis</emphasis>
: (1) head narrow, not as wide as body, extremities relatively long; (2) tympanic membrane and annulus differentiated (annulus and membrane visible beneath skin); (3) cranial crests absent; (4) prevomerine teeth, dentigerous process of vomers, and dentigerous ramus absent; pterygoid not in contact with parasphenoid; anterior parasphenoid ramus short, not reaching palatines; ear fully developed; (5) pectoral girdle anatomically arciferal but functionally firmisternal (halves of the epicoracoid cartilages fused); (6) nasal bones widely separated medially; (7) tongue long and narrow, much longer than wide; (8) tips of digits narrow and rounded, not expanded, lacking circumferential groves and pads; (9) terminal phalanges T-shaped to knobbed; phalangeal formulae of hands and feet 2-2-3-3 and 2-2-3-4-3, respectively; (10) Finger I equal to or slightly shorter than Finger II; (11) two subarticular tubercles on Finger IV; (12) Toe V slightly longer than Toe III; (13) lateral fringes and webbing absent on digits; (14) two metatarsal tubercles both prominent and subconical; inner edge of tarsus bearing a prominent, elongate, sigmoid-shaped or fold-like tubercle not contiguous with inner metatarsal tubercle (
<figureCitation id="133F84E1A94CFFF4FC050971F6E6B071" box="[956,1019,1846,1868]" captionStart="Figure 8" captionStartId="18.[809,894,1674,1696]" captionTargetBox="[815,1421,963,1634]" captionTargetId="figure-352@18.[813,1421,961,1635]" captionTargetPageId="18" captionText="Figure 8. Plantar surfaces of (A) Psychrophrynella usurpator (MUBI 4643; SVL 24.4 mm) and (B) Microkayla boettgeri (MUBI 5365; SVL 18.8 mm) showing, respectively, the presence and absence of tarsal tubercle." pageId="26" pageNumber="155">Fig. 8</figureCitation>
); (15) dorsum finely shagreen; belly smooth; (16) trigeminal nerve passing external to
<emphasis id="B9704476A94CFFF5FACC0911F711B7E1" italics="true" lastPageId="27" lastPageNumber="156" pageId="26" pageNumber="155">m. adductor mandibulae externus</emphasis>
(S condition;
<bibRefCitation id="EF95E595A94DFFF5FD050E82F5C7B7C0" author="Lynch JD" pageId="27" pageNumber="156" pagination="423 - 431" refId="ref25263" refString="Lynch JD. 1986. New species of minute leptodactylid frogs from the Andes of Ecuador and Peru. Journal of Herpetology 20: 423-431." type="journal article" year="1986">Lynch, 1986</bibRefCitation>
); (17) eggs large, not pigmented; (18) males with median subgular vocal sac and lacking nuptial asperities; (19) mating call composed of a series of notes.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,268 @@
<document id="BEDCAA2F34B2FD39B7EE7A05F9388E6A" ID-ISSN="0024-4082" ID-ZooBank="B2DCFB0-BF1A-47A1-911C-726876890892" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779474141" checkinUser="plazi" docAuthor="Riva, Ignacio De La, Chaparro, Juan C., Castroviejo-Fisher, Santiago &amp; Padial, José M." docDate="2018" docId="03AD2972A959FFFFFC190DAAF13EB43F" docLanguage="en" docName="zlx020.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Bryophryne wilakunka Riva, Chaparro, Castroviejo-Fisher &amp; Padial, 2018, SP. NOV." docType="treatment" docVersion="1" lastPageNumber="146" masterDocId="FF94510AA956FFEEFFB90E47F51DB73A" masterDocTitle="Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)" masterLastPageNumber="172" masterPageNumber="129" pageNumber="144" updateTime="1738779668666" updateUser="GgImagineBatch">
<mods:mods id="17BFA8BF911BECC8AE616E3CEDB60767" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="3B93499DBE004F2524A7F1C420A6C99B">
<mods:title id="00406C26188A6D461E55CA32B1A27083">Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)</mods:title>
</mods:titleInfo>
<mods:name id="B0D22E46445ACDDAF254CD1218B24701" type="personal">
<mods:role id="A2CC004DF64AAD80DB3FCBF7F9B3927A">
<mods:roleTerm id="966F523125B20301523561B6831173B8">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="091879D9779509A1136A9B571E4C9F38">Riva, Ignacio De La</mods:namePart>
</mods:name>
<mods:name id="96E2F9527DE5183E5256EFAC36422CB4" type="personal">
<mods:role id="43EE85FFB267F021D26896E0B83725EE">
<mods:roleTerm id="6909743EC9E25AC270AE7975BE0DAD20">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="0A8F751419A1E1E729E19C75813B8B99">Chaparro, Juan C.</mods:namePart>
</mods:name>
<mods:name id="93B2E5C74E77A9D0CFA726DD4F5DB95D" type="personal">
<mods:role id="4B9C4B86A1C3F96D6F1ADA80BA7FF6D2">
<mods:roleTerm id="5D0FF7870E32C8BFE1DA20E2A86EE1D9">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="F4643A33C333C1E8222D9AD135C107DC">Castroviejo-Fisher, Santiago</mods:namePart>
</mods:name>
<mods:name id="CB28FE4A3B587D88C20677BF9A53569F" type="personal">
<mods:role id="73AB1F24E722677253F2B8195E68F5F9">
<mods:roleTerm id="DA3A4F5E52EDA4D0AC33E42038C704AC">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="BCE7EFB20BFB893C9FA2AF0CDF5FEB04">Padial, José M.</mods:namePart>
</mods:name>
<mods:typeOfResource id="4E0CC7C24DD3A47A4D0E7470ED5FF60A">text</mods:typeOfResource>
<mods:relatedItem id="D0F02D07AE7036BE0D2E7C29C2CDB64D" type="host">
<mods:titleInfo id="C33CC64294FCE5BEDC747758EB032DB0">
<mods:title id="1123C40C4411E0F2713FB725289E2FB6">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="E5751971A5B03FC2383A3455BEC67826">
<mods:date id="E1F5F9B1D47E488C1FFC9CF2F0DEE41F">2018</mods:date>
<mods:detail id="EFA9A28792E67BB77420437CFB05E9E6" type="volume">
<mods:number id="620644A07E2DB23F0773F97BF6EBE406">182</mods:number>
</mods:detail>
<mods:extent id="DB2EAE22D0B05B7B93F8955D39EC048C" unit="page">
<mods:start id="3A993555F3BDE9FB86C321F3BA7ACD7A">129</mods:start>
<mods:end id="E2DF43F1F6C3CBBF650B7C08F43CBBC1">172</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="CE8DCD903EE5DE3696EE70D2936F6A4A">journal article</mods:classification>
<mods:identifier id="3F25EE3E67062AB0ABA94640E972D2F1" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="4CC0E83B55F3DC3B1A6BF471CD897B76" type="ZooBank">B2DCFB0-BF1A-47A1-911C-726876890892</mods:identifier>
</mods:mods>
<treatment id="03AD2972A959FFFFFC190DAAF13EB43F" LSID="urn:lsid:plazi:treatment:03AD2972A959FFFFFC190DAAF13EB43F" httpUri="http://treatment.plazi.org/id/03AD2972A959FFFFFC190DAAF13EB43F" lastPageId="17" lastPageNumber="146" pageId="15" pageNumber="144">
<subSubSection id="C31ECBEFA959FFE1FC190DAAF020B33F" box="[928,1341,1005,1029]" pageId="15" pageNumber="144" type="nomenclature">
<paragraph id="8BBB9864A959FFE1FC190DAAF020B33F" blockId="15.[928,1341,1005,1029]" box="[928,1341,1005,1029]" pageId="15" pageNumber="144">
<heading id="D0F32F08A959FFE1FC190DAAF020B33F" box="[928,1341,1005,1029]" centered="true" fontSize="9" level="2" pageId="15" pageNumber="144" reason="2">
<taxonomicName id="4C04E3E7A959FFE1FC190DAAF1CEB339" ID-CoL="NJL6" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[928,1235,1005,1028]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="15" pageNumber="144" phylum="Chordata" rank="species" species="wilakunka" status="sp. nov.">
<smallCapsWord id="8D5D0EB8A959FFE1FC190DAAF15FB339" baselines="1022,1022" box="[928,1090,1005,1028]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Bryophryne" pageId="15" pageNumber="144">BRYOPHRYNE</smallCapsWord>
<smallCapsWord id="8D5D0EB8A959FFE1FBF00DB7F1CEB339" baselines="1022" box="[1097,1235,1008,1027]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="wilakunka" pageId="15" pageNumber="144">WILAKUNKA</smallCapsWord>
</taxonomicName>
<emphasis id="B9704476A959FFE1FB630DB7F020B33F" bold="true" box="[1242,1341,1005,1029]" pageId="15" pageNumber="144">
<taxonomicNameLabel id="A243F90DA959FFE1FB630DB7F020B33F" box="[1242,1341,1005,1029]" pageId="15" pageNumber="144" rank="species">
<smallCapsWord id="8D5D0EB8A959FFE1FB630DB7F1EAB339" baselines="1022" box="[1242,1271,1008,1027]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="sp" pageId="15" pageNumber="144">SP</smallCapsWord>
.
<smallCapsWord id="8D5D0EB8A959FFE1FABC0DB7F02BB339" baselines="1022" box="[1285,1334,1008,1027]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="nov" pageId="15" pageNumber="144">NOV</smallCapsWord>
.
</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C31ECBEFA959FFFFFBFD0A54F13EB43F" lastPageId="17" lastPageNumber="146" pageId="15" pageNumber="144" type="description">
<paragraph id="8BBB9864A959FFE1FBFD0A54F184B316" blockId="15.[1092,1177,1043,1068]" box="[1092,1177,1043,1068]" pageId="15" pageNumber="144">
(
<figureCitation id="133F84E1A959FFE1FBF40A54F18CB316" box="[1101,1169,1043,1068]" captionStart="Figure 6" captionStartId="17.[162,242,1056,1078]" captionTargetBox="[167,775,195,1017]" captionTargetId="figure-671@17.[167,775,195,1017]" captionTargetPageId="17" captionText="Figure 6. Live specimen of Bryophryne wilakunka sp. nov. from the type locality in Ayapata, Peru. (AB) Dorsal and ventral views of adult female holotype (MUBI 5425, SVL 24.6 mm)." pageId="15" pageNumber="144">
<smallCapsWord id="8D5D0EB8A959FFE1FBF40A54F168B311" baselines="1062,1062" box="[1101,1141,1043,1068]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Fig" pageId="15" pageNumber="144">FIG</smallCapsWord>
. 6
</figureCitation>
)
</paragraph>
<paragraph id="8BBB9864A959FFE1FC820A7BF09AB34A" blockId="15.[827,1442,1084,1136]" pageId="15" pageNumber="144">
h t t p: / / z o o b a n k. o r g / u r n: l s i d: z o o b a n k. org:act:
<uuid id="FFA2A2B1A959FFE1FC310A1DF09AB34A" box="[904,1415,1114,1136]" pageId="15" pageNumber="144">F655DAB0-847F-4612-8803-30980E3D688A</uuid>
</paragraph>
<paragraph id="8BBB9864A959FFE1FC820ADEF6B3B272" blockId="15.[827,1445,1177,1352]" pageId="15" pageNumber="144">
<materialsCitation id="3B6C9239A959FFE1FC820ADEF6B3B272" collectingDate="2006-02-24" collectionCode="MUBI" collectorName="I. De la Riva &amp; J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro." country="Peru" county="De la Riva" elevation="3947" latitude="-13.852944" location="Ayapata valley" longLatPrecision="1" longitude="-70.31451" municipality="Carabaya" pageId="15" pageNumber="144" specimenCode="MUBI 5425" specimenCount="1" stateProvince="Puno" typeStatus="holotype">
<emphasis id="B9704476A959FFE1FC820ADEF6BAB394" box="[827,935,1177,1198]" italics="true" pageId="15" pageNumber="144">
<typeStatus id="54BF26C6A959FFE1FC820ADEF6BAB394" box="[827,935,1177,1198]" pageId="15" pageNumber="144" type="holotype">Holotype</typeStatus>
</emphasis>
:
<specimenCode id="DBA2301FA959FFE1FC000ADDF154B395" box="[953,1097,1177,1199]" collectionCode="MUBI" pageId="15" pageNumber="144">MUBI 5425</specimenCode>
(field number 4704), adult female from
<location id="8EDBCEBFA959FFE1FC670AFFF180B3F4" LSID="urn:lsid:plazi:treatment:03AD2972A959FFFFFC190DAAF13EB43F:8EDBCEBFA959FFE1FC670AFFF180B3F4" box="[990,1181,1208,1230]" country="Peru" county="De la Riva" latitude="-13.852944" longLatPrecision="1" longitude="-70.31451" municipality="Carabaya" name="Ayapata valley" pageId="15" pageNumber="144" stateProvince="Puno">Ayapata valley</location>
, province
<collectingMunicipality id="6BDF021EA959FFE1FA9A0AFFF081B3F4" box="[1315,1436,1208,1230]" pageId="15" pageNumber="144">Carabaya</collectingMunicipality>
, department
<collectingRegion id="49C05686A959FFE1FC740A90F116B3D6" box="[973,1035,1239,1260]" country="Peru" name="Puno" pageId="15" pageNumber="144">Puno</collectingRegion>
,
<collectingCountry id="F313D8F4A959FFE1FBA10A90F14CB3D6" box="[1048,1105,1239,1260]" name="Peru" pageId="15" pageNumber="144">Peru</collectingCountry>
,
<geoCoordinate id="EE30FEA3A959FFE1FBE70A91F1E9B3D6" box="[1118,1268,1237,1260]" degrees="13" direction="south" minutes="51" orientation="latitude" pageId="15" pageNumber="144" precision="1" seconds="10.6" value="-13.852944">
13°51
<emphasis id="B9704476A959FFE1FB180A92F1BAB3D6" box="[1185,1191,1237,1260]" italics="true" pageId="15" pageNumber="144"></emphasis>
10.6
<emphasis id="B9704476A959FFE1FB630A92F1F9B3D6" box="[1242,1252,1237,1260]" italics="true" pageId="15" pageNumber="144"></emphasis>
S
</geoCoordinate>
,
<geoCoordinate id="EE30FEA3A959FFE1FAB80A90F0BCB3D6" box="[1281,1441,1237,1260]" degrees="70" direction="west" minutes="18" orientation="longitude" pageId="15" pageNumber="144" precision="1" seconds="52.2" value="-70.31451">
70°18
<emphasis id="B9704476A959FFE1FAFD0A92F057B3D6" box="[1348,1354,1237,1260]" italics="true" pageId="15" pageNumber="144"></emphasis>
52.2
<emphasis id="B9704476A959FFE1FAC40A92F09AB3D6" box="[1405,1415,1237,1260]" italics="true" pageId="15" pageNumber="144"></emphasis>
W
</geoCoordinate>
,
<quantity id="4CFC3581A959FFE1FC820AB2F693B231" box="[827,910,1269,1291]" metricMagnitude="3" metricUnit="m" metricValue="3.947" pageId="15" pageNumber="144" unit="m" value="3947.0">
<elevation id="00297F57A959FFE1FC820AB2F693B231" box="[827,910,1269,1291]" metricMagnitude="3" metricUnit="m" metricValue="3.947" pageId="15" pageNumber="144" unit="m" value="3947.0">3947 m</elevation>
</quantity>
(
<figureCitation id="133F84E1A959FFE1FC240AB2F6C1B230" box="[925,988,1269,1291]" captionStart="Figure 3" captionStartId="11.[164,243,1434,1456]" captionTargetBox="[387,1218,197,1394]" captionTargetId="figure-207@11.[385,1220,195,1395]" captionTargetPageId="11" captionText="Figure 3. Map of the Andes of southern Peru around department of Cusco showing the distribution (type localities only) of the 12 nominal species of Bryophryne described hitherto: (1) B. flammiventris; (2) B. abramalagae; (3) B. bustamantei; (4) B. bakersfield; (5) B. cophites; (6) B. hanssaueri; (7) B. nubilosus; (8) B. gymnotis; (9) B. quellokunka sp. nov.; (10) B. zonalis; (11) B. tocra sp. nov.; (12) B. wilakunka sp. nov." pageId="15" pageNumber="144">Fig. 3</figureCitation>
), collected on
<date id="FFBABEA4A959FFE1FBC50AB2F059B231" box="[1148,1348,1269,1291]" pageId="15" pageNumber="144" value="2006-02-24">
<collectingDate id="EFFE474CA959FFE1FBC50AB2F059B231" box="[1148,1348,1269,1291]" pageId="15" pageNumber="144" value="2006-02-24">24 February 2006</collectingDate>
</date>
by
<collectorName id="26F1FDB2A959FFE1FAD40AB1F68CB210" pageId="15" pageNumber="144">
I.
<collectingCounty id="62DAE0E8A959FFE1FA3A0AB1F68CB210" pageId="15" pageNumber="144">De la Riva</collectingCounty>
</collectorName>
,
<collectorName id="26F1FDB2A959FFE1FC270B53F131B210" box="[926,1068,1300,1322]" pageId="15" pageNumber="144">J. M. Padial</collectorName>
,
<collectorName id="26F1FDB2A959FFE1FB810B53F02DB210" box="[1080,1328,1300,1322]" pageId="15" pageNumber="144">S. Castroviejo-Fisher</collectorName>
, and
<collectorName id="26F1FDB2A959FFE1FAC80B53F6B3B272" pageId="15" pageNumber="144">J. C. Chaparro.</collectorName>
</materialsCitation>
</paragraph>
<paragraph id="8BBB9864A959FFE1FC820B35F1A5B29C" blockId="15.[827,1443,1393,1446]" pageId="15" pageNumber="144">
<materialsCitation id="3B6C9239A959FFE1FC820B35F1A9B29C" collectingDate="2006-02-24" collectionCode="MNCN" collectorName="I. De la Riva &amp; J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro." country="Peru" county="De la Riva" elevation="3947" latitude="-13.852944" location="Ayapata valley" longLatPrecision="1" longitude="-70.31451" municipality="Carabaya" pageId="15" pageNumber="144" specimenCode="MNCN 43788" specimenCount="1" stateProvince="Puno" typeStatus="Paratopotype">
<emphasis id="B9704476A959FFE1FC820B35F6D2B2BD" box="[827,975,1394,1415]" italics="true" pageId="15" pageNumber="144">
<typeStatus id="54BF26C6A959FFE1FC820B35F6D2B2BD" box="[827,975,1394,1415]" pageId="15" pageNumber="144" type="paratopotype">Paratopotype</typeStatus>
</emphasis>
:
<specimenCode id="DBA2301FA959FFE1FC630B36F16BB2BC" box="[986,1142,1393,1414]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="15" pageNumber="144" type="Museum">MNCN 43788</specimenCode>
(field number 4705) (adult male), same data as the holotype
</materialsCitation>
.
</paragraph>
<paragraph id="8BBB9864A959FFFEFC820B88F4E6B25E" blockId="15.[827,1443,1486,1907]" lastBlockId="16.[145,761,960,1902]" lastPageId="16" lastPageNumber="145" pageId="15" pageNumber="144">
<emphasis id="B9704476A959FFE1FC820B88F6B6B2DE" box="[827,939,1487,1508]" italics="true" pageId="15" pageNumber="144">Diagnosis</emphasis>
:
<taxonomicName id="4C04E3E7A959FFE1FC000B89F1A3B2D9" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[953,1214,1486,1507]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="15" pageNumber="144" phylum="Chordata" rank="species" species="wilakunka">
<emphasis id="B9704476A959FFE1FC000B89F1A3B2D9" box="[953,1214,1486,1507]" italics="true" pageId="15" pageNumber="144">Bryophryne wilakunka</emphasis>
</taxonomicName>
is characterized by: (1) skin on dorsal surfaces, including extremities and head, densely and uniformly warty (warts irregular in shape, low and flat to conical); flanks more densely warty and with larger and sharper warts than dorsum; dorsal folds absent; skin on belly and throat areolate (apparently smooth in preservative); (2) tympanic membrane and annulus small, slightly differentiated, tympanic fold conspicuous; (3) snout short, rounded in dorsal and lateral views; (4) upper eyelid covered with small low warts, cranial crests absent; (5) dentigerous process of vomers absent; (6) vocal slits present, nuptial pads absent; (7) Finger I equal to Finger II, tips of digits rounded, lacking circumferential grooves, ungual flaps and pads; (8) fingers lacking lateral fringes; (9) ulnar region bearing warts; (10) heel lacking tubercles, tarsus lacking tubercles and folds; (11) plantar surfaces of feet bearing two metatarsal tubercles, inner slightly larger than outer; supernumerary plantar tubercles low, weakly defined; (12) toes short and broad, lacking lateral fringes; feet webbing absent; Toe III equal to V, tips of digits rounded, lacking ungual flap and pads; (13) dorsal coloration dark grey to dark brown and black; ventral coloration orange to bright dark red with irregular orange spots on shanks, groins, and throat; palmar and plantar surfaces, and inner dorsal surfaces the same colour as belly; (14) females larger than males, SVL 17.9 (
<specimenCount id="9D0253EDA946FFFEFD890B77F784B27C" box="[560,665,1328,1350]" count="1" pageId="16" pageNumber="145" type="adult">one adult</specimenCount>
male) to 24.6 (
<specimenCount id="9D0253EDA946FFFEFF740B08F42BB25F" box="[205,310,1359,1381]" count="1" pageId="16" pageNumber="145" type="adult">one adult</specimenCount>
female) (
<tableCitation id="C686ADDFA946FFFEFE250B08F4F1B25E" box="[412,492,1359,1381]" captionStart="Table 3" captionStartId="12.[142,206,698,720]" captionText="Table 3. Morphometrics for new Peruvian species of Bryophryne and Microkayla (range, in parenthesis, follows mean; AM, adult males; AF, adult females)" pageId="16" pageNumber="145">Table 3</tableCitation>
).
</paragraph>
<caption id="DF7BC8ECA946FFFEFF280D2FF709B4A6" pageId="16" pageNumber="145" startId="16.[145,223,872,894]" targetBox="[305,1265,195,833]" targetPageId="16" targetType="figure">
<paragraph id="8BBB9864A946FFFEFF280D2FF709B4A6" blockId="16.[145,1425,872,924]" pageId="16" pageNumber="145">
<emphasis id="B9704476A946FFFEFF280D2FF5E5B444" bold="true" box="[145,248,872,894]" pageId="16" pageNumber="145">Figure 5.</emphasis>
Habitat at the type locality of
<emphasis id="B9704476A946FFFEFD8C0D2FF64AB444" bold="true" box="[565,855,872,894]" pageId="16" pageNumber="145">
<taxonomicName id="4C04E3E7A946FFFEFD8C0D2FF7E0B444" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[565,765,872,894]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="tocra" status="sp. nov.">
<emphasis id="B9704476A946FFFEFD8C0D2FF7E0B444" bold="true" box="[565,765,872,894]" italics="true" pageId="16" pageNumber="145">Bryophryne tocra</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA946FFFEFCBB0D2EF64AB444" box="[770,855,873,894]" pageId="16" pageNumber="145" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
along the Ollachea-Macusani road, province Carabaya, department Puno, Peru, 3213 m a.s.l.
</paragraph>
</caption>
<paragraph id="8BBB9864A946FFFEFF100B2AF08FB3F1" blockId="16.[145,761,960,1902]" lastBlockId="16.[809,1426,960,1227]" pageId="16" pageNumber="145">
The sister species and also the geographically closest species to
<taxonomicName id="4C04E3E7A946FFFEFE8E0BCAF4C8B29B" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[311,469,1420,1442]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="wilakunka">
<emphasis id="B9704476A946FFFEFE8E0BCAF4C8B29B" box="[311,469,1420,1442]" italics="true" pageId="16" pageNumber="145">B. wilakunka</emphasis>
</taxonomicName>
is
<taxonomicName id="4C04E3E7A946FFFEFE430BCAF748B298" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[506,597,1421,1442]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="tocra" status="sp. nov.">
<emphasis id="B9704476A946FFFEFE430BCAF748B298" box="[506,597,1421,1442]" italics="true" pageId="16" pageNumber="145">B. tocra</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA946FFFEFDE70BCAF7A8B298" box="[606,693,1421,1442]" pageId="16" pageNumber="145" rank="species">sp. nov.</taxonomicNameLabel>
(
<typeStatus id="54BF26C6A946FFFEFD7C0BCBF7E5B29B" box="[709,760,1420,1441]" pageId="16" pageNumber="145">type</typeStatus>
localities separated by
<quantity id="4CFC3581A946FFFEFE2F0BECF4ECB2FB" box="[406,497,1451,1473]" metricMagnitude="4" metricUnit="m" metricValue="1.98" pageId="16" pageNumber="145" unit="km" value="19.8">19.8 km</quantity>
straight line distance), from which it differs by having slightly areolate belly (coarsely areolate in
<taxonomicName id="4C04E3E7A946FFFEFEC70BAEF4C9B2C4" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[382,468,1513,1534]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="tocra">
<emphasis id="B9704476A946FFFEFEC70BAEF4C9B2C4" box="[382,468,1513,1534]" italics="true" pageId="16" pageNumber="145">B. tocra</emphasis>
</taxonomicName>
), densely warty head and extremities (slightly warty to smooth), a dark grey to black dorsal coloration (dark brown with metallic hues), bright dark red to orange ventral coloration (white with black spots or marbled with black stripes), and reddish-orange blotches on flanks, groins, and axillae (groins, axillae and posterior surfaces of thighs with yellow flash marks surrounded by bold black). Two other species,
<taxonomicName id="4C04E3E7A946FFFEFE780899F772B1C8" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[449,623,1757,1779]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A946FFFEFE780899F772B1C8" box="[449,623,1757,1779]" italics="true" pageId="16" pageNumber="145">B. quellokunka</emphasis>
</taxonomicName>
and
<taxonomicName id="4C04E3E7A946FFFEFD130899F5A1B02B" authorityName="Lehr and Catenazzi" authorityYear="2009" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="zonalis">
<emphasis id="B9704476A946FFFEFD130899F5A1B02B" italics="true" pageId="16" pageNumber="145">B. zonalis</emphasis>
</taxonomicName>
occur in the Marcapata Valley,
<quantity id="4CFC3581A946FFFEFD8808BBF767B028" box="[561,634,1788,1810]" metricMagnitude="4" metricUnit="m" metricValue="8.0" pageId="16" pageNumber="145" unit="km" value="80.0">80 km</quantity>
northwest of
<emphasis id="B9704476A946FFFEFF17095CF44CB00A" box="[174,337,1819,1840]" italics="true" pageId="16" pageNumber="145">
<taxonomicName id="4C04E3E7A946FFFEFF17095CF450B00A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[174,333,1819,1840]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="wilakunka">B. wilakunka</taxonomicName>
.
</emphasis>
From
<emphasis id="B9704476A946FFFEFE19095CF7E5B00A" box="[416,760,1819,1840]" italics="true" pageId="16" pageNumber="145">
<taxonomicName id="4C04E3E7A946FFFEFE19095CF74CB00A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[416,593,1819,1840]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="quellokunka">B. quellokunka</taxonomicName>
,
<taxonomicName id="4C04E3E7A946FFFEFDE4095CF7E5B00A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[605,760,1819,1840]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="wilakunka">B. wilakunka</taxonomicName>
</emphasis>
differs by having skin on head densely and uniformly warty (shagreen to smooth in
<taxonomicName id="4C04E3E7A946FFFEFE5E091EF78CB057" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[487,657,1880,1902]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A946FFFEFE5E091EF78CB057" box="[487,657,1880,1902]" italics="true" pageId="16" pageNumber="145">B. quellokunka</emphasis>
</taxonomicName>
), ventral coloration orange to bright dark red (variable, from greyish-purple with diffuse black blotches to brown), and iris dark brown (two inferior thirds dark brown and upper third metallic bluish-grey). From
<emphasis id="B9704476A946FFFEFA8A0A5AF6F1B36A" italics="true" pageId="16" pageNumber="145">
<taxonomicName id="4C04E3E7A946FFFEFA8A0A5AF658B36A" authorityName="Lehr and Catenazzi" authorityYear="2009" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="zonalis">B. zonalis</taxonomicName>
,
<taxonomicName id="4C04E3E7A946FFFEFCEB0A7CF6F1B36A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[850,1004,1083,1104]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="wilakunka">B. wilakunka</taxonomicName>
</emphasis>
differs by lacking dorsolateral folds (present in
<taxonomicName id="4C04E3E7A946FFFEFC0D0A1DF134B354" authorityName="Lehr and Catenazzi" authorityYear="2009" box="[948,1065,1113,1135]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="16" pageNumber="145" phylum="Chordata" rank="species" species="zonalis">
<emphasis id="B9704476A946FFFEFC0D0A1DF134B354" box="[948,1065,1113,1135]" italics="true" pageId="16" pageNumber="145">B. zonalis</emphasis>
</taxonomicName>
), having tympanic membrane and annulus slightly differentiated (absent), vocal slits present in males (absent) and ventral coloration orange to bright dark red (dark grey with white flecks).
</paragraph>
<paragraph id="8BBB9864A946FFFFFC900AB5F1ACB66C" blockId="16.[809,1425,1265,1901]" lastBlockId="17.[827,1443,197,342]" lastPageId="17" lastPageNumber="146" pageId="16" pageNumber="145">
<emphasis id="B9704476A946FFFEFC900AB5F16EB23C" box="[809,1139,1265,1287]" italics="true" pageId="16" pageNumber="145">
Description of the
<typeStatus id="54BF26C6A946FFFEFBB70AB6F16EB23C" box="[1038,1139,1265,1286]" pageId="16" pageNumber="145" type="holotype">holotype</typeStatus>
</emphasis>
: An adult female,
<quantity id="4CFC3581A946FFFEFAE70AB6F648B21F" metricMagnitude="-2" metricUnit="m" metricValue="2.46" pageId="16" pageNumber="145" unit="mm" value="24.6">24.6 mm</quantity>
SVL. Body moderately robust; dorsal skin warty, especially in posterior third of body and flanks; ventral skin slightly areolate, but with large and flat glandular warts; complete dorsolateral folds absent, faintly visible folds in the anterior third of body; pectoral fold absent; head wider than long; HW 34.5% of SVL, HL 31.3% of SVL; snout short, rounded in dorsal view and in profile; nostrils prominent, closer to snout than to eyes; canthus rostralis straight in dorsal view, rounded in profile; eyenostril distance 57.6% of eye length; loreal region concave; cranial crests absent; tympanic membrane and tympanic annulus small, differentiated beneath the skin; supratympanic fold conspicuous in life; tongue large, oval; choanae small, rounded, broadly separated; dentigerous processes of vomers absent; limbs moderately short; tips of digits round, not expanded laterally, lacking circumferential groves and ungual flap; ulnar tubercle and fold absent; inner palmar tubercle single, round, slightly smaller than oval outer; fingers moderately short, not fringed;
<emphasis id="B9704476A947FFFFFC820E81F6BBB7E1" box="[827,934,198,219]" italics="true" pageId="17" pageNumber="146">Variation</emphasis>
: The male MNCN 43788 is smaller than the
<typeStatus id="54BF26C6A947FFFFFC820EA3F6BDB7C0" box="[827,928,228,250]" pageId="17" pageNumber="146" type="holotype">holotype</typeStatus>
(see
<tableCitation id="C686ADDFA947FFFFFC670EA3F12BB7C3" box="[990,1078,228,250]" captionStart="Table 3" captionStartId="12.[142,206,698,720]" captionText="Table 3. Morphometrics for new Peruvian species of Bryophryne and Microkayla (range, in parenthesis, follows mean; AM, adult males; AF, adult females)" pageId="17" pageNumber="146">Table 3</tableCitation>
), but otherwise highly similar in all other respects; it lacks nuptial pads. In life, the
<typeStatus id="54BF26C6A947FFFFFC820F65F6B9B60D" box="[827,932,290,311]" pageId="17" pageNumber="146" type="paratype">paratype</typeStatus>
was greenish-brown, with ventral surfaces cream instead of reddish-orange.
</paragraph>
<paragraph id="8BBB9864A947FFFFFC820F39F06CB534" blockId="17.[827,1443,382,527]" pageId="17" pageNumber="146">
<emphasis id="B9704476A947FFFFFC820F39F1BAB6A9" box="[827,1191,382,403]" italics="true" pageId="17" pageNumber="146">Distribution and natural history</emphasis>
: Known only from the
<typeStatus id="54BF26C6A947FFFFFC820FD9F673B689" box="[827,878,414,435]" pageId="17" pageNumber="146">type</typeStatus>
locality. Individuals were found during the day under rocks in open wet puna at almost
<quantity id="4CFC3581A947FFFFFB410FFBF057B6EB" box="[1272,1354,444,465]" metricMagnitude="3" metricUnit="m" metricValue="4.0" pageId="17" pageNumber="146" unit="m" value="4000.0">4000 m</quantity>
(
<figureCitation id="133F84E1A947FFFFFAE10FFBF089B6EB" box="[1368,1428,444,466]" captionStart="Figure 7" captionStartId="18.[146,226,872,894]" captionTargetBox="[305,1265,195,833]" captionTargetId="figure-327@18.[305,1265,195,833]" captionTargetPageId="18" captionText="Figure 7. Habitat at the type locality of Bryophryne wilakunka sp. nov. in the Ayapata valley, province Carabaya, department Puno, Peru, 3947 m a.s.l." pageId="17" pageNumber="146">Fig. 7</figureCitation>
); they moved quite fast and were able to make short leaps (something unusual in other species of this genus).
</paragraph>
<paragraph id="8BBB9864A947FFFFFC820C7FF13EB43F" blockId="17.[827,1443,568,774]" pageId="17" pageNumber="146">
<emphasis id="B9704476A947FFFFFC820C7FF6ABB577" box="[827,950,568,589]" italics="true" pageId="17" pageNumber="146">Etymology</emphasis>
: The species epithet is used as a name in apposition and derives from the Aymara Wila Kunka, meaning red throat (wila = red, kunka = throat), which we use to refer to the bright dark red to orange ventral coloration of this species. Wila Kunka is also the name of a mountain (
<quantity id="4CFC3581A947FFFFFC4B0C96F156B5DC" box="[1010,1099,721,743]" metricMagnitude="3" metricUnit="m" metricValue="5.35" pageId="17" pageNumber="146" unit="m" value="5350.0">5350 m</quantity>
) in the Kallawaya mountain range of
<collectingRegion id="49C05686A947FFFFFC270CB7F6C7B43F" box="[926,986,752,773]" country="Peru" name="Puno" pageId="17" pageNumber="146">Puno</collectingRegion>
,
<collectingCountry id="F313D8F4A947FFFFFC5F0CB7F102B43F" box="[998,1055,752,773]" name="Peru" pageId="17" pageNumber="146">Peru</collectingCountry>
.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,318 @@
<document id="3502266F505B25828E512648BEF34989" ID-ISSN="0024-4082" ID-ZooBank="B2DCFB0-BF1A-47A1-911C-726876890892" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779474141" checkinUser="plazi" docAuthor="Riva, Ignacio De La, Chaparro, Juan C., Castroviejo-Fisher, Santiago &amp; Padial, José M." docDate="2018" docId="03AD2972A95BFFE1FC070D6BF1A4B487" docLanguage="en" docName="zlx020.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Bryophryne tocra Riva, Chaparro, Castroviejo-Fisher &amp; Padial, 2018, SP. NOV." docType="treatment" docVersion="1" lastPageNumber="144" masterDocId="FF94510AA956FFEEFFB90E47F51DB73A" masterDocTitle="Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)" masterLastPageNumber="172" masterPageNumber="129" pageNumber="142" updateTime="1738779668666" updateUser="GgImagineBatch">
<mods:mods id="48DD5C7011B96D11426F847F17D7F80C" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="0E117BE233B3FAD0918623E842098CE0">
<mods:title id="2F3F6AAB5BEB403FC9D69C308D6AFB6A">Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)</mods:title>
</mods:titleInfo>
<mods:name id="D9187FE6C5F1FDB689C17A2BBBFE58FC" type="personal">
<mods:role id="633F984F388B1C43917A2597D0F11E28">
<mods:roleTerm id="C719DB8AE54966C7BDF285893E7AC8BE">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="E2FDC15BAFE62B39681182AF0DC24484">Riva, Ignacio De La</mods:namePart>
</mods:name>
<mods:name id="2B66E83BD0263949FA826CFE251C70FB" type="personal">
<mods:role id="371658E99E3067CCCF94B87D4235D2C4">
<mods:roleTerm id="8654E4D49EA6C6AB500F7B3C9708FF74">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="00AE678F90E3E746DAF094B139BD9AF0">Chaparro, Juan C.</mods:namePart>
</mods:name>
<mods:name id="E7E6D597572C3175355F6D01C0C4CD97" type="personal">
<mods:role id="69F92D2C0DBF0FA82172C8F475CDF2D8">
<mods:roleTerm id="8F6A90078B06D8C641794598836DDFFF">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="FE310716D05BC2C99CE3ACD462978B51">Castroviejo-Fisher, Santiago</mods:namePart>
</mods:name>
<mods:name id="ED0AB3A9A827D54EF3067A73963A0BBD" type="personal">
<mods:role id="ADFE7BA4CB45C77387569757749DE1C4">
<mods:roleTerm id="6A5390A46CF4F0D439D286F3575B3A60">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="05598C2CF9BFF9848DAE01300C1464F9">Padial, José M.</mods:namePart>
</mods:name>
<mods:typeOfResource id="9EAB3D4C2B28C138B7903952C92605C7">text</mods:typeOfResource>
<mods:relatedItem id="D7DEAE554F050A1CEBD7E09A3B1EA625" type="host">
<mods:titleInfo id="D4C05B89C6C7CFFDECCB49A8789924B0">
<mods:title id="E8930DDA5030D8C147AFEFD7CBD72F41">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="05EC4F2A9E28F757C70B0C234A336111">
<mods:date id="5224F7A525ACAE965FABCF502337D7A2">2018</mods:date>
<mods:detail id="B085E614C8175DBE45304F566A1B1132" type="volume">
<mods:number id="B4928F58313BE489E228345BDDC3AFD6">182</mods:number>
</mods:detail>
<mods:extent id="2E2AB35D5501B9022703B7B2DCA34C8A" unit="page">
<mods:start id="6D5630367592BD8D027395A84319DDC4">129</mods:start>
<mods:end id="6F019E42803CC1E3DCF229226C195564">172</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="5EF81A6F5C8D7DD5A088064BED4C020F">journal article</mods:classification>
<mods:identifier id="3EE3660EFE6401322D0D0FCEF0EEF044" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="0D1C4DD0A8EE0814188030724116FFC2" type="ZooBank">B2DCFB0-BF1A-47A1-911C-726876890892</mods:identifier>
</mods:mods>
<treatment id="03AD2972A95BFFE1FC070D6BF1A4B487" LSID="urn:lsid:plazi:treatment:03AD2972A95BFFE1FC070D6BF1A4B487" httpUri="http://treatment.plazi.org/id/03AD2972A95BFFE1FC070D6BF1A4B487" lastPageId="15" lastPageNumber="144" pageId="13" pageNumber="142">
<subSubSection id="C31ECBEFA95BFFE3FC070D6BF002B479" box="[958,1311,811,835]" pageId="13" pageNumber="142" type="nomenclature">
<paragraph id="8BBB9864A95BFFE3FC070D6BF002B479" blockId="13.[958,1311,811,835]" box="[958,1311,811,835]" pageId="13" pageNumber="142">
<heading id="D0F32F08A95BFFE3FC070D6BF002B479" box="[958,1311,811,835]" centered="true" fontSize="9" level="2" pageId="13" pageNumber="142" reason="2">
<taxonomicName id="4C04E3E7A95BFFE3FC070D6BF1A8B478" ID-CoL="NJL5" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[958,1205,812,835]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="13" pageNumber="142" phylum="Chordata" rank="species" species="tocra" status="sp. nov.">
<smallCapsWord id="8D5D0EB8A95BFFE3FC070D6BF17DB478" baselines="829,829" box="[958,1120,812,835]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Bryophryne" pageId="13" pageNumber="142">BRYOPHRYNE</smallCapsWord>
<smallCapsWord id="8D5D0EB8A95BFFE3FBDE0D68F1A8B478" baselines="829" box="[1127,1205,815,834]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="tocra" pageId="13" pageNumber="142">TOCRA</smallCapsWord>
</taxonomicName>
<emphasis id="B9704476A95BFFE3FB040D68F002B479" bold="true" box="[1213,1311,811,835]" pageId="13" pageNumber="142">
<taxonomicNameLabel id="A243F90DA95BFFE3FB040D68F002B479" box="[1213,1311,811,835]" pageId="13" pageNumber="142" rank="species">
<smallCapsWord id="8D5D0EB8A95BFFE3FB040D68F1C7B478" baselines="829" box="[1213,1242,815,834]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="sp" pageId="13" pageNumber="142">SP</smallCapsWord>
.
<smallCapsWord id="8D5D0EB8A95BFFE3FB5E0D68F005B478" baselines="829" box="[1255,1304,815,834]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="nov" pageId="13" pageNumber="142">NOV</smallCapsWord>
.
</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C31ECBEFA95BFFE1FBFD0D15F1A4B487" lastPageId="15" lastPageNumber="144" pageId="13" pageNumber="142" type="description">
<paragraph id="8BBB9864A95BFFE3FBFD0D15F184B451" blockId="13.[1092,1177,850,875]" box="[1092,1177,850,875]" pageId="13" pageNumber="142">
(
<figureCitation id="133F84E1A95BFFE3FBF40D15F18CB451" box="[1101,1169,850,875]" captionStart="Figure 4" captionStartId="14.[145,223,1206,1228]" captionTargetBox="[305,1265,195,1167]" captionTargetId="figure-363@14.[305,1265,195,1167]" captionTargetPageId="14" captionText="Figure 4. Live specimens of Bryophryne tocra sp. nov. from near Ollachea, Peru. (AB) Adult female (MNCN 44214, SVL 27.6 mm), from the type locality. (CD) Adult female holotype (MUBI 5420, SVL 27.2 mm). (EF) Adult male (MNCN 43786, SVL 19.3 mm), from the type locality." pageId="13" pageNumber="142">
<smallCapsWord id="8D5D0EB8A95BFFE3FBF40D15F168B450" baselines="869,869" box="[1101,1141,850,875]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Fig" pageId="13" pageNumber="142">FIG</smallCapsWord>
. 4
</figureCitation>
)
</paragraph>
<paragraph id="8BBB9864A95BFFE3FC820D3CF083B495" blockId="13.[827,1443,890,943]" pageId="13" pageNumber="142">
u r n: l s i d: z o o b a n k. org:act:
<uuid id="FFA2A2B1A95BFFE3FC3F0DDEF083B495" box="[902,1438,921,943]" pageId="13" pageNumber="142">22B3787A-AC6A-4936-A1AF-338AA34FE6DA</uuid>
</paragraph>
<paragraph id="8BBB9864A95BFFE3FC820D9FF17AB39C" blockId="13.[827,1443,984,1190]" pageId="13" pageNumber="142">
<materialsCitation id="3B6C9239A95BFFE3FC820D9FF17AB39C" collectingDate="2006-02-24" collectionCode="MUBI" collectorName="I. De la Riva &amp; J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro." country="Peru" county="De la Riva" elevation="3213" latitude="-13.842" location="Ollachea" longLatPrecision="1" longitude="-70.49769" municipality="Carabaya" pageId="13" pageNumber="142" specimenCode="MUBI 5420" specimenCount="1" stateProvince="Puno" typeStatus="holotype">
<emphasis id="B9704476A95BFFE3FC820D9FF6BAB4D7" box="[827,935,984,1005]" italics="true" pageId="13" pageNumber="142">
<typeStatus id="54BF26C6A95BFFE3FC820D9FF6BAB4D7" box="[827,935,984,1005]" pageId="13" pageNumber="142" type="holotype">Holotype</typeStatus>
</emphasis>
:
<specimenCode id="DBA2301FA95BFFE3FC000D9FF154B4D4" box="[953,1097,984,1006]" collectionCode="MUBI" pageId="13" pageNumber="142">MUBI 5420</specimenCode>
(field number 4697), adult female from a point between
<location id="8EDBCEBFA95BFFE3FB2F0DB1F1E0B336" LSID="urn:lsid:plazi:treatment:03AD2972A95BFFE1FC070D6BF1A4B487:8EDBCEBFA95BFFE3FB2F0DB1F1E0B336" box="[1174,1277,1014,1036]" country="Peru" county="De la Riva" latitude="-13.842" longLatPrecision="1" longitude="-70.49769" municipality="Carabaya" name="Ollachea" pageId="13" pageNumber="142" stateProvince="Puno">Ollachea</location>
and the junction to
<location id="8EDBCEBFA95BFFE3FC370A52F6C0B311" LSID="urn:lsid:plazi:treatment:03AD2972A95BFFE1FC070D6BF1A4B487:8EDBCEBFA95BFFE3FC370A52F6C0B311" box="[910,989,1045,1067]" country="Peru" county="De la Riva" latitude="-13.842" longLatPrecision="1" longitude="-70.49769" municipality="Carabaya" name="Corani" pageId="13" pageNumber="142" stateProvince="Puno">Corani</location>
on the
<location id="8EDBCEBFA95BFFE3FB8E0A52F001B311" LSID="urn:lsid:plazi:treatment:03AD2972A95BFFE1FC070D6BF1A4B487:8EDBCEBFA95BFFE3FB8E0A52F001B311" box="[1079,1308,1045,1067]" country="Peru" county="De la Riva" latitude="-13.842" longLatPrecision="1" longitude="-70.49769" municipality="Carabaya" name="Ollachea - Macusani" pageId="13" pageNumber="142" stateProvince="Puno">OllacheaMacusani</location>
road, province
<collectingMunicipality id="6BDF021EA95BFFE3FCC80A73F6FEB370" box="[881,995,1076,1098]" pageId="13" pageNumber="142">Carabaya</collectingMunicipality>
, department
<collectingRegion id="49C05686A95BFFE3FBC70A73F1A6B373" box="[1150,1211,1076,1097]" country="Peru" name="Puno" pageId="13" pageNumber="142">Puno</collectingRegion>
,
<collectingCountry id="F313D8F4A95BFFE3FB7F0A73F1E3B373" box="[1222,1278,1076,1097]" name="Peru" pageId="13" pageNumber="142">Peru</collectingCountry>
,
<geoCoordinate id="EE30FEA3A95BFFE3FAB20A73F082B373" box="[1291,1439,1075,1098]" degrees="13" direction="south" minutes="50" orientation="latitude" pageId="13" pageNumber="142" precision="1" seconds="31.2" value="-13.842">
13°50
<emphasis id="B9704476A95BFFE3FAF50A74F04FB370" box="[1356,1362,1075,1098]" italics="true" pageId="13" pageNumber="142"></emphasis>
31.2
<emphasis id="B9704476A95BFFE3FA3D0A74F093B370" box="[1412,1422,1075,1098]" italics="true" pageId="13" pageNumber="142"></emphasis>
S
</geoCoordinate>
,
<geoCoordinate id="EE30FEA3A95BFFE3FC820A14F6C9B352" box="[827,980,1105,1128]" degrees="70" direction="west" minutes="29" orientation="longitude" pageId="13" pageNumber="142" precision="1" seconds="51.7" value="-70.49769">
70°29
<emphasis id="B9704476A95BFFE3FCC20A16F69CB352" box="[891,897,1105,1128]" italics="true" pageId="13" pageNumber="142"></emphasis>
51.7
<emphasis id="B9704476A95BFFE3FC0B0A16F6A1B352" box="[946,956,1105,1128]" italics="true" pageId="13" pageNumber="142"></emphasis>
W
</geoCoordinate>
,
<quantity id="4CFC3581A95BFFE3FC650A14F132B352" box="[988,1071,1107,1128]" metricMagnitude="3" metricUnit="m" metricValue="3.213" pageId="13" pageNumber="142" unit="m" value="3213.0">
<elevation id="00297F57A95BFFE3FC650A14F132B352" box="[988,1071,1107,1128]" metricMagnitude="3" metricUnit="m" metricValue="3.213" pageId="13" pageNumber="142" unit="m" value="3213.0">3213 m</elevation>
</quantity>
(
<figureCitation id="133F84E1A95BFFE3FB840A15F166B352" box="[1085,1147,1106,1128]" captionStart="Figure 3" captionStartId="11.[164,243,1434,1456]" captionTargetBox="[387,1218,197,1394]" captionTargetId="figure-207@11.[385,1220,195,1395]" captionTargetPageId="11" captionText="Figure 3. Map of the Andes of southern Peru around department of Cusco showing the distribution (type localities only) of the 12 nominal species of Bryophryne described hitherto: (1) B. flammiventris; (2) B. abramalagae; (3) B. bustamantei; (4) B. bakersfield; (5) B. cophites; (6) B. hanssaueri; (7) B. nubilosus; (8) B. gymnotis; (9) B. quellokunka sp. nov.; (10) B. zonalis; (11) B. tocra sp. nov.; (12) B. wilakunka sp. nov." pageId="13" pageNumber="142">Fig. 3</figureCitation>
), collected on
<date id="FFBABEA4A95BFFE3FAA10A14F669B3BD" pageId="13" pageNumber="142" value="2006-02-24">
<collectingDate id="EFFE474CA95BFFE3FAA10A14F669B3BD" pageId="13" pageNumber="142" value="2006-02-24">24 February 2006</collectingDate>
</date>
by
<collectorName id="26F1FDB2A95BFFE3FC1A0A35F15CB3BD" box="[931,1089,1137,1159]" pageId="13" pageNumber="142">
I.
<collectingCounty id="62DAE0E8A95BFFE3FC070A35F15CB3BD" box="[958,1089,1137,1159]" pageId="13" pageNumber="142">De la Riva</collectingCounty>
</collectorName>
,
<collectorName id="26F1FDB2A95BFFE3FBE90A35F1FEB3BD" box="[1104,1251,1137,1159]" pageId="13" pageNumber="142">J. M. Padial</collectorName>
,
<collectorName id="26F1FDB2A95BFFE3FB4B0A36F698B39C" pageId="13" pageNumber="142">S. Castroviejo-Fisher</collectorName>
and
<collectorName id="26F1FDB2A95BFFE3FC040AD7F17AB39C" box="[957,1127,1168,1190]" pageId="13" pageNumber="142">J. C. Chaparro.</collectorName>
</materialsCitation>
</paragraph>
<paragraph id="8BBB9864A95BFFE3FC820A88F012B2A6" blockId="13.[827,1443,1230,1436]" pageId="13" pageNumber="142">
<materialsCitation id="3B6C9239A95BFFE3FC820A88F6ABB239" collectionCode="MUBI" pageId="13" pageNumber="142" specimenCode="MUBI 5418-19" specimenCount="1" typeStatus="Paratopotypes">
<emphasis id="B9704476A95BFFE3FC820A88F6C2B3DE" box="[827,991,1231,1252]" italics="true" pageId="13" pageNumber="142">
<typeStatus id="54BF26C6A95BFFE3FC820A88F6C2B3DE" box="[827,991,1231,1252]" pageId="13" pageNumber="142" type="paratopotype">Paratopotypes</typeStatus>
</emphasis>
:
<specimenCode id="DBA2301FA95BFFE3FC540A88F1BEB3DE" box="[1005,1187,1230,1252]" collectionCode="MUBI" pageId="13" pageNumber="142">MUBI 541819</specimenCode>
, (field numbers 4693, 4695) and
</materialsCitation>
<materialsCitation id="3B6C9239A95BFFE3FC780AAAF055B218" collectingDate="2006-02-24" collectionCode="MNCN" collectorName="I. De la Riva &amp; J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro." country="Peru" county="De la Riva" elevation="3213" latitude="-13.842" location="Ollachea" longLatPrecision="1" longitude="-70.49769" municipality="Carabaya" pageId="13" pageNumber="142" specimenCode="MNCN 43785-87" specimenCount="1" stateProvince="Puno" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA95BFFE3FC780AAAF188B239" box="[961,1173,1261,1283]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="13" pageNumber="142" type="Museum">MNCN 4378587</specimenCode>
(field numbers 4692, 4694, 4696) (males), same data as the holotype
</materialsCitation>
;
<materialsCitation id="3B6C9239A95BFFE3FAE80B4BF00CB27A" collectionCode="MNCN" country="Peru" pageId="13" pageNumber="142" specimenCode="MNCN 44214" specimenCount="1" stateProvince="Puno" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA95BFFE3FAE80B4BF69CB27A" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="13" pageNumber="142" type="Museum">MNCN 44214</specimenCode>
(field number 4783) (female) and
</materialsCitation>
<materialsCitation id="3B6C9239A95BFFE3FAA30B6CF016B2A6" collectingDate="2007-02-04" collectionCode="MUBI" collectorName="J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro" country="Peru" location="De la Riva" pageId="13" pageNumber="142" specimenCode="MUBI 5696" specimenCount="1" stateProvince="Puno" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA95BFFE3FAA30B6CF0BEB27A" box="[1306,1443,1322,1344]" collectionCode="MUBI" pageId="13" pageNumber="142">MUBI 5696</specimenCode>
(field number 4784) (male) from the type locality, collected on
<date id="FFBABEA4A95BFFE3FC1C0B2FF143B247" box="[933,1118,1384,1406]" pageId="13" pageNumber="142" value="2007-02-04">
<collectingDate id="EFFE474CA95BFFE3FC1C0B2FF143B247" box="[933,1118,1384,1406]" pageId="13" pageNumber="142" value="2007-02-04">4 February 2007</collectingDate>
</date>
by I.
<location id="8EDBCEBFA95BFFE3FB200B2FF00DB244" LSID="urn:lsid:plazi:treatment:03AD2972A95BFFE1FC070D6BF1A4B487:8EDBCEBFA95BFFE3FB200B2FF00DB244" box="[1177,1296,1384,1406]" country="Peru" name="De la Riva" pageId="13" pageNumber="142" stateProvince="Puno">De la Riva</location>
,
<collectorName id="26F1FDB2A95BFFE3FAA30B2FF083B244" box="[1306,1438,1384,1406]" pageId="13" pageNumber="142">J. M. Padial</collectorName>
,
<collectorName id="26F1FDB2A95BFFE3FC820BC0F135B2A6" box="[827,1064,1414,1436]" pageId="13" pageNumber="142">S. Castroviejo-Fisher</collectorName>
, and
<collectorName id="26F1FDB2A95BFFE3FBDC0BC0F016B2A6" box="[1125,1291,1414,1436]" pageId="13" pageNumber="142">J. C. Chaparro</collectorName>
</materialsCitation>
.
</paragraph>
<paragraph id="8BBB9864A95BFFE0FC820B81F4CCB036" blockId="13.[827,1443,1477,1898]" lastBlockId="14.[145,762,1323,1897]" lastPageId="14" lastPageNumber="143" pageId="13" pageNumber="142">
<emphasis id="B9704476A95BFFE3FC820B81F6B4B2E1" box="[827,937,1478,1499]" italics="true" pageId="13" pageNumber="142">Diagnosis</emphasis>
:
<taxonomicName id="4C04E3E7A95BFFE3FC0D0B82F16FB2E1" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[948,1138,1477,1499]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="13" pageNumber="142" phylum="Chordata" rank="species" species="tocra">
<emphasis id="B9704476A95BFFE3FC0D0B82F16FB2E1" box="[948,1138,1477,1499]" italics="true" pageId="13" pageNumber="142">Bryophryne tocra</emphasis>
</taxonomicName>
is characterized by: (1) skin on dorsum coarsely shagreen with scattered warts to warty (warts small, round to elongate); flanks coarsely warty, with some enlarged conical warts; head and forearms smooth to slightly shagreen; dorsal folds absent, a row of large warts from behind the eye to sacral region in some specimens; ventral skin coarsely areolate, throat areolate, chest smooth; (2) tympanic membrane and tympanic annulus small, differentiable beneath the skin; supratympanic fold short, conspicuous; (3) snout short, rounded in dorsal and lateral views; (4) upper eyelid lacking tubercles, cranial crests absent; (5) dentigerous process of vomers absent; (6) vocal slits present, nuptial pads absent; (7) Finger I slightly shorter than Finger II, tips of digits rounded, lacking circumferential grooves and ungual flap; (8) fingers lacking lateral fringes; (9) ulnar region bearing warts; (10) heel lacking tubercles, tarsus lacking tubercles and folds; (11) plantar surfaces of feet bearing two metatarsal tubercles, inner slightly larger than outer; supernumerary plantar tubercles low, weakly defined; (12) toes lacking lateral fringes; webbing absent; Toe III equal to V, tips of digits rounded, lacking circumferential grooves and ungual flap; (13) dorsal coloration dark brown to grey, with metallic tones; ventral coloration white with black spots or marbled with black stripes; groins, axillae and posterior surfaces of thighs with yellow flash marks surrounded by bold black; (14) females larger than males, SVL
<quantity id="4CFC3581A958FFE0FF7E089EF452B1D5" box="[199,335,1753,1775]" metricMagnitude="-1" metricUnit="m" metricValue="6.9596" metricValueMax="7.0104" metricValueMin="6.908799999999999" pageId="14" pageNumber="143" unit="in" value="27.4" valueMax="27.6" valueMin="27.2">27.227.6 in</quantity>
adult females (
<emphasis id="B9704476A958FFE0FE41089EF71AB1D4" box="[504,519,1753,1774]" italics="true" pageId="14" pageNumber="143">n</emphasis>
= 2), 18.420.0 mm in adult males (
<emphasis id="B9704476A958FFE0FE9A08BFF42FB037" box="[291,306,1784,1805]" italics="true" pageId="14" pageNumber="143">n</emphasis>
= 5) (
<tableCitation id="C686ADDFA958FFE0FECB08B0F4DEB036" box="[370,451,1783,1805]" captionStart="Table 3" captionStartId="12.[142,206,698,720]" captionText="Table 3. Morphometrics for new Peruvian species of Bryophryne and Microkayla (range, in parenthesis, follows mean; AM, adult males; AF, adult females)" pageId="14" pageNumber="143">Table 3</tableCitation>
).
</paragraph>
<caption id="DF7BC8ECA958FFE0FF280AF1F70AB23D" pageId="14" pageNumber="143" startId="14.[145,223,1206,1228]" targetBox="[305,1265,195,1167]" targetPageId="14" targetType="figure">
<paragraph id="8BBB9864A958FFE0FF280AF1F70AB23D" blockId="14.[145,1425,1206,1287]" pageId="14" pageNumber="143">
<emphasis id="B9704476A958FFE0FF280AF1F5E5B3F1" bold="true" box="[145,248,1206,1228]" pageId="14" pageNumber="143">Figure 4.</emphasis>
Live specimens of
<emphasis id="B9704476A958FFE0FE060AF1F7FFB3F6" bold="true" box="[447,738,1206,1228]" pageId="14" pageNumber="143">
<taxonomicName id="4C04E3E7A958FFE0FE060AF1F79AB3F6" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[447,647,1206,1228]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="tocra" status="sp. nov.">
<emphasis id="B9704476A958FFE0FE060AF1F79AB3F6" bold="true" box="[447,647,1206,1228]" italics="true" pageId="14" pageNumber="143">Bryophryne tocra</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA958FFE0FD340AF0F7FFB3F6" box="[653,738,1207,1228]" pageId="14" pageNumber="143" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
from near Ollachea, Peru. (AB) Adult female (MNCN 44214, SVL 27.6 mm), from the type locality. (CD) Adult female holotype (MUBI 5420, SVL 27.2 mm). (EF) Adult male (MNCN 43786, SVL 19.3 mm), from the type locality.
</paragraph>
</caption>
<paragraph id="8BBB9864A958FFE0FF100951F08FB037" blockId="14.[145,762,1323,1897]" lastBlockId="14.[809,1426,1323,1805]" pageId="14" pageNumber="143">
The sister and geographically closest species to
<taxonomicName id="4C04E3E7A958FFE0FD5B0950F5D7B070" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="tocra">
<emphasis id="B9704476A958FFE0FD5B0950F5D7B070" italics="true" pageId="14" pageNumber="143">B. tocra</emphasis>
</taxonomicName>
is
<taxonomicName id="4C04E3E7A958FFE0FF530972F49DB070" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[234,384,1845,1866]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="wilakunka">
<emphasis id="B9704476A958FFE0FF530972F49DB070" box="[234,384,1845,1866]" italics="true" pageId="14" pageNumber="143">B. wilakunka</emphasis>
</taxonomicName>
(
<typeStatus id="54BF26C6A958FFE0FE370972F4A2B070" box="[398,447,1845,1866]" pageId="14" pageNumber="143">type</typeStatus>
localities separated by
<quantity id="4CFC3581A958FFE0FD700972F5ABB053" metricMagnitude="4" metricUnit="m" metricValue="1.98" pageId="14" pageNumber="143" unit="km" value="19.8">19.8 km</quantity>
straight line distance). Differences between them are listed below under
<taxonomicName id="4C04E3E7A958FFE0FB810B6BF1CEB27A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1080,1235,1323,1345]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="wilakunka">
<emphasis id="B9704476A958FFE0FB810B6BF1CEB27A" box="[1080,1235,1323,1345]" italics="true" pageId="14" pageNumber="143">B. wilakunka</emphasis>
</taxonomicName>
. Two species,
<taxonomicName id="4C04E3E7A958FFE0FAC30B6BF6A6B265" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A958FFE0FAC30B6BF6A6B265" italics="true" pageId="14" pageNumber="143">B. quellokunka</emphasis>
</taxonomicName>
and
<taxonomicName id="4C04E3E7A958FFE0FC430B0CF173B265" authorityName="Lehr and Catenazzi" authorityYear="2009" box="[1018,1134,1354,1376]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="zonalis">
<emphasis id="B9704476A958FFE0FC430B0CF173B265" box="[1018,1134,1354,1376]" italics="true" pageId="14" pageNumber="143">B. zonalis</emphasis>
</taxonomicName>
occur at the Marcapata Valley,
<quantity id="4CFC3581A958FFE0FCCC0B2EF6A5B245" box="[885,952,1385,1407]" metricMagnitude="4" metricUnit="m" metricValue="6.5" pageId="14" pageNumber="143" unit="km" value="65.0">65 km</quantity>
northwest of
<taxonomicName id="4C04E3E7A958FFE0FBF30B2EF181B244" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1098,1180,1385,1406]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="tocra">
<emphasis id="B9704476A958FFE0FBF30B2EF181B244" box="[1098,1180,1385,1406]" italics="true" pageId="14" pageNumber="143">B. tocra</emphasis>
</taxonomicName>
. From
<taxonomicName id="4C04E3E7A958FFE0FB5F0B2EF096B244" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1254,1419,1385,1406]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A958FFE0FB5F0B2EF096B244" box="[1254,1419,1385,1406]" italics="true" pageId="14" pageNumber="143">B. quellokunka</emphasis>
</taxonomicName>
,
<taxonomicName id="4C04E3E7A958FFE0FC900BCFF662B2A7" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[809,895,1416,1437]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="tocra">
<emphasis id="B9704476A958FFE0FC900BCFF662B2A7" box="[809,895,1416,1437]" italics="true" pageId="14" pageNumber="143">B. tocra</emphasis>
</taxonomicName>
differs by having throat areolate (smooth in
<taxonomicName id="4C04E3E7A958FFE0FAC30BCFF6ABB281" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A958FFE0FAC30BCFF6ABB281" italics="true" pageId="14" pageNumber="143">B. quellokunka</emphasis>
</taxonomicName>
), chest smooth (areolate), yellow blotches surrounded by black on groins, axillae and posterior surfaces of thighs (absent), and venter white with black spots or stripes (variable from greyish-purple with diffuse black blotches to brown); additionally, the iris of
<taxonomicName id="4C04E3E7A958FFE0FC900807F69FB16F" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[809,898,1600,1621]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="tocra">
<emphasis id="B9704476A958FFE0FC900807F69FB16F" box="[809,898,1600,1621]" italics="true" pageId="14" pageNumber="143">B. tocra</emphasis>
</taxonomicName>
in life is brown with fine black reticulations (two inferior thirds of iris dark brown and upper third metallic bluish-grey in
<taxonomicName id="4C04E3E7A958FFE0FB8B083AF1C1B1A8" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1074,1244,1661,1682]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A958FFE0FB8B083AF1C1B1A8" box="[1074,1244,1661,1682]" italics="true" pageId="14" pageNumber="143">B. quellokunka</emphasis>
</taxonomicName>
). From
<taxonomicName id="4C04E3E7A958FFE0FA8F083AF659B18A" authorityName="Lehr and Catenazzi" authorityYear="2009" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="zonalis">
<emphasis id="B9704476A958FFE0FA8F083AF659B18A" italics="true" pageId="14" pageNumber="143">B. zonalis</emphasis>
</taxonomicName>
,
<taxonomicName id="4C04E3E7A958FFE0FCE808DBF6BAB18B" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[849,935,1692,1713]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="tocra">
<emphasis id="B9704476A958FFE0FCE808DBF6BAB18B" box="[849,935,1692,1713]" italics="true" pageId="14" pageNumber="143">B. tocra</emphasis>
</taxonomicName>
differs by having tympanum and tympanic annulus visible (absent in
<taxonomicName id="4C04E3E7A958FFE0FBEF08FCF1D9B1F5" authorityName="Lehr and Catenazzi" authorityYear="2009" box="[1110,1220,1722,1744]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="14" pageNumber="143" phylum="Chordata" rank="species" species="zonalis">
<emphasis id="B9704476A958FFE0FBEF08FCF1D9B1F5" box="[1110,1220,1722,1744]" italics="true" pageId="14" pageNumber="143">B. zonalis</emphasis>
</taxonomicName>
), and groins, axillae and posterior surfaces of thighs with yellow flash marks surrounded by bold black (yellow marks absent).
</paragraph>
<paragraph id="8BBB9864A958FFE1FC900970F779B4CD" blockId="14.[809,1425,1846,1899]" lastBlockId="15.[163,780,197,1384]" lastPageId="15" lastPageNumber="144" pageId="14" pageNumber="143">
<emphasis id="B9704476A958FFE0FC900970F144B071" box="[809,1113,1846,1868]" italics="true" pageId="14" pageNumber="143">
Description of the
<typeStatus id="54BF26C6A958FFE0FC430971F144B071" box="[1018,1113,1846,1867]" pageId="14" pageNumber="143" type="holotype">holotype</typeStatus>
</emphasis>
: An adult female,
<quantity id="4CFC3581A958FFE0FA940971F08CB071" box="[1325,1425,1846,1867]" metricMagnitude="-2" metricUnit="m" metricValue="2.7199999999999998" pageId="14" pageNumber="143" unit="mm" value="27.2">27.2 mm</quantity>
SVL. Body moderately robust; dorsal skin coarsely shagreen with scattered warts of different sizes; ventral skin areolate; dorsolateral folds absent; pectoral fold present; head slightly wider than long; HW 30.8% of SVL, HL 29.8% of SVL; snout moderately short, rounded in dorsal view and in profile; nostrils slightly prominent, closer to snout than to eyes; canthus rostralis straight in dorsal view and in profile; eyenostril distance 62.0% of eye length; loreal region concave; cranial crests absent; tympanic membrane and tympanic annulus small, barely perceptible beneath the skin; skin of tympanic area covered by large subconical warts; supratympanic fold well marked, short; tongue large, oval; choanae small, rounded, broadly separated; dentigerous process of vomers absent; ulnar tubercle and fold absent; inner palmar tubercle single, oval, slightly smaller than outer; fingers moderately short, not fringed, lacking circumferential grooves and ungual flap; subarticular tubercles round, poorly marked; supernumerary tubercles irregular and poorly defined; first finger slightly shorter than second, relative length of fingers 1 &lt;2 &lt;4 &lt;3; tibia length 35.6% of SVL; tarsal fold absent; two metatarsal tubercles, oval inner slightly larger than rounded outer; supernumerary and subarticular tubercles low, poorly defined; toe tips round, not expanded laterally, lacking circumferential grooves and ungual flap, toes lacking basal webbing or lateral fringes; relative length of toes 1 &lt;2 &lt;3 = 5 &lt;4; foot length 40.0% of SVL.
</paragraph>
<paragraph id="8BBB9864A959FFE1FF020A46F61BB252" blockId="15.[163,780,197,1384]" pageId="15" pageNumber="144">
In preservative, dorsum greyish-brown, venter pale cream with brown, small, irregular blotches; throat cream; large cream blotches on groin surrounded by dark brown; palmar and plantar surfaces cream. In life, the dorsum of the
<typeStatus id="54BF26C6A959FFE1FE110A3BF717B3A8" box="[424,522,1148,1170]" pageId="15" pageNumber="144" type="holotype">holotype</typeStatus>
was mostly uniformly brown above; there were large pale yellow blotches surrounded by black in axillae, flanks and posterior surface of thighs, with a similar, more attenuated pattern on flanks and lower surfaces of hind limbs; the venter was grey with irregular brown dots and the throat was yellowish-cream; palmar and plantar surfaces were dirty orange; the iris was brown with fine black reticulation.
</paragraph>
<paragraph id="8BBB9864A959FFE1FF1A0BD5F415B2D9" blockId="15.[163,778,1425,1508]" pageId="15" pageNumber="144">
<emphasis id="B9704476A959FFE1FF1A0BD5F766B29C" box="[163,635,1425,1447]" italics="true" pageId="15" pageNumber="144">
Measurements (in mm) of the
<typeStatus id="54BF26C6A959FFE1FDAF0BD6F766B29C" box="[534,635,1425,1446]" pageId="15" pageNumber="144" type="holotype">holotype</typeStatus>
</emphasis>
: SVL, 27.2; HL, 8.1; HW, 8.4; IND, 2.4; END, 2.1; ED, 3.4; TL, 9.7; FL, 10.9.
</paragraph>
<paragraph id="8BBB9864A959FFE1FF1A0849F0B9B537" blockId="15.[163,779,1549,1908]" lastBlockId="15.[827,1444,197,525]" pageId="15" pageNumber="144">
<emphasis id="B9704476A959FFE1FF1A0849F40CB119" box="[163,273,1550,1571]" italics="true" pageId="15" pageNumber="144">Variation</emphasis>
: Males are smaller than females (
<tableCitation id="C686ADDFA959FFE1FD1F084AF7E1B118" box="[678,764,1549,1571]" captionStart="Table 3" captionStartId="12.[142,206,698,720]" captionText="Table 3. Morphometrics for new Peruvian species of Bryophryne and Microkayla (range, in parenthesis, follows mean; AM, adult males; AF, adult females)" pageId="15" pageNumber="144">Table 3</tableCitation>
), and have vocal slits but lack nuptial pads. In preservative, they are greybrown above with a pale grey dorsal triangle between eyes and snout, and a brown canthal stripe that in MUBI 5419 and MUBI 5696 extends to the tympanic region; ventral coloration is variable, from finely dotted with brown (MUBI 5418, MNCN 43785, 43787) to brown with a marbled cream pattern (MUBI 5696 and MNCN 43786) to mostly uniformly brown (MUBI 5419); MNCN 43785 has irregular dark grey blotches on dorsum, outlined by pale grey margins; males have vocal slits and lack nuptial pads. In life, these males were uniformly brown with small orange blotches on groin, which can be present on the lower surface of the shanks and the posterior surfaces of thighs too. In preservative, female MNCN 44214 is similar to the
<typeStatus id="54BF26C6A959FFE1FBE90F07F1A9B66C" box="[1104,1204,320,342]" pageId="15" pageNumber="144" type="holotype">holotype</typeStatus>
but with a marbled venter forming a brown and cream pattern, including the throat; the palmar and plantar surfaces are pale brown instead of cream, and the pale blotches on groin, axillae, lower belly and flanks are smaller; in life, these blotches were yellow, and the venter consisted of a reticulated pattern of dark brown and greenish-cream.
</paragraph>
<paragraph id="8BBB9864A959FFE1FC820C71F1E5B5DF" blockId="15.[827,1443,566,741]" pageId="15" pageNumber="144">
<emphasis id="B9704476A959FFE1FC820C71F1B7B571" box="[827,1194,566,587]" italics="true" pageId="15" pageNumber="144">Distribution and natural history</emphasis>
: Known only from the type locality. Individuals were found during the day under stones in open wet puna (
<figureCitation id="133F84E1A959FFE1FB0D0C34F1E8B5B3" box="[1204,1269,627,649]" captionStart="Figure 5" captionStartId="16.[145,223,872,894]" captionTargetBox="[305,1265,195,833]" captionTargetId="figure-544@16.[305,1265,195,833]" captionTargetPageId="16" captionText="Figure 5. Habitat at the type locality of Bryophryne tocra sp. nov. along the Ollachea-Macusani road, province Carabaya, department Puno, Peru, 3213 m a.s.l." pageId="15" pageNumber="144">Fig. 5</figureCitation>
). The
<typeStatus id="54BF26C6A959FFE1FAF90C34F0BEB5B3" box="[1344,1443,627,649]" pageId="15" pageNumber="144" type="holotype">holotype</typeStatus>
bears mature unpigmented eggs. When disturbed, individuals were able to make small leaps (something unusual in other species of this genus).
</paragraph>
<paragraph id="8BBB9864A959FFE1FC820D49F1A4B487" blockId="15.[827,1443,782,957]" pageId="15" pageNumber="144">
<emphasis id="B9704476A959FFE1FC820D49F6ABB419" box="[827,950,782,803]" italics="true" pageId="15" pageNumber="144">Etymology</emphasis>
: The species epithet is used as a name in apposition, and derives from the Quechua word Tuqra for faded, discoloured, pale, and we use it to refer to the white belly of the new species. Tuqra is also the name of a mountain (
<quantity id="4CFC3581A959FFE1FC560DCEF155B4A4" box="[1007,1096,905,927]" metricMagnitude="3" metricUnit="m" metricValue="5.0" pageId="15" pageNumber="144" unit="m" value="5000.0">5000 m</quantity>
) in the Willkanuta mountain range in the Andes of
<collectingRegion id="49C05686A959FFE1FB8C0DEFF16CB487" box="[1077,1137,936,957]" country="Peru" name="Puno" pageId="15" pageNumber="144">Puno</collectingRegion>
,
<collectingCountry id="F313D8F4A959FFE1FBC50DEFF1A8B487" box="[1148,1205,936,957]" name="Peru" pageId="15" pageNumber="144">Peru</collectingCountry>
.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,672 @@
<document id="CB099262DCD4F5D5103F282816A55D45" ID-ISSN="0024-4082" ID-ZooBank="B2DCFB0-BF1A-47A1-911C-726876890892" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779474141" checkinUser="plazi" docAuthor="Riva, Ignacio De La, Chaparro, Juan C., Castroviejo-Fisher, Santiago &amp; Padial, José M." docDate="2018" docId="03AD2972A95CFFE3FF5D0C45F0B9B5DC" docLanguage="en" docName="zlx020.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Bryophryne quellokunka Riva, Chaparro, Castroviejo-Fisher &amp; Padial, 2018, SP. NOV." docType="treatment" docVersion="1" lastPageNumber="142" masterDocId="FF94510AA956FFEEFFB90E47F51DB73A" masterDocTitle="Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)" masterLastPageNumber="172" masterPageNumber="129" pageNumber="139" updateTime="1738779668666" updateUser="GgImagineBatch">
<mods:mods id="B09C3EF810032B2FD66560F328E8DF16" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="95E77C4F9ACCF0863F8C50475D4A6165">
<mods:title id="E458299733F3247659D05CA5DFC45C1A">Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae)</mods:title>
</mods:titleInfo>
<mods:name id="D832C0B7C17983F24EA92ECCFAAC7D53" type="personal">
<mods:role id="784FE9D697E9964AC92F7BFE66726613">
<mods:roleTerm id="57CD3E9983076BF2CCC79806349DEF57">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="2A8744BD63D7A57269D46EBFA7951231">Riva, Ignacio De La</mods:namePart>
</mods:name>
<mods:name id="A88839F2F547B435252BFB26221C8DAE" type="personal">
<mods:role id="D7E6E51175DA0B32F65850311A862DA0">
<mods:roleTerm id="97A743198A26019077FFCDF3A71825A4">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="319B9085A9177DC544E22BCDCA194BE4">Chaparro, Juan C.</mods:namePart>
</mods:name>
<mods:name id="CC60E1F7C82C1BDD835396A81D7F1F7B" type="personal">
<mods:role id="D1ED393ECB2E65D85023408ADF3E6E80">
<mods:roleTerm id="C24FC629701BE156115264F3A8A9200F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="758ECCCA0D3B2A05B808F3D44C6E1EDE">Castroviejo-Fisher, Santiago</mods:namePart>
</mods:name>
<mods:name id="82D67D007C9B0C77A0AECB1B7010A13E" type="personal">
<mods:role id="5E56E174FD6D995F0F1CA51976F3137D">
<mods:roleTerm id="C27CEE69A8FC75633C3DA8443E5FBA1E">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="2478A2FB56373DF189A2D30DFAFFB95F">Padial, José M.</mods:namePart>
</mods:name>
<mods:typeOfResource id="473521B96C0CB7CEB6CF54E141D58FE8">text</mods:typeOfResource>
<mods:relatedItem id="7B289FB13008A04FE3604381E7993ABE" type="host">
<mods:titleInfo id="BCA90B5B93FF666CC02E023FEAFD28B4">
<mods:title id="ADB956FC62A6C52491211EE60F5DDC08">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="5B656466F07034E0885E5E3C26B998EE">
<mods:date id="DA28AA3A23116DC592E930784B15C818">2018</mods:date>
<mods:detail id="0804CD0DB771C132E607CC1D709DC49B" type="volume">
<mods:number id="2E24910B2B01E4C97BDCBC02CB1BA4B7">182</mods:number>
</mods:detail>
<mods:extent id="CF50BB0392B0E5CB351CC38B7AA62D57" unit="page">
<mods:start id="AB81B1FDF6F65FA684D99A50D49C8861">129</mods:start>
<mods:end id="E450F4B381B3BCF162AC26B56740861C">172</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="3926C09EE7DA3E4CBED08D3D87A42A4E">journal article</mods:classification>
<mods:identifier id="85519A67FE24BEC7DAF2A08FD2A005CF" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="056EC1F2553CB1D0B9C1FC708B0965BE" type="ZooBank">B2DCFB0-BF1A-47A1-911C-726876890892</mods:identifier>
</mods:mods>
<treatment id="03AD2972A95CFFE3FF5D0C45F0B9B5DC" LSID="urn:lsid:plazi:treatment:03AD2972A95CFFE3FF5D0C45F0B9B5DC" httpUri="http://treatment.plazi.org/id/03AD2972A95CFFE3FF5D0C45F0B9B5DC" lastPageId="13" lastPageNumber="142" pageId="10" pageNumber="139">
<subSubSection id="C31ECBEFA95CFFE4FF5D0C45F7BBB520" box="[228,678,514,538]" pageId="10" pageNumber="139" type="nomenclature">
<paragraph id="8BBB9864A95CFFE4FF5D0C45F7BBB520" blockId="10.[228,678,514,538]" box="[228,678,514,538]" pageId="10" pageNumber="139">
<heading id="D0F32F08A95CFFE4FF5D0C45F7BBB520" box="[228,678,514,538]" centered="true" fontSize="9" level="2" pageId="10" pageNumber="139" reason="2">
<taxonomicName id="4C04E3E7A95CFFE4FF5D0C45F721B520" ID-CoL="NJL4" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[228,572,514,538]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="10" pageNumber="139" phylum="Chordata" rank="species" species="quellokunka" status="sp. nov.">
<smallCapsWord id="8D5D0EB8A95CFFE4FF5D0C45F49BB523" baselines="531,532" box="[228,390,514,537]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Bryophryne" pageId="10" pageNumber="139">BRYOPHRYNE</smallCapsWord>
<smallCapsWord id="8D5D0EB8A95CFFE4FE340C41F721B520" baselines="533" box="[397,572,518,538]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="quellokunka" pageId="10" pageNumber="139">QUELLOKUNKA</smallCapsWord>
</taxonomicName>
<emphasis id="B9704476A95CFFE4FDFA0C42F7BBB520" bold="true" box="[579,678,514,538]" pageId="10" pageNumber="139">
<taxonomicNameLabel id="A243F90DA95CFFE4FDFA0C42F7BBB520" box="[579,678,514,538]" pageId="10" pageNumber="139" rank="species">
<smallCapsWord id="8D5D0EB8A95CFFE4FDFA0C42F77DB522" baselines="531" box="[579,608,517,536]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="sp" pageId="10" pageNumber="139">SP</smallCapsWord>
.
<smallCapsWord id="8D5D0EB8A95CFFE4FDD70C42F782B522" baselines="531" box="[622,671,517,536]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="nov" pageId="10" pageNumber="139">NOV</smallCapsWord>
.
</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C31ECBEFA95CFFE3FE230C6EF0B9B5DC" lastPageId="13" lastPageNumber="142" pageId="10" pageNumber="139" type="description">
<paragraph id="8BBB9864A95CFFE4FE230C6EF4F2B578" blockId="10.[410,495,553,578]" box="[410,495,553,578]" pageId="10" pageNumber="139">
(
<figureCitation id="133F84E1A95CFFE4FE1A0C6EF4FAB578" box="[419,487,553,578]" captionStart="Figure 2" captionStartId="10.[145,225,1860,1882]" captionTargetBox="[305,1265,1176,1821]" captionTargetId="figure-470@10.[305,1265,1176,1821]" captionTargetPageId="10" captionText="Figure 2. Live specimens of Bryophryne quellokunka sp. nov. from Qorpinte, Marcapata, Peru. (AB) Adult female holotype (MUBI 5380, SVL 28.2 mm). (CD) Adult male (MNCN 43782, SVL 20.1 mm), from the type locality." pageId="10" pageNumber="139">
<smallCapsWord id="8D5D0EB8A95CFFE4FE1A0C6EF4D1B57A" baselines="572,571" box="[419,460,553,578]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Fig" pageId="10" pageNumber="139">FIG</smallCapsWord>
. 2
</figureCitation>
)
</paragraph>
<paragraph id="8BBB9864A95CFFE4FF280C16F457B5BC" blockId="10.[145,761,593,646]" pageId="10" pageNumber="139">
<uri id="FF959466A95CFFE4FF280C16F457B5BC" pageId="10" pageNumber="139">
urn:lsid:zoobank.org:act:
<uuid id="FFA2A2B1A95CFFE4FE1B0C16F457B5BC" pageId="10" pageNumber="139">0396BD77-2426-4541-93DE- D22D858AD292</uuid>
</uri>
</paragraph>
<paragraph id="8BBB9864A95CFFE4FF280CE9F4DCB446" blockId="10.[145,762,686,892]" pageId="10" pageNumber="139">
<materialsCitation id="3B6C9239A95CFFE4FF280CE9F4DCB446" collectingDate="2006-02-20" collectionCode="MUBI" collectorName="I. De la Riva &amp; J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro." country="Peru" county="De la Riva" elevation="3964" latitude="-13.605223" location="Qorpinte" longLatPrecision="1" longitude="-71.052444" municipality="Quispicanchis" pageId="10" pageNumber="139" specimenCode="MUBI 5380" specimenCount="1" stateProvince="Cusco" typeStatus="holotype">
<emphasis id="B9704476A95CFFE4FF280CE9F5E0B5F9" box="[145,253,686,707]" italics="true" pageId="10" pageNumber="139">
<typeStatus id="54BF26C6A95CFFE4FF280CE9F5E0B5F9" box="[145,253,686,707]" pageId="10" pageNumber="139" type="holotype">Holotype</typeStatus>
</emphasis>
:
<specimenCode id="DBA2301FA95CFFE4FEB60CE8F482B5FE" box="[271,415,686,708]" collectionCode="MUBI" pageId="10" pageNumber="139">MUBI 5380</specimenCode>
(field number 4626), adult female from
<location id="8EDBCEBFA95CFFE4FE810C8AF4B6B5D9" LSID="urn:lsid:plazi:treatment:03AD2972A95CFFE3FF5D0C45F0B9B5DC:8EDBCEBFA95CFFE4FE810C8AF4B6B5D9" box="[312,427,717,739]" country="Peru" county="De la Riva" latitude="-13.605223" longLatPrecision="1" longitude="-71.052444" municipality="Quispicanchis" name="Qorpinte" pageId="10" pageNumber="139" stateProvince="Cusco">Qorpinte</location>
,
<quantity id="4CFC3581A95CFFE4FE040C8AF4E0B5D9" box="[445,509,717,739]" metricMagnitude="3" metricUnit="m" metricValue="2.0" pageId="10" pageNumber="139" unit="km" value="2.0">2 km</quantity>
from
<location id="8EDBCEBFA95CFFE4FDE90C8AF7EAB5D9" LSID="urn:lsid:plazi:treatment:03AD2972A95CFFE3FF5D0C45F0B9B5DC:8EDBCEBFA95CFFE4FDE90C8AF7EAB5D9" box="[592,759,717,739]" country="Peru" county="De la Riva" latitude="-13.605223" longLatPrecision="1" longitude="-71.052444" municipality="Quispicanchis" name="Tambopampa" pageId="10" pageNumber="139" stateProvince="Cusco">Tambopampa</location>
towards
<location id="8EDBCEBFA95CFFE4FF410CABF466B43B" LSID="urn:lsid:plazi:treatment:03AD2972A95CFFE3FF5D0C45F0B9B5DC:8EDBCEBFA95CFFE4FF410CABF466B43B" box="[248,379,748,769]" country="Peru" county="De la Riva" latitude="-13.605223" longLatPrecision="1" longitude="-71.052444" municipality="Quispicanchis" name="Marcapata" pageId="10" pageNumber="139" stateProvince="Cusco">Marcapata</location>
,
<location id="8EDBCEBFA95CFFE4FE300CABF72AB438" LSID="urn:lsid:plazi:treatment:03AD2972A95CFFE3FF5D0C45F0B9B5DC:8EDBCEBFA95CFFE4FE300CABF72AB438" box="[393,567,748,770]" country="Peru" county="De la Riva" latitude="-13.605223" longLatPrecision="1" longitude="-71.052444" municipality="Quispicanchis" name="Palquilla river" pageId="10" pageNumber="139" stateProvince="Cusco">Palquilla river</location>
valley, province
<collectingMunicipality id="6BDF021EA95CFFE4FF280D4DF429B41A" box="[145,308,778,800]" pageId="10" pageNumber="139">Quispicanchis</collectingMunicipality>
, department
<collectingRegion id="49C05686A95CFFE4FE740D4CF70EB41A" box="[461,531,779,800]" country="Peru" name="Cusco" pageId="10" pageNumber="139">Cusco</collectingRegion>
,
<collectingCountry id="F313D8F4A95CFFE4FDA70D4CF74BB41A" box="[542,598,779,800]" name="Peru" pageId="10" pageNumber="139">Peru</collectingCountry>
,
<geoCoordinate id="EE30FEA3A95CFFE4FDDB0D4DF7E9B41A" box="[610,756,777,800]" degrees="13" direction="south" minutes="36" orientation="latitude" pageId="10" pageNumber="139" precision="1" seconds="18.8" value="-13.605223">
13°36
<emphasis id="B9704476A95CFFE4FD1A0D4EF7B4B41A" box="[675,681,777,800]" italics="true" pageId="10" pageNumber="139"></emphasis>
18.8
<emphasis id="B9704476A95CFFE4FD630D4EF7F9B41A" box="[730,740,777,800]" italics="true" pageId="10" pageNumber="139"></emphasis>
S
</geoCoordinate>
,
<geoCoordinate id="EE30FEA3A95CFFE4FF280D6EF401B405" box="[145,284,808,831]" degrees="71" direction="west" minutes="03" orientation="longitude" pageId="10" pageNumber="139" precision="1" seconds="8.8" value="-71.052444">
71°03
<emphasis id="B9704476A95CFFE4FF6B0D6FF5C5B405" box="[210,216,808,831]" italics="true" pageId="10" pageNumber="139"></emphasis>
8.8
<emphasis id="B9704476A95CFFE4FF420D6FF418B405" box="[251,261,808,831]" italics="true" pageId="10" pageNumber="139"></emphasis>
W
</geoCoordinate>
,
<quantity id="4CFC3581A95CFFE4FE9E0D6EF466B405" box="[295,379,809,831]" metricMagnitude="3" metricUnit="m" metricValue="3.964" pageId="10" pageNumber="139" unit="m" value="3964.0">
<elevation id="00297F57A95CFFE4FE9E0D6EF466B405" box="[295,379,809,831]" metricMagnitude="3" metricUnit="m" metricValue="3.964" pageId="10" pageNumber="139" unit="m" value="3964.0">3964 m</elevation>
</quantity>
(
<figureCitation id="133F84E1A95CFFE4FE320D6EF4D6B404" box="[395,459,809,831]" captionStart="Figure 3" captionStartId="11.[164,243,1434,1456]" captionTargetBox="[387,1218,197,1394]" captionTargetId="figure-207@11.[385,1220,195,1395]" captionTargetPageId="11" captionText="Figure 3. Map of the Andes of southern Peru around department of Cusco showing the distribution (type localities only) of the 12 nominal species of Bryophryne described hitherto: (1) B. flammiventris; (2) B. abramalagae; (3) B. bustamantei; (4) B. bakersfield; (5) B. cophites; (6) B. hanssaueri; (7) B. nubilosus; (8) B. gymnotis; (9) B. quellokunka sp. nov.; (10) B. zonalis; (11) B. tocra sp. nov.; (12) B. wilakunka sp. nov." pageId="10" pageNumber="139">Fig. 3</figureCitation>
), collected on
<date id="FFBABEA4A95CFFE4FDD40D6EF5D7B464" pageId="10" pageNumber="139" value="2006-02-20">
<collectingDate id="EFFE474CA95CFFE4FDD40D6EF5D7B464" pageId="10" pageNumber="139" value="2006-02-20">20 February 2006</collectingDate>
</date>
by
<collectorName id="26F1FDB2A95CFFE4FF400D0FF48AB464" box="[249,407,840,862]" pageId="10" pageNumber="139">
I.
<collectingCounty id="62DAE0E8A95CFFE4FEAD0D0FF48AB464" box="[276,407,840,862]" pageId="10" pageNumber="139">De la Riva</collectingCounty>
</collectorName>
,
<collectorName id="26F1FDB2A95CFFE4FE1F0D0FF724B464" box="[422,569,840,862]" pageId="10" pageNumber="139">J. M. Padial</collectorName>
,
<collectorName id="26F1FDB2A95CFFE4FDF10D0FF5C7B446" pageId="10" pageNumber="139">S. Castroviejo-Fisher</collectorName>
, and
<collectorName id="26F1FDB2A95CFFE4FEAE0D20F4DCB446" box="[279,449,870,892]" pageId="10" pageNumber="139">J. C. Chaparro.</collectorName>
</materialsCitation>
</paragraph>
<paragraph id="8BBB9864A95CFFE4FF280DE1F759B349" blockId="10.[145,761,933,1139]" pageId="10" pageNumber="139">
<materialsCitation id="3B6C9239A95CFFE4FF280DE1F4BBB4E0" collectionCode="MUBI" pageId="10" pageNumber="139" specimenCode="MUBI 5374, 5375, 5377" specimenCount="1" typeStatus="Paratopotypes">
<emphasis id="B9704476A95CFFE4FF280DE1F42DB481" box="[145,304,934,955]" italics="true" pageId="10" pageNumber="139">
<typeStatus id="54BF26C6A95CFFE4FF280DE1F42DB481" box="[145,304,934,955]" pageId="10" pageNumber="139" type="paratopotype">Paratopotypes</typeStatus>
</emphasis>
:
<specimenCode id="DBA2301FA95CFFE4FE840DE1F4D8B481" box="[317,453,933,955]" collectionCode="MUBI" pageId="10" pageNumber="139">MUBI 5374</specimenCode>
,
<specimenCode id="DBA2301FA95CFFE4FE690DE2F714B481" box="[464,521,933,955]" collectionCode="MUBI" pageId="10" pageNumber="139">5375</specimenCode>
,
<specimenCode id="DBA2301FA95CFFE4FDAD0DE2F756B481" box="[532,587,933,955]" collectionCode="MUBI" pageId="10" pageNumber="139">5377</specimenCode>
(field numbers 4617, 4618, 4620), and
</materialsCitation>
<materialsCitation id="3B6C9239A95CFFE4FE090D83F75EB4C2" collectionCode="MNCN" pageId="10" pageNumber="139" specimenCode="MNCN 43780, 43782" specimenCount="1" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA95CFFE4FE090D83F744B4E3" box="[432,601,964,985]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="10" pageNumber="139" type="Museum">MNCN 43780</specimenCode>
,
<specimenCode id="DBA2301FA95CFFE4FDDE0D83F7B2B4E3" box="[615,687,964,985]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="10" pageNumber="139" type="Museum">43782</specimenCode>
(field numbers 4616, 4622) (adult males)
</materialsCitation>
;
<materialsCitation id="3B6C9239A95CFFE4FDEB0DA4F700B32D" collectionCode="MNCN" pageId="10" pageNumber="139" specimenCode="MNCN 43784" specimenCount="1" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA95CFFE4FDEB0DA4F7EAB4C2" box="[594,759,995,1016]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="10" pageNumber="139" type="Museum">MNCN 43784</specimenCode>
(field number 4627) (adult female)
</materialsCitation>
;
<materialsCitation id="3B6C9239A95CFFE4FD900A45F786B30C" collectionCode="MUBI" pageId="10" pageNumber="139" specimenCode="MUBI 5376, 5378, 5379" specimenCount="1" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA95CFFE4FD900A45F7ADB32D" box="[553,688,1025,1047]" collectionCode="MUBI" pageId="10" pageNumber="139">MUBI 5376</specimenCode>
,
<specimenCode id="DBA2301FA95CFFE4FD050A46F7E8B32D" box="[700,757,1025,1047]" collectionCode="MUBI" pageId="10" pageNumber="139">5378</specimenCode>
,
<specimenCode id="DBA2301FA95CFFE4FF280A67F5D7B30C" box="[145,202,1056,1078]" collectionCode="MUBI" pageId="10" pageNumber="139">5379</specimenCode>
(field numbers 4619, 4624, 4625) and
</materialsCitation>
<materialsCitation id="3B6C9239A95CFFE4FD1C0A67F75DB349" collectingDate="2006-02-20" collectionCode="MNCN" collectorName="I. De la Riva &amp; J. M. Padial &amp; S. Castroviejo-Fisher &amp; J. C. Chaparro." country="Peru" county="De la Riva" elevation="3964" latitude="-13.605223" location="Qorpinte" longLatPrecision="1" longitude="-71.052444" municipality="Quispicanchis" pageId="10" pageNumber="139" specimenCode="MNCN 43799, 43781, 43783" specimenCount="1" stateProvince="Cusco" typeStatus="Paratopotypes">
<specimenCode id="DBA2301FA95CFFE4FD1C0A67F5C5B36E" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="10" pageNumber="139" type="Museum">MNCN 43799</specimenCode>
,
<specimenCode id="DBA2301FA95CFFE4FF5A0A78F437B36E" box="[227,298,1087,1108]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="10" pageNumber="139" type="Museum">43781</specimenCode>
,
<specimenCode id="DBA2301FA95CFFE4FE8C0A78F467B36E" box="[309,378,1087,1108]" collectionCode="MNCN" country="Spain" httpUri="http://biocol.org/urn:lsid:biocol.org:col:35275" lsid="urn:lsid:biocol.org:col:35275" name="Museo Nacional de Ciencias Naturales" pageId="10" pageNumber="139" type="Museum">43783</specimenCode>
(field numbers 4615, 4621, 4623) (juveniles), same data as the holotype
</materialsCitation>
.
</paragraph>
<paragraph id="8BBB9864A95CFFE4FC900E81F168B348" blockId="10.[809,1425,197,1139]" pageId="10" pageNumber="139">
<emphasis id="B9704476A95CFFE4FC900E81F6BEB7E1" box="[809,931,198,219]" italics="true" pageId="10" pageNumber="139">Diagnosis</emphasis>
:
<taxonomicName id="4C04E3E7A95CFFE4FC0C0E82F1FAB7E0" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[949,1255,197,218]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="10" pageNumber="139" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A95CFFE4FC0C0E82F1FAB7E0" box="[949,1255,197,218]" italics="true" pageId="10" pageNumber="139">Bryophryne quellokunka</emphasis>
</taxonomicName>
is characterized by: (1) skin on dorsum uniformly warty, warts round to conical and low, with two incomplete dorsolateral folds barely reaching midbody and continuing sometimes as an irregular row of warts; skin of head shagreen to smooth, warty dorsally; belly and chest areolate, throat smooth; (2) tympanic membrane and tympanic annulus slightly perceptible beneath skin, smaller than 2/3 of EL, supratympanic fold composed of a row of warts; (3) snout short, round in dorsal view, blunt in lateral view; (4) upper eyelid lacking tubercles, bearing small conical warts; (5) dentigerous process of vomers absent; (6) vocal slits and sac present, nuptial pads absent; (7) Finger I shorter than Finger II, tips of digits rounded, lacking ungual flap and circumferential grooves; (8) fingers lacking lateral fringes; (9) ulnar region bearing warts; (10) heel lacking tubercles, tarsus lacking tubercles and folds; (11) two metatarsal tubercles, inner slightly larger than outer; supernumerary tubercles inconspicuous; (12) toes lacking lateral fringes; webbing absent; Toe III longer than V, tips of digits rounded, lacking ungual flap and circumferential grooves; (13) dorsal coloration reddish-brown to dark brown, sometimes with a blackish-grey interorbital and/or middorsal mark; ventral coloration variable, from greyish-purple with diffuse black blotches to brown, throat and plantar surfaces orange to yellow, axillae and groins without flash marks; (14) females larger than males, SVL
<quantity id="4CFC3581A95CFFE4FC900A79F6A7B36E" box="[809,954,1086,1108]" metricMagnitude="-1" metricUnit="m" metricValue="7.0866" metricValueMax="7.1628" metricValueMin="7.0104" pageId="10" pageNumber="139" unit="in" value="27.9" valueMax="28.2" valueMin="27.6">27.628.2 in</quantity>
adult females (
<emphasis id="B9704476A95CFFE4FBCF0A78F198B36E" box="[1142,1157,1087,1108]" italics="true" pageId="10" pageNumber="139">n</emphasis>
= 2), 18.0
<quantity id="4CFC3581A95CFFE4FAB30A79F06CB36E" box="[1290,1393,1086,1108]" metricMagnitude="-2" metricUnit="m" metricValue="2.03" pageId="10" pageNumber="139" unit="mm" value="20.3">20.3 mm</quantity>
in adult males (
<emphasis id="B9704476A95CFFE4FC790A19F6D2B349" box="[960,975,1118,1139]" italics="true" pageId="10" pageNumber="139">n</emphasis>
= 5) (
<tableCitation id="C686ADDFA95CFFE4FBA80A1AF17BB348" box="[1041,1126,1117,1139]" captionStart="Table 3" captionStartId="12.[142,206,698,720]" captionText="Table 3. Morphometrics for new Peruvian species of Bryophryne and Microkayla (range, in parenthesis, follows mean; AM, adult males; AF, adult females)" pageId="10" pageNumber="139">Table 3</tableCitation>
).
</paragraph>
<caption id="DF7BC8ECA95CFFE4FF280903F01AB042" pageId="10" pageNumber="139" startId="10.[145,225,1860,1882]" targetBox="[305,1265,1176,1821]" targetPageId="10" targetType="figure">
<paragraph id="8BBB9864A95CFFE4FF280903F01AB042" blockId="10.[145,1424,1860,1912]" pageId="10" pageNumber="139">
<emphasis id="B9704476A95CFFE4FF280903F5E1B063" bold="true" box="[145,252,1860,1882]" pageId="10" pageNumber="139">Figure 2.</emphasis>
Live specimens of
<emphasis id="B9704476A95CFFE4FE740903F648B060" bold="true" box="[461,853,1860,1882]" pageId="10" pageNumber="139">
<taxonomicName id="4C04E3E7A95CFFE4FE740903F7E8B060" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[461,757,1860,1882]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="10" pageNumber="139" phylum="Chordata" rank="species" species="quellokunka" status="sp. nov.">
<emphasis id="B9704476A95CFFE4FE740903F7E8B060" bold="true" box="[461,757,1860,1882]" italics="true" pageId="10" pageNumber="139">Bryophryne quellokunka</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA95CFFE4FD450902F648B060" box="[764,853,1861,1882]" pageId="10" pageNumber="139" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
from Qorpinte, Marcapata, Peru. (AB) Adult female holotype (MUBI 5380, SVL 28.2 mm). (CD) Adult male (MNCN 43782, SVL 20.1 mm), from the type locality.
</paragraph>
</caption>
<caption id="DF7BC8ECA95DFFE5FF1D0BDDF7FEB132" pageId="11" pageNumber="140" startId="11.[164,243,1434,1456]" targetBox="[387,1218,197,1394]" targetPageId="11" targetType="figure">
<paragraph id="8BBB9864A95DFFE5FF1D0BDDF7FEB132" blockId="11.[163,1442,1434,1545]" pageId="11" pageNumber="140">
<emphasis id="B9704476A95DFFE5FF1D0BDDF411B295" bold="true" box="[164,268,1434,1456]" pageId="11" pageNumber="140">Figure 3.</emphasis>
Map of the Andes of southern Peru around department of Cusco showing the distribution (type localities only) of the 12 nominal species of
<taxonomicName id="4C04E3E7A95DFFE5FE7E0BFFF75DB2F4" authorityName="Hedges, Duellman &amp; Heinicke" authorityYear="2008" box="[455,576,1464,1486]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="genus">
<emphasis id="B9704476A95DFFE5FE7E0BFFF75DB2F4" box="[455,576,1464,1486]" italics="true" pageId="11" pageNumber="140">Bryophryne</emphasis>
</taxonomicName>
described hitherto: (1)
<taxonomicName id="4C04E3E7A95DFFE5FC8B0BFEF6FDB2F4" authorityName="Lehr and Catenazzi" authorityYear="2010" box="[818,992,1464,1486]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="flammiventris">
<emphasis id="B9704476A95DFFE5FC8B0BFEF6FDB2F4" box="[818,992,1464,1486]" italics="true" pageId="11" pageNumber="140">B. flammiventris</emphasis>
</taxonomicName>
; (2)
<taxonomicName id="4C04E3E7A95DFFE5FBB40BFEF1AFB2F4" authorityName="Lehr and Catenazzi" authorityYear="2010" box="[1037,1202,1464,1486]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="abramalagae">
<emphasis id="B9704476A95DFFE5FBB40BFEF1AFB2F4" box="[1037,1202,1464,1486]" italics="true" pageId="11" pageNumber="140">B. abramalagae</emphasis>
</taxonomicName>
; (3)
<taxonomicName id="4C04E3E7A95DFFE5FB660BFEF066B2F4" baseAuthorityName="Chaparro, De la Riva, Padial, Ochoa &amp; Lehr" baseAuthorityYear="2007" box="[1247,1403,1464,1486]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="bustamantei">
<emphasis id="B9704476A95DFFE5FB660BFEF066B2F4" box="[1247,1403,1464,1486]" italics="true" pageId="11" pageNumber="140">B. bustamantei</emphasis>
</taxonomicName>
; (4)
<taxonomicName id="4C04E3E7A95DFFE5FF1A0B91F42DB2D1" authorityName="Chaparro, Padial, Gutierrez, and De la Riva" authorityYear="2015" box="[163,304,1493,1515]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="bakersfield">
<emphasis id="B9704476A95DFFE5FF1A0B91F42DB2D1" box="[163,304,1493,1515]" italics="true" pageId="11" pageNumber="140">B. bakersfield</emphasis>
</taxonomicName>
; (5)
<taxonomicName id="4C04E3E7A95DFFE5FEE40B91F4D1B2D1" baseAuthorityName="Lynch" baseAuthorityYear="1975" box="[349,460,1493,1515]" class="Amphibia" family="Craugastoridae" genus="Phrynopus" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="cophites">
<emphasis id="B9704476A95DFFE5FEE40B91F4D1B2D1" box="[349,460,1493,1515]" italics="true" pageId="11" pageNumber="140">B. cophites</emphasis>
</taxonomicName>
; (6)
<taxonomicName id="4C04E3E7A95DFFE5FE400B91F79AB2D1" authorityName="Lehr and Catenazzi" authorityYear="2009" box="[505,647,1493,1515]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="hanssaueri">
<emphasis id="B9704476A95DFFE5FE400B91F79AB2D1" box="[505,647,1493,1515]" italics="true" pageId="11" pageNumber="140">B. hanssaueri</emphasis>
</taxonomicName>
; (7)
<taxonomicName id="4C04E3E7A95DFFE5FD0C0B91F628B2D1" authorityName="Lehr and Catenazzi" authorityYear="2008" box="[693,821,1493,1515]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="nubilosus">
<emphasis id="B9704476A95DFFE5FD0C0B91F628B2D1" box="[693,821,1493,1515]" italics="true" pageId="11" pageNumber="140">B. nubilosus</emphasis>
</taxonomicName>
; (8)
<taxonomicName id="4C04E3E7A95DFFE5FCDB0B91F6C7B2D1" authorityName="Lehr and Catenazzi" authorityYear="2009" box="[866,986,1493,1515]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="gymnotis">
<emphasis id="B9704476A95DFFE5FCDB0B91F6C7B2D1" box="[866,986,1493,1515]" italics="true" pageId="11" pageNumber="140">B. gymnotis</emphasis>
</taxonomicName>
; (9)
<emphasis id="B9704476A95DFFE5FBB10B91F00BB2D0" bold="true" box="[1032,1302,1493,1515]" pageId="11" pageNumber="140">
<taxonomicName id="4C04E3E7A95DFFE5FBB10B91F1A7B2D1" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1032,1210,1493,1515]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="quellokunka" status="sp. nov.">
<emphasis id="B9704476A95DFFE5FBB10B91F1A7B2D1" bold="true" box="[1032,1210,1493,1515]" italics="true" pageId="11" pageNumber="140">B. quellokunka</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA95DFFE5FB790B92F00BB2D0" box="[1216,1302,1493,1514]" pageId="11" pageNumber="140" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
; (10)
<taxonomicName id="4C04E3E7A95DFFE5FAE90B91F5A1B133" authorityName="Lehr and Catenazzi" authorityYear="2009" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="zonalis">
<emphasis id="B9704476A95DFFE5FAE90B91F5A1B133" italics="true" pageId="11" pageNumber="140">B. zonalis</emphasis>
</taxonomicName>
; (11)
<emphasis id="B9704476A95DFFE5FF4F0BB4F4B3B132" bold="true" box="[246,430,1523,1544]" pageId="11" pageNumber="140">
<taxonomicName id="4C04E3E7A95DFFE5FF4F0BB4F44CB132" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[246,337,1523,1544]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="tocra" status="sp. nov.">
<emphasis id="B9704476A95DFFE5FF4F0BB4F44CB132" bold="true" box="[246,337,1523,1544]" italics="true" pageId="11" pageNumber="140">B. tocra</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA95DFFE5FEE10BB4F4B3B132" box="[344,430,1523,1544]" pageId="11" pageNumber="140" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
; (12)
<taxonomicName id="4C04E3E7A95DFFE5FE510BB4F79BB132" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[488,646,1522,1544]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="wilakunka" status="sp. nov.">
<emphasis id="B9704476A95DFFE5FE510BB4F79BB132" bold="true" box="[488,646,1522,1544]" italics="true" pageId="11" pageNumber="140">B. wilakunka</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A243F90DA95DFFE5FD350BB4F7FEB132" box="[652,739,1523,1544]" pageId="11" pageNumber="140" rank="species">sp. nov.</taxonomicNameLabel>
</paragraph>
</caption>
<paragraph id="8BBB9864A95DFFE5FF020802F0BFB055" blockId="11.[163,780,1605,1903]" lastBlockId="11.[827,1443,1605,1903]" pageId="11" pageNumber="140">
<taxonomicName id="4C04E3E7A95DFFE5FF020802F4F5B160" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[187,488,1605,1626]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A95DFFE5FF020802F4F5B160" box="[187,488,1605,1626]" italics="true" pageId="11" pageNumber="140">Bryophryne quellokunka</emphasis>
</taxonomicName>
is sister to
<taxonomicName id="4C04E3E7A95DFFE5FD390802F619B160" baseAuthorityName="Lynch" baseAuthorityYear="1975" box="[640,772,1605,1626]" class="Amphibia" family="Craugastoridae" genus="Phrynopus" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="cophites">
<emphasis id="B9704476A95DFFE5FD390802F619B160" box="[640,772,1605,1626]" italics="true" pageId="11" pageNumber="140">B. cophites</emphasis>
</taxonomicName>
, and this clade is in turn sister to
<taxonomicName id="4C04E3E7A95DFFE5FD880823F7CCB142" authorityName="Chaparro, Padial, Gutierrez, and De la Riva" authorityYear="2015" box="[561,721,1635,1657]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="bakersfield">
<emphasis id="B9704476A95DFFE5FD880823F7CCB142" box="[561,721,1635,1657]" italics="true" pageId="11" pageNumber="140">B. bakersfield</emphasis>
</taxonomicName>
. The three species in this clade are similar but have some morphological differences.
<taxonomicName id="4C04E3E7A95DFFE5FE6A08E6F7C6B18C" authorityName="Chaparro, Padial, Gutierrez, and De la Riva" authorityYear="2015" box="[467,731,1697,1718]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="bakersfield">
<emphasis id="B9704476A95DFFE5FE6A08E6F7C6B18C" box="[467,731,1697,1718]" italics="true" pageId="11" pageNumber="140">Bryophryne bakersfield</emphasis>
</taxonomicName>
has complete dorsolateral folds and short but conspicuous dorsal and occipital fold, and the dorsal skin is less homogeneously warty. Also, while the coloration of
<taxonomicName id="4C04E3E7A95DFFE5FD4D08BAF429B00A" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A95DFFE5FD4D08BAF429B00A" italics="true" pageId="11" pageNumber="140">B. quellokunka</emphasis>
</taxonomicName>
is mostly homogeneously brown, colour patterns in
<taxonomicName id="4C04E3E7A95DFFE5FE95097CF4D4B075" authorityName="Chaparro, Padial, Gutierrez, and De la Riva" authorityYear="2015" box="[300,457,1850,1872]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="bakersfield">
<emphasis id="B9704476A95DFFE5FE95097CF4D4B075" box="[300,457,1850,1872]" italics="true" pageId="11" pageNumber="140">B. bakersfield</emphasis>
</taxonomicName>
are diverse (orange, yellow, black, olive green, etc.).
<taxonomicName id="4C04E3E7A95DFFE5FE09091EF78BB054" baseAuthorityName="Lynch" baseAuthorityYear="1975" box="[432,662,1881,1902]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="cophites">
<emphasis id="B9704476A95DFFE5FE09091EF78BB054" box="[432,662,1881,1902]" italics="true" pageId="11" pageNumber="140">Bryophryne cophites</emphasis>
</taxonomicName>
has a less warty dorsal skin, almost smooth or with low warts, while the skin of
<taxonomicName id="4C04E3E7A95DFFE5FBBA0823F1B2B142" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1027,1199,1635,1657]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A95DFFE5FBBA0823F1B2B142" box="[1027,1199,1635,1657]" italics="true" pageId="11" pageNumber="140">B. quellokunka</emphasis>
</taxonomicName>
is conspicuously and homogeneously warty and has two incomplete dorsolateral folds sometimes shown as an irregular row of warts. Another species,
<taxonomicName id="4C04E3E7A95DFFE5FBF10887F1AAB1EE" authorityName="Lehr and Catenazzi" authorityYear="2009" box="[1096,1207,1727,1749]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="zonalis">
<emphasis id="B9704476A95DFFE5FBF10887F1AAB1EE" box="[1096,1207,1727,1749]" italics="true" pageId="11" pageNumber="140">B. zonalis</emphasis>
</taxonomicName>
, is known from near the
<typeStatus id="54BF26C6A95DFFE5FCDC0898F68BB1CE" box="[869,918,1759,1780]" pageId="11" pageNumber="140">type</typeStatus>
locality of
<taxonomicName id="4C04E3E7A95DFFE5FBA90898F1A5B1C9" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1040,1208,1758,1780]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A95DFFE5FBA90898F1A5B1C9" box="[1040,1208,1758,1780]" italics="true" pageId="11" pageNumber="140">B. quellokunka</emphasis>
</taxonomicName>
but at a lower elevation (Kusillochayoc,
<quantity id="4CFC3581A95DFFE5FB9B08BAF164B028" box="[1058,1145,1789,1810]" metricMagnitude="3" metricUnit="m" metricValue="3.129" pageId="11" pageNumber="140" unit="m" value="3129.0">3129 m</quantity>
;
<bibRefCitation id="EF95E595A95DFFE5FB3D08BAF088B028" author="Lehr E &amp; Catenazzi A" box="[1156,1429,1789,1811]" pageId="11" pageNumber="140" pagination="125 - 138" refId="ref24971" refString="Lehr E, Catenazzi A. 2009. Three new species of Bryophryne (Anura: Strabomantidae) from the region of Cusco, Peru. South American Journal of Herpetology 4: 125-138." type="journal article" year="2009">Lehr &amp; Catenazzi, 2009</bibRefCitation>
), and both species have marked differences.
<taxonomicName id="4C04E3E7A95DFFE5FAA6095CF691B075" authorityName="Lehr and Catenazzi" authorityYear="2009" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="11" pageNumber="140" phylum="Chordata" rank="species" species="zonalis">
<emphasis id="B9704476A95DFFE5FAA6095CF691B075" italics="true" pageId="11" pageNumber="140">Bryophryne zonalis</emphasis>
</taxonomicName>
has metallic blue to metallic orange spots surrounded by bold black in the lower part of the belly
</paragraph>
<caption id="DF7BC8ECA95AFFE2FF370CFDF3FDB5EA" box="[142,1760,698,720]" pageId="12" pageNumber="141" startId="12.[142,206,698,720]" targetType="table">
<paragraph id="8BBB9864A95AFFE2FF370CFDF3FDB5EA" blockId="12.[142,1760,698,720]" box="[142,1760,698,720]" pageId="12" pageNumber="141">
<emphasis id="B9704476A95AFFE2FF370CFDF5F5B5EA" bold="true" box="[142,232,698,720]" pageId="12" pageNumber="141">Table 3.</emphasis>
Morphometrics for new Peruvian species of
<taxonomicName id="4C04E3E7A95AFFE2FD050CFDF628B5EA" authorityName="Hedges, Duellman &amp; Heinicke" authorityYear="2008" box="[700,821,698,720]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="12" pageNumber="141" phylum="Chordata" rank="genus">
<emphasis id="B9704476A95AFFE2FD050CFDF628B5EA" box="[700,821,698,720]" italics="true" pageId="12" pageNumber="141">Bryophryne</emphasis>
</taxonomicName>
and
<taxonomicName id="4C04E3E7A95AFFE2FCD00CFDF6C2B5EA" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[873,991,698,720]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="12" pageNumber="141" phylum="Chordata" rank="genus">
<emphasis id="B9704476A95AFFE2FCD00CFDF6C2B5EA" box="[873,991,698,720]" italics="true" pageId="12" pageNumber="141">Microkayla</emphasis>
</taxonomicName>
(range, in parenthesis, follows mean; AM, adult males; AF, adult females)
</paragraph>
</caption>
<paragraph id="8BBB9864A95AFFE2FEBB0CB3F205B20F" pageId="12" pageNumber="141">
<table id="F9046AC4A95A0011FF370CB3F22CB20F" box="[142,1841,756,1333]" gridcols="11" gridrows="17" pageId="12" pageNumber="141">
<tr id="35349A26A95A0011FF370CB3F22CB430" box="[142,1841,756,778]" gridrow="0" pageId="12" pageNumber="141" rowspan-0="1" rowspan-10="1" rowspan-4="1" rowspan-6="1" rowspan-8="1">
<th id="76E5F35AA95A0011FEBB0CB3F4B4B430" box="[258,425,756,778]" colspan="2" colspanRight="1" gridcol="1" gridrow="0" pageId="12" pageNumber="141">
<taxonomicName id="4C04E3E7A95AFFE2FEBB0CB3F490B430" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[258,397,756,778]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="12" pageNumber="141" phylum="Chordata" rank="species" species="wilakunka">
<emphasis id="B9704476A95AFFE2FEBB0CB3F490B430" box="[258,397,756,778]" italics="true" pageId="12" pageNumber="141">B. wilakunka</emphasis>
</taxonomicName>
</th>
<th id="76E5F35AA95A0011FE7C0CB3F771B430" box="[453,620,756,778]" gridcol="3" gridrow="0" pageId="12" pageNumber="141">
<taxonomicName id="4C04E3E7A95AFFE2FE7C0CB3F77CB430" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[453,609,756,778]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="12" pageNumber="141" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A95AFFE2FE7C0CB3F77CB430" box="[453,609,756,778]" italics="true" pageId="12" pageNumber="141">B. quellokunka</emphasis>
</taxonomicName>
</th>
<th id="76E5F35AA95A0011FC870CB3F6F8B430" box="[830,997,756,778]" gridcol="5" gridrow="0" pageId="12" pageNumber="141">
<taxonomicName id="4C04E3E7A95AFFE2FC870CB3F690B430" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[830,909,756,778]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="12" pageNumber="141" phylum="Chordata" rank="species" species="tocra">
<emphasis id="B9704476A95AFFE2FC870CB3F690B430" box="[830,909,756,778]" italics="true" pageId="12" pageNumber="141">B. tocra</emphasis>
</taxonomicName>
</th>
<th id="76E5F35AA95A0011FB0E0CB3F043B430" box="[1207,1374,756,778]" gridcol="7" gridrow="0" pageId="12" pageNumber="141">
<taxonomicName id="4C04E3E7A95AFFE2FB0E0CB3F03CB430" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[1207,1313,756,778]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="12" pageNumber="141" phylum="Chordata" rank="species" species="chilina">
<emphasis id="B9704476A95AFFE2FB0E0CB3F03CB430" box="[1207,1313,756,778]" italics="true" pageId="12" pageNumber="141">M. chilina</emphasis>
</taxonomicName>
</th>
<th id="76E5F35AA95A0011FA760CB3F368B430" box="[1487,1653,756,778]" gridcol="9" gridrow="0" pageId="12" pageNumber="141">
<taxonomicName id="4C04E3E7A95AFFE2FA760CB3F334B430" authority="AM" box="[1487,1577,756,778]" class="Amphibia" family="Craugastoridae" genus="Microkayla" kingdom="Animalia" order="Anura" pageId="12" pageNumber="141" phylum="Chordata" rank="species" species="chapi">
<emphasis id="B9704476A95AFFE2FA760CB3F334B430" box="[1487,1577,756,778]" italics="true" pageId="12" pageNumber="141">M. chapi</emphasis>
</taxonomicName>
</th>
</tr>
<tr id="35349A26A95A0011FF370D6CF22CB47B" box="[142,1841,811,833]" gridrow="1" pageId="12" pageNumber="141" rowspan-0="1">
<td id="76E5F35AA95A0011FEBB0D6CF450B47B" box="[258,333,811,833]" gridcol="1" gridrow="1" pageId="12" pageNumber="141">AM</td>
<td id="76E5F35AA95A0011FED10D6CF4B4B47B" box="[360,425,811,833]" gridcol="2" gridrow="1" pageId="12" pageNumber="141">AF</td>
<td id="76E5F35AA95A0011FE7C0D6CF771B47B" box="[453,620,811,833]" gridcol="3" gridrow="1" pageId="12" pageNumber="141">AM</td>
<td id="76E5F35AA95A0011FD380D6CF635B47B" box="[641,808,811,833]" gridcol="4" gridrow="1" pageId="12" pageNumber="141">AF</td>
<td id="76E5F35AA95A0011FC870D6CF6F8B47B" box="[830,997,811,833]" gridcol="5" gridrow="1" pageId="12" pageNumber="141">AM</td>
<td id="76E5F35AA95A0011FC430D6CF1BCB47B" box="[1018,1185,811,833]" gridcol="6" gridrow="1" pageId="12" pageNumber="141">AF</td>
<td id="76E5F35AA95A0011FB0E0D6CF043B47B" box="[1207,1374,811,833]" gridcol="7" gridrow="1" pageId="12" pageNumber="141">AM</td>
<td id="76E5F35AA95A0011FACA0D6CF0A9B47B" box="[1395,1460,811,833]" gridcol="8" gridrow="1" pageId="12" pageNumber="141">AF</td>
<td id="76E5F35AA95A0011FA760D6CF368B47B" box="[1487,1653,811,833]" gridcol="9" gridrow="1" pageId="12" pageNumber="141">AM</td>
<td id="76E5F35AA95A0011F9320D6CF22CB47B" box="[1675,1841,811,833]" gridcol="10" gridrow="1" pageId="12" pageNumber="141">AF</td>
</tr>
<tr id="35349A26A95A0011FF370D25F22CB442" box="[142,1841,866,888]" gridrow="2" pageId="12" pageNumber="141" rowspan-0="1">
<td id="76E5F35AA95A0011FEBB0D25F450B442" box="[258,333,866,888]" gridcol="1" gridrow="2" pageId="12" pageNumber="141">MNCN</td>
<td id="76E5F35AA95A0011FED10D25F4B4B442" box="[360,425,866,888]" gridcol="2" gridrow="2" pageId="12" pageNumber="141">MUBI</td>
<td id="76E5F35AA95A0011FE7C0D25F771B442" box="[453,620,866,888]" gridcol="3" gridrow="2" pageId="12" pageNumber="141">
<emphasis id="B9704476A95AFFE2FE7C0D25F4CEB442" box="[453,467,866,888]" italics="true" pageId="12" pageNumber="141">n</emphasis>
= 5
</td>
<td id="76E5F35AA95A0011FD380D25F635B442" box="[641,808,866,888]" gridcol="4" gridrow="2" pageId="12" pageNumber="141">
<emphasis id="B9704476A95AFFE2FD3B0D25F78DB442" box="[642,656,866,888]" italics="true" pageId="12" pageNumber="141">n</emphasis>
= 2
</td>
<td id="76E5F35AA95A0011FC870D25F6F8B442" box="[830,997,866,888]" gridcol="5" gridrow="2" pageId="12" pageNumber="141">
<emphasis id="B9704476A95AFFE2FC870D25F651B442" box="[830,844,866,888]" italics="true" pageId="12" pageNumber="141">n</emphasis>
= 5
</td>
<td id="76E5F35AA95A0011FC430D25F1BCB442" box="[1018,1185,866,888]" gridcol="6" gridrow="2" pageId="12" pageNumber="141">
<emphasis id="B9704476A95AFFE2FC420D25F114B442" box="[1019,1033,866,888]" italics="true" pageId="12" pageNumber="141">n</emphasis>
= 2
</td>
<td id="76E5F35AA95A0011FB0E0D25F043B442" box="[1207,1374,866,888]" gridcol="7" gridrow="2" pageId="12" pageNumber="141">
<emphasis id="B9704476A95AFFE2FB0E0D25F1D8B442" box="[1207,1221,866,888]" italics="true" pageId="12" pageNumber="141">n</emphasis>
= 4
</td>
<td id="76E5F35AA95A0011FACA0D25F0A9B442" box="[1395,1460,866,888]" gridcol="8" gridrow="2" pageId="12" pageNumber="141">MUBI</td>
<td id="76E5F35AA95A0011FA760D25F368B442" box="[1487,1653,866,888]" gridcol="9" gridrow="2" pageId="12" pageNumber="141">
<emphasis id="B9704476A95AFFE2FA760D25F0C0B442" box="[1487,1501,866,888]" italics="true" pageId="12" pageNumber="141">n</emphasis>
= 9
</td>
<td id="76E5F35AA95A0011F9320D25F22CB442" box="[1675,1841,866,888]" gridcol="10" gridrow="2" pageId="12" pageNumber="141">
<emphasis id="B9704476A95AFFE2F9320D25F384B442" box="[1675,1689,866,888]" italics="true" pageId="12" pageNumber="141">n</emphasis>
= 3
</td>
</tr>
<tr id="35349A26A95A0011FF370DC7F22CB4AC" box="[142,1841,896,918]" gridrow="3" pageId="12" pageNumber="141" rowspan-0="1" rowspan-10="1" rowspan-3="1" rowspan-4="1" rowspan-5="1" rowspan-6="1" rowspan-7="1" rowspan-9="1">
<td id="76E5F35AA95A0011FEBB0DC7F450B4AC" box="[258,333,896,918]" gridcol="1" gridrow="3" pageId="12" pageNumber="141">43788</td>
<td id="76E5F35AA95A0011FED10DC7F4B4B4AC" box="[360,425,896,918]" gridcol="2" gridrow="3" pageId="12" pageNumber="141">5425</td>
<td id="76E5F35AA95A0011FACA0DC7F0A9B4AC" box="[1395,1460,896,918]" gridcol="8" gridrow="3" pageId="12" pageNumber="141">5350</td>
</tr>
<tr id="35349A26A95A0011FF370DF0F22CB4F7" box="[142,1841,951,973]" gridrow="4" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370DF0F5F6B4F7" box="[142,235,951,973]" gridcol="0" gridrow="4" pageId="12" pageNumber="141">SVL</th>
<td id="76E5F35AA95A0011FEBB0DF0F450B4F7" box="[258,333,951,973]" gridcol="1" gridrow="4" pageId="12" pageNumber="141">17.9</td>
<td id="76E5F35AA95A0011FED10DF0F4B4B4F7" box="[360,425,951,973]" gridcol="2" gridrow="4" pageId="12" pageNumber="141">24.6</td>
<td id="76E5F35AA95A0011FE7C0DF0F771B4F7" box="[453,620,951,973]" gridcol="3" gridrow="4" pageId="12" pageNumber="141">19.3 (18.020.3)</td>
<td id="76E5F35AA95A0011FD380DF0F635B4F7" box="[641,808,951,973]" gridcol="4" gridrow="4" pageId="12" pageNumber="141">27.9 (27.628.2)</td>
<td id="76E5F35AA95A0011FC870DF0F6F8B4F7" box="[830,997,951,973]" gridcol="5" gridrow="4" pageId="12" pageNumber="141">19.3 (18.420.0)</td>
<td id="76E5F35AA95A0011FC430DF0F1BCB4F7" box="[1018,1185,951,973]" gridcol="6" gridrow="4" pageId="12" pageNumber="141">27.4 (27.227.6)</td>
<td id="76E5F35AA95A0011FB0E0DF0F043B4F7" box="[1207,1374,951,973]" gridcol="7" gridrow="4" pageId="12" pageNumber="141">23.8 (23.224.3)</td>
<td id="76E5F35AA95A0011FACA0DF0F0A9B4F7" box="[1395,1460,951,973]" gridcol="8" gridrow="4" pageId="12" pageNumber="141">25.5</td>
<td id="76E5F35AA95A0011FA760DF0F368B4F7" box="[1487,1653,951,973]" gridcol="9" gridrow="4" pageId="12" pageNumber="141">17.8 (16.319.1)</td>
<td id="76E5F35AA95A0011F9320DF0F22CB4F7" box="[1675,1841,951,973]" gridcol="10" gridrow="4" pageId="12" pageNumber="141">20.8 (19.921.6)</td>
</tr>
<tr id="35349A26A95A0011FF370D92F22CB4D1" box="[142,1841,981,1003]" gridrow="5" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370D92F5F6B4D1" box="[142,235,981,1003]" gridcol="0" gridrow="5" pageId="12" pageNumber="141">HL</th>
<td id="76E5F35AA95A0011FEBB0D92F450B4D1" box="[258,333,981,1003]" gridcol="1" gridrow="5" pageId="12" pageNumber="141">6.1</td>
<td id="76E5F35AA95A0011FED10D92F4B4B4D1" box="[360,425,981,1003]" gridcol="2" gridrow="5" pageId="12" pageNumber="141">7.7</td>
<td id="76E5F35AA95A0011FE7C0D92F771B4D1" box="[453,620,981,1003]" gridcol="3" gridrow="5" pageId="12" pageNumber="141">6.2 (5.36.8)</td>
<td id="76E5F35AA95A0011FD380D92F635B4D1" box="[641,808,981,1003]" gridcol="4" gridrow="5" pageId="12" pageNumber="141">8.8 (8.79.0)</td>
<td id="76E5F35AA95A0011FC870D92F6F8B4D1" box="[830,997,981,1003]" gridcol="5" gridrow="5" pageId="12" pageNumber="141">6.0 (5.46.4)</td>
<td id="76E5F35AA95A0011FC430D92F1BCB4D1" box="[1018,1185,981,1003]" gridcol="6" gridrow="5" pageId="12" pageNumber="141">8.1 (8.18.1)</td>
<td id="76E5F35AA95A0011FB0E0D92F043B4D1" box="[1207,1374,981,1003]" gridcol="7" gridrow="5" pageId="12" pageNumber="141">7.8 (7.58.0)</td>
<td id="76E5F35AA95A0011FACA0D92F0A9B4D1" box="[1395,1460,981,1003]" gridcol="8" gridrow="5" pageId="12" pageNumber="141">7.4</td>
<td id="76E5F35AA95A0011FA760D92F368B4D1" box="[1487,1653,981,1003]" gridcol="9" gridrow="5" pageId="12" pageNumber="141">5.9 (5.46.4)</td>
<td id="76E5F35AA95A0011F9320D92F22CB4D1" box="[1675,1841,981,1003]" gridcol="10" gridrow="5" pageId="12" pageNumber="141">6.6 (6.26.8)</td>
</tr>
<tr id="35349A26A95A0011FF370DB4F22CB333" box="[142,1841,1011,1033]" gridrow="6" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370DB4F5F6B333" box="[142,235,1011,1033]" gridcol="0" gridrow="6" pageId="12" pageNumber="141">HW</th>
<td id="76E5F35AA95A0011FEBB0DB4F450B333" box="[258,333,1011,1033]" gridcol="1" gridrow="6" pageId="12" pageNumber="141">6.1</td>
<td id="76E5F35AA95A0011FED10DB4F4B4B333" box="[360,425,1011,1033]" gridcol="2" gridrow="6" pageId="12" pageNumber="141">8.5</td>
<td id="76E5F35AA95A0011FE7C0DB4F771B333" box="[453,620,1011,1033]" gridcol="3" gridrow="6" pageId="12" pageNumber="141">6.3 (5.76.8)</td>
<td id="76E5F35AA95A0011FD380DB4F635B333" box="[641,808,1011,1033]" gridcol="4" gridrow="6" pageId="12" pageNumber="141">9.1 (8.99.3)</td>
<td id="76E5F35AA95A0011FC870DB4F6F8B333" box="[830,997,1011,1033]" gridcol="5" gridrow="6" pageId="12" pageNumber="141">6.6 (5.87.1)</td>
<td id="76E5F35AA95A0011FC430DB4F1BCB333" box="[1018,1185,1011,1033]" gridcol="6" gridrow="6" pageId="12" pageNumber="141">9.0 (8.49.5)</td>
<td id="76E5F35AA95A0011FB0E0DB4F043B333" box="[1207,1374,1011,1033]" gridcol="7" gridrow="6" pageId="12" pageNumber="141">8.1 (8.08.2)</td>
<td id="76E5F35AA95A0011FACA0DB4F0A9B333" box="[1395,1460,1011,1033]" gridcol="8" gridrow="6" pageId="12" pageNumber="141">7.7</td>
<td id="76E5F35AA95A0011FA760DB4F368B333" box="[1487,1653,1011,1033]" gridcol="9" gridrow="6" pageId="12" pageNumber="141">6.2 (5.76.9)</td>
<td id="76E5F35AA95A0011F9320DB4F22CB333" box="[1675,1841,1011,1033]" gridcol="10" gridrow="6" pageId="12" pageNumber="141">6.9 (6.87.0)</td>
</tr>
<tr id="35349A26A95A0011FF370A56F22CB31D" box="[142,1841,1041,1063]" gridrow="7" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370A56F5F6B31D" box="[142,235,1041,1063]" gridcol="0" gridrow="7" pageId="12" pageNumber="141">IND</th>
<td id="76E5F35AA95A0011FEBB0A56F450B31D" box="[258,333,1041,1063]" gridcol="1" gridrow="7" pageId="12" pageNumber="141">1.9</td>
<td id="76E5F35AA95A0011FED10A56F4B4B31D" box="[360,425,1041,1063]" gridcol="2" gridrow="7" pageId="12" pageNumber="141">2.0</td>
<td id="76E5F35AA95A0011FE7C0A56F771B31D" box="[453,620,1041,1063]" gridcol="3" gridrow="7" pageId="12" pageNumber="141">1.9 (1.72.0)</td>
<td id="76E5F35AA95A0011FD380A56F635B31D" box="[641,808,1041,1063]" gridcol="4" gridrow="7" pageId="12" pageNumber="141">2.1 (2.12.2)</td>
<td id="76E5F35AA95A0011FC870A56F6F8B31D" box="[830,997,1041,1063]" gridcol="5" gridrow="7" pageId="12" pageNumber="141">2.0 (1.82.2)</td>
<td id="76E5F35AA95A0011FC430A56F1BCB31D" box="[1018,1185,1041,1063]" gridcol="6" gridrow="7" pageId="12" pageNumber="141">2.5 (2.42.5)</td>
<td id="76E5F35AA95A0011FB0E0A56F043B31D" box="[1207,1374,1041,1063]" gridcol="7" gridrow="7" pageId="12" pageNumber="141">2.3 (2.02.5)</td>
<td id="76E5F35AA95A0011FACA0A56F0A9B31D" box="[1395,1460,1041,1063]" gridcol="8" gridrow="7" pageId="12" pageNumber="141">2.3</td>
<td id="76E5F35AA95A0011FA760A56F368B31D" box="[1487,1653,1041,1063]" gridcol="9" gridrow="7" pageId="12" pageNumber="141">1.7 (1.41.9)</td>
<td id="76E5F35AA95A0011F9320A56F22CB31D" box="[1675,1841,1041,1063]" gridcol="10" gridrow="7" pageId="12" pageNumber="141">1.6 (1.51.8)</td>
</tr>
<tr id="35349A26A95A0011FF370A68F22CB37F" box="[142,1841,1071,1093]" gridrow="8" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370A68F5F6B37F" box="[142,235,1071,1093]" gridcol="0" gridrow="8" pageId="12" pageNumber="141">END</th>
<td id="76E5F35AA95A0011FEBB0A68F450B37F" box="[258,333,1071,1093]" gridcol="1" gridrow="8" pageId="12" pageNumber="141">1.5</td>
<td id="76E5F35AA95A0011FED10A68F4B4B37F" box="[360,425,1071,1093]" gridcol="2" gridrow="8" pageId="12" pageNumber="141">1.9</td>
<td id="76E5F35AA95A0011FE7C0A68F771B37F" box="[453,620,1071,1093]" gridcol="3" gridrow="8" pageId="12" pageNumber="141">1.6 (1.51.9)</td>
<td id="76E5F35AA95A0011FD380A68F635B37F" box="[641,808,1071,1093]" gridcol="4" gridrow="8" pageId="12" pageNumber="141">2.1 (2.12.2)</td>
<td id="76E5F35AA95A0011FC870A68F6F8B37F" box="[830,997,1071,1093]" gridcol="5" gridrow="8" pageId="12" pageNumber="141">1.6 (1.51.9)</td>
<td id="76E5F35AA95A0011FC430A68F1BCB37F" box="[1018,1185,1071,1093]" gridcol="6" gridrow="8" pageId="12" pageNumber="141">2.3 (2.12.5)</td>
<td id="76E5F35AA95A0011FB0E0A68F043B37F" box="[1207,1374,1071,1093]" gridcol="7" gridrow="8" pageId="12" pageNumber="141">1.9 (1.72.3)</td>
<td id="76E5F35AA95A0011FACA0A68F0A9B37F" box="[1395,1460,1071,1093]" gridcol="8" gridrow="8" pageId="12" pageNumber="141">2.1</td>
<td id="76E5F35AA95A0011FA760A68F368B37F" box="[1487,1653,1071,1093]" gridcol="9" gridrow="8" pageId="12" pageNumber="141">1.5 (1.31.7)</td>
<td id="76E5F35AA95A0011F9320A68F22CB37F" box="[1675,1841,1071,1093]" gridcol="10" gridrow="8" pageId="12" pageNumber="141">1.5 (1.41.6)</td>
</tr>
<tr id="35349A26A95A0011FF370A0AF22CB359" box="[142,1841,1101,1123]" gridrow="9" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370A0AF5F6B359" box="[142,235,1101,1123]" gridcol="0" gridrow="9" pageId="12" pageNumber="141">ED</th>
<td id="76E5F35AA95A0011FEBB0A0AF450B359" box="[258,333,1101,1123]" gridcol="1" gridrow="9" pageId="12" pageNumber="141">2.6</td>
<td id="76E5F35AA95A0011FED10A0AF4B4B359" box="[360,425,1101,1123]" gridcol="2" gridrow="9" pageId="12" pageNumber="141">3.3</td>
<td id="76E5F35AA95A0011FE7C0A0AF771B359" box="[453,620,1101,1123]" gridcol="3" gridrow="9" pageId="12" pageNumber="141">2.6 (2.42.8)</td>
<td id="76E5F35AA95A0011FD380A0AF635B359" box="[641,808,1101,1123]" gridcol="4" gridrow="9" pageId="12" pageNumber="141">3.7 (3.73.7)</td>
<td id="76E5F35AA95A0011FC870A0AF6F8B359" box="[830,997,1101,1123]" gridcol="5" gridrow="9" pageId="12" pageNumber="141">2.6 (2.32.9)</td>
<td id="76E5F35AA95A0011FC430A0AF1BCB359" box="[1018,1185,1101,1123]" gridcol="6" gridrow="9" pageId="12" pageNumber="141">3.5 (3.43.6)</td>
<td id="76E5F35AA95A0011FB0E0A0AF043B359" box="[1207,1374,1101,1123]" gridcol="7" gridrow="9" pageId="12" pageNumber="141">3.0 (2.83.2)</td>
<td id="76E5F35AA95A0011FACA0A0AF0A9B359" box="[1395,1460,1101,1123]" gridcol="8" gridrow="9" pageId="12" pageNumber="141">3.4</td>
<td id="76E5F35AA95A0011FA760A0AF368B359" box="[1487,1653,1101,1123]" gridcol="9" gridrow="9" pageId="12" pageNumber="141">2.4 (2.02.7)</td>
<td id="76E5F35AA95A0011F9320A0AF22CB359" box="[1675,1841,1101,1123]" gridcol="10" gridrow="9" pageId="12" pageNumber="141">2.5 (2.42.7)</td>
</tr>
<tr id="35349A26A95A0011FF370A2CF22CB3BB" box="[142,1841,1131,1153]" gridrow="10" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370A2CF5F6B3BB" box="[142,235,1131,1153]" gridcol="0" gridrow="10" pageId="12" pageNumber="141">TL</th>
<td id="76E5F35AA95A0011FEBB0A2CF450B3BB" box="[258,333,1131,1153]" gridcol="1" gridrow="10" pageId="12" pageNumber="141">6.9</td>
<td id="76E5F35AA95A0011FED10A2CF4B4B3BB" box="[360,425,1131,1153]" gridcol="2" gridrow="10" pageId="12" pageNumber="141">8.3</td>
<td id="76E5F35AA95A0011FE7C0A2CF771B3BB" box="[453,620,1131,1153]" gridcol="3" gridrow="10" pageId="12" pageNumber="141">6.8 (6.37.5)</td>
<td id="76E5F35AA95A0011FD380A2CF635B3BB" box="[641,808,1131,1153]" gridcol="4" gridrow="10" pageId="12" pageNumber="141">9.2 (9.09.3)</td>
<td id="76E5F35AA95A0011FC870A2CF6F8B3BB" box="[830,997,1131,1153]" gridcol="5" gridrow="10" pageId="12" pageNumber="141">7.2 (6.67.8)</td>
<td id="76E5F35AA95A0011FC430A2CF1BCB3BB" box="[1018,1185,1131,1153]" gridcol="6" gridrow="10" pageId="12" pageNumber="141">9.9 (9.710.0)</td>
<td id="76E5F35AA95A0011FB0E0A2CF043B3BB" box="[1207,1374,1131,1153]" gridcol="7" gridrow="10" pageId="12" pageNumber="141">7.3 (6.97.7)</td>
<td id="76E5F35AA95A0011FACA0A2CF0A9B3BB" box="[1395,1460,1131,1153]" gridcol="8" gridrow="10" pageId="12" pageNumber="141">7.7</td>
<td id="76E5F35AA95A0011FA760A2CF368B3BB" box="[1487,1653,1131,1153]" gridcol="9" gridrow="10" pageId="12" pageNumber="141">5.6 (4.96.0)</td>
<td id="76E5F35AA95A0011F9320A2CF22CB3BB" box="[1675,1841,1131,1153]" gridcol="10" gridrow="10" pageId="12" pageNumber="141">6.5 (6.07.0)</td>
</tr>
<tr id="35349A26A95A0011FF370ACEF22CB3A5" box="[142,1841,1161,1183]" gridrow="11" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370ACEF5F6B3A5" box="[142,235,1161,1183]" gridcol="0" gridrow="11" pageId="12" pageNumber="141">FL</th>
<td id="76E5F35AA95A0011FEBB0ACEF450B3A5" box="[258,333,1161,1183]" gridcol="1" gridrow="11" pageId="12" pageNumber="141">7.6</td>
<td id="76E5F35AA95A0011FED10ACEF4B4B3A5" box="[360,425,1161,1183]" gridcol="2" gridrow="11" pageId="12" pageNumber="141">10.2</td>
<td id="76E5F35AA95A0011FE7C0ACEF771B3A5" box="[453,620,1161,1183]" gridcol="3" gridrow="11" pageId="12" pageNumber="141">7.9 (7.28.6)</td>
<td id="76E5F35AA95A0011FD380ACEF635B3A5" box="[641,808,1161,1183]" gridcol="4" gridrow="11" pageId="12" pageNumber="141">10.5 (9.911.0)</td>
<td id="76E5F35AA95A0011FC870ACEF6F8B3A5" box="[830,997,1161,1183]" gridcol="5" gridrow="11" pageId="12" pageNumber="141">8.2 (7.98.5)</td>
<td id="76E5F35AA95A0011FC430ACEF1BCB3A5" box="[1018,1185,1161,1183]" gridcol="6" gridrow="11" pageId="12" pageNumber="141">10.9 (10.910.9)</td>
<td id="76E5F35AA95A0011FB0E0ACEF043B3A5" box="[1207,1374,1161,1183]" gridcol="7" gridrow="11" pageId="12" pageNumber="141">8.8 (7.69.4)</td>
<td id="76E5F35AA95A0011FACA0ACEF0A9B3A5" box="[1395,1460,1161,1183]" gridcol="8" gridrow="11" pageId="12" pageNumber="141">9.5</td>
<td id="76E5F35AA95A0011FA760ACEF368B3A5" box="[1487,1653,1161,1183]" gridcol="9" gridrow="11" pageId="12" pageNumber="141">6.6 (6.07.0)</td>
<td id="76E5F35AA95A0011F9320ACEF22CB3A5" box="[1675,1841,1161,1183]" gridcol="10" gridrow="11" pageId="12" pageNumber="141">7.4 (7.27.6)</td>
</tr>
<tr id="35349A26A95A0011FF370AE0F22CB387" box="[142,1841,1191,1213]" gridrow="12" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370AE0F5F6B387" box="[142,235,1191,1213]" gridcol="0" gridrow="12" pageId="12" pageNumber="141">HL/SVL</th>
<td id="76E5F35AA95A0011FEBB0AE0F450B387" box="[258,333,1191,1213]" gridcol="1" gridrow="12" pageId="12" pageNumber="141">0.3</td>
<td id="76E5F35AA95A0011FED10AE0F4B4B387" box="[360,425,1191,1213]" gridcol="2" gridrow="12" pageId="12" pageNumber="141">0.3</td>
<td id="76E5F35AA95A0011FE7C0AE0F771B387" box="[453,620,1191,1213]" gridcol="3" gridrow="12" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011FD380AE0F635B387" box="[641,808,1191,1213]" gridcol="4" gridrow="12" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011FC870AE0F6F8B387" box="[830,997,1191,1213]" gridcol="5" gridrow="12" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011FC430AE0F1BCB387" box="[1018,1185,1191,1213]" gridcol="6" gridrow="12" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011FB0E0AE0F043B387" box="[1207,1374,1191,1213]" gridcol="7" gridrow="12" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011FACA0AE0F0A9B387" box="[1395,1460,1191,1213]" gridcol="8" gridrow="12" pageId="12" pageNumber="141">0.3</td>
<td id="76E5F35AA95A0011FA760AE0F368B387" box="[1487,1653,1191,1213]" gridcol="9" gridrow="12" pageId="12" pageNumber="141">0.3 (0.30.4)</td>
<td id="76E5F35AA95A0011F9320AE0F22CB387" box="[1675,1841,1191,1213]" gridcol="10" gridrow="12" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
</tr>
<tr id="35349A26A95A0011FF370A82F22CB3E1" box="[142,1841,1221,1243]" gridrow="13" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370A82F5F6B3E1" box="[142,235,1221,1243]" gridcol="0" gridrow="13" pageId="12" pageNumber="141">HW/SVL</th>
<td id="76E5F35AA95A0011FEBB0A82F450B3E1" box="[258,333,1221,1243]" gridcol="1" gridrow="13" pageId="12" pageNumber="141">0.3</td>
<td id="76E5F35AA95A0011FED10A82F4B4B3E1" box="[360,425,1221,1243]" gridcol="2" gridrow="13" pageId="12" pageNumber="141">0.3</td>
<td id="76E5F35AA95A0011FE7C0A82F771B3E1" box="[453,620,1221,1243]" gridcol="3" gridrow="13" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011FD380A82F635B3E1" box="[641,808,1221,1243]" gridcol="4" gridrow="13" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011FC870A82F6F8B3E1" box="[830,997,1221,1243]" gridcol="5" gridrow="13" pageId="12" pageNumber="141">0.3 (0.30.4)</td>
<td id="76E5F35AA95A0011FC430A82F1BCB3E1" box="[1018,1185,1221,1243]" gridcol="6" gridrow="13" pageId="12" pageNumber="141">0.3 (0.30.4)</td>
<td id="76E5F35AA95A0011FB0E0A82F043B3E1" box="[1207,1374,1221,1243]" gridcol="7" gridrow="13" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011FACA0A82F0A9B3E1" box="[1395,1460,1221,1243]" gridcol="8" gridrow="13" pageId="12" pageNumber="141">0.3</td>
<td id="76E5F35AA95A0011FA760A82F368B3E1" box="[1487,1653,1221,1243]" gridcol="9" gridrow="13" pageId="12" pageNumber="141">0.3 (0.30.4)</td>
<td id="76E5F35AA95A0011F9320A82F22CB3E1" box="[1675,1841,1221,1243]" gridcol="10" gridrow="13" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
</tr>
<tr id="35349A26A95A0011FF370AA4F22CB3C3" box="[142,1841,1251,1273]" gridrow="14" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370AA4F5F6B3C3" box="[142,235,1251,1273]" gridcol="0" gridrow="14" pageId="12" pageNumber="141">END/ED</th>
<td id="76E5F35AA95A0011FEBB0AA4F450B3C3" box="[258,333,1251,1273]" gridcol="1" gridrow="14" pageId="12" pageNumber="141">0.6</td>
<td id="76E5F35AA95A0011FED10AA4F4B4B3C3" box="[360,425,1251,1273]" gridcol="2" gridrow="14" pageId="12" pageNumber="141">0.6</td>
<td id="76E5F35AA95A0011FE7C0AA4F771B3C3" box="[453,620,1251,1273]" gridcol="3" gridrow="14" pageId="12" pageNumber="141">0.6 (0.60.7)</td>
<td id="76E5F35AA95A0011FD380AA4F635B3C3" box="[641,808,1251,1273]" gridcol="4" gridrow="14" pageId="12" pageNumber="141">0.6 (0.60.6)</td>
<td id="76E5F35AA95A0011FC870AA4F6F8B3C3" box="[830,997,1251,1273]" gridcol="5" gridrow="14" pageId="12" pageNumber="141">0.6 (0.50.7)</td>
<td id="76E5F35AA95A0011FC430AA4F1BCB3C3" box="[1018,1185,1251,1273]" gridcol="6" gridrow="14" pageId="12" pageNumber="141">0.6 (0.60.7)</td>
<td id="76E5F35AA95A0011FB0E0AA4F043B3C3" box="[1207,1374,1251,1273]" gridcol="7" gridrow="14" pageId="12" pageNumber="141">0.6 (0.60.7)</td>
<td id="76E5F35AA95A0011FACA0AA4F0A9B3C3" box="[1395,1460,1251,1273]" gridcol="8" gridrow="14" pageId="12" pageNumber="141">0.6</td>
<td id="76E5F35AA95A0011FA760AA4F368B3C3" box="[1487,1653,1251,1273]" gridcol="9" gridrow="14" pageId="12" pageNumber="141">0.6 (0.50.7)</td>
<td id="76E5F35AA95A0011F9320AA4F22CB3C3" box="[1675,1841,1251,1273]" gridcol="10" gridrow="14" pageId="12" pageNumber="141">0.6 (0.60.6)</td>
</tr>
<tr id="35349A26A95A0011FF370B46F22CB22D" box="[142,1841,1281,1303]" gridrow="15" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370B46F5F6B22D" box="[142,235,1281,1303]" gridcol="0" gridrow="15" pageId="12" pageNumber="141">TL/SVL</th>
<td id="76E5F35AA95A0011FEBB0B46F450B22D" box="[258,333,1281,1303]" gridcol="1" gridrow="15" pageId="12" pageNumber="141">0.4</td>
<td id="76E5F35AA95A0011FED10B46F4B4B22D" box="[360,425,1281,1303]" gridcol="2" gridrow="15" pageId="12" pageNumber="141">0.3</td>
<td id="76E5F35AA95A0011FE7C0B46F771B22D" box="[453,620,1281,1303]" gridcol="3" gridrow="15" pageId="12" pageNumber="141">0.4 (0.30.4)</td>
<td id="76E5F35AA95A0011FD380B46F635B22D" box="[641,808,1281,1303]" gridcol="4" gridrow="15" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011FC870B46F6F8B22D" box="[830,997,1281,1303]" gridcol="5" gridrow="15" pageId="12" pageNumber="141">0.4 (0.40.4)</td>
<td id="76E5F35AA95A0011FC430B46F1BCB22D" box="[1018,1185,1281,1303]" gridcol="6" gridrow="15" pageId="12" pageNumber="141">0.4 (0.40.4)</td>
<td id="76E5F35AA95A0011FB0E0B46F043B22D" box="[1207,1374,1281,1303]" gridcol="7" gridrow="15" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011FACA0B46F0A9B22D" box="[1395,1460,1281,1303]" gridcol="8" gridrow="15" pageId="12" pageNumber="141">0.3</td>
<td id="76E5F35AA95A0011FA760B46F368B22D" box="[1487,1653,1281,1303]" gridcol="9" gridrow="15" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
<td id="76E5F35AA95A0011F9320B46F22CB22D" box="[1675,1841,1281,1303]" gridcol="10" gridrow="15" pageId="12" pageNumber="141">0.3 (0.30.3)</td>
</tr>
<tr id="35349A26A95A0011FF370B58F22CB20F" box="[142,1841,1311,1333]" gridrow="16" pageId="12" pageNumber="141">
<th id="76E5F35AA95A0011FF370B58F5F6B20F" box="[142,235,1311,1333]" gridcol="0" gridrow="16" pageId="12" pageNumber="141">FL/SVL</th>
<td id="76E5F35AA95A0011FEBB0B58F450B20F" box="[258,333,1311,1333]" gridcol="1" gridrow="16" pageId="12" pageNumber="141">0.4</td>
<td id="76E5F35AA95A0011FED10B58F4B4B20F" box="[360,425,1311,1333]" gridcol="2" gridrow="16" pageId="12" pageNumber="141">0.4</td>
<td id="76E5F35AA95A0011FE7C0B58F771B20F" box="[453,620,1311,1333]" gridcol="3" gridrow="16" pageId="12" pageNumber="141">0.4 (0.40.4)</td>
<td id="76E5F35AA95A0011FD380B58F635B20F" box="[641,808,1311,1333]" gridcol="4" gridrow="16" pageId="12" pageNumber="141">0.4 (0.40.4)</td>
<td id="76E5F35AA95A0011FC870B58F6F8B20F" box="[830,997,1311,1333]" gridcol="5" gridrow="16" pageId="12" pageNumber="141">0.4 (0.40.5)</td>
<td id="76E5F35AA95A0011FC430B58F1BCB20F" box="[1018,1185,1311,1333]" gridcol="6" gridrow="16" pageId="12" pageNumber="141">0.4 (0.40.4)</td>
<td id="76E5F35AA95A0011FB0E0B58F043B20F" box="[1207,1374,1311,1333]" gridcol="7" gridrow="16" pageId="12" pageNumber="141">0.4 (0.30.4)</td>
<td id="76E5F35AA95A0011FACA0B58F0A9B20F" box="[1395,1460,1311,1333]" gridcol="8" gridrow="16" pageId="12" pageNumber="141">0.4</td>
<td id="76E5F35AA95A0011FA760B58F368B20F" box="[1487,1653,1311,1333]" gridcol="9" gridrow="16" pageId="12" pageNumber="141">0.4 (0.30.4)</td>
<td id="76E5F35AA95A0011F9320B58F22CB20F" box="[1675,1841,1311,1333]" gridcol="10" gridrow="16" pageId="12" pageNumber="141">0.4 (0.30.4)</td>
</tr>
</table>
</paragraph>
<paragraph id="8BBB9864A95AFFE2FF370B19F357B24A" blockId="12.[142,1610,1374,1392]" box="[142,1610,1374,1392]" pageId="12" pageNumber="141">SVL, snout-vent length; HL, head length; HW, head width; IND, internarial distance; END, distance from eye to nostril; ED, eye diameter; TL, tibia length; FL, foot length.</paragraph>
<paragraph id="8BBB9864A95BFFE3FF1A0E82F427B64E" blockId="13.[163,780,197,372]" pageId="13" pageNumber="142">
and ventral parts of shanks, lacking in
<taxonomicName id="4C04E3E7A95BFFE3FDE50E81F619B7E0" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[604,772,197,219]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="13" pageNumber="142" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A95BFFE3FDE50E81F619B7E0" box="[604,772,197,219]" italics="true" pageId="13" pageNumber="142">B. quellokunka</emphasis>
</taxonomicName>
. It has a shagreen to smooth dorsal skin, and the upper third of iris is golden with fine black reticulations (bluish-grey in
<taxonomicName id="4C04E3E7A95BFFE3FEEE0F65F71BB60C" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[343,518,289,311]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="13" pageNumber="142" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A95BFFE3FEEE0F65F71BB60C" box="[343,518,289,311]" italics="true" pageId="13" pageNumber="142">B. quellokunka</emphasis>
</taxonomicName>
). Also,
<taxonomicName id="4C04E3E7A95BFFE3FDE50F65F616B60C" authorityName="Riva &amp; Chaparro &amp; Castroviejo-Fisher &amp; Padial" authorityYear="2018" box="[604,779,289,311]" class="Amphibia" family="Craugastoridae" genus="Bryophryne" kingdom="Animalia" order="Anura" pageId="13" pageNumber="142" phylum="Chordata" rank="species" species="quellokunka">
<emphasis id="B9704476A95BFFE3FDE50F65F616B60C" box="[604,779,289,311]" italics="true" pageId="13" pageNumber="142">B. quellokunka</emphasis>
</taxonomicName>
is larger in size (maximum SVL of females
<quantity id="4CFC3581A95BFFE3FD1C0F07F616B66F" box="[677,779,320,341]" metricMagnitude="-2" metricUnit="m" metricValue="2.82" pageId="13" pageNumber="142" unit="mm" value="28.2">28.2 mm</quantity>
vs.
<quantity id="4CFC3581A95BFFE3FF710F18F433B64E" box="[200,302,351,372]" metricMagnitude="-2" metricUnit="m" metricValue="2.44" pageId="13" pageNumber="142" unit="mm" value="24.4">24.4 mm</quantity>
).
</paragraph>
<paragraph id="8BBB9864A95BFFE3FF1A0FDFF7ACB23D" blockId="13.[163,779,408,1626]" pageId="13" pageNumber="142">
<emphasis id="B9704476A95BFFE3FF1A0FDFF4CEB697" box="[163,467,408,429]" italics="true" pageId="13" pageNumber="142">
Description of the
<typeStatus id="54BF26C6A95BFFE3FECD0FDFF4CEB697" box="[372,467,408,429]" pageId="13" pageNumber="142" type="holotype">holotype</typeStatus>
</emphasis>
: An adult female,
<quantity id="4CFC3581A95BFFE3FD1F0FDFF617B697" box="[678,778,408,429]" metricMagnitude="-2" metricUnit="m" metricValue="2.82" pageId="13" pageNumber="142" unit="mm" value="28.2">28.2 mm</quantity>
SVL. Body robust; dorsal skin homogeneously warty; ventral skin areolate; dorsolateral folds present, incomplete; pectoral fold absent; head wider than long; HW 32.9% of SVL, HL 31.9% of SVL; snout moderately short, rounded in dorsal view and in profile; nostrils not prominent, closer to snout than to eyes; canthus rostralis barely marked; eyenostril distance 59.4% of eye length; loreal region slightly concave; cranial crests absent; tympanic membrane and tympanic annulus small, slightly evident beneath the skin; supratympanic fold absent; tongue large, oval; choanae small, oval, broadly separated; dentigerous processes of vomers absent; limbs short; tips of digits round, not expanded laterally; ulnar tubercle and fold absent; inner palmar tubercle oval, flattened, poorly defined, the same size as round outer; fingers moderately short, not fringed, tips rounded and lacking circumferential grooves and ungual flap; subarticular tubercles at the base of fingers round, large; supernumerary tubercles round, poorly marked; first finger slightly shorter than second, relative length of fingers 1 &lt;2 &lt;4 &lt;3; tibia length 32.9% of SVL; tarsal fold absent; two round metatarsal tubercles, inner approximately the same size as outer; supernumerary tubercles flat, not well marked; subarticular tubercles round, moderately swollen; toes lacking basal webbing or lateral fringes, toe tips round, lacking circumferential groves and ungual flap; relative length of toes 1 &lt;2 &lt;3 &lt;5 &lt;4; foot length 39.0% of SVL.
</paragraph>
<paragraph id="8BBB9864A95BFFE3FF020B56F61BB160" blockId="13.[163,779,408,1626]" pageId="13" pageNumber="142">In preservative, dorsum uniformly brown, venter and throat pale brown with a uniform, fine marbled cream pattern; digits cream. In life, the dorsum was uniformly brown with some reddish-brown warts, the venter was grey with irregular brown markings, the throat was yellowish orange, and the digits were orange; there were small orange irregular blotches on axillae and groins; the venter was greyish-brown with irregular dirty-yellow patterns; the digits were yellowish-orange; the two inferior thirds of the iris were dark brown while the upper third was metallic bluish-grey.</paragraph>
<paragraph id="8BBB9864A95BFFE3FF1A08C7F415B1E8" blockId="13.[163,778,1664,1746]" pageId="13" pageNumber="142">
<emphasis id="B9704476A95BFFE3FF1A08C7F766B1AF" box="[163,635,1664,1685]" italics="true" pageId="13" pageNumber="142">
Measurements (in mm) of the
<typeStatus id="54BF26C6A95BFFE3FDAF08C7F766B1AF" box="[534,635,1664,1685]" pageId="13" pageNumber="142" type="holotype">holotype</typeStatus>
</emphasis>
: SVL, 28.2; HL, 9.0; HW, 9.3; IND, 2.2; END, 2.2; ED, 3.7; TL, 9.3; FL, 11.0.
</paragraph>
<paragraph id="8BBB9864A95BFFE3FF1A08BEF11BB64E" blockId="13.[163,779,1785,1899]" lastBlockId="13.[827,1443,197,372]" pageId="13" pageNumber="142">
<emphasis id="B9704476A95BFFE3FF1A08BEF413B034" box="[163,270,1785,1806]" italics="true" pageId="13" pageNumber="142">Variation</emphasis>
:
<materialsCitation id="3B6C9239A95BFFE3FEA208BEF6E2B649" collectionCode="MUBI" pageId="13" pageNumber="142" specimenCode="MUBI 5375, 5377, MUBI 5376" specimenCount="2">
Dorsal colour pattern is similar in all specimens; some of them (e.g.
<specimenCode id="DBA2301FA95BFFE3FE03095FF75DB017" box="[442,576,1815,1837]" collectionCode="MUBI" pageId="13" pageNumber="142">MUBI 5375</specimenCode>
,
<specimenCode id="DBA2301FA95BFFE3FDF30950F79FB017" box="[586,642,1815,1837]" collectionCode="MUBI" pageId="13" pageNumber="142">5377</specimenCode>
) have irregular, feeble dark brown markings on the sides of the scapular region, above the groins, on limbs and on the canthal region; the venter and throat vary from almost uniformly brown (
<specimenCode id="DBA2301FA95BFFE3FBAD0EA3F1BFB7C3" box="[1044,1186,227,249]" collectionCode="MUBI" pageId="13" pageNumber="142">MUBI 5376</specimenCode>
) to almost uniformly cream (
<specimenCode id="DBA2301FA95BFFE3FC360F45F105B622" box="[911,1048,258,280]" collectionCode="MUBI" pageId="13" pageNumber="142">MUBI 5375</specimenCode>
). Only
<specimenCount id="9D0253EDA95BFFE3FBD10F44F010B622" box="[1128,1293,258,280]" count="2" pageId="13" pageNumber="142" type="generic">two specimens</specimenCount>
out of 13 did not have the bluish-grey upper third of the iris, having it brown as the rest of the eye. For morphometric variation, see
<tableCitation id="C686ADDFA95BFFE3FC150F19F6E2B649" box="[940,1023,350,372]" captionStart="Table 3" captionStartId="12.[142,206,698,720]" captionText="Table 3. Morphometrics for new Peruvian species of Bryophryne and Microkayla (range, in parenthesis, follows mean; AM, adult males; AF, adult females)" pageId="13" pageNumber="142">Table 3</tableCitation>
</materialsCitation>
.
</paragraph>
<paragraph id="8BBB9864A95BFFE3FC820FDAF1A2B6CA" blockId="13.[827,1443,413,496]" pageId="13" pageNumber="142">
<emphasis id="B9704476A95BFFE3FC820FDAF1B7B688" box="[827,1194,413,434]" italics="true" pageId="13" pageNumber="142">Distribution and natural history</emphasis>
: Known only from the
<typeStatus id="54BF26C6A95BFFE3FC820FFBF673B6EB" box="[827,878,444,465]" pageId="13" pageNumber="142">type</typeStatus>
locality (
<figureCitation id="133F84E1A95BFFE3FC670FFCF13CB6EB" box="[990,1057,443,465]" captionStart="Figure 3" captionStartId="11.[164,243,1434,1456]" captionTargetBox="[387,1218,197,1394]" captionTargetId="figure-207@11.[385,1220,195,1395]" captionTargetPageId="11" captionText="Figure 3. Map of the Andes of southern Peru around department of Cusco showing the distribution (type localities only) of the 12 nominal species of Bryophryne described hitherto: (1) B. flammiventris; (2) B. abramalagae; (3) B. bustamantei; (4) B. bakersfield; (5) B. cophites; (6) B. hanssaueri; (7) B. nubilosus; (8) B. gymnotis; (9) B. quellokunka sp. nov.; (10) B. zonalis; (11) B. tocra sp. nov.; (12) B. wilakunka sp. nov." pageId="13" pageNumber="142">Fig. 3</figureCitation>
). Individuals were found during the day under stones in wet puna.
</paragraph>
<paragraph id="8BBB9864A95BFFE3FC820C5EF0B9B5DC" blockId="13.[827,1444,537,743]" pageId="13" pageNumber="142">
<emphasis id="B9704476A95BFFE3FC820C5EF6A8B514" box="[827,949,537,558]" italics="true" pageId="13" pageNumber="142">Etymology</emphasis>
: The species epithet is used as a name in apposition, and derives from the Quechua word Qello Kunka meaning yellow throat (qello yellow, kunka throat), and refers to the yellowish throat of the species. Qello Kunka is also the name of a mountain (
<quantity id="4CFC3581A95BFFE3FAFF0CD4F086B593" box="[1350,1435,659,681]" metricMagnitude="3" metricUnit="m" metricValue="5.1" pageId="13" pageNumber="142" unit="m" value="5100.0">5100 m</quantity>
) in the Quispicanchis province, Marcapata district, that belongs to the Vilcanota (Willkamayu) mountain range.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,202 @@
<document id="209270814752B873CCE4074BA4E4EC4A" ID-ISSN="0024-4082" ID-ZooBank="D3A2334-44D3-4ADA-AAC6-1130F3D7FD22" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779536232" checkinUser="plazi" docAuthor="Pinna, Mário De, Zuanon, Jansen, Py-Daniel, Lucia Rapp &amp; Petry, Paulo" docDate="2018" docId="03FE8787D950FFEE03C2970DFB0BC86C" docLanguage="en" docName="zlx028.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Tarumaniidae Pinna, Zuanon, Py-Daniel &amp; Petry, 2018, FAM. NOV." docType="treatment" docVersion="1" lastPageNumber="82" masterDocId="FFC7FFFFD954FFE80011957AFFB0CA05" masterDocTitle="A new family of neotropical freshwater fishes from deep fossorial Amazonian habitat, with a reappraisal of morphological characiform phylogeny (Teleostei: Ostariophysi)" masterLastPageNumber="106" masterPageNumber="76" pageNumber="80" updateTime="1738779691674" updateUser="GgImagineBatch">
<mods:mods id="6CDB0BD85354F98FD923D0F21591AB1C" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="5A0A257CCBA071856CD19DC49458BA6B">
<mods:title id="541B3560491C8A4F88AE06A64AB0D391">A new family of neotropical freshwater fishes from deep fossorial Amazonian habitat, with a reappraisal of morphological characiform phylogeny (Teleostei: Ostariophysi)</mods:title>
</mods:titleInfo>
<mods:name id="275C28D25FBFF02F5B65550B509ED30C" type="personal">
<mods:role id="34898F67FDACB493FD1371D3FF9D6EA9">
<mods:roleTerm id="D92AB5B2E044702A8D8A744BA82631F5">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="C2E03019AEE6B261EC83D7E13B3C803B">Pinna, Mário De</mods:namePart>
</mods:name>
<mods:name id="4F8B826DC847E0B4225FED358A9033B5" type="personal">
<mods:role id="AF6CC324B4B6C487172F31ADBB1511AD">
<mods:roleTerm id="39BF53647CB36A776517D6A8672AB3A9">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="475D072DD88FA25BEA59E7ECB69DB5FD">Zuanon, Jansen</mods:namePart>
</mods:name>
<mods:name id="F26363584B2C63613E852F076440F440" type="personal">
<mods:role id="4D09E93ABEF193F955A427A841CC5C8D">
<mods:roleTerm id="FD05C221298839896B64172D4C416A8C">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="AC2D7EF71013E00AC78D9FEFCC12ABAE">Py-Daniel, Lucia Rapp</mods:namePart>
</mods:name>
<mods:name id="6A420AC582D71E180C4DF7084DBAC611" type="personal">
<mods:role id="EF1060E14C93760E8620399B78965BF8">
<mods:roleTerm id="A74411F79F03793564653CD7EB1DCDD8">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="99AB25527B42FE29D8E09A444CCC4D59">Petry, Paulo</mods:namePart>
</mods:name>
<mods:typeOfResource id="7DC46DF572096FF1DBBDA80CB768EBCB">text</mods:typeOfResource>
<mods:relatedItem id="CFC0FD7C1D05B774B8DB835472644EF7" type="host">
<mods:titleInfo id="4976F8D2DFBC053F9A6550D2BC977F4C">
<mods:title id="EADBB53713BFCDD4FC025E3C0985D2C8">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="A7EFAE19C1209EE95135DD36A8ED501E">
<mods:date id="E55896C26960105330A186D6486205FC">2018</mods:date>
<mods:detail id="27F984DF385FF78C054B94F72012BA7F" type="volume">
<mods:number id="BF4FF36023F630FE9E1D24DFE51D071C">182</mods:number>
</mods:detail>
<mods:extent id="BD6027332047C697F33844F7CD006D9C" unit="page">
<mods:start id="427D51DB93E4F7441FDBA59F070732FA">76</mods:start>
<mods:end id="FE31A7F0A466A751DEE8235211CDD533">106</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="CA1883EDC9190DDFCF5D26AF3C2EC15B">journal article</mods:classification>
<mods:identifier id="6E6F97FA4EB607DD653725167241878B" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="F3A323861C72553BB29A62E6303B2A70" type="ZooBank">D3A2334-44D3-4ADA-AAC6-1130F3D7FD22</mods:identifier>
</mods:mods>
<treatment id="03FE8787D950FFEE03C2970DFB0BC86C" LSID="urn:lsid:plazi:treatment:03FE8787D950FFEE03C2970DFB0BC86C" httpUri="http://treatment.plazi.org/id/03FE8787D950FFEE03C2970DFB0BC86C" lastPageId="6" lastPageNumber="82" pageId="4" pageNumber="80">
<subSubSection id="C34D651AD950FFEC03C2970DFABBC88A" box="[979,1291,631,655]" pageId="4" pageNumber="80" type="nomenclature">
<paragraph id="8BE83691D950FFEC03C2970DFABBC88A" blockId="4.[979,1291,631,655]" box="[979,1291,631,655]" pageId="4" pageNumber="80">
<heading id="D0A081FDD950FFEC03C2970DFABBC88A" box="[979,1291,631,655]" centered="true" fontSize="9" level="2" pageId="4" pageNumber="80" reason="3">
<taxonomicName id="4C574D12D950FFEC03C2970DFB3CC88B" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[979,1164,631,655]" family="Tarumaniidae" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="4" pageNumber="80" phylum="Chordata" rank="family" status="fam. nov.">
<smallCapsWord id="8D0EA04DD950FFEC03C2970DFB3CC88B" baselines="649,649" box="[979,1164,631,655]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Tarumaniidae" pageId="4" pageNumber="80">TARUMANIIDAE</smallCapsWord>
</taxonomicName>
<emphasis id="B923EA83D950FFEC04829701FABBC88A" bold="true" box="[1171,1291,631,655]" pageId="4" pageNumber="80">
<taxonomicNameLabel id="A21057F8D950FFEC04829701FABBC88A" box="[1171,1291,631,655]" pageId="4" pageNumber="80" rank="family">
<smallCapsWord id="8D0EA04DD950FFEC04829701FB75C88B" baselines="649" box="[1171,1221,635,654]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="fam" pageId="4" pageNumber="80">FAM</smallCapsWord>
.
<smallCapsWord id="8D0EA04DD950FFEC04C29701FAB4C88B" baselines="649" box="[1235,1284,635,654]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="nov" pageId="4" pageNumber="80">NOV</smallCapsWord>
.
</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C34D651AD950FFEE032A97DBFB0BC86C" lastPageId="6" lastPageNumber="82" pageId="4" pageNumber="80" type="materials_examined">
<paragraph id="8BE83691D950FFEC032A97DBFADCC8B3" blockId="4.[827,1388,672,694]" box="[827,1388,672,694]" pageId="4" pageNumber="80">
<emphasis id="B923EA83D950FFEC032A97DBFBF5C8B0" box="[827,1093,672,694]" italics="true" pageId="4" pageNumber="80">
<typeStatus id="54EC8833D950FFEC032A97DBFCC0C8B3" box="[827,880,673,694]" pageId="4" pageNumber="80">Type</typeStatus>
genus:
<taxonomicName id="4C574D12D950FFEC03D597DAFBF5C8B0" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[964,1093,672,693]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="4" pageNumber="80" phylum="Chordata" rank="genus" status="gen. nov.">Tarumania</taxonomicName>
</emphasis>
<taxonomicNameLabel id="A21057F8D950FFEC045A97DAFB1DC8B0" box="[1099,1197,672,693]" pageId="4" pageNumber="80" rank="genus">gen. nov.</taxonomicNameLabel>
described below.
</paragraph>
<paragraph id="8BE83691D950FFEC032A97AEFB9CC90D" blockId="4.[827,1443,724,776]" pageId="4" pageNumber="80">
<emphasis id="B923EA83D950FFEC032A97AEFAB2C8EC" box="[827,1282,724,745]" italics="true" pageId="4" pageNumber="80">
Species included:
<taxonomicName id="4C574D12D950FFEC041D97AEFAB2C8EC" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[1036,1282,724,745]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="4" pageNumber="80" phylum="Chordata" rank="species" species="walkerae" status="sp. nov.">Tarumania walkerae</taxonomicName>
</emphasis>
<taxonomicNameLabel id="A21057F8D950FFEC051A97AEFAD1C8EC" box="[1291,1377,724,745]" pageId="4" pageNumber="80" rank="species">sp. nov.</taxonomicNameLabel>
(
<figureCitation id="136C2A14D950FFEC056097AEFCD4C90D" captionStart-0="Figure 1" captionStart-1="Figure 2" captionStart-2="Figure 3" captionStartId-0="5.[144,222,537,559]" captionStartId-1="5.[144,222,1316,1338]" captionStartId-2="5.[145,223,1805,1827]" captionTargetBox-0="[144,1424,195,497]" captionTargetBox-1="[500,1070,647,1277]" captionTargetBox-2="[385,1185,1396,1765]" captionTargetId-0="figure-27@5.[144,1424,195,497]" captionTargetId-1="figure-41@5.[471,1098,631,1277]" captionTargetId-2="figure-63@5.[385,1185,1396,1765]" captionTargetPageId-0="5" captionTargetPageId-1="5" captionTargetPageId-2="5" captionText-0="Figure 1. Tarumania walkerae gen. et sp. nov., holotype, INPA 33737." captionText-1="Figure 2. Tarumania walkerae gen. et sp. nov., holotype, INPA 33737. Dorsal (a) and ventral (b) views of head" captionText-2="Figure 3. Live specimen, juvenile, of Tarumania walkerae, paratype, MZUSP 120543, shortly after collection. Arrow shows pelvic fins in anteriorly deflected position." pageId="4" pageNumber="80">Figs 13</figureCitation>
) described below.
</paragraph>
<paragraph id="8BE83691D950FFEE032A965DFE8BC97B" blockId="4.[827,1444,806,1902]" lastBlockId="6.[163,780,197,894]" lastPageId="6" lastPageNumber="82" pageId="4" pageNumber="80">
<emphasis id="B923EA83D950FFEC032A965DFC08C939" box="[827,952,807,828]" italics="true" pageId="4" pageNumber="80">Diagnosis:</emphasis>
Distinguished from all other families of Osteichthyes by the presence of a swimbladder composed of 11 longitudinally arranged interconnected compartments extending along most of the body, immediately ventral to the vertebral column (
<figureCitation id="136C2A14D950FFEC056496DBFCF9C9D0" captionStart="Figure 4" captionStartId="6.[163,241,1819,1841]" captionTargetBox="[164,1441,1501,1778]" captionTargetId="figure-678@6.[163,1443,1500,1779]" captionTargetPageId="6" captionText="Figure 4. Schematic representation of swimbladder of Tarumania walkerae, based mostly on INPA 26241, 51.5-mm SL. ac, anterior swimbladder chamber; sd, sinusoid swimbladder duct. Roman numerals IIXI represent sequential swimbladder chambers." pageId="4" pageNumber="80">Fig. 4</figureCitation>
; vs. swimbladder with one or two compartments). Also unique among teleosts (except
<taxonomicName id="4C574D12D950FFEC04FF96A4FA29C9F1" box="[1262,1433,990,1012]" family="Platytroctidae" kingdom="Animalia" order="Osmeriformes" pageId="4" pageNumber="80" phylum="Chordata" rank="family">Platytroctidae</taxonomicName>
) by the presence of reverse-imbricated scales (i.e. with free margins directed anteriorly) covering most of the head (
<figureCitation id="136C2A14D950FFEC03A59140FC47CE55" box="[948,1015,1082,1104]" captionStart="Figure 5" captionStartId="7.[146,225,710,732]" captionTargetBox="[416,1184,195,670]" captionTargetId="figure-601@7.[385,1185,195,671]" captionTargetPageId="7" captionText="Figure 5. Tarumania walkerae, paratype, INPA 21603, lateral view of head showing reverse-imbricated scales. Specimen cleaned of superficial mucus." pageId="4" pageNumber="80">Fig. 5</figureCitation>
; vs. scales with normal imbrication throughout body and head). Further distinguished from all other Ostariophysi by having two rows of teeth on the maxilla (
<figureCitation id="136C2A14D950FFEC042791ECFBC7CEA9" box="[1078,1143,1174,1196]" captionStart="Figure 6" captionStartId="9.[145,225,822,844]" captionTargetBox="[153,755,196,782]" captionTargetId="figure-773@9.[149,757,195,783]" captionTargetPageId="9" captionText="Figure 6. Jaws of Tarumania walkerae, paratype, INPA 25747, 151.2-mm SL, lateral view. aa, angulo-articular; den, dentary; mx, maxilla; pmx, premaxilla; ra, retroarticular." pageId="4" pageNumber="80">Fig. 6</figureCitation>
; vs. single row). Uniquely diagnosed from all other
<taxonomicName id="4C574D12D950FFEC044691CFFAB0CECE" box="[1111,1280,1205,1227]" kingdom="Animalia" order="Characiformes" pageId="4" pageNumber="80" phylum="Chordata" rank="order">Characiformes</taxonomicName>
by each of the following characters: the numerous vertebrae (6970; vs. 68 or fewer), pleural ribs (4144; vs. 32 or fewer) and scales (244267 along midlateral row and 25 rows on caudal peduncle; vs. 162 or fewer); the spatulate caudal peduncle (
<figureCitation id="136C2A14D950FFEC04189034FBFACF61" box="[1033,1098,1358,1380]" captionStart="Figure 1" captionStartId="5.[144,222,537,559]" captionTargetBox="[144,1424,195,497]" captionTargetId="figure-27@5.[144,1424,195,497]" captionTargetPageId="5" captionText="Figure 1. Tarumania walkerae gen. et sp. nov., holotype, INPA 33737." pageId="4" pageNumber="80">Fig. 1</figureCitation>
; vs. oblong or round in cross-section); the lanceolate caudal fin (
<figureCitation id="136C2A14D950FFEC04F59017FA98CF87" box="[1252,1320,1389,1411]" captionStart="Figure 1" captionStartId="5.[144,222,537,559]" captionTargetBox="[144,1424,195,497]" captionTargetId="figure-27@5.[144,1424,195,497]" captionTargetPageId="5" captionText="Figure 1. Tarumania walkerae gen. et sp. nov., holotype, INPA 33737." pageId="4" pageNumber="80">Fig. 1</figureCitation>
; vs. bifurcated. emarginate or round); and the platybasic skull, with the parasphenoid expanded and conjoined with the remainder of the neurocranium, forming the floor of the braincase (
<figureCitation id="136C2A14D950FFEC041C9092FBE1CFF8" box="[1037,1105,1512,1534]" captionStart="Figure 7" captionStartId="10.[163,241,1789,1811]" captionTargetBox="[165,1441,773,1748]" captionTargetId="figure-347@10.[163,1443,771,1750]" captionTargetPageId="10" captionText="Figure 7. Cranium of Tarumania walkerae, paratype, INPA 25747, 151.2-mm SL. (a) Dorsal view; (b) ventral view; (c) lateral view. Scale bar = 1 mm. ba, basioccipital; ep, epioccipital; ex, exoccipital; fr, frontal; le, lateral ethmoid; me, mesethmoid; os, orbitosphenoid; pa, parietal; par, parasphenoid; po, prootic; pt, pterotic; pts, pterosphenoid; so, supraoccipital; sph, sphenotic; vo, vomer." pageId="4" pageNumber="80">Fig. 7</figureCitation>
; vs. skull tropibasic). Other characters not necessarily unique to the taxon but still rare or unusual across a wide taxonomic array include: pelvic fins long and in the living fish deflectable 180 degrees anteriorly (
<figureCitation id="136C2A14D950FFEC04949318FB79CC72" box="[1157,1225,1634,1656]" captionStart="Figure 3" captionStartId="5.[145,223,1805,1827]" captionTargetBox="[385,1185,1396,1765]" captionTargetId="figure-63@5.[385,1185,1396,1765]" captionTargetPageId="5" captionText="Figure 3. Live specimen, juvenile, of Tarumania walkerae, paratype, MZUSP 120543, shortly after collection. Arrow shows pelvic fins in anteriorly deflected position." pageId="4" pageNumber="80">Fig. 3</figureCitation>
; arrow); a flexible neck that can bend the head at a right angle relative to the trunk; the infraorbital bone series reduced to single plate-like element lacking a sensory canal; the interopercle with a large semicircular notch along the dorsal margin (
<figureCitation id="136C2A14D950FFEC03FF9386FB9FCD14" box="[1006,1071,1788,1810]" captionStart="Figure 8" captionStartId="11.[145,225,1727,1749]" captionTargetBox="[145,759,1394,1686]" captionTargetId="figure-826@11.[145,763,1392,1688]" captionTargetPageId="11" captionText="Figure 8. Suspensorium, opercular apparatus and lower jaw of Tarumania walkerae, paratype, MZUSP 120544, 98.4- mm SL, medial view. Scale bar = 2 mm. ect, ectopterygoid; ent, entopterygoid; hyo, hyomandibula; iop, interopercle; lj, lower jaw; mpt, metapterygoid; op, opercle; pal, palatine; pop, preopercle; q, quadrate; sop, subopercle; sym, symplectic." pageId="4" pageNumber="80">Fig. 8</figureCitation>
); the presence of a single upper pharyngeal toothplate (corresponding to the posterior element in other characiforms) (
<figureCitation id="136C2A14D950FFEC04E49243FA88CD4B" box="[1269,1336,1849,1871]" captionStart="Figure 9" captionStartId="12.[162,241,956,978]" captionTargetBox="[405,1202,198,913]" captionTargetId="figure-443@12.[402,1202,196,917]" captionTargetPageId="12" captionText="Figure 9. Branchial arches of Tarumania walkerae, paratypes, dorsal views; (a) MZUSP 120544, 98.4-mm SL; (b) INPA 25747, 151.2-mm SL. (a) Ventral arches; (b) dorsal arches (gill filaments removed). Scale bars = 1 mm. acb, accessory element of ceratobranchial 4; bb14, basibranchials 14; bh, basihyal; cb15, ceratobranchials 15; epi14, epibranchials 14; hb13, hypobranchials 13; phb14, pharyngobranchials 14; po, paired ossifications of basihyal cartilage; tp, upper pharyngeal toothplate." pageId="4" pageNumber="80">Fig. 9</figureCitation>
); a large hypural-like bone located between haemal spines of second and third ural centra (
<figureCitation id="136C2A14D952FFEE021395BFFDE2CADF" box="[514,594,197,219]" captionStart="Figure 10" captionStartId="13.[145,223,1171,1193]" captionTargetBox="[140,766,343,1130]" captionTargetId="figure-396@13.[139,766,342,1131]" captionTargetPageId="13" captionText="Figure 10. Caudal skeleton of Tarumania walkerae, paratype, MZUSP 120543, 61.6-mm SL, lateral view. Scale bar = 1 mm. ahs, accessory haemal spine; cc, compound caudal centrum; ep, epural; fr, fin rays; hs, haemal spine; hy1n, hypural 1n; ns, neural spine; phy, parhypural; pu32, preural centra 3 and 2; ur, urostyle." pageId="6" pageNumber="82">Fig. 10</figureCitation>
). Other characters variably shared with a number of other clades but still useful to diagnose the taxon include the latero-sensory canal system mostly absent on the neurocranium and body but present in the nasal, dentary and preopercle; the teeth all unicuspidate, with two on each jaw hypertrophied and caniniform (
<figureCitation id="136C2A14D952FFEE028A9407FD51CB96" box="[667,737,381,403]" captionStart="Figure 5" captionStartId="7.[146,225,710,732]" captionTargetBox="[416,1184,195,670]" captionTargetId="figure-601@7.[385,1185,195,671]" captionTargetPageId="7" captionText="Figure 5. Tarumania walkerae, paratype, INPA 21603, lateral view of head showing reverse-imbricated scales. Specimen cleaned of superficial mucus." pageId="6" pageNumber="82">Figs 5</figureCitation>
,
<figureCitation id="136C2A14D952FFEE02FE9407FD4DCB97" box="[751,765,381,402]" captionStart="Figure 8" captionStartId="11.[145,225,1727,1749]" captionTargetBox="[145,759,1394,1686]" captionTargetId="figure-826@11.[145,763,1392,1688]" captionTargetPageId="11" captionText="Figure 8. Suspensorium, opercular apparatus and lower jaw of Tarumania walkerae, paratype, MZUSP 120544, 98.4- mm SL, medial view. Scale bar = 2 mm. ect, ectopterygoid; ent, entopterygoid; hyo, hyomandibula; iop, interopercle; lj, lower jaw; mpt, metapterygoid; op, opercle; pal, palatine; pop, preopercle; q, quadrate; sop, subopercle; sym, symplectic." pageId="6" pageNumber="82">8</figureCitation>
); the eyes very small and located on the anterior portion of the head (
<figureCitation id="136C2A14D952FFEE017394C0FE72CBD5" box="[354,450,442,464]" captionStart-0="Figure 1" captionStart-1="Figure 2" captionStart-2="Figure 3" captionStartId-0="5.[144,222,537,559]" captionStartId-1="5.[144,222,1316,1338]" captionStartId-2="5.[145,223,1805,1827]" captionTargetBox-0="[144,1424,195,497]" captionTargetBox-1="[500,1070,647,1277]" captionTargetBox-2="[385,1185,1396,1765]" captionTargetId-0="figure-27@5.[144,1424,195,497]" captionTargetId-1="figure-41@5.[471,1098,631,1277]" captionTargetId-2="figure-63@5.[385,1185,1396,1765]" captionTargetPageId-0="5" captionTargetPageId-1="5" captionTargetPageId-2="5" captionText-0="Figure 1. Tarumania walkerae gen. et sp. nov., holotype, INPA 33737." captionText-1="Figure 2. Tarumania walkerae gen. et sp. nov., holotype, INPA 33737. Dorsal (a) and ventral (b) views of head" captionText-2="Figure 3. Live specimen, juvenile, of Tarumania walkerae, paratype, MZUSP 120543, shortly after collection. Arrow shows pelvic fins in anteriorly deflected position." pageId="6" pageNumber="82">Figs 13</figureCitation>
); the external notochord and larval pectoral fin persistent, the former in specimens up to 50-mm SL and the latter up to 30-mm SL; the cranial fontanels closed (
<figureCitation id="136C2A14D952FFEE01C3976CFDA5C829" box="[466,533,534,556]" captionStart="Figure 7" captionStartId="10.[163,241,1789,1811]" captionTargetBox="[165,1441,773,1748]" captionTargetId="figure-347@10.[163,1443,771,1750]" captionTargetPageId="10" captionText="Figure 7. Cranium of Tarumania walkerae, paratype, INPA 25747, 151.2-mm SL. (a) Dorsal view; (b) ventral view; (c) lateral view. Scale bar = 1 mm. ba, basioccipital; ep, epioccipital; ex, exoccipital; fr, frontal; le, lateral ethmoid; me, mesethmoid; os, orbitosphenoid; pa, parietal; par, parasphenoid; po, prootic; pt, pterotic; pts, pterosphenoid; so, supraoccipital; sph, sphenotic; vo, vomer." pageId="6" pageNumber="82">Fig. 7</figureCitation>
); the central part of the frontals and parietals elevated and exposed on the surface of the head in large specimens, forming an ornamented platform (
<figureCitation id="136C2A14D952FFEE01CB9708FDADC88D" box="[474,541,626,648]" captionStart="Figure 7" captionStartId="10.[163,241,1789,1811]" captionTargetBox="[165,1441,773,1748]" captionTargetId="figure-347@10.[163,1443,771,1750]" captionTargetPageId="10" captionText="Figure 7. Cranium of Tarumania walkerae, paratype, INPA 25747, 151.2-mm SL. (a) Dorsal view; (b) ventral view; (c) lateral view. Scale bar = 1 mm. ba, basioccipital; ep, epioccipital; ex, exoccipital; fr, frontal; le, lateral ethmoid; me, mesethmoid; os, orbitosphenoid; pa, parietal; par, parasphenoid; po, prootic; pt, pterotic; pts, pterosphenoid; so, supraoccipital; sph, sphenotic; vo, vomer." pageId="6" pageNumber="82">Fig. 7</figureCitation>
); the post-temporal fossae absent (
<figureCitation id="136C2A14D952FFEE014297EBFE26C8A2" box="[339,406,657,679]" captionStart="Figure 7" captionStartId="10.[163,241,1789,1811]" captionTargetBox="[165,1441,773,1748]" captionTargetId="figure-347@10.[163,1443,771,1750]" captionTargetPageId="10" captionText="Figure 7. Cranium of Tarumania walkerae, paratype, INPA 25747, 151.2-mm SL. (a) Dorsal view; (b) ventral view; (c) lateral view. Scale bar = 1 mm. ba, basioccipital; ep, epioccipital; ex, exoccipital; fr, frontal; le, lateral ethmoid; me, mesethmoid; os, orbitosphenoid; pa, parietal; par, parasphenoid; po, prootic; pt, pterotic; pts, pterosphenoid; so, supraoccipital; sph, sphenotic; vo, vomer." pageId="6" pageNumber="82">Fig. 7</figureCitation>
); the intercalar absent (
<figureCitation id="136C2A14D952FFEE02A897EBFD4CC8A2" box="[697,764,657,679]" captionStart="Figure 7" captionStartId="10.[163,241,1789,1811]" captionTargetBox="[165,1441,773,1748]" captionTargetId="figure-347@10.[163,1443,771,1750]" captionTargetPageId="10" captionText="Figure 7. Cranium of Tarumania walkerae, paratype, INPA 25747, 151.2-mm SL. (a) Dorsal view; (b) ventral view; (c) lateral view. Scale bar = 1 mm. ba, basioccipital; ep, epioccipital; ex, exoccipital; fr, frontal; le, lateral ethmoid; me, mesethmoid; os, orbitosphenoid; pa, parietal; par, parasphenoid; po, prootic; pt, pterotic; pts, pterosphenoid; so, supraoccipital; sph, sphenotic; vo, vomer." pageId="6" pageNumber="82">Fig. 7</figureCitation>
); the frontals expanded laterally, forming shelves along the anterior half of the skull (
<figureCitation id="136C2A14D952FFEE01ED97B4FD8CC8E1" box="[508,572,718,740]" captionStart="Figure 7" captionStartId="10.[163,241,1789,1811]" captionTargetBox="[165,1441,773,1748]" captionTargetId="figure-347@10.[163,1443,771,1750]" captionTargetPageId="10" captionText="Figure 7. Cranium of Tarumania walkerae, paratype, INPA 25747, 151.2-mm SL. (a) Dorsal view; (b) ventral view; (c) lateral view. Scale bar = 1 mm. ba, basioccipital; ep, epioccipital; ex, exoccipital; fr, frontal; le, lateral ethmoid; me, mesethmoid; os, orbitosphenoid; pa, parietal; par, parasphenoid; po, prootic; pt, pterotic; pts, pterosphenoid; so, supraoccipital; sph, sphenotic; vo, vomer." pageId="6" pageNumber="82">Fig. 7</figureCitation>
); the mesethmoid anteriorly expanded (
<figureCitation id="136C2A14D952FFEE01BF9797FE43C906" box="[430,499,749,771]" captionStart="Figure 7" captionStartId="10.[163,241,1789,1811]" captionTargetBox="[165,1441,773,1748]" captionTargetId="figure-347@10.[163,1443,771,1750]" captionTargetPageId="10" captionText="Figure 7. Cranium of Tarumania walkerae, paratype, INPA 25747, 151.2-mm SL. (a) Dorsal view; (b) ventral view; (c) lateral view. Scale bar = 1 mm. ba, basioccipital; ep, epioccipital; ex, exoccipital; fr, frontal; le, lateral ethmoid; me, mesethmoid; os, orbitosphenoid; pa, parietal; par, parasphenoid; po, prootic; pt, pterotic; pts, pterosphenoid; so, supraoccipital; sph, sphenotic; vo, vomer." pageId="6" pageNumber="82">Fig. 7</figureCitation>
); the quadrate-metapterygoid foramen absent or not differentiated (
<figureCitation id="136C2A14D952FFEE02CF9676FF01C945" captionStart="Figure 8" captionStartId="11.[145,225,1727,1749]" captionTargetBox="[145,759,1394,1686]" captionTargetId="figure-826@11.[145,763,1392,1688]" captionTargetPageId="11" captionText="Figure 8. Suspensorium, opercular apparatus and lower jaw of Tarumania walkerae, paratype, MZUSP 120544, 98.4- mm SL, medial view. Scale bar = 2 mm. ect, ectopterygoid; ent, entopterygoid; hyo, hyomandibula; iop, interopercle; lj, lower jaw; mpt, metapterygoid; op, opercle; pal, palatine; pop, preopercle; q, quadrate; sop, subopercle; sym, symplectic." pageId="6" pageNumber="82">Fig. 8</figureCitation>
); the postcleithra and suprapreopercle absent; the supraoccipital spine deeply sunk in the anterior trunk musculature.
</paragraph>
<caption id="DF286619D951FFED00819763FC12C82A" box="[144,930,537,559]" pageId="5" pageNumber="81" startId="5.[144,222,537,559]" targetBox="[144,1424,195,497]" targetPageId="5" targetType="figure">
<paragraph id="8BE83691D951FFED00819763FC12C82A" blockId="5.[144,930,537,559]" box="[144,930,537,559]" pageId="5" pageNumber="81">
<emphasis id="B923EA83D951FFED00819763FD1BC82B" bold="true" box="[144,683,537,559]" pageId="5" pageNumber="81">
Figure 1.
<taxonomicName id="4C574D12D951FFED01129763FE4BC82A" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[259,507,537,559]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="5" pageNumber="81" phylum="Chordata" rank="species" species="walkerae" status="gen. et sp. nov.">
<emphasis id="B923EA83D951FFED01129763FE4BC82A" bold="true" box="[259,507,537,559]" italics="true" pageId="5" pageNumber="81">Tarumania walkerae</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A21057F8D951FFED02109763FD1BC82B" box="[513,683,537,558]" pageId="5" pageNumber="81" rank="species">gen. et sp. nov.</taxonomicNameLabel>
</emphasis>
, holotype, INPA 33737.
</paragraph>
</caption>
<caption id="DF286619D951FFED0081905EFAF3CF3F" box="[144,1347,1316,1338]" pageId="5" pageNumber="81" startId="5.[144,222,1316,1338]" targetBox="[500,1070,647,1277]" targetPageId="5" targetType="figure">
<paragraph id="8BE83691D951FFED0081905EFAF3CF3F" blockId="5.[144,1347,1316,1338]" box="[144,1347,1316,1338]" pageId="5" pageNumber="81">
<emphasis id="B923EA83D951FFED0081905EFD1BCF3C" bold="true" box="[144,683,1316,1338]" pageId="5" pageNumber="81">
Figure 2.
<taxonomicName id="4C574D12D951FFED0112905EFE4BCF3F" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[259,507,1316,1338]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="5" pageNumber="81" phylum="Chordata" rank="species" species="walkerae" status="gen. et sp. nov.">
<emphasis id="B923EA83D951FFED0112905EFE4BCF3F" bold="true" box="[259,507,1316,1338]" italics="true" pageId="5" pageNumber="81">Tarumania walkerae</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A21057F8D951FFED0210905EFD1BCF3C" box="[513,683,1316,1337]" pageId="5" pageNumber="81" rank="species">gen. et sp. nov.</taxonomicNameLabel>
</emphasis>
, holotype, INPA 33737. Dorsal (a) and ventral (b) views of head
</paragraph>
</caption>
<caption id="DF286619D951FFED00809277FDFACD44" pageId="5" pageNumber="81" startId="5.[145,223,1805,1827]" targetBox="[385,1185,1396,1765]" targetPageId="5" targetType="figure">
<paragraph id="8BE83691D951FFED00809277FDFACD44" blockId="5.[145,1425,1805,1857]" pageId="5" pageNumber="81">
<emphasis id="B923EA83D951FFED00809277FF48CD27" bold="true" box="[145,248,1805,1827]" pageId="5" pageNumber="81">Figure 3.</emphasis>
Live specimen, juvenile, of
<taxonomicName id="4C574D12D951FFED020B9277FD44CD26" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[538,756,1805,1827]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="5" pageNumber="81" phylum="Chordata" rank="species" species="walkerae">
<emphasis id="B923EA83D951FFED020B9277FD44CD26" box="[538,756,1805,1827]" italics="true" pageId="5" pageNumber="81">Tarumania walkerae</emphasis>
</taxonomicName>
, paratype, MZUSP 120543, shortly after collection. Arrow shows pelvic fins in anteriorly deflected position.
</paragraph>
</caption>
<paragraph id="8BE83691D952FFEE00B296E6FB0BC86C" blockId="6.[163,779,924,1467]" lastBlockId="6.[827,1443,197,617]" pageId="6" pageNumber="82">
<emphasis id="B923EA83D952FFEE00B296E6FEA0C9B4" box="[163,272,924,945]" italics="true" pageId="6" pageNumber="82">Remarks:</emphasis>
As shown below, our investigation into the phylogenetic position of the new taxon concludes that it is the sister group to the family
<taxonomicName id="4C574D12D952FFEE025696A3FD55C9EA" baseAuthorityName="Vari" baseAuthorityYear="1995" box="[583,741,985,1007]" family="Erythrinidae" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="family">Erythrinidae</taxonomicName>
. In purely nomenclatural terms, such positioning is compatible either with an expansion of the latter family or with the erection of a new family. Both choices result in exclusively monophyletic named taxa and therefore conform to the principles of phylogenetic classification. Given such flexibility, our choice for a new family rests on considerations additional to criteria of monophyly. First, the inclusion of
<taxonomicName id="4C574D12D952FFEE029991B5FCBBCEE1" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[648,779,1231,1252]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="genus">
<emphasis id="B923EA83D952FFEE029991B5FCBBCEE1" box="[648,779,1231,1252]" italics="true" pageId="6" pageNumber="82">Tarumania</emphasis>
</taxonomicName>
in
<taxonomicName id="4C574D12D952FFEE00D29197FEEECF06" baseAuthorityName="Vari" baseAuthorityYear="1995" box="[195,350,1261,1283]" family="Erythrinidae" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="family">Erythrinidae</taxonomicName>
would result in profound modifications of the composition and range of morphological and biological variation seen in that family, which has been stable for more than a century. This would create information-retrieval problems with a vast amount of data in previous literature. Second, most of the traditionally recognized diagnostic characters in
<taxonomicName id="4C574D12D952FFEE034A95BFFC45CADE" baseAuthorityName="Vari" baseAuthorityYear="1995" box="[859,1013,197,219]" family="Erythrinidae" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="family">Erythrinidae</taxonomicName>
are not present in
<taxonomicName id="4C574D12D952FFEE04CF95BCFAD3CADE" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[1246,1379,198,219]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="genus">
<emphasis id="B923EA83D952FFEE04CF95BCFAD3CADE" box="[1246,1379,198,219]" italics="true" pageId="6" pageNumber="82">Tarumania</emphasis>
</taxonomicName>
, rendering such familial allocation difficult to integrate with established taxonomic practice. Finally, the large phenotypic distance between
<taxonomicName id="4C574D12D952FFEE04839458FAA5CB32" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[1170,1301,290,311]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="genus">
<emphasis id="B923EA83D952FFEE04839458FAA5CB32" box="[1170,1301,290,311]" italics="true" pageId="6" pageNumber="82">Tarumania</emphasis>
</taxonomicName>
and species of
<taxonomicName id="4C574D12D952FFEE034B943AFC47CB53" baseAuthorityName="Vari" baseAuthorityYear="1995" box="[858,1015,320,342]" family="Erythrinidae" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="family">Erythrinidae</taxonomicName>
meets or exceeds that seen among characiform families in general, making a separate family for the genus a solution fitting the established classification of the order. Inclusion of
<taxonomicName id="4C574D12D952FFEE04FF94E6FADFCBB4" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[1262,1391,412,433]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="genus">
<emphasis id="B923EA83D952FFEE04FF94E6FADFCBB4" box="[1262,1391,412,433]" italics="true" pageId="6" pageNumber="82">Tarumania</emphasis>
</taxonomicName>
into an expanded
<taxonomicName id="4C574D12D952FFEE03C094C0FBD5CBD5" baseAuthorityName="Vari" baseAuthorityYear="1995" box="[977,1125,442,464]" family="Erythrinidae" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="family">Erythrinidae</taxonomicName>
is clearly a less satisfactory solution and one that would incur more disturbance than necessary in the classification of characiforms. Recognition of a separate family more closely reflects the biological reality of the entities involved and better promotes nomenclatural stability.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,424 @@
<document id="85A976DF1303CFB2384EE2CAC1FAC568" ID-ISSN="0024-4082" ID-ZooBank="D3A2334-44D3-4ADA-AAC6-1130F3D7FD22" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779536232" checkinUser="plazi" docAuthor="Pinna, Mário De, Zuanon, Jansen, Py-Daniel, Lucia Rapp &amp; Petry, Paulo" docDate="2018" docId="03FE8787D952FFE103A096A0FE95CEA8" docLanguage="en" docName="zlx028.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Tarumania walkerae Pinna, Zuanon, Py-Daniel &amp; Petry, 2018, SP. NOV." docType="treatment" docVersion="1" lastPageNumber="85" masterDocId="FFC7FFFFD954FFE80011957AFFB0CA05" masterDocTitle="A new family of neotropical freshwater fishes from deep fossorial Amazonian habitat, with a reappraisal of morphological characiform phylogeny (Teleostei: Ostariophysi)" masterLastPageNumber="106" masterPageNumber="76" pageNumber="82" updateTime="1738779691674" updateUser="GgImagineBatch">
<mods:mods id="2807884F03331105DCD137BD52420DB3" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="00E685ECA9EFDE50DE157A7B4CCC51EF">
<mods:title id="D1FEEABDACCD1F41C2E358F1B185D012">A new family of neotropical freshwater fishes from deep fossorial Amazonian habitat, with a reappraisal of morphological characiform phylogeny (Teleostei: Ostariophysi)</mods:title>
</mods:titleInfo>
<mods:name id="6E76AB446E2108F396544567CB1EF047" type="personal">
<mods:role id="4610D43FC1AE0F255B67242CA0885E64">
<mods:roleTerm id="F697812BD9464E9ED555A3690B0C83AE">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="DA3BECEA3917FEF81BD2839B42626028">Pinna, Mário De</mods:namePart>
</mods:name>
<mods:name id="F4C7892C009A4E4551DFA584C16B9B12" type="personal">
<mods:role id="34D53B7ABA5E25325CE0C8825F524259">
<mods:roleTerm id="B975190C3234B6AEA91482985A461916">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="AFE03CCC86626A38DFA921A8DA0F856F">Zuanon, Jansen</mods:namePart>
</mods:name>
<mods:name id="68329D19C5ECA44BF201D3AB22302659" type="personal">
<mods:role id="734E1946F31C2C9E04EBA9D1445BDA2E">
<mods:roleTerm id="F74D50DD2ED0762195DFC8E7A5638703">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="EB3B391B2640D8EFAB875F6D0FF64633">Py-Daniel, Lucia Rapp</mods:namePart>
</mods:name>
<mods:name id="95E7CF3B9A35E2AD0212C83061C2AC96" type="personal">
<mods:role id="7F19B877FBF53DF4EB36965F18E0C946">
<mods:roleTerm id="FD781AE8A95155D208CD2662289C1D02">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="AED67C8F469BC680206DB4F185F03C73">Petry, Paulo</mods:namePart>
</mods:name>
<mods:typeOfResource id="73D1004F1273E0C70579EC34CD5507FE">text</mods:typeOfResource>
<mods:relatedItem id="FAEAEA91D4AD01C6FE7A4CE63CBD63E0" type="host">
<mods:titleInfo id="8283F1D536C9450B19C7D7BFFDD523A7">
<mods:title id="3C66817EE9AF232C9CCEE1B165E06C6F">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="A8C9BF83F9BAE35C18770BA661D4295A">
<mods:date id="51EFD7E5173662A3B483ECD6BE844E22">2018</mods:date>
<mods:detail id="8CDBCB1066DC97B4F2D71CE65DF88BDF" type="volume">
<mods:number id="46B0BE80A30166898313F163B44ECC3D">182</mods:number>
</mods:detail>
<mods:extent id="71BA9956F370CB47BDF0704717BF3FCE" unit="page">
<mods:start id="583E88B9E7282007073DAF9A88980C34">76</mods:start>
<mods:end id="F674E225687F4588A46F1870974EAF40">106</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="8073BC10595BC2F68D2AC9B6F7FFFC58">journal article</mods:classification>
<mods:identifier id="63D07F7DC28485305A37A5A7240031B7" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="683CA767263DC24CBEBA6AD82347034B" type="ZooBank">D3A2334-44D3-4ADA-AAC6-1130F3D7FD22</mods:identifier>
</mods:mods>
<treatment id="03FE8787D952FFE103A096A0FE95CEA8" LSID="urn:lsid:plazi:treatment:03FE8787D952FFE103A096A0FE95CEA8" httpUri="http://treatment.plazi.org/id/03FE8787D952FFE103A096A0FE95CEA8" lastPageId="9" lastPageNumber="85" pageId="6" pageNumber="82">
<subSubSection id="C34D651AD952FFEE03A096A0FA9CC9F7" box="[945,1324,986,1010]" pageId="6" pageNumber="82" type="nomenclature">
<paragraph id="8BE83691D952FFEE03A096A0FA9CC9F7" blockId="6.[945,1324,986,1010]" box="[945,1324,986,1010]" pageId="6" pageNumber="82">
<heading id="D0A081FDD952FFEE03A096A0FA9CC9F7" box="[945,1324,986,1010]" centered="true" fontSize="9" level="2" pageId="6" pageNumber="82" reason="2">
<taxonomicName id="4C574D12D952FFEE03A096A0FB72C9F4" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[945,1218,986,1009]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="species" species="walkerae" status="sp. nov.">
<smallCapsWord id="8D0EA04DD952FFEE03A096A0FB8EC9F4" baselines="1003,1004" box="[945,1086,986,1009]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Tarumania" pageId="6" pageNumber="82">TARUMANIA</smallCapsWord>
<smallCapsWord id="8D0EA04DD952FFEE045796A4FB72C9F4" baselines="1004" box="[1094,1218,990,1009]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="walkerae" pageId="6" pageNumber="82">WALKERAE</smallCapsWord>
</taxonomicName>
<emphasis id="B923EA83D952FFEE04D896A7FA9CC9F7" bold="true" box="[1225,1324,986,1010]" pageId="6" pageNumber="82">
<taxonomicNameLabel id="A21057F8D952FFEE04D896A7FA9CC9F7" box="[1225,1324,986,1010]" pageId="6" pageNumber="82" rank="species">
<smallCapsWord id="8D0EA04DD952FFEE04D896A7FB56C9F5" baselines="1003" box="[1225,1254,989,1008]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="sp" pageId="6" pageNumber="82">SP</smallCapsWord>
.
<smallCapsWord id="8D0EA04DD952FFEE04E596A7FA95C9F5" baselines="1003" box="[1268,1317,989,1008]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="nov" pageId="6" pageNumber="82">NOV</smallCapsWord>
.
</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C34D651AD952FFE10422917BFE95CEA8" lastPageId="9" lastPageNumber="85" pageId="6" pageNumber="82" type="description">
<paragraph id="8BE83691D952FFEE0422917BFB1ACE1F" blockId="6.[1075,1194,1025,1050]" box="[1075,1194,1025,1050]" pageId="6" pageNumber="82">
[
<figureCitation id="136C2A14D952FFEE042A917BFB12CE1F" box="[1083,1186,1025,1050]" captionStart-0="Figure 1" captionStart-1="Figure 2" captionStart-2="Figure 3" captionStartId-0="5.[144,222,537,559]" captionStartId-1="5.[144,222,1316,1338]" captionStartId-2="5.[145,223,1805,1827]" captionTargetBox-0="[144,1424,195,497]" captionTargetBox-1="[500,1070,647,1277]" captionTargetBox-2="[385,1185,1396,1765]" captionTargetId-0="figure-27@5.[144,1424,195,497]" captionTargetId-1="figure-41@5.[471,1098,631,1277]" captionTargetId-2="figure-63@5.[385,1185,1396,1765]" captionTargetPageId-0="5" captionTargetPageId-1="5" captionTargetPageId-2="5" captionText-0="Figure 1. Tarumania walkerae gen. et sp. nov., holotype, INPA 33737." captionText-1="Figure 2. Tarumania walkerae gen. et sp. nov., holotype, INPA 33737. Dorsal (a) and ventral (b) views of head" captionText-2="Figure 3. Live specimen, juvenile, of Tarumania walkerae, paratype, MZUSP 120543, shortly after collection. Arrow shows pelvic fins in anteriorly deflected position." pageId="6" pageNumber="82">
<smallCapsWord id="8D0EA04DD952FFEE042A917BFBC1CE1D" baselines="1044,1043" box="[1083,1137,1025,1050]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Figs" pageId="6" pageNumber="82">FIGS</smallCapsWord>
13
</figureCitation>
]
</paragraph>
<paragraph id="8BE83691D952FFEE032A9144FB16CECA" blockId="6.[827,1442,1086,1231]" pageId="6" pageNumber="82">
<materialsCitation id="3B3F3CCCD952FFEE032A9144FB16CECA" collectingDate="2006-09-02" collectionCode="INPA" collectorName="L. Rapp Py-Daniel &amp; Rapp Py-Daniel, J &amp; M. de Pinna" country="Brazil" county="Manaus" latitude="-2.90965" location="Igarape Taruma-Mirim" longLatPrecision="1" longitude="-60.22915" municipality="Rio Negro" pageId="6" pageNumber="82" specimenCode="INPA 33737, 81.6" specimenCount="1" stateProvince="Amazonas" typeStatus="holotype">
<emphasis id="B923EA83D952FFEE032A9144FC1BCE56" box="[827,939,1086,1107]" italics="true" pageId="6" pageNumber="82">
<typeStatus id="54EC8833D952FFEE032A9144FC15CE56" box="[827,933,1086,1107]" pageId="6" pageNumber="82" type="holotype">Holotype</typeStatus>
:
</emphasis>
<specimenCode id="DBF19EEAD952FFEE03A49145FBFACE51" box="[949,1098,1087,1108]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="6" pageNumber="82">INPA 33737</specimenCode>
,
<specimenCode id="DBF19EEAD952FFEE04469144FB39CE51" box="[1111,1161,1086,1108]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="6" pageNumber="82">81.6</specimenCode>
-mm SL, marginal pool of
<location id="8E88604AD952FFEE03489127FBC0CE76" LSID="urn:lsid:plazi:treatment:03FE8787D952FFE103A096A0FE95CEA8:8E88604AD952FFEE03489127FBC0CE76" box="[857,1136,1117,1139]" country="Brazil" county="Manaus" latitude="-2.90965" longLatPrecision="1" longitude="-60.22915" municipality="Rio Negro" name="Igarape Taruma-Mirim" pageId="6" pageNumber="82" stateProvince="Amazonas">Igarapé Tarumã-Mirim</location>
(tributary to
<collectingMunicipality id="6B8CACEBD952FFEE050A9127FA26CE77" box="[1307,1430,1117,1139]" pageId="6" pageNumber="82">Rio Negro</collectingMunicipality>
),
<collectingRegion id="4993F873D952FFEE032A9106FBA6CE94" box="[827,1046,1148,1169]" country="Brazil" name="Amazonas" pageId="6" pageNumber="82">Amazonas State</collectingRegion>
,
<collectingCounty id="62894E1DD952FFEE04389106FB21CE94" box="[1065,1169,1148,1169]" pageId="6" pageNumber="82">Manaus</collectingCounty>
,
<collectingCountry id="F3407601D952FFEE04B79106FB47CE97" box="[1190,1271,1148,1170]" name="Brazil" pageId="6" pageNumber="82">Brazil</collectingCountry>
(
<geoCoordinate id="EE635056D952FFEE051E9106FA10CE94" box="[1295,1440,1148,1170]" degrees="02. 90965" direction="south" orientation="latitude" pageId="6" pageNumber="82" precision="1" value="-2.90965">02.90965°S</geoCoordinate>
<geoCoordinate id="EE635056D952FFEE032A91E0FC7ACEB5" box="[827,970,1178,1200]" degrees="60.22915" direction="west" orientation="longitude" pageId="6" pageNumber="82" precision="1" value="-60.22915">60.22915°W</geoCoordinate>
), coll.
<collectorName id="26A25347D952FFEE040491E1FB40CEB5" box="[1045,1264,1178,1200]" pageId="6" pageNumber="82">L. Rapp Py-Daniel</collectorName>
, J. Zuanon and
<collectorName id="26A25347D952FFEE032A91C0FC76CECA" box="[827,966,1209,1231]" pageId="6" pageNumber="82">M. de Pinna</collectorName>
,
<date id="FFE91051D952FFEE03C091C3FB11CECA" box="[977,1185,1209,1231]" pageId="6" pageNumber="82" value="2006-09-02">
<collectingDate id="EFADE9B9D952FFEE03C091C3FB11CECA" box="[977,1185,1209,1231]" pageId="6" pageNumber="82" value="2006-09-02">2 September 2006</collectingDate>
</date>
.
</materialsCitation>
</paragraph>
<paragraph id="8BE83691D952FFEF032A9194FEF3CC54" blockId="6.[827,1443,1261,1467]" lastBlockId="7.[145,762,798,1617]" lastPageId="7" lastPageNumber="83" pageId="6" pageNumber="82">
<materialsCitation id="3B3F3CCCD952FFEE032A9194FC42CF45" collectionCode="INPA" collectorName="State" country="Brazil" location="Igarape Taruma-Mirim" municipality="Igarape do Camarao" pageId="6" pageNumber="82" specimenCode="INPA 16563, 1" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
<emphasis id="B923EA83D952FFEE032A9194FAEBCF07" box="[827,1371,1261,1283]" italics="true" pageId="6" pageNumber="82">
<typeStatus id="54EC8833D952FFEE032A9194FC1CCF06" box="[827,940,1262,1283]" pageId="6" pageNumber="82" type="paratype">Paratypes</typeStatus>
(all from
<collectingCountry id="F3407601D952FFEE04319197FBDACF07" box="[1056,1130,1261,1282]" name="Brazil" pageId="6" pageNumber="82">Brazil</collectingCountry>
,
<collectorName id="26A25347D952FFEE04679197FB02CF07" box="[1142,1202,1261,1282]" pageId="6" pageNumber="82">State</collectorName>
of
<collectingRegion id="4993F873D952FFEE04C49197FAFDCF07" box="[1237,1357,1261,1282]" country="Brazil" name="Amazonas" pageId="6" pageNumber="82">Amazonas</collectingRegion>
):
</emphasis>
<specimenCode id="DBF19EEAD952FFEE05729197FC31CF27" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="6" pageNumber="82">INPA 16563</specimenCode>
,
<specimenCode id="DBF19EEAD952FFEE039A9076FC29CF24" box="[907,921,1292,1313]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="6" pageNumber="82">1</specimenCode>
ex,
<emphasis id="B923EA83D952FFEE03D29076FC7ECF24" box="[963,974,1292,1313]" italics="true" pageId="6" pageNumber="82">c</emphasis>
. 23-mm SL,
<collectingMunicipality id="6B8CACEBD952FFEE044B9076FAF1CF24" box="[1114,1345,1292,1314]" pageId="6" pageNumber="82">Igarapé do Camarão</collectingMunicipality>
,
<location id="8E88604AD952FFEE055A9076FC42CF45" LSID="urn:lsid:plazi:treatment:03FE8787D952FFE103A096A0FE95CEA8:8E88604AD952FFEE055A9076FC42CF45" country="Brazil" municipality="Igarape do Camarao" name="Igarape Taruma-Mirim" pageId="6" pageNumber="82" stateProvince="Amazonas">Igarapé Tarumã-Mirim</location>
</materialsCitation>
,
<materialsCitation id="3B3F3CCCD952FFEE04119050FC1ECFBE" collectingDate="1999-01-28" collectionCode="INPA" collectorName="Ilse Walker &amp; Parque Nacional das Anavilhanas" country="Brazil" county="Rio Negro" latitude="-2.72" location="Novo Airao" longLatPrecision="784" longitude="-60.75" municipality="Lago do Prato" pageId="6" pageNumber="82" specimenCode="INPA 25747" specimenCount="3" stateProvince="Amazonas" typeStatus="paratype">
col.
<collectorName id="26A25347D952FFEE04239050FB0FCF45" box="[1074,1215,1322,1344]" pageId="6" pageNumber="82">Ilse Walker</collectorName>
,
<date id="FFE91051D952FFEE04DC9051FA2DCF45" box="[1229,1437,1323,1344]" pageId="6" pageNumber="82" value="1999-01-28">
<collectingDate id="EFADE9B9D952FFEE04DC9051FA2DCF45" box="[1229,1437,1323,1344]" pageId="6" pageNumber="82" value="1999-01-28">28 January 1999</collectingDate>
</date>
;
<specimenCode id="DBF19EEAD952FFEE032A9033FC7BCF5A" box="[827,971,1353,1375]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="6" pageNumber="82">INPA 25747</specimenCode>
,
<specimenCount id="9D51FD18D952FFEE03C69033FBD5CF5A" box="[983,1125,1353,1375]" count="3" pageId="6" pageNumber="82" type="generic">3 specimens</specimenCount>
(1 c&amp;s), 87.3- to 151.2-mm SL,
<collectingCounty id="62894E1DD952FFEE037B9012FC51CF78" box="[874,993,1384,1406]" pageId="6" pageNumber="82">Rio Negro</collectingCounty>
at
<collectorName id="26A25347D952FFEE041B9012FA2ECF7B" box="[1034,1438,1384,1406]" pageId="6" pageNumber="82">Parque Nacional das Anavilhanas</collectorName>
, paraná do
<collectingMunicipality id="6B8CACEBD952FFEE03D690FDFBCECF99" box="[967,1150,1414,1436]" pageId="6" pageNumber="82">Lago do Prato</collectingMunicipality>
,
<location id="8E88604AD952FFEE049E90FDFAADCF99" LSID="urn:lsid:plazi:treatment:03FE8787D952FFE103A096A0FE95CEA8:8E88604AD952FFEE049E90FDFAADCF99" box="[1167,1309,1414,1436]" country="Brazil" county="Rio Negro" latitude="-2.72" longLatPrecision="784" longitude="-60.75" municipality="Lago do Prato" name="Novo Airao" pageId="6" pageNumber="82" stateProvince="Amazonas">Novo Airão</location>
(~
<geoCoordinate id="EE635056D952FFEE055090FDFA12CF99" box="[1345,1442,1415,1436]" degrees="02.72" direction="south" orientation="latitude" pageId="6" pageNumber="82" precision="555" value="-2.72">02.72°S</geoCoordinate>
<geoCoordinate id="EE635056D952FFEE032A90DFFC16CFBE" box="[827,934,1445,1467]" degrees="60.75" direction="west" orientation="longitude" pageId="6" pageNumber="82" precision="555" value="-60.75">60.75°W</geoCoordinate>
)
</materialsCitation>
,
<materialsCitation id="3B3F3CCCD952FFEF03AF90DFFF74C957" collectingDate="2001-08-22" collectionCode="INPA" collectorName="J. Zuanon" country="Brazil" county="Manaus" lastPageId="7" lastPageNumber="83" latitude="-2.90965" location="Igarape Taruma-Mirim" longLatPrecision="1" longitude="-60.22915" municipality="Rio Negro" pageId="6" pageNumber="82" specimenCode="INPA 26241, 3" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
coll.
<collectorName id="26A25347D952FFEE03EA90DCFBC8CFBE" box="[1019,1144,1446,1467]" pageId="6" pageNumber="82">J. Zuanon</collectorName>
,
<date id="FFE91051D952FFEE049990DFFAE0CFBF" box="[1160,1360,1445,1466]" pageId="6" pageNumber="82" value="2001-08-22">
<collectingDate id="EFADE9B9D952FFEE049990DFFAE0CFBF" box="[1160,1360,1445,1466]" pageId="6" pageNumber="82" value="2001-08-22">22 August 2001</collectingDate>
</date>
;
<specimenCode id="DBF19EEAD952FFEF057190DFFF69C931" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" lastPageId="7" lastPageNumber="83" name="Instituto Nacional de Pesquisas da Amazonia" pageId="6" pageNumber="82">INPA 26241</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF00F49664FF43C936" box="[229,243,798,819]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="82">3</specimenCode>
ex, 44.9- to 51.2-mm SL, same data as holotype
</materialsCitation>
,
<materialsCitation id="3B3F3CCCD953FFEF00DF9646FF45C995" collectingDate="2006-09-02" collectionCode="INPA" collectorName="L. Rapp Py-Daniel &amp; Rapp Py-Daniel, J &amp; M. de Pinna" country="Brazil" county="Manaus" latitude="-2.9083" location="Igarape Taruma-Mirim" longLatPrecision="1" longitude="-60.22873" municipality="Rio Negro" pageId="7" pageNumber="83" specimenCode="INPA 26245, 11" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
but at
<geoCoordinate id="EE635056D953FFEF01069647FE3AC957" box="[279,394,829,850]" degrees="2.90830" direction="south" orientation="latitude" pageId="7" pageNumber="83" precision="1" value="-2.9083">2.90830°S</geoCoordinate>
<geoCoordinate id="EE635056D953FFEF01819646FDA8C957" box="[400,536,828,850]" degrees="60.22873" direction="west" orientation="longitude" pageId="7" pageNumber="83" precision="1" value="-60.22873">60.22873°W</geoCoordinate>
;
<specimenCode id="DBF19EEAD953FFEF02339647FD1DC957" box="[546,685,828,850]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">INPA 26245</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF02A99647FD63C957" box="[696,723,829,850]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">11</specimenCode>
ex, 38.4- to 61.5-mm SL (56.3562.02 mm), collected with holotype
</materialsCitation>
;
<materialsCitation id="3B3F3CCCD953FFEF01109600FECFC9AB" collectingDate="2006-09-02" collectionCode="INPA" collectorName="L. Rapp Py-Daniel &amp; Rapp Py-Daniel, J &amp; M. de Pinna" country="Brazil" county="Manaus" latitude="-2.90965" location="Igarape Taruma-Mirim" longLatPrecision="1" longitude="-60.22915" municipality="Rio Negro" pageId="7" pageNumber="83" specimenCode="INPA 26246, 2" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
<specimenCode id="DBF19EEAD953FFEF01109600FE3FC995" box="[257,399,890,912]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">INPA 26246</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF018A9600FE19C98A" box="[411,425,890,911]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">2</specimenCode>
ex, 44.7- to 45.2-mm SL, collected with holotype
</materialsCitation>
;
<materialsCitation id="3B3F3CCCD953FFEF019A96E3FE2CC9C8" collectingDate="2006-09-02" collectionCode="INPA" collectorName="L. Rapp Py-Daniel &amp; Rapp Py-Daniel, J &amp; M. de Pinna" country="Brazil" county="Manaus" latitude="-2.90965" location="Igarape Taruma-Mirim" longLatPrecision="1" longitude="-60.22915" municipality="Rio Negro" pageId="7" pageNumber="83" specimenCode="INPA 26248, 1" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
<specimenCode id="DBF19EEAD953FFEF019A96E3FDABC9AB" box="[395,539,920,942]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">INPA 26248</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF023696E3FD85C9AB" box="[551,565,921,942]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">1</specimenCode>
ex, 63.5-mm SL, same data as holotype
</materialsCitation>
,
<materialsCitation id="3B3F3CCCD953FFEF01B896CDFEA9CE0F" collectingDate="2006-09-02" collectionCode="INPA" collectorName="L. Rapp Py-Daniel &amp; Rapp Py-Daniel, J &amp; M. de Pinna" country="Brazil" county="Manaus" latitude="-2.89637" location="Igarape Taruma-Mirim" longLatPrecision="1" longitude="-60.22833" municipality="Rio Negro" pageId="7" pageNumber="83" specimenCode="INPA 33733, 3" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
but
<geoCoordinate id="EE635056D953FFEF01CB96CDFDEFC9C8" box="[474,607,951,973]" degrees="02.89637" direction="south" orientation="latitude" pageId="7" pageNumber="83" precision="1" value="-2.89637">02.89637°S</geoCoordinate>
<geoCoordinate id="EE635056D953FFEF027696CDFD44C9C8" box="[615,756,951,973]" degrees="60.22833" direction="west" orientation="longitude" pageId="7" pageNumber="83" precision="1" value="-60.22833">60.22833°W</geoCoordinate>
;
<specimenCode id="DBF19EEAD953FFEF008096ACFEAEC9EE" box="[145,286,982,1003]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">INPA 33733</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF013896ACFE87C9EE" box="[297,311,982,1003]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">3</specimenCode>
ex, 58.5- to 102.8-mm SL same locality as holotype
</materialsCitation>
,
<materialsCitation id="3B3F3CCCD953FFEF0134968EFE8DCE4D" collectingDate="2002-02-11" collectorName="J. Zuanon" country="Brazil" location="Igarape Taruma-Mirim" municipality="Manaus" pageId="7" pageNumber="83" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
coll.
<collectorName id="26A25347D953FFEF014D968FFE60CE0F" box="[348,464,1013,1034]" pageId="7" pageNumber="83">J. Zuanon</collectorName>
<emphasis id="B923EA83D953FFEF01C9968FFDBBCE0C" box="[472,523,1012,1034]" italics="true" pageId="7" pageNumber="83">et al</emphasis>
.,
<date id="FFE91051D953FFEF0230968FFD44CE0F" box="[545,756,1012,1034]" pageId="7" pageNumber="83" value="2002-02-11">
<collectingDate id="EFADE9B9D953FFEF0230968FFD44CE0F" box="[545,756,1012,1034]" pageId="7" pageNumber="83" value="2002-02-11">11 February 2002</collectingDate>
</date>
; 35585, 11 ex, 17.5- to 99.9-mm SL,
<collectingMunicipality id="6B8CACEBD953FFEF0223916EFD22CE2C" box="[562,658,1044,1065]" pageId="7" pageNumber="83">Manaus</collectingMunicipality>
,
<location id="8E88604AD953FFEF028F9169FE8DCE4D" LSID="urn:lsid:plazi:treatment:03FE8787D952FFE103A096A0FE95CEA8:8E88604AD953FFEF028F9169FE8DCE4D" country="Brazil" municipality="Manaus" name="Igarape Taruma-Mirim" pageId="7" pageNumber="83" stateProvince="Amazonas">Igarapé Tarumã-Mirim</location>
</materialsCitation>
,
<materialsCitation id="3B3F3CCCD953FFEF01599148FDBDCE80" collectingDate="2010-02-03" collectionCode="INPA" collectorName="J. Zuanon" country="Brazil" location="Igarape Taruma-Mirim" municipality="Manaus" pageId="7" pageNumber="83" specimenCode="INPA 42299, 7" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
col.
<collectorName id="26A25347D953FFEF01659148FE55CE42" box="[372,485,1074,1095]" pageId="7" pageNumber="83">J. Zuanon</collectorName>
,
<date id="FFE91051D953FFEF01E09148FD1FCE42" box="[497,687,1074,1096]" pageId="7" pageNumber="83" value="2010-02-03">
<collectingDate id="EFADE9B9D953FFEF01E09148FD1FCE42" box="[497,687,1074,1096]" pageId="7" pageNumber="83" value="2010-02-03">3 February 2010</collectingDate>
</date>
;
<specimenCode id="DBF19EEAD953FFEF02AB9148FF6BCE63" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">INPA 42299</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF00F9912BFF46CE63" box="[232,246,1105,1126]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">7</specimenCode>
ex, 57.5- to 87.0-mm SL,
<collectingMunicipality id="6B8CACEBD953FFEF023F912BFD3FCE63" box="[558,655,1105,1126]" pageId="7" pageNumber="83">Manaus</collectingMunicipality>
,
<location id="8E88604AD953FFEF028C912BFE8DCE80" LSID="urn:lsid:plazi:treatment:03FE8787D952FFE103A096A0FE95CEA8:8E88604AD953FFEF028C912BFE8DCE80" country="Brazil" municipality="Manaus" name="Igarape Taruma-Mirim" pageId="7" pageNumber="83" stateProvince="Amazonas">Igarapé Tarumã-Mirim</location>
, pool inside forest
</materialsCitation>
,
<materialsCitation id="3B3F3CCCD953FFEF02099115FE96CEE5" collectingDate="2011-12-20" collectionCode="INPA" collectorName="J. Zuanon" country="Brazil" latitude="-2.9097223" location="Igarape Taruma-Mirim" longLatPrecision="21" longitude="-60.229168" municipality="Manaus" pageId="7" pageNumber="83" specimenCode="INPA 42302, 6" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
col.
<collectorName id="26A25347D953FFEF0255910AFD03CE80" box="[580,691,1136,1157]" pageId="7" pageNumber="83">J. Zuanon</collectorName>
<emphasis id="B923EA83D953FFEF02AA910AFD5CCE81" box="[699,748,1135,1157]" italics="true" pageId="7" pageNumber="83">et al</emphasis>
.,
<date id="FFE91051D953FFEF008091F4FEDFCEA6" box="[145,367,1166,1188]" pageId="7" pageNumber="83" value="2011-12-20">
<collectingDate id="EFADE9B9D953FFEF008091F4FEDFCEA6" box="[145,367,1166,1188]" pageId="7" pageNumber="83" value="2011-12-20">20 December 2011</collectingDate>
</date>
;
<specimenCode id="DBF19EEAD953FFEF016D91F4FDBECEA6" box="[380,526,1166,1187]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">INPA 42302</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF020A91F4FD99CEA1" box="[539,553,1166,1188]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">6</specimenCode>
ex, 26.7- to 37.6- mm SL,
<collectingMunicipality id="6B8CACEBD953FFEF00E291D7FEE2CEC7" box="[243,338,1197,1218]" pageId="7" pageNumber="83">Manaus</collectingMunicipality>
,
<location id="8E88604AD953FFEF014C91D7FDDBCEC7" LSID="urn:lsid:plazi:treatment:03FE8787D952FFE103A096A0FE95CEA8:8E88604AD953FFEF014C91D7FDDBCEC7" box="[349,619,1196,1219]" country="Brazil" latitude="-2.9097223" longLatPrecision="21" longitude="-60.229168" municipality="Manaus" name="Igarape Taruma-Mirim" pageId="7" pageNumber="83" stateProvince="Amazonas">Igarapé Tarumã-Mirim</location>
(
<geoCoordinate id="EE635056D953FFEF026B91D6FD49CEC7" box="[634,761,1195,1218]" degrees="02" direction="south" minutes="54" orientation="latitude" pageId="7" pageNumber="83" precision="15" seconds="35" value="-2.9097223">
02°54
<emphasis id="B923EA83D953FFEF02AD91D1FD72CEC7" box="[700,706,1195,1218]" italics="true" pageId="7" pageNumber="83"></emphasis>
35
<emphasis id="B923EA83D953FFEF02CE91D1FD59CEC7" box="[735,745,1195,1218]" italics="true" pageId="7" pageNumber="83"></emphasis>
S
</geoCoordinate>
<geoCoordinate id="EE635056D953FFEF008091B1FEAECEE5" box="[145,286,1226,1249]" degrees="60" direction="west" minutes="13" orientation="longitude" pageId="7" pageNumber="83" precision="15" seconds="45" value="-60.229168">
60°13
<emphasis id="B923EA83D953FFEF00C591B0FF6ACEE4" box="[212,218,1226,1249]" italics="true" pageId="7" pageNumber="83"></emphasis>
45
<emphasis id="B923EA83D953FFEF00E991B0FEB2CEE4" box="[248,258,1226,1249]" italics="true" pageId="7" pageNumber="83"></emphasis>
W
</geoCoordinate>
)
</materialsCitation>
,
<materialsCitation id="3B3F3CCCD953FFEF012391B1FD42CF38" collectingDate="2010-01-27" collectionCode="INPA" collectorName="J. Zuanon &amp; Parque Nacional das Anavilhanas" country="Brazil" county="Igarape Acu" latitude="-2.82201" location="Novo Airao" longLatPrecision="1" longitude="-60.87086" municipality="Rio Negro" pageId="7" pageNumber="83" specimenCode="INPA 52935, 1" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
col.
<collectorName id="26A25347D953FFEF017391B6FE66CEE4" box="[354,470,1228,1249]" pageId="7" pageNumber="83">J. Zuanon</collectorName>
<emphasis id="B923EA83D953FFEF01CE91B6FDA3CEE5" box="[479,531,1227,1249]" italics="true" pageId="7" pageNumber="83">et al</emphasis>
.,
<date id="FFE91051D953FFEF023B91B1FD44CEE5" box="[554,756,1227,1249]" pageId="7" pageNumber="83" value="2010-01-27">
<collectingDate id="EFADE9B9D953FFEF023B91B1FD44CEE5" box="[554,756,1227,1249]" pageId="7" pageNumber="83" value="2010-01-27">27 January 2010</collectingDate>
</date>
;
<specimenCode id="DBF19EEAD953FFEF00809190FE91CF05" box="[145,289,1258,1280]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">INPA 52935</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF013C9190FE8BCEFA" box="[301,315,1258,1279]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">1</specimenCode>
ex, 22.9-mm SL,
<collectorName id="26A25347D953FFEF02169190FE99CF1B" pageId="7" pageNumber="83">Parque Nacional das Anavilhanas</collectorName>
,
<collectingCounty id="62894E1DD953FFEF01269073FE78CF1B" box="[311,456,1289,1311]" pageId="7" pageNumber="83">Igarapé Açu</collectingCounty>
(tributary to
<collectingMunicipality id="6B8CACEBD953FFEF02609072FD5CCF1B" box="[625,748,1288,1310]" pageId="7" pageNumber="83">Rio Negro</collectingMunicipality>
),
<location id="8E88604AD953FFEF00809052FE95CF38" LSID="urn:lsid:plazi:treatment:03FE8787D952FFE103A096A0FE95CEA8:8E88604AD953FFEF00809052FE95CF38" box="[145,293,1319,1341]" country="Brazil" county="Igarape Acu" latitude="-2.82201" longLatPrecision="1" longitude="-60.87086" municipality="Rio Negro" name="Novo Airao" pageId="7" pageNumber="83" stateProvince="Amazonas">Novo Airão</location>
(
<geoCoordinate id="EE635056D953FFEF012D905DFDB3CF39" box="[316,515,1319,1340]" degrees="2.8220100000" direction="south" orientation="latitude" pageId="7" pageNumber="83" precision="1" value="-2.82201">2.8220100000</geoCoordinate>
<geoCoordinate id="EE635056D953FFEF0200905DFD5ACF38" box="[529,746,1319,1341]" degrees="60.8708600000" direction="west" orientation="longitude" pageId="7" pageNumber="83" precision="1" value="-60.87086">60.8708600000</geoCoordinate>
)
</materialsCitation>
,
<materialsCitation id="3B3F3CCCD953FFEF0080903CFD8CCF9C" collectingDate="2016-05-04" collectionCode="INPA" collectorName="D. Bastos" country="Brazil" latitude="-2.901638" location="Rio Taruma" longLatPrecision="1" longitude="-60.22928" municipality="Manaus" pageId="7" pageNumber="83" specimenCode="INPA 53174, 1" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
coll.
<collectorName id="26A25347D953FFEF00DC903CFEF3CF5E" box="[205,323,1350,1371]" pageId="7" pageNumber="83">D. Bastos</collectorName>
<emphasis id="B923EA83D953FFEF015F903CFE35CF5E" box="[334,389,1350,1371]" italics="true" pageId="7" pageNumber="83">et al</emphasis>
.,
<date id="FFE91051D953FFEF018E903CFD84CF59" box="[415,564,1350,1372]" pageId="7" pageNumber="83" value="2016-05-04">
<collectingDate id="EFADE9B9D953FFEF018E903CFD84CF59" box="[415,564,1350,1372]" pageId="7" pageNumber="83" value="2016-05-04">4 May 2016</collectingDate>
</date>
;
<specimenCode id="DBF19EEAD953FFEF0252903CFD6CCF59" box="[579,732,1350,1372]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">INPA 53174</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF02FA903CFD48CF5E" box="[747,760,1350,1371]" collectionCode="INPA" country="Brazil" httpUri="http://grbio.org/cool/rm88-499z" name="Instituto Nacional de Pesquisas da Amazonia" pageId="7" pageNumber="83">1</specimenCode>
ex, 73.0-mm SL,
<collectingMunicipality id="6B8CACEBD953FFEF017A901FFE60CF7F" box="[363,464,1381,1402]" pageId="7" pageNumber="83">Manaus</collectingMunicipality>
, pool near
<location id="8E88604AD953FFEF0275901EFD47CF7F" LSID="urn:lsid:plazi:treatment:03FE8787D952FFE103A096A0FE95CEA8:8E88604AD953FFEF0275901EFD47CF7F" box="[612,759,1380,1402]" country="Brazil" latitude="-2.901638" longLatPrecision="1" longitude="-60.22928" municipality="Manaus" name="Rio Taruma" pageId="7" pageNumber="83" stateProvince="Amazonas">Rio Tarumã</location>
(
<geoCoordinate id="EE635056D953FFEF008890F9FEE7CF9C" box="[153,343,1411,1433]" degrees="2.9016380000" direction="south" orientation="latitude" pageId="7" pageNumber="83" precision="1" value="-2.901638">2.9016380000</geoCoordinate>
<geoCoordinate id="EE635056D953FFEF017290F9FD84CF9C" box="[355,564,1411,1433]" degrees="60.2292800000" direction="west" orientation="longitude" pageId="7" pageNumber="83" precision="1" value="-60.22928">60.2292800000</geoCoordinate>
)
</materialsCitation>
,
<materialsCitation id="3B3F3CCCD953FFEF025D90F9FD22CFD3" collectingDate="2016-10-12" collectionCode="MZUSP" collectorName="D. Bastos" country="Brazil" county="Manaus" latitude="-2.90965" location="Igarape Taruma-Mirim" longLatPrecision="1" longitude="-60.22915" municipality="Rio Negro" pageId="7" pageNumber="83" specimenCode="MZUSP 120543, 11" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
col.
<collectorName id="26A25347D953FFEF029090FEFD48CF9C" box="[641,760,1412,1433]" pageId="7" pageNumber="83">D. Bastos</collectorName>
<emphasis id="B923EA83D953FFEF008090D8FF72CFB2" box="[145,194,1442,1463]" italics="true" pageId="7" pageNumber="83">et al</emphasis>
.,
<date id="FFE91051D953FFEF00C790D8FE22CFBD" box="[214,402,1442,1464]" pageId="7" pageNumber="83" value="2016-10-12">
<collectingDate id="EFADE9B9D953FFEF00C790D8FE22CFBD" box="[214,402,1442,1464]" pageId="7" pageNumber="83" value="2016-10-12">12 October 2016</collectingDate>
</date>
;
<specimenCode id="DBF19EEAD953FFEF018F90D8FDE3CFBD" box="[414,595,1442,1464]" collectionCode="MZUSP" country="Brazil" httpUri="http://grbio.org/cool/6yx0-3nm7" name="Museu de Zoologia da Universidade de Sao Paulo" pageId="7" pageNumber="83">MZUSP 120543</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF024E90D8FDCACFB2" box="[607,634,1442,1463]" collectionCode="MZUSP" country="Brazil" httpUri="http://grbio.org/cool/6yx0-3nm7" name="Museu de Zoologia da Universidade de Sao Paulo" pageId="7" pageNumber="83">11</specimenCode>
ex (1 c&amp;s), 42.2- to 76.1-mm SL, collected with holotype
</materialsCitation>
;
<materialsCitation id="3B3F3CCCD953FFEF028F90BBFD3ECC11" collectingDate="2006-09-02" collectionCode="MZUSP" collectorName="L. Rapp Py-Daniel &amp; Rapp Py-Daniel, J &amp; M. de Pinna" country="Brazil" county="Manaus" latitude="-2.90965" location="Igarape Taruma-Mirim" longLatPrecision="1" longitude="-60.22915" municipality="Rio Negro" pageId="7" pageNumber="83" specimenCode="MZUSP 120544, 1" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
<specimenCode id="DBF19EEAD953FFEF028F90BBFF58CFF0" collectionCode="MZUSP" country="Brazil" httpUri="http://grbio.org/cool/6yx0-3nm7" name="Museu de Zoologia da Universidade de Sao Paulo" pageId="7" pageNumber="83">MZUSP 120544</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF00E490A5FEB3CFF1" box="[245,259,1503,1524]" collectionCode="MZUSP" country="Brazil" httpUri="http://grbio.org/cool/6yx0-3nm7" name="Museu de Zoologia da Universidade de Sao Paulo" pageId="7" pageNumber="83">1</specimenCode>
ex C&amp;S, 98.4-mm SL, collected with holotype (preserved after 2 years in captivity)
</materialsCitation>
;
<materialsCitation id="3B3F3CCCD953FFEF028A9084FF40CC55" collectingDate="2006-09-02" collectionCode="MZUSP" collectorName="L. Rapp Py-Daniel &amp; Rapp Py-Daniel, J &amp; M. de Pinna" country="Brazil" county="Manaus" latitude="-2.90965" location="Igarape Taruma-Mirim" longLatPrecision="1" longitude="-60.22915" municipality="Rio Negro" pageId="7" pageNumber="83" specimenCode="MZUSP 120545, 3" specimenCount="1" stateProvince="Amazonas" typeStatus="paratype">
<specimenCode id="DBF19EEAD953FFEF028A9084FF56CC37" collectionCode="MZUSP" country="Brazil" httpUri="http://grbio.org/cool/6yx0-3nm7" name="Museu de Zoologia da Universidade de Sao Paulo" pageId="7" pageNumber="83">MZUSP 120545</specimenCode>
,
<specimenCode id="DBF19EEAD953FFEF00E39367FEB0CC37" box="[242,256,1565,1586]" collectionCode="MZUSP" country="Brazil" httpUri="http://grbio.org/cool/6yx0-3nm7" name="Museu de Zoologia da Universidade de Sao Paulo" pageId="7" pageNumber="83">3</specimenCode>
ex (1 c&amp;s), 46.4- to 52.6-mm SL, same data as INPA
</materialsCitation>
26241.
</paragraph>
<caption id="DF286619D952FFEE00B29261FEBECD69" pageId="6" pageNumber="82" startId="6.[163,241,1819,1841]" targetBox="[164,1441,1501,1778]" targetPageId="6" targetType="figure">
<paragraph id="8BE83691D952FFEE00B29261FEBECD69" blockId="6.[163,1444,1819,1900]" pageId="6" pageNumber="82">
<emphasis id="B923EA83D952FFEE00B29261FEBACD35" bold="true" box="[163,266,1819,1841]" pageId="6" pageNumber="82">Figure 4.</emphasis>
Schematic representation of swimbladder of
<taxonomicName id="4C574D12D952FFEE02F29261FC0DCD34" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[739,957,1819,1841]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="species" species="walkerae">
<emphasis id="B923EA83D952FFEE02F29261FC0DCD34" box="[739,957,1819,1841]" italics="true" pageId="6" pageNumber="82">Tarumania walkerae</emphasis>
</taxonomicName>
, based mostly on INPA 26241, 51.5-mm SL. ac, anterior swimbladder chamber; sd, sinusoid swimbladder duct. Roman numerals IIXI represent sequential swimbladder chambers.
</paragraph>
</caption>
<caption id="DF286619D953FFEF008397BCFE0FC8FF" pageId="7" pageNumber="83" startId="7.[146,225,710,732]" targetBox="[416,1184,195,670]" targetPageId="7" targetType="figure">
<paragraph id="8BE83691D953FFEF008397BCFE0FC8FF" blockId="7.[145,1424,710,762]" pageId="7" pageNumber="83">
<emphasis id="B923EA83D953FFEF008397BCFF4BC8DE" bold="true" box="[146,251,710,732]" pageId="7" pageNumber="83">Figure 5.</emphasis>
<taxonomicName id="4C574D12D953FFEF011497BDFE50C8DE" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[261,480,710,732]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="7" pageNumber="83" phylum="Chordata" rank="species" species="walkerae">
<emphasis id="B923EA83D953FFEF011497BDFE50C8DE" box="[261,480,710,732]" italics="true" pageId="7" pageNumber="83">Tarumania walkerae</emphasis>
</taxonomicName>
, paratype, INPA 21603, lateral view of head showing reverse-imbricated scales. Specimen cleaned of superficial mucus.
</paragraph>
</caption>
<paragraph id="8BE83691D953FFEF00809315FE72CD39" blockId="7.[145,761,1647,1853]" pageId="7" pageNumber="83">
<emphasis id="B923EA83D953FFEF00809315FEBFCC81" box="[145,271,1647,1668]" italics="true" pageId="7" pageNumber="83">Etymology:</emphasis>
The specific name honours eminent limnologist Ilse Walker [Instituto Nacional de Pesquisas da Amazônia, Manaus (INPA)], not only for her lifelong contribution to the knowledge of Amazonian ecology but also for having collected the first (and for some years, only) known specimen. The epithet is a noun in the genitive feminine case.
</paragraph>
<paragraph id="8BE83691D953FFEF03389664FBD9C931" blockId="7.[809,1129,798,820]" box="[809,1129,798,820]" pageId="7" pageNumber="83">
<emphasis id="B923EA83D953FFEF03389664FC10C936" box="[809,928,798,819]" italics="true" pageId="7" pageNumber="83">Diagnosis:</emphasis>
As for the family.
</paragraph>
<paragraph id="8BE83691D953FFE003389628FD4CCEEB" blockId="7.[809,1432,850,1853]" lastBlockId="8.[163,779,197,1844]" lastPageId="8" lastPageNumber="84" pageId="7" pageNumber="83">
<emphasis id="B923EA83D953FFEF03389628FC01C962" box="[809,945,850,871]" italics="true" pageId="7" pageNumber="83">Description:</emphasis>
Body greatly elongate (BD ~9% of SL) and approximately oval in cross-section, ending in highly compressed, spatulate caudal peduncle deeper than rest of body. Proportional measurements provided in
<tableCitation id="C6D5032AD953FFEF033896B6FCCBC9E4" box="[809,891,972,994]" captionStart="Table 1" captionStartId="2.[827,891,196,217]" captionText="Table 1. Selected measurements and counts of holotype (HT) and 11 paratypes (PT) of Tarumania walkerae" pageId="7" pageNumber="83">Table 1</tableCitation>
. Anal and urogenital openings located immediately anterior to origin of anal fin. Myotomes narrow and numerous. Head small (~15% of SL), its profile continuous with that of the body in live and recently preserved specimens (partly dehydrated specimens with well-defined groove dorsally between head and trunk). Dorsal trunk musculature produced anteriorly to cover posterior part of cranium. Snout blunt, ending anteriorly in large and slightly upturned mouth, with lower jaw longer than upper one. Posterior margin of upper jaw reaching to vertical through posterior margin of eye. Eye small, located on anterior fifth of head in lateral view. Anterior and posterior nares not juxtaposed, separated from each other by considerable distance, longer than eye diameter. Anterior naris positioned immediately dorsal to upper lip and produced on surface of the head as small mound. Branchiostegal membranes united to each other, free from isthmus, forming wide branchial opening. Maxilla with two rows of conical teeth, straight or slightly curved, for part of its dentate surface. Jaw dentition described in Selected osteological features. Infraorbital latero-sensory canal absent. Skull roof without cranial fontanels. Part of frontal and parietal bones prominent and exposed on dorsal surface of the head in large specimens. Numerous neuromast lines over head and anterior part of the body. Body neuromasts mostly arranged as short vertical rows of five or six elements. Supraoccipital spine invisible externally. Dorsal fin short-based and lanceolate, i or ii + 46, its origin at ~70% of SL. Pectoral fin short, i or ii + 710, its length approximately half of HL, attached on ventral fourth of thorax. First pectoral-fin ray approximately half as long as others, adpressed to second ray. Pelvic fin large, i + 5 or 6 (i.e. all rays branched), extending posteriorly to vertical through base of dorsal fin. Anal fin ii + 9 + i, its base more than twice as long as that of dorsal fin and its origin slightly anterior to vertical through tip of adducted dorsal fin. Caudal fin lanceolate or oblong and no differentiation between upper and lower lobes, with 8 + 10 principal rays plus four accessory rays in lower lobe. Caudal-fin attachment area more extensive ventrally than dorsally. Adipose fin absent. Squamation fine and extremely uniform in size, covering entire body in regular narrow rows, as well as most of the head (including entire perimeter of orbit), except lips and exposed top of skull. Scales on head similar in morphology to those on body, but with different imbrication, that is free margins not directed posteriorly. Imbrication pattern changes along limit between trunk musculature and head. Scales at interface with free margins directed laterally or ventrally. Such orientation maintained in scales over gill covers and posterior portion of cheeks. Free scale margins shifting to progressively more anterior orientation over anterior portion of cheeks, until completely reversed on dorsal part of head (
<figureCitation id="136C2A14D95CFFE00128917BFEC7CE12" box="[313,375,1025,1047]" captionStart="Figure 5" captionStartId="7.[146,225,710,732]" captionTargetBox="[416,1184,195,670]" captionTargetId="figure-601@7.[385,1185,195,671]" captionTargetPageId="7" captionText="Figure 5. Tarumania walkerae, paratype, INPA 21603, lateral view of head showing reverse-imbricated scales. Specimen cleaned of superficial mucus." pageId="8" pageNumber="84">Fig. 5</figureCitation>
). Scales in midlateral series of body 244267, none perforated by lateral-line pores, 21 or 22 scale rows between origins of dorsal and pelvic fins. Modally 25 series of scales on caudal peduncle. Pre-dorsal scales 168193. Vertebrae 64 or 65 (4345 precaudal and 2122 caudal). Pleural ribs 4144. Anterior branchial arch with 11 or 12 gill rakers, 3 or 4 upper and 8 lower (posterior lower one sometimes at limit).
</paragraph>
<paragraph id="8BE83691D95CFFE000AA918CFC1BC8A2" blockId="8.[163,779,197,1844]" lastBlockId="8.[827,1443,197,679]" pageId="8" pageNumber="84">
Swimbladder subdivided into 11 compartments, positioned in longitudinal series immediately ventral to vertebral column (
<figureCitation id="136C2A14D95CFFE00189904EFE69CF4C" box="[408,473,1332,1354]" captionStart="Figure 4" captionStartId="6.[163,241,1819,1841]" captionTargetBox="[164,1441,1501,1778]" captionTargetId="figure-678@6.[163,1443,1500,1779]" captionTargetPageId="6" captionText="Figure 4. Schematic representation of swimbladder of Tarumania walkerae, based mostly on INPA 26241, 51.5-mm SL. ac, anterior swimbladder chamber; sd, sinusoid swimbladder duct. Roman numerals IIXI represent sequential swimbladder chambers." pageId="8" pageNumber="84">Fig. 4</figureCitation>
). Series arranged in anterior row of three and posterior row of eight, connected by sinuous duct. Individual compartments varying in shape and size. Size of compartments increasing towards anterior and posterior ends, with smallest ones approximately in middle of abdominal cavity. First compartment corresponding in position and shape to anterior chamber of swimbladder in other characiforms. All other compartments represent subdivisions of the posterior chamber. Anterior chamber largest of all in volume, with wide cordiform shape in ventral view. All subsequent chambers narrower than first one. Second chamber cylindrical, longer than first one. Third chamber conical, bottle shaped and markedly smaller in volume than its predecessors, with posterior atrium-like region tapering posteriorly into narrow sinusoid duct expanding slightly into fourth chamber, smallest of all. Constriction separates fourth from slightly larger fifth chamber. Sixth chamber larger still. All subsequent chambers similar in shape, although progressively larger posteriorly, except for last chamber, slightly smaller and more roundish than its predecessor, and abutting against posterior limit of abdominal cavity, dorsally to anterior anal-fin pterygiophores. All swimbladder chambers connected via short ducts, except third and fourth, connected via long sinusoid duct described above. Wall of anterior chamber noticeably thicker than that of subsequent chambers, otherwise uniformly thin and delicate. Ductus pneumaticus opening ventrally from second chamber, close to limit with first one. Swimbladder configuration described is constant in
<specimenCount id="9D51FD18D95CFFE004E49708FA13C88D" box="[1269,1443,626,648]" count="4" pageId="8" pageNumber="84" type="generic">four specimens</specimenCount>
dissected.
</paragraph>
<paragraph id="8BE83691D95CFFE0032A97B7FAD3CD37" blockId="8.[827,1443,717,1842]" pageId="8" pageNumber="84">
<emphasis id="B923EA83D95CFFE0032A97B7FC6FC8E7" box="[827,991,717,738]" italics="true" pageId="8" pageNumber="84">Pigmentation:</emphasis>
Overall ground colour dark brownish, slightly less dark ventrally. Subtle differences in the density of pigment forming irregular small blotches on the dorsum and flanks, partly merging into irregular vertical or slanted bars on anterior third of trunk, sometimes extending across dorsum. Barred pattern more intense on caudal peduncle, sometimes changing into irregular blotches. Areas of procurrent caudal-fin rays dorsally and ventrally on caudal peduncle darker than rest of peduncle in small specimens, but indistinguishable in larger individuals. Dorsal and ventral edges of caudal peduncle outlined as very dark thin line. Scales with dark exposed portions collectively forming pattern of fine longitudinal stripes covering entire body, visible under close examination. Dark slanted lines on lower half of flanks outlining limits of myomeres. Head as dark as body. Snout and area of opercle darker than rest of the head, with sides of cheeks slightly lighter. Dorsal and lateral sides of head with numerous short thin light lines corresponding to neuromast lines. Central portion of isthmus with same colour as abdomen, with adjacent portion of branchiostegal membrane distinctly darker than rest of ventral aspect of head. Caudal fin with very dark posteriorly convex semilunar mark across base, covering ~15% of length of longest (central) rays at its widest. Heavy dark pigment covering basal third of anal fin, more intense at its ventral limit, forming very dark stripe in some specimens. Rest of fin abruptly hyaline. Dorsal fin with dark field over its basal 1020%, otherwise hyaline. Pectoral and pelvic fins with dark fields at bases, more pronounced on former, forming dark spot with elongate dark fields radiating alongside fin rays. Remainder of both fins hyaline. Colour of small individuals (up to 6.0-cm SL) very dark and uniform, nearly black. In life, colour pattern obviously mimics dead leaves in habitat, with hyaline portions of fins practically invisible.
</paragraph>
<caption id="DF286619D95DFFE10080964CFD53C982" pageId="9" pageNumber="85" startId="9.[145,225,822,844]" targetBox="[153,755,196,782]" targetPageId="9" targetType="figure">
<paragraph id="8BE83691D95DFFE10080964CFD53C982" blockId="9.[145,761,822,903]" pageId="9" pageNumber="85">
<emphasis id="B923EA83D95DFFE10080964CFF4CC94E" bold="true" box="[145,252,822,844]" pageId="9" pageNumber="85">Figure 6.</emphasis>
<taxonomicName id="4C574D12D95DFFE10118964CFE8FC949" box="[265,319,822,844]" class="Insecta" family="Carabidae" genus="Jaws" higherTaxonomySource="CoL" kingdom="Animalia" order="Coleoptera" pageId="9" pageNumber="85" phylum="Arthropoda" rank="genus">Jaws</taxonomicName>
of
<taxonomicName id="4C574D12D95DFFE10170964CFDF3C949" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[353,579,822,844]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="9" pageNumber="85" phylum="Chordata" rank="species" species="walkerae">
<emphasis id="B923EA83D95DFFE10170964CFDF3C949" box="[353,579,822,844]" italics="true" pageId="9" pageNumber="85">Tarumania walkerae</emphasis>
</taxonomicName>
, paratype, INPA 25747, 151.2-mm SL, lateral view. aa, angulo-articular; den, dentary; mx, maxilla; pmx, premaxilla; ra, retroarticular.
</paragraph>
</caption>
<paragraph id="8BE83691D95DFFE1008096D6FF55C9E5" blockId="9.[145,760,939,992]" pageId="9" pageNumber="85">
<emphasis id="B923EA83D95DFFE1008096D6FEF0C9C4" box="[145,320,940,961]" italics="true" pageId="9" pageNumber="85">Maximum size:</emphasis>
151.2-mm SL (a specimen from INPA 25747).
</paragraph>
<paragraph id="8BE83691D95DFFE100809684FE95CEA8" blockId="9.[145,761,1022,1197]" pageId="9" pageNumber="85">
<emphasis id="B923EA83D95DFFE100809684FE77CE16" box="[145,455,1022,1043]" italics="true" pageId="9" pageNumber="85">Geographical distribution:</emphasis>
So far endemic to the Rio Negro basin, from the Rio Tarumã-Mirim, tributary to the Rio Negro near the city of Manaus, and from the Anavilhanas archipelago, on the main Rio Negro (
<figureCitation id="136C2A14D95DFFE1008B9103FF41CE8B" box="[154,241,1145,1167]" captionStart="Figure 11" captionStartId="13.[146,224,1878,1900]" captionText="Figure 11. Geographical distribution of Tarumania walkerae." pageId="9" pageNumber="85">Fig. 11</figureCitation>
). The two localities are ~
<quantity id="4CAF9B74D95DFFE102299103FD38CE8A" box="[568,648,1145,1167]" metricMagnitude="4" metricUnit="m" metricValue="6.0" pageId="9" pageNumber="85" unit="km" value="60.0">60 km</quantity>
apart in straight line.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,87 @@
<document id="CB31C3FC527ECE5C392FF76BDE77C294" ID-ISSN="0024-4082" ID-ZooBank="D3A2334-44D3-4ADA-AAC6-1130F3D7FD22" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779536232" checkinUser="plazi" docAuthor="Pinna, Mário De, Zuanon, Jansen, Py-Daniel, Lucia Rapp &amp; Petry, Paulo" docDate="2018" docId="03FE8787D952FFEE03F897ECFC16C9AB" docLanguage="en" docName="zlx028.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Tarumania Pinna, Zuanon, Py-Daniel &amp; Petry, 2018, GEN. NOV." docType="treatment" docVersion="1" lastPageNumber="82" masterDocId="FFC7FFFFD954FFE80011957AFFB0CA05" masterDocTitle="A new family of neotropical freshwater fishes from deep fossorial Amazonian habitat, with a reappraisal of morphological characiform phylogeny (Teleostei: Ostariophysi)" masterLastPageNumber="106" masterPageNumber="76" pageNumber="82" updateTime="1738779691674" updateUser="GgImagineBatch">
<mods:mods id="C19FF539B1B24CD4A834181A1A7210F2" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="4DE9D901682E3599161416F8EBFEDE10">
<mods:title id="E4D4BC24A8225DD50D98A2E94CDE11E4">A new family of neotropical freshwater fishes from deep fossorial Amazonian habitat, with a reappraisal of morphological characiform phylogeny (Teleostei: Ostariophysi)</mods:title>
</mods:titleInfo>
<mods:name id="BDC7B69FA39E55804C9303EC569338A6" type="personal">
<mods:role id="AC1BCAD6A9A93D85598CA23E15FC49C5">
<mods:roleTerm id="8D436B6F0FFE23B9F8082BA6EBB7C3EE">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="2B16FA707EFABC186C518D6A107A3E6B">Pinna, Mário De</mods:namePart>
</mods:name>
<mods:name id="72C8A617699877749006CB8CA8BD011D" type="personal">
<mods:role id="8C927204384F0C09D8048BF7244C4CB7">
<mods:roleTerm id="332DAD95D32DE0AD336C82B7DF9DDCFE">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="A588929BC48F6F851ACDCA661E01D723">Zuanon, Jansen</mods:namePart>
</mods:name>
<mods:name id="B05C49CC2341A17B3DCC9A647D0EC68D" type="personal">
<mods:role id="989E1C8ECFFB57DEFCBDBA90F2DD82A0">
<mods:roleTerm id="22DF2DFA5773D5E343078A8841ECD852">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="8F13AF4EF77D7FFA666170AF8ED09AAF">Py-Daniel, Lucia Rapp</mods:namePart>
</mods:name>
<mods:name id="236D260CDAF7732666180B856CFA4D7E" type="personal">
<mods:role id="CC24048E9D7DCACC450E8E024940F5C4">
<mods:roleTerm id="696A87D88D1407A54018460A91F3BBCD">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="9FE287D0ED54EED251DD6A255DA6F2EB">Petry, Paulo</mods:namePart>
</mods:name>
<mods:typeOfResource id="6354A942B4C26436CC75F2139AF5CB2E">text</mods:typeOfResource>
<mods:relatedItem id="FE7D2B53DA533791D0566BF704FB69AC" type="host">
<mods:titleInfo id="0E2B5C394E5A980B0F5A760B3136642C">
<mods:title id="C1069B6C2754E61C99DCC33B0D03A53D">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="B0C7B1A26050E8146B5057120A158E1E">
<mods:date id="D4A0313EC3EAF9990ABFF3CA0A61C3F0">2018</mods:date>
<mods:detail id="602B841E4413AAEBDB108B70D580761B" type="volume">
<mods:number id="DD2645D40C2368CBA60CE376828313E8">182</mods:number>
</mods:detail>
<mods:extent id="71C08BC10FED32418485801ECAA557AC" unit="page">
<mods:start id="104BC6A7B7D415A9850B5B8BAA694610">76</mods:start>
<mods:end id="4090FB9D8F092ACE5A0FE27D1004404B">106</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="4E252C7F868A03E8E7762EF29732905B">journal article</mods:classification>
<mods:identifier id="EA6BEA3F747E1BC8BEE77F307BC5E69E" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="BC3035BEF4FF9B98795D7601FD8C1842" type="ZooBank">D3A2334-44D3-4ADA-AAC6-1130F3D7FD22</mods:identifier>
</mods:mods>
<treatment id="03FE8787D952FFEE03F897ECFC16C9AB" LSID="urn:lsid:plazi:treatment:03FE8787D952FFEE03F897ECFC16C9AB" httpUri="http://treatment.plazi.org/id/03FE8787D952FFEE03F897ECFC16C9AB" lastPageNumber="82" pageId="6" pageNumber="82">
<subSubSection id="C34D651AD952FFEE03F897ECFB45C8AB" box="[1001,1269,662,686]" pageId="6" pageNumber="82" type="nomenclature">
<paragraph id="8BE83691D952FFEE03F897ECFB45C8AB" blockId="6.[1001,1269,662,686]" box="[1001,1269,662,686]" pageId="6" pageNumber="82">
<heading id="D0A081FDD952FFEE03F897ECFB45C8AB" box="[1001,1269,662,686]" centered="true" fontSize="9" level="2" pageId="6" pageNumber="82" reason="2">
<taxonomicName id="4C574D12D952FFEE03F897ECFBC6C8A8" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[1001,1142,662,685]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="genus" status="gen. nov.">
<smallCapsWord id="8D0EA04DD952FFEE03F897ECFBC6C8A8" baselines="679,680" box="[1001,1142,662,685]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Tarumania" pageId="6" pageNumber="82">TARUMANIA</smallCapsWord>
</taxonomicName>
<emphasis id="B923EA83D952FFEE046F97E3FB45C8AB" bold="true" box="[1150,1269,662,686]" pageId="6" pageNumber="82">
<taxonomicNameLabel id="A21057F8D952FFEE046F97E3FB45C8AB" box="[1150,1269,662,686]" pageId="6" pageNumber="82" rank="genus">
<smallCapsWord id="8D0EA04DD952FFEE046F97E3FB1FC8A9" baselines="679" box="[1150,1199,665,684]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="gen" pageId="6" pageNumber="82">GEN</smallCapsWord>
.
<smallCapsWord id="8D0EA04DD952FFEE04AC97E3FB5EC8A9" baselines="679" box="[1213,1262,665,684]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="nov" pageId="6" pageNumber="82">NOV</smallCapsWord>
.
</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C34D651AD952FFEE032A97AFFC16C9AB" pageId="6" pageNumber="82" type="materials_examined">
<paragraph id="8BE83691D952FFEE032A97AFFAA8C8EC" blockId="6.[827,1304,724,746]" box="[827,1304,724,746]" pageId="6" pageNumber="82">
<emphasis id="B923EA83D952FFEE032A97AFFB0DC8EC" box="[827,1213,724,746]" italics="true" pageId="6" pageNumber="82">
<typeStatus id="54EC8833D952FFEE032A97AFFCC0C8EF" box="[827,880,725,746]" pageId="6" pageNumber="82">Type</typeStatus>
species:
<taxonomicName id="4C574D12D952FFEE03C197AEFB0DC8EC" authorityName="Pinna &amp; Zuanon &amp; Py-Daniel &amp; Petry" authorityYear="2018" box="[976,1213,724,745]" family="Tarumaniidae" genus="Tarumania" higherTaxonomySource="GBIF" kingdom="Animalia" order="Characiformes" pageId="6" pageNumber="82" phylum="Chordata" rank="species" species="walkerae" status="sp. nov.">Tarumania walkerae</taxonomicName>
</emphasis>
<taxonomicNameLabel id="A21057F8D952FFEE04D597AEFAA8C8EC" box="[1220,1304,724,745]" pageId="6" pageNumber="82" rank="species">sp. nov.</taxonomicNameLabel>
</paragraph>
<paragraph id="8BE83691D952FFEE032A9672FBCBC91B" blockId="6.[827,1147,776,798]" box="[827,1147,776,798]" pageId="6" pageNumber="82">
<emphasis id="B923EA83D952FFEE032A9672FC02C918" box="[827,946,776,797]" italics="true" pageId="6" pageNumber="82">Diagnosis:</emphasis>
As for the family.
</paragraph>
<paragraph id="8BE83691D952FFEE032A9646FC16C9AB" blockId="6.[827,1442,828,942]" pageId="6" pageNumber="82">
<emphasis id="B923EA83D952FFEE032A9646FC0CC954" box="[827,956,828,849]" italics="true" pageId="6" pageNumber="82">Etymology:</emphasis>
From the river Tarumã-Mirim, tributary of the lower Rio Negro, first known locality of the new taxon. A noun in nominative singular. Gender feminine.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,394 @@
<document id="57C275868105AEAA6BADAD4CA394AD22" ID-ISSN="0024-4082" ID-ZooBank="14B8382-1788-4E8D-AE6A-7771423F5B22" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779420829" checkinUser="plazi" docAuthor="Rodríguez-Rey, Ghennie T., Filho, Alfredo Carvalho, Araújo, Maria Elisabeth De &amp; Solé-Cava, Antonio M." docDate="2018" docId="4C548796FFAC1218FE91F968FB1EA8E9" docLanguage="en" docName="zlx026.pdf" docOrigin="Zoological Journal of the Linnean Society 182" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Bathygobius soporator AND B. GEMINATUS" docType="treatment" docVersion="1" lastPageNumber="379" masterDocId="B06DFFEEFFBE120BFF94FF9EFF96A810" masterDocTitle="Evolutionary history of Bathygobius (Perciformes: Gobiidae) in the Atlantic biogeographic provinces: a new endemic species and old mitochondrial lineages" masterLastPageNumber="384" masterPageNumber="360" pageNumber="378" updateTime="1738779548989" updateUser="GgImagineBatch">
<mods:mods id="36465011CCE543283CB6CE21AAC74A5D" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="BF073DB9685973FCCD7360172B789D5F">
<mods:title id="A1EB6965EBADE127F52D06EAE3A3B51C">Evolutionary history of Bathygobius (Perciformes: Gobiidae) in the Atlantic biogeographic provinces: a new endemic species and old mitochondrial lineages</mods:title>
</mods:titleInfo>
<mods:name id="A0E9216E8F5E10A864EB1EB3FA90CDEE" type="personal">
<mods:role id="F44CEF5435F21C4C2008D2439F205C8A">
<mods:roleTerm id="AF49882EAD6E0B297484F19F2B192645">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="90A0869489A4AD39C7C6CED12EC7D4FF">Rodríguez-Rey, Ghennie T.</mods:namePart>
</mods:name>
<mods:name id="D9A0C4F92441EADD47A2A647C88EA7CB" type="personal">
<mods:role id="F8C385CFB6FDAFC37A77DCBCCAA587AA">
<mods:roleTerm id="21F83A46C81664D500C08E3ED498473A">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="4A55ADE95B26F51016D33F52AD1B4D08">Filho, Alfredo Carvalho</mods:namePart>
</mods:name>
<mods:name id="A6555E58DA5EBD1EAE6D11308DFB01F3" type="personal">
<mods:role id="1EE76EA26E32A3D150A55183263B498A">
<mods:roleTerm id="6489057A998E01E1D7AE4EF51DA52AEB">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="D17BFDB51D12FFC135FE34C46EE9F037">Araújo, Maria Elisabeth De</mods:namePart>
</mods:name>
<mods:name id="0F86362984BC609FDBF6AAA8796AF0BE" type="personal">
<mods:role id="D8F2905CF8CCDDA5A4479C8DF511EA1A">
<mods:roleTerm id="58719C5325296C3537AB0279B55AE1AE">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="E4536A0004371A30CB90BD4DD41C13BC">Solé-Cava, Antonio M.</mods:namePart>
</mods:name>
<mods:typeOfResource id="D3BE9FBBCE73387629B66B8FB93C3E12">text</mods:typeOfResource>
<mods:relatedItem id="F9D9F0EDD35056B154284FAC765C46F1" type="host">
<mods:titleInfo id="A1B78E88111E1482F8046EC6775A2253">
<mods:title id="4DAB5720CFA9D8D4CCFA74170C496A44">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="651CD6BAB9012A16563F03CA31ABED36">
<mods:date id="782911726623459A2DB824935223D85C">2018</mods:date>
<mods:detail id="EF880E3561CEB217EF52A35340D60E2F" type="volume">
<mods:number id="011876BB403952B2F076926256C5A21B">182</mods:number>
</mods:detail>
<mods:extent id="20805094D70D7C80B2F9CAC1481CAA42" unit="page">
<mods:start id="F6479FDA64164108F5F8AE864E82796C">360</mods:start>
<mods:end id="627ECA8B1011ACD831BC56D0D9301F8A">384</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="262210635457E6F3148AA96BDE4900EB">journal article</mods:classification>
<mods:identifier id="508265A71A990B146F42DA50EBEB652C" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="22FA4942316FEE584C841E3D52E6F6DF" type="ZooBank">14B8382-1788-4E8D-AE6A-7771423F5B22</mods:identifier>
</mods:mods>
<treatment id="4C548796FFAC1218FE91F968FB1EA8E9" LSID="urn:lsid:plazi:treatment:4C548796FFAC1218FE91F968FB1EA8E9" httpUri="http://treatment.plazi.org/id/4C548796FFAC1218FE91F968FB1EA8E9" lastPageId="19" lastPageNumber="379" pageId="18" pageNumber="378">
<subSubSection id="8CE7650BFFAC1219FE91F968FDD5AF3C" pageId="18" pageNumber="378" type="nomenclature">
<paragraph id="C4423680FFAC1219FE91F968FDD5AF3C" blockId="18.[261,681,1782,1838]" pageId="18" pageNumber="378">
<heading id="9F0A81ECFFAC1219FE91F968FDD5AF3C" centered="true" fontSize="9" level="2" pageId="18" pageNumber="378" reason="2">
<smallCapsWord id="C2A4A05CFFAC1219FE91F968FE4FAF1E" baselines="1801,1801" box="[261,473,1782,1807]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Phylogeography" pageId="18" pageNumber="378">PHYLOGEOGRAPHY</smallCapsWord>
<smallCapsWord id="C2A4A05CFFAC1219FE75F964FE68AF1E" baselines="1801" box="[481,510,1786,1806]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="of" pageId="18" pageNumber="378">OF</smallCapsWord>
<taxonomicName id="03FD4D03FFAC1219FD91F969FDD5AF3C" ID-CoL="KX5C" authority="AND B. GEMINATUS" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="soporator">
<emphasis id="F689EA92FFAC1219FD91F969FD81AF1E" box="[517,535,1783,1806]" italics="true" pageId="18" pageNumber="378">B</emphasis>
.
<smallCapsWord id="C2A4A05CFFAC1219FDB1F964FD3FAF1E" baselines="1801" box="[549,681,1786,1806]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="soporator" pageId="18" pageNumber="378">
<emphasis id="F689EA92FFAC1219FDB1F964FD3FAF1E" box="[549,681,1786,1806]" italics="true" pageId="18" pageNumber="378">SOPORATOR</emphasis>
</smallCapsWord>
<smallCapsWord id="C2A4A05CFFAC1219FEFEF886FE0FAF3C" baselines="1831" box="[362,409,1816,1836]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="and" pageId="18" pageNumber="378">AND</smallCapsWord>
<emphasis id="F689EA92FFAC1219FE34F88BFE24AF3C" box="[416,434,1813,1836]" italics="true" pageId="18" pageNumber="378">B</emphasis>
.
<smallCapsWord id="C2A4A05CFFAC1219FE2BF886FDD5AF3C" baselines="1831" box="[447,579,1816,1836]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="geminatus" pageId="18" pageNumber="378">
<emphasis id="F689EA92FFAC1219FE2BF886FDD5AF3C" box="[447,579,1816,1836]" italics="true" pageId="18" pageNumber="378">GEMINATUS</emphasis>
</smallCapsWord>
</taxonomicName>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="8CE7650BFFAC1218FF37F8A3FB1EA8E9" lastPageId="19" lastPageNumber="379" pageId="18" pageNumber="378" type="description">
<paragraph id="C4423680FFAC1219FF37F8A3FAB6AC43" blockId="18.[163,780,1853,1906]" lastBlockId="18.[827,1444,197,1905]" pageId="18" pageNumber="378">
The phylogeographic analyses revealed a similar pattern of genetic diversity for both
<taxonomicName id="03FD4D03FFAC1219FDBDF8C3FC21A8CB" authority="and B. geminatus" box="[553,951,198,1906]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="379" phylum="Chordata" rank="species" species="soporator">
<emphasis id="F689EA92FFAC1219FDBDF8C3FD20AF62" box="[553,694,1885,1906]" italics="true" pageId="18" pageNumber="378">B. soporator</emphasis>
and
<emphasis id="F689EA92FFAC1219FD66F8C3FC92AF62" box="[754,772,1885,1906]" italics="true" pageId="18" pageNumber="378">B</emphasis>
.
<emphasis id="F689EA92FFAC1219FCAFFF58FC21A8CB" box="[827,951,198,219]" italics="true" pageId="18" pageNumber="378">geminatus</emphasis>
</taxonomicName>
. Both species presented deeply differentiated lineages (CAL and EA lineages for
<taxonomicName id="03FD4D03FFAC1219FAB8FF7BFC05A908" authority="and" authorityName="AND" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="379" phylum="Chordata" rank="species" species="soporator">
<emphasis id="F689EA92FFAC1219FAB8FF7BFAA8A8EA" box="[1324,1342,229,250]" italics="true" pageId="18" pageNumber="378">B</emphasis>
.
<emphasis id="F689EA92FFAC1219FAD9FF7BFCCBA908" italics="true" pageId="18" pageNumber="378">soporator</emphasis>
and
</taxonomicName>
NWA lineage for
<taxonomicName id="03FD4D03FFAC1219FBE6FE9DFA84A908" authorityName="Tornabene, Baldwin &amp; Pezold" authorityYear="2010" box="[1138,1298,259,280]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="geminatus">
<emphasis id="F689EA92FFAC1219FBE6FE9DFB12A908" box="[1138,1156,259,280]" italics="true" pageId="18" pageNumber="378">B</emphasis>
.
<emphasis id="F689EA92FFAC1219FB01FE9DFA84A908" box="[1173,1298,259,280]" italics="true" pageId="18" pageNumber="378">geminatus</emphasis>
</taxonomicName>
), separated from other related lineages (WA lineages) by 613 and 2534 mutations for
<emphasis id="F689EA92FFAC1219FBF0FEDEFB02A945" box="[1124,1172,320,341]" italics="true" pageId="18" pageNumber="378">COI</emphasis>
and cyt
<emphasis id="F689EA92FFAC1219FB6FFEDEFA9FA945" box="[1275,1289,320,341]" italics="true" pageId="18" pageNumber="378">b</emphasis>
, respectively (
<figureCitation id="5CC62A05FFAC1219FCD7FEC0FC1FA964" box="[835,905,350,372]" captionStart="Figure 4" captionStartId="11.[145,223,1672,1694]" captionTargetBox="[242,1329,777,1632]" captionTargetId="figure-341@11.[241,1329,776,1633]" captionTargetPageId="11" captionText="Figure 4. Genealogical relationships among haplotypes of Bathygobius soporator and their geographic distribution based on COI. In the parsimony median-joining network, sizes of the circles are proportional to the frequency of each haplotype. Line lengths indicate the number of mutations between haplotypes (shortest lines = 1 mutation). Pie charts in the map represent the proportion of each lineage at each location (correspondence between circle sizes and number of individuals is indicated in the legend). Colour coding of network and pie charts corresponds to lineages observed: dark grey, WA1 lineage; light grey, WA2 lineage; white, CAL lineage; black, EA lineage. In the map, the dark grey area corresponds to the warm-temperate biogeographic province (Carolina) and the light grey areas to tropical biogeographic provinces [Caribbean, Brazilian and Tropical East Atlantic (TEA); Briggs &amp; Bowen, 2013]." pageId="18" pageNumber="378">Figs 4</figureCitation>
,
<figureCitation id="5CC62A05FFAC1219FC02FEC0FC32A964" box="[918,932,350,372]" captionStart="Figure 6" captionStartId="14.[163,241,1688,1710]" captionTargetBox="[348,1259,931,1648]" captionTargetId="figure-273@14.[347,1259,930,1648]" captionTargetPageId="14" captionText="Figure 6. Genealogical relationships among haplotypes of Bathygobius geminatus and their geographic distribution based on COI. In the parsimony median-joining network, sizes of the circles are proportional to the frequency of each haplotype. Line lengths indicate the number of mutations between haplotypes (shortest lines = 1 mutation). Pie charts in the map represent the ratio of specimens of each lineage at each location (correspondence between circle sizes and number of individuals is indicated in the legend). Colour coding of network and pie charts corresponds to lineages observed: dark grey, WA1 lineage; light grey, WA2 lineage; white, NWA lineage. In the map, the dark grey area corresponds to the warm-temperate biogeographic province (Carolina) and the light grey areas to tropical biogeographic provinces (Caribbean and Brazilian; Briggs &amp; Bowen, 2013)." pageId="18" pageNumber="378">6</figureCitation>
; Supporting Information, Fig. S8). This deep divergence could indicate a relatively old partition corresponding to the major biogeographic provinces. In some reef fishes and sea urchins, for example, the deep genetic divergences observed among Atlantic biogeographic provinces (
<emphasis id="F689EA92FFAC1219FBD2FE66FBFAAA1D" box="[1094,1132,504,525]" italics="true" pageId="18" pageNumber="378">d =</emphasis>
2.312.7% for cyt
<emphasis id="F689EA92FFAC1219FADFFE66FACFAA1D" box="[1355,1369,504,525]" italics="true" pageId="18" pageNumber="378">b</emphasis>
) were attributed to the presence of cryptic species within the Atlantic (
<bibRefCitation id="A06C4B71FFAC1219FC33FDA8FBFEAA5A" author="Muss A &amp; Robertson DR &amp; Stepien CA &amp; Wirtz P &amp; Bowen BW" box="[935,1128,565,587]" pageId="18" pageNumber="378" pagination="561 - 572" refId="ref19436" refString="Muss A, Robertson DR, Stepien CA, Wirtz P, Bowen BW. 2001. Phylogeography of Ophioblennius: the role of ocean currents and geography in reef fish evolution. Evolution 55: 561-572." type="journal article" year="2001">
Muss
<emphasis id="F689EA92FFAC1219FC7FFDA8FBB2AA5A" box="[1003,1060,565,587]" italics="true" pageId="18" pageNumber="378">et al.</emphasis>
, 2001
</bibRefCitation>
;
<bibRefCitation id="A06C4B71FFAC1219FBE1FDABFAD4AA5A" author="Carlin JL &amp; Robertson DR &amp; Bowen BW" box="[1141,1346,565,587]" pageId="18" pageNumber="378" pagination="1057 - 1069" refId="ref17205" refString="Carlin JL, Robertson DR, Bowen BW. 2003. Ancient divergences and recent connections in two tropical Atlantic reef fishes Epinephelus adscensionis and Rypticus saponaceous (Percoidei: Serranidae). Marine Biology 143: 1057-1069." type="journal article" year="2003">
Carlin
<emphasis id="F689EA92FFAC1219FB52FDA8FB68AA5A" box="[1222,1278,565,587]" italics="true" pageId="18" pageNumber="378">et al.</emphasis>
, 2003
</bibRefCitation>
;
<bibRefCitation id="A06C4B71FFAC1219FADBFDABFC20AA79" author="Lessios HA &amp; Kane J &amp; Robertson DR" pageId="18" pageNumber="378" pagination="2026 - 2036" refId="ref18647" refString="Lessios HA, Kane J, Robertson DR. 2003. Phylogeography of the pantropical sea urchin Tripneustes: contrasting patterns of population structure between oceans. Evolution 57: 2026-2036." type="journal article" year="2003">
Lessios
<emphasis id="F689EA92FFAC1219FCAFFDCAFCE4AA79" box="[827,882,596,617]" italics="true" pageId="18" pageNumber="378">et al.</emphasis>
, 2003
</bibRefCitation>
;
<bibRefCitation id="A06C4B71FFAC1219FC56FDCAFBDDAA79" author="Rocha LA" box="[962,1099,596,618]" pageId="18" pageNumber="378" pagination="770 - 782" refId="ref19839" refString="Rocha LA. 2004. Mitochondrial DNA and color pattern variation in three Western Atlantic Halichoeres (Labridae), with the revalidation of two species. Copeia 2004: 770-782." type="journal article" year="2004">Rocha, 2004</bibRefCitation>
). The divergence values of the most differentiated lineages of
<taxonomicName id="03FD4D03FFAC1219FB39FDEDFAACAA98" box="[1197,1338,627,648]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="soporator">
<emphasis id="F689EA92FFAC1219FB39FDEDFAACAA98" box="[1197,1338,627,648]" italics="true" pageId="18" pageNumber="378">B. soporator</emphasis>
</taxonomicName>
(median
<emphasis id="F689EA92FFAC1219FCAFFD0FFCF5AAB7" box="[827,867,657,679]" italics="true" pageId="18" pageNumber="378">d =</emphasis>
2.7% for
<emphasis id="F689EA92FFAC1219FC49FD0FFB98AAB6" box="[989,1038,657,678]" italics="true" pageId="18" pageNumber="378">COI</emphasis>
; median
<emphasis id="F689EA92FFAC1219FB10FD0FFB05AAB6" box="[1156,1171,657,678]" italics="true" pageId="18" pageNumber="378">d</emphasis>
= 4.1% for cyt
<emphasis id="F689EA92FFAC1219FAC1FD0FFAF5AAB6" box="[1365,1379,657,678]" italics="true" pageId="18" pageNumber="378">b</emphasis>
) and
<taxonomicName id="03FD4D03FFAC1219FCAFFD2EFC49AAD5" authorityName="Tornabene, Baldwin &amp; Pezold" authorityYear="2010" box="[827,991,688,709]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="geminatus">
<emphasis id="F689EA92FFAC1219FCAFFD2EFCDBAAD5" box="[827,845,688,709]" italics="true" pageId="18" pageNumber="378">B</emphasis>
.
<emphasis id="F689EA92FFAC1219FCCBFD2EFC49AAD5" box="[863,991,688,709]" italics="true" pageId="18" pageNumber="378">geminatus</emphasis>
</taxonomicName>
(median
<emphasis id="F689EA92FFAC1219FBCFFD2EFB13AAD5" box="[1115,1157,688,709]" italics="true" pageId="18" pageNumber="378">d =</emphasis>
1.8% for
<emphasis id="F689EA92FFAC1219FA90FD2EFAA0AAD5" box="[1284,1334,688,709]" italics="true" pageId="18" pageNumber="378">COI</emphasis>
; median
<emphasis id="F689EA92FFAC1219FCAFFD50FCDCAAF3" box="[827,842,718,739]" italics="true" pageId="18" pageNumber="378">d</emphasis>
= 2.7% for cyt
<emphasis id="F689EA92FFAC1219FB84FD50FB88AAF3" box="[1040,1054,718,739]" italics="true" pageId="18" pageNumber="378">b</emphasis>
) are similar to those observed between cryptic species of some reef fishes, but are smaller than those found between sister species in the genus
<taxonomicName id="03FD4D03FFAC1219FC1DFCB4FB8AAB2F" authorityName="Bleeker" authorityYear="1878" box="[905,1052,810,831]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="genus">
<emphasis id="F689EA92FFAC1219FC1DFCB4FB8AAB2F" box="[905,1052,810,831]" italics="true" pageId="18" pageNumber="378">Bathygobius</emphasis>
</taxonomicName>
(
<tableCitation id="897F033BFFAC1219FBBAFCB4FB13AB50" box="[1070,1157,810,832]" captionStart="Table 1" captionStartId="6.[143,207,606,628]" captionText="Table 1. Average K2P distance summary for Bathygobius species" pageId="18" pageNumber="378">Table 1</tableCitation>
). Because of the lack of diagnostic morphological or pigmentation characters (
<bibRefCitation id="A06C4B71FFAC1219FCD7FCF6FBD8AB6D" author="Tornabene L &amp; Baldwin C &amp; Weigt LA &amp; Pezold F" box="[835,1102,872,894]" pageId="18" pageNumber="378" pagination="141 - 170" refId="ref20692" refString="Tornabene L, Baldwin C, Weigt LA, Pezold F. 2010. Exploring the diversity of western Atlantic Bathygobius (Teleostei: Gobiidae) with cytocrome c oxidase-I, with descriptions of two new species. Aqua 16: 141-170." type="journal article" year="2010">
Tornabene
<emphasis id="F689EA92FFAC1219FC5EFCF6FB90AB6D" box="[970,1030,872,893]" italics="true" pageId="18" pageNumber="378">et al.</emphasis>
, 2010
</bibRefCitation>
), and the monomorphism in the nuclear genes
<emphasis id="F689EA92FFAC1219FB86FC19FBCEAB8C" box="[1042,1112,903,924]" italics="true" pageId="18" pageNumber="378">RAG1</emphasis>
(
<bibRefCitation id="A06C4B71FFAC1219FBFCFC18FA0CAB8C" author="Tornabene L &amp; Pezold F" box="[1128,1434,902,924]" pageId="18" pageNumber="378" pagination="27 - 36" refId="ref20737" refString="Tornabene L, Pezold F. 2011. Phylogenetic analysis of Western Atlantic Bathygobius (Teleostei: Gobiidae). Zootaxa 3042: 27-36." type="journal article" year="2011">Tornabene &amp; Pezold, 2011</bibRefCitation>
) and Rhodopsin (data not shown), we conservatively chose not to assign those lineages to distinct species. Genetic divergence without obvious morphological differences has been observed in the wrasse
<taxonomicName id="03FD4D03FFAC1219FA89FB9FFC3DAC25" family="Labridae" genus="Halichoeres" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="bivittatus">
<emphasis id="F689EA92FFAC1219FA89FB9FFC3DAC25" italics="true" pageId="18" pageNumber="378">Halichoeres bivittatus</emphasis>
</taxonomicName>
between the tropical and subtropical habitats (
<emphasis id="F689EA92FFAC1219FCE2FBA0FC0DAC44" box="[886,923,1086,1108]" italics="true" pageId="18" pageNumber="378">d =</emphasis>
3.4% for cyt
<emphasis id="F689EA92FFAC1219FBBAFBA0FBAAAC43" box="[1070,1084,1086,1107]" italics="true" pageId="18" pageNumber="378">b</emphasis>
;
<bibRefCitation id="A06C4B71FFAC1219FBDDFBA0FA87AC44" author="Rocha LA &amp; Robertson DR &amp; Roman J &amp; Bowen BW" box="[1097,1297,1086,1108]" pageId="18" pageNumber="378" pagination="573 - 579" refId="ref19957" refString="Rocha LA, Robertson DR, Roman J, Bowen BW. 2005. Ecological speciation in tropical reef fishes. Proceedings of the Royal Society of London B: Biological Sciences 272: 573-579." type="journal article" year="2005">
Rocha
<emphasis id="F689EA92FFAC1219FB02FBA1FB58AC43" box="[1174,1230,1086,1108]" italics="true" pageId="18" pageNumber="378">et al.</emphasis>
, 2005
</bibRefCitation>
).
</paragraph>
<paragraph id="C4423680FFAC1219FCC7FBC3FB5AAEE6" blockId="18.[827,1444,197,1905]" pageId="18" pageNumber="378">
The two most closely related lineages (WA1 and WA2) of
<taxonomicName id="03FD4D03FFAC1219FCCCFBE2FB2AAC81" authority="and B. geminatus" box="[856,1212,1148,1170]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="379" phylum="Chordata" rank="species" species="soporator">
<emphasis id="F689EA92FFAC1219FCCCFBE2FC73AC81" box="[856,997,1148,1169]" italics="true" pageId="18" pageNumber="378">B. soporator</emphasis>
and
<emphasis id="F689EA92FFAC1219FBB6FBE2FBA2AC81" box="[1058,1076,1148,1169]" italics="true" pageId="18" pageNumber="378">B</emphasis>
.
<emphasis id="F689EA92FFAC1219FBD6FBE2FB2AAC81" box="[1090,1212,1148,1169]" italics="true" pageId="18" pageNumber="378">geminatus</emphasis>
</taxonomicName>
were also observed in sympatry throughout the tropical Western Atlantic and were separated by two
<emphasis id="F689EA92FFAC1219FBE8FB27FB3AACDE" box="[1148,1196,1209,1230]" italics="true" pageId="18" pageNumber="378">COI</emphasis>
and five to seven cyt
<emphasis id="F689EA92FFAC1219FCAFFB46FCDFACFD" box="[827,841,1240,1261]" italics="true" pageId="18" pageNumber="378">b</emphasis>
mutations, indicating a recent divergence (
<figureCitation id="5CC62A05FFAC1219FAAFFB46FA14ACFD" box="[1339,1410,1240,1262]" captionStart="Figure 4" captionStartId="11.[145,223,1672,1694]" captionTargetBox="[242,1329,777,1632]" captionTargetId="figure-341@11.[241,1329,776,1633]" captionTargetPageId="11" captionText="Figure 4. Genealogical relationships among haplotypes of Bathygobius soporator and their geographic distribution based on COI. In the parsimony median-joining network, sizes of the circles are proportional to the frequency of each haplotype. Line lengths indicate the number of mutations between haplotypes (shortest lines = 1 mutation). Pie charts in the map represent the proportion of each lineage at each location (correspondence between circle sizes and number of individuals is indicated in the legend). Colour coding of network and pie charts corresponds to lineages observed: dark grey, WA1 lineage; light grey, WA2 lineage; white, CAL lineage; black, EA lineage. In the map, the dark grey area corresponds to the warm-temperate biogeographic province (Carolina) and the light grey areas to tropical biogeographic provinces [Caribbean, Brazilian and Tropical East Atlantic (TEA); Briggs &amp; Bowen, 2013]." pageId="18" pageNumber="378">Figs 4</figureCitation>
,
<figureCitation id="5CC62A05FFAC1219FA1BFB46FA0BACFE" box="[1423,1437,1240,1262]" captionStart="Figure 6" captionStartId="14.[163,241,1688,1710]" captionTargetBox="[348,1259,931,1648]" captionTargetId="figure-273@14.[347,1259,930,1648]" captionTargetPageId="14" captionText="Figure 6. Genealogical relationships among haplotypes of Bathygobius geminatus and their geographic distribution based on COI. In the parsimony median-joining network, sizes of the circles are proportional to the frequency of each haplotype. Line lengths indicate the number of mutations between haplotypes (shortest lines = 1 mutation). Pie charts in the map represent the ratio of specimens of each lineage at each location (correspondence between circle sizes and number of individuals is indicated in the legend). Colour coding of network and pie charts corresponds to lineages observed: dark grey, WA1 lineage; light grey, WA2 lineage; white, NWA lineage. In the map, the dark grey area corresponds to the warm-temperate biogeographic province (Carolina) and the light grey areas to tropical biogeographic provinces (Caribbean and Brazilian; Briggs &amp; Bowen, 2013)." pageId="18" pageNumber="378">6</figureCitation>
; Supporting Information, Fig. S8). Co-existence of different mitochondrial lineages in sympatry has also been observed in reef fishes such as the surgeonfish
<taxonomicName id="03FD4D03FFAC1219FCAFFACDFB7AAD77" authority="(Horne et al., 2008)" baseAuthorityName="Horne" baseAuthorityYear="2008" box="[827,1260,1362,1384]" family="Acanthuridae" genus="Naso" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="brevirostris">
<emphasis id="F689EA92FFAC1219FCAFFACDFB94AD77" box="[827,1026,1362,1384]" italics="true" pageId="18" pageNumber="378">Naso brevirostris</emphasis>
(
<bibRefCitation id="A06C4B71FFAC1219FB87FACDFB75AD77" author="Horne JB &amp; van Herwerden L &amp; Choat JH &amp; Robertson DR" box="[1043,1251,1362,1384]" pageId="18" pageNumber="378" pagination="629 - 638" refId="ref18409" refString="Horne JB, van Herwerden L, Choat JH, Robertson DR. 2008. High population connectivity across the Indo-Pacific: congruent lack of phylogeographic structure in three reef fish congeners. Molecular Phylogenetics and Evolution 49: 629-638." type="journal article" year="2008">
Horne
<emphasis id="F689EA92FFAC1219FBF7FACDFB0BAD77" box="[1123,1181,1362,1384]" italics="true" pageId="18" pageNumber="378">et al.</emphasis>
, 2008
</bibRefCitation>
)
</taxonomicName>
, the coral trout
<taxonomicName id="03FD4D03FFAC1219FCAFFAEFFBF6AD96" baseAuthorityName="Bloch" baseAuthorityYear="1790" box="[827,1120,1393,1414]" family="Serranidae" genus="Plectropomus" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="maculatus">
<emphasis id="F689EA92FFAC1219FCAFFAEFFBF6AD96" box="[827,1120,1393,1414]" italics="true" pageId="18" pageNumber="378">Plectropomus maculatus</emphasis>
</taxonomicName>
and the snapper
<taxonomicName id="03FD4D03FFAC1219FAA3FAECFB21ADB5" authority="(Evans et al., 2010)" baseAuthorityName="Evans" baseAuthorityYear="2010" family="Lutjanidae" genus="Lutjanus" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="carponotatus">
<emphasis id="F689EA92FFAC1219FAA3FAECFC46ADB5" italics="true" pageId="18" pageNumber="378">Lutjanus carponotatus</emphasis>
(
<bibRefCitation id="A06C4B71FFAC1219FC74FA0EFB3BADB5" author="Evans RD &amp; van Herwerden L &amp; Russ GR &amp; Frisch AJ" box="[992,1197,1424,1445]" pageId="18" pageNumber="378" pagination="16 - 25" refId="ref17704" refString="Evans RD, van Herwerden L, Russ GR, Frisch AJ. 2010. Strong genetic but not spatial subdivision of two reef fish species targeted by fishers on the Great Barrier Reef. Fisheries Research 102: 16-25." type="journal article" year="2010">
Evans
<emphasis id="F689EA92FFAC1219FBBBFA0EFBFEADB5" box="[1071,1128,1424,1445]" italics="true" pageId="18" pageNumber="378">et al.</emphasis>
, 2010
</bibRefCitation>
)
</taxonomicName>
. In each WA lineage of
<taxonomicName id="03FD4D03FFAC1219FCC2FA31FC49ADD4" box="[854,991,1455,1476]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="soporator">
<emphasis id="F689EA92FFAC1219FCC2FA31FCFEADD4" box="[854,872,1455,1476]" italics="true" pageId="18" pageNumber="378">B</emphasis>
.
<emphasis id="F689EA92FFAC1219FCE0FA31FC49ADD4" box="[884,991,1455,1476]" italics="true" pageId="18" pageNumber="378">soporator</emphasis>
</taxonomicName>
, the Caribbean and Brazilian provinces shared the most common haplotype and four other central haplotypes. The central position of shared haplotypes indicates an old age for the connections between provinces. In
<taxonomicName id="03FD4D03FFAC1219FC4FF9B4FBE0AE2F" authorityName="Tornabene, Baldwin &amp; Pezold" authorityYear="2010" box="[987,1142,1577,1599]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="geminatus">
<emphasis id="F689EA92FFAC1219FC4FF9B4FC7BAE2F" box="[987,1005,1578,1599]" italics="true" pageId="18" pageNumber="378">B</emphasis>
.
<emphasis id="F689EA92FFAC1219FC68F9B4FBE0AE2F" box="[1020,1142,1578,1599]" italics="true" pageId="18" pageNumber="378">geminatus</emphasis>
</taxonomicName>
, our results suggest that the lineages co-occur in the Brazilian coast and that the WA1 lineage may be restricted to the Brazilian province. However, because of the small sample sizes in the Caribbean, we cannot affirm that the WA1 lineage really does not occur in the Caribbean, as observed for the WA lineages of
<taxonomicName id="03FD4D03FFAC1219FBAFF97CFB53AEE7" box="[1083,1221,1761,1783]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="18" pageNumber="378" phylum="Chordata" rank="species" species="soporator">
<emphasis id="F689EA92FFAC1219FBAFF97CFBDBAEE7" box="[1083,1101,1762,1783]" italics="true" pageId="18" pageNumber="378">B</emphasis>
.
<emphasis id="F689EA92FFAC1219FBCEF97CFB53AEE7" box="[1114,1221,1762,1783]" italics="true" pageId="18" pageNumber="378">soporator</emphasis>
</taxonomicName>
.
</paragraph>
<paragraph id="C4423680FFAC1218FCC7F89EFE61ABAA" blockId="18.[827,1444,197,1905]" lastBlockId="19.[145,762,197,1875]" lastPageId="19" lastPageNumber="379" pageId="18" pageNumber="378">
Two primary hypotheses have been proposed to explain the high biodiversity of regions such as the Greater Caribbean: the centre of origin (CO) hypothesis and the centre of accumulation (CA) hypothesis (
<bibRefCitation id="A06C4B71FFAD1218FF0EFF5BFE15A8CB" author="Rocha LA &amp; Rocha CR &amp; Robertson DR &amp; Bowen BW" box="[154,387,197,219]" pageId="19" pageNumber="379" refId="ref19995" refString="Rocha LA, Rocha CR, Robertson DR, Bowen BW. 2008 b. Comparative phylogeography of Atlantic reef fishes indicates both origin and accumulation of diversity in the Caribbean. BMC Evolutionary Biology 8: 157." type="journal volume" year="2008">
Rocha
<emphasis id="F689EA92FFAD1218FF79FF58FEBCA8CA" box="[237,298,197,219]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2008b
</bibRefCitation>
). The CO hypothesis proposes that species originate in the centre and disperse to the periphery, whereas the CA hypothesis proposes that diversity centres accumulate species that originated elsewhere (
<bibRefCitation id="A06C4B71FFAD1218FEF3FEDEFDDBA946" author="Rocha LA &amp; Rocha CR &amp; Robertson DR &amp; Bowen BW" box="[359,589,320,342]" pageId="19" pageNumber="379" refId="ref19995" refString="Rocha LA, Rocha CR, Robertson DR, Bowen BW. 2008 b. Comparative phylogeography of Atlantic reef fishes indicates both origin and accumulation of diversity in the Caribbean. BMC Evolutionary Biology 8: 157." type="journal volume" year="2008">
Rocha
<emphasis id="F689EA92FFAD1218FE2DFEDEFE60A945" box="[441,502,320,341]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2008b
</bibRefCitation>
;
<bibRefCitation id="A06C4B71FFAD1218FDC9FEDEFF5EA964" author="Bowen BW &amp; Rocha LA &amp; Toonen RJ &amp; Karl SA &amp; ToBo Laboratory" pageId="19" pageNumber="379" pagination="359 - 366" refId="ref17115" refString="Bowen BW, Rocha LA, Toonen RJ, Karl SA; ToBo Laboratory. 2013. The origins of tropical marine biodiversity. Trends in Ecology &amp; Evolution 28: 359-366." type="journal article" year="2013">
Bowen
<emphasis id="F689EA92FFAD1218FD22FEDEFD64A945" box="[694,754,320,341]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2013
</bibRefCitation>
). Therefore, under a CO hypothesis, the ancestral haplotypes should be found at the centre of diversity, and under a CA hypothesis, the ancestral haplotypes should be found in peripheral populations. In
<taxonomicName id="03FD4D03FFAD1218FF05FE44FE8AA9FF" box="[145,284,474,495]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="19" pageNumber="379" phylum="Chordata" rank="species" species="soporator">
<emphasis id="F689EA92FFAD1218FF05FE44FE8AA9FF" box="[145,284,474,495]" italics="true" pageId="19" pageNumber="379">B. soporator</emphasis>
</taxonomicName>
, the ancestral haplotype was distributed in the Northwestern Atlantic (
<figureCitation id="5CC62A05FFAD1218FD9DFE66FDF6AA1E" box="[521,608,504,526]" captionStart="Figure 5" captionStartId="13.[145,224,1083,1105]" captionTargetBox="[243,1327,197,1043]" captionTargetId="figure-288@13.[241,1329,195,1043]" captionTargetPageId="13" captionText="Figure 5. (A) Bayesian phylogenetic tree of haplotypes and (B) BSPs for each lineage of Bathygobius soporator based on COI. Bayesian posterior probability values and ML bootstraps are indicated only for the nodes with over 60% support (50% majority-rule consensus tree). In the tree, B. soporator lineages are indicated by vertical bars. Colours denote the distribution as indicated by the embedded key. Current distributions of each haplotype are indicated at terminals. Pie charts of the nodes, with over 75% support for both inference methods, indicate the relative probabilities from ancestral distribution: Southwestern Atlantic (SWA), Northwestern Atlantic (NWA), Eastern Atlantic (EA) and Eastern Pacific (EP). For details of the ancestral distributions, see Table 6. In the BSP, the median estimate (black solid line) and 95% HPD limits (grey solid line) are indicated.The maximum time is the upper 95% HPD of the root height. Dotted lines correspond to the approximate onset of the expansion events.The main glaciations over the last 200 thousand years are shaded in grey: MIS6 (190130 ka), MIS4 (7060 ka) and MIS2 (2414 ka; Cohen &amp; Gibbard, 2011)." pageId="19" pageNumber="379">Fig. 5A</figureCitation>
; Supporting Information, Fig. S9A), indicating a Greater Caribbean ancestor for the lineages that dispersed towards the Southern Atlantic, supporting the CO hypothesis. In contrast, the ancestral distribution of
<taxonomicName id="03FD4D03FFAD1218FDC8FDEDFD6FAA98" authorityName="Tornabene, Baldwin &amp; Pezold" authorityYear="2010" box="[604,761,627,648]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="19" pageNumber="379" phylum="Chordata" rank="species" species="geminatus">
<emphasis id="F689EA92FFAD1218FDC8FDEDFDF8AA98" box="[604,622,627,648]" italics="true" pageId="19" pageNumber="379">B</emphasis>
.
<emphasis id="F689EA92FFAD1218FDEAFDEDFD6FAA98" box="[638,761,627,648]" italics="true" pageId="19" pageNumber="379">geminatus</emphasis>
</taxonomicName>
was in the Southwestern Atlantic (
<figureCitation id="5CC62A05FFAD1218FD88FD0FFDFAAAB6" box="[540,620,657,679]" captionStart="Figure 7" captionStartId="15.[145,224,1010,1032]" captionTargetBox="[243,1329,197,969]" captionTargetId="figure-29@15.[241,1329,195,970]" captionTargetPageId="15" captionText="Figure 7. (A) Bayesian phylogenetic tree of haplotypes and (B) BSPs for each lineage of Bathygobius geminatus based on COI. Bayesian posterior probability values and ML bootstraps are indicated only for the nodes with over 60% support (50% majority-rule consensus tree). In the tree, B. geminatus lineages are indicated by vertical bars. Colours denote the distribution as indicated by the embedded key. Current distributions of each haplotype are indicated at terminals. Pie charts of the nodes, with over 75% support for both inference methods, indicate the relative probabilities from ancestral distribution: Southwestern Atlantic (SWA) and Northwestern Atlantic (NWA). For details of the ancestral distributions, see Table 6. In the BSP, the median estimate (black solid line) and 95% HPD limits (grey solid line) are indicated. The maximum time is the upper 95% HPD of the root height. Dotted lines correspond to the approximate onset of the expansion events. The main glaciations over the last 200 thousand years are shaded in grey: MIS6 (190130 ka), MIS4 (7060 ka) and MIS2 (2414 ka; Cohen &amp; Gibbard, 2011)." pageId="19" pageNumber="379">Fig. 7A</figureCitation>
; Supporting Information, Fig. S9B), indicating that the lineages probably derived from a Brazilian ancestor that dispersed towards the Northern Atlantic, supporting the CA hypothesis. Genetic patterns that support both or either of the hypotheses for the Greater Caribbean have also been reported in other reef fishes (e.g.
<bibRefCitation id="A06C4B71FFAD1218FD27FCD7FE8BAB6E" author="Rocha LA &amp; Rocha CR &amp; Robertson DR &amp; Bowen BW" pageId="19" pageNumber="379" refId="ref19995" refString="Rocha LA, Rocha CR, Robertson DR, Bowen BW. 2008 b. Comparative phylogeography of Atlantic reef fishes indicates both origin and accumulation of diversity in the Caribbean. BMC Evolutionary Biology 8: 157." type="journal volume" year="2008">
Rocha
<emphasis id="F689EA92FFAD1218FF05FCF6FF5CAB6D" box="[145,202,872,893]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2008b
</bibRefCitation>
;
<bibRefCitation id="A06C4B71FFAD1218FEBEFCF6FDF8AB6D" author="Castellanos-Gell J &amp; Robainas-Barcia A &amp; Casane D &amp; Chevalier-Monteagudo P &amp; Pina-Amargos F &amp; Machado E" box="[298,622,872,894]" pageId="19" pageNumber="379" pagination="1561 - 1565" refId="ref17246" refString="Castellanos-Gell J, Robainas-Barcia A, Casane D, Chevalier-Monteagudo P, Pina-Amargos F, Garcia- Machado E. 2012. The surgeonfish, Acanthurus bahianus, has crossed the Amazon-Orinoco outflow barrier. Marine Biology 159: 1561-1565." type="journal article" year="2012">
Castellanos-Gell
<emphasis id="F689EA92FFAD1218FE64FCF6FDBFAB6D" box="[496,553,872,893]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2012
</bibRefCitation>
), indicating that these two models are not mutually exclusive, but instead may operate in concert.
</paragraph>
<paragraph id="C4423680FFAD1218FF3DFC5AFB1EA8E9" blockId="19.[145,762,197,1875]" lastBlockId="19.[809,1426,197,249]" pageId="19" pageNumber="379">
Recent phylogeographic and demographic studies have shown that climatic fluctuations during the Pleistocene (
<emphasis id="F689EA92FFAD1218FEB5FB9CFEBAAC07" box="[289,300,1026,1047]" italics="true" pageId="19" pageNumber="379">c</emphasis>
. 2.6 Mya to 10 ka) influenced the demographic history and distribution of several marine species (e.g.
<bibRefCitation id="A06C4B71FFAD1218FEB6FBA1FE6EAC44" author="Bowen BW &amp; Bass AL &amp; Muss A &amp; Carlin J &amp; Robertson DR" box="[290,504,1086,1108]" pageId="19" pageNumber="379" pagination="899 - 913" refId="ref17070" refString="Bowen BW, Bass AL, Muss A, Carlin J, Robertson DR. 2006. Phylogeography of two Atlantic squirrelfishes (Family Holocentridae): exploring links between pelagic larval duration and population connectivity. Marine Biology 149: 899-913." type="journal article" year="2006">
Bowen
<emphasis id="F689EA92FFAD1218FEECFBA1FE24AC43" box="[376,434,1086,1108]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2006
</bibRefCitation>
;
<bibRefCitation id="A06C4B71FFAD1218FD92FBA0FF5FAC62" author="Rodriguez-Rey GT &amp; Sole-Cava AM &amp; Lazoski C" pageId="19" pageNumber="379" pagination="59 - 69" refId="ref20034" refString="Rodriguez-Rey GT, Sole-Cava AM, Lazoski C. 2013. Genetic homogeneity and historical expansions of the slipper lobster, Scyllarides brasiliensis, in the south-west Atlantic. Marine and Freshwater Research 65: 59-69." type="journal article" year="2013">
Rodríguez-Rey
<emphasis id="F689EA92FFAD1218FD2DFBA1FD65AC43" box="[697,755,1086,1108]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2013
</bibRefCitation>
). During those periods, coral reef habitats experienced massive fluctuations in distribution and quality because of changes in sea level and temperature (
<bibRefCitation id="A06C4B71FFAD1218FF0DFB27FE87ACDF" author="Daly RA" box="[153,273,1209,1231]" pageId="19" pageNumber="379" pagination="155 - 251" refId="ref17466" refString="Daly RA. 1915. The glacial-control theory of coral reefs. Proceedings of the American Academy of Arts and Sciences 51: 155-251." type="journal article" year="1915">Daly, 1915</bibRefCitation>
;
<bibRefCitation id="A06C4B71FFAD1218FE8BFB27FD99ACDE" author="Kiessling W &amp; Simpson C &amp; Beck B &amp; Mewis H &amp; Pandolfi JM" box="[287,527,1209,1231]" pageId="19" pageNumber="379" pagination="21378 - 21383" refId="ref18523" refString="Kiessling W, Simpson C, Beck B, Mewis H, Pandolfi JM. 2012. Equatorial decline of reef corals during the last Pleistocene interglacial. Proceedings of the National Academy of Sciences of the United States of America 109: 21378-21383." type="journal article" year="2012">
Kiessling
<emphasis id="F689EA92FFAD1218FE06FB24FE5DACDE" box="[402,459,1209,1231]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2012
</bibRefCitation>
). Reef habitats may have been reduced by 90% in the Caribbean during the glacial periods, when the sea level was at least
<quantity id="03059B65FFAD1218FF05FA8BFF4FAD3A" box="[145,217,1301,1322]" metricMagnitude="2" metricUnit="m" metricValue="1.0" pageId="19" pageNumber="379" unit="m" value="100.0">100 m</quantity>
below current levels, decreasing the available habitats for reef fishes and the connectivity among populations (
<bibRefCitation id="A06C4B71FFAD1218FEA4FACCFD0FAD77" author="Bellwood DR &amp; Wainwright PC" box="[304,665,1362,1384]" pageId="19" pageNumber="379" pagination="5 - 32" refId="ref16945" refString="Bellwood DR, Wainwright PC. 2002. The history and biogeography of fishes on coral reefs. In: Sale PF, ed. Coral reef fishes: dynamics and diversity on a complex ecosystem. New York: Academic Press, 5-32." type="book chapter" year="2002">Bellwood &amp; Wainwright, 2002</bibRefCitation>
;
<bibRefCitation id="A06C4B71FFAD1218FD3DFACDFE8AAD97" author="Bowen BW &amp; Bass AL &amp; Muss A &amp; Carlin J &amp; Robertson DR" pageId="19" pageNumber="379" pagination="899 - 913" refId="ref17070" refString="Bowen BW, Bass AL, Muss A, Carlin J, Robertson DR. 2006. Phylogeography of two Atlantic squirrelfishes (Family Holocentridae): exploring links between pelagic larval duration and population connectivity. Marine Biology 149: 899-913." type="journal article" year="2006">
Bowen
<emphasis id="F689EA92FFAD1218FF05FAECFF46AD96" box="[145,208,1393,1415]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2006
</bibRefCitation>
). During interglacial periods, the rising sea level increased habitat availability, resulting in population expansions of marine species (
<bibRefCitation id="A06C4B71FFAD1218FD3EFA31FE98ADF3" author="Bowen BW &amp; Bass AL &amp; Muss A &amp; Carlin J &amp; Robertson DR" pageId="19" pageNumber="379" pagination="899 - 913" refId="ref17070" refString="Bowen BW, Bass AL, Muss A, Carlin J, Robertson DR. 2006. Phylogeography of two Atlantic squirrelfishes (Family Holocentridae): exploring links between pelagic larval duration and population connectivity. Marine Biology 149: 899-913." type="journal article" year="2006">
Bowen
<emphasis id="F689EA92FFAD1218FF05FA50FF5CADF2" box="[145,202,1485,1507]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2006
</bibRefCitation>
). Our results indicate that the expansions observed in the lineages of both species of
<taxonomicName id="03FD4D03FFAD1218FDFFFA72FD6FAE11" authorityName="Bleeker" authorityYear="1878" box="[619,761,1516,1537]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="19" pageNumber="379" phylum="Chordata" rank="genus">
<emphasis id="F689EA92FFAD1218FDFFFA72FD6FAE11" box="[619,761,1516,1537]" italics="true" pageId="19" pageNumber="379">Bathygobius</emphasis>
</taxonomicName>
could have occurred during interglacial periods in Late Pleistocene (MIS5 and MIS3;
<figureCitation id="5CC62A05FFAD1218FE7AF9B7FDD1AE2F" box="[494,583,1577,1599]" captionStart="Figure 5" captionStartId="13.[145,224,1083,1105]" captionTargetBox="[243,1327,197,1043]" captionTargetId="figure-288@13.[241,1329,195,1043]" captionTargetPageId="13" captionText="Figure 5. (A) Bayesian phylogenetic tree of haplotypes and (B) BSPs for each lineage of Bathygobius soporator based on COI. Bayesian posterior probability values and ML bootstraps are indicated only for the nodes with over 60% support (50% majority-rule consensus tree). In the tree, B. soporator lineages are indicated by vertical bars. Colours denote the distribution as indicated by the embedded key. Current distributions of each haplotype are indicated at terminals. Pie charts of the nodes, with over 75% support for both inference methods, indicate the relative probabilities from ancestral distribution: Southwestern Atlantic (SWA), Northwestern Atlantic (NWA), Eastern Atlantic (EA) and Eastern Pacific (EP). For details of the ancestral distributions, see Table 6. In the BSP, the median estimate (black solid line) and 95% HPD limits (grey solid line) are indicated.The maximum time is the upper 95% HPD of the root height. Dotted lines correspond to the approximate onset of the expansion events.The main glaciations over the last 200 thousand years are shaded in grey: MIS6 (190130 ka), MIS4 (7060 ka) and MIS2 (2414 ka; Cohen &amp; Gibbard, 2011)." pageId="19" pageNumber="379">Figs 5B</figureCitation>
and
<figureCitation id="5CC62A05FFAD1218FD17F9B7FD34AE2E" box="[643,674,1577,1598]" captionStart="Figure 7" captionStartId="15.[145,224,1010,1032]" captionTargetBox="[243,1329,197,969]" captionTargetId="figure-29@15.[241,1329,195,970]" captionTargetPageId="15" captionText="Figure 7. (A) Bayesian phylogenetic tree of haplotypes and (B) BSPs for each lineage of Bathygobius geminatus based on COI. Bayesian posterior probability values and ML bootstraps are indicated only for the nodes with over 60% support (50% majority-rule consensus tree). In the tree, B. geminatus lineages are indicated by vertical bars. Colours denote the distribution as indicated by the embedded key. Current distributions of each haplotype are indicated at terminals. Pie charts of the nodes, with over 75% support for both inference methods, indicate the relative probabilities from ancestral distribution: Southwestern Atlantic (SWA) and Northwestern Atlantic (NWA). For details of the ancestral distributions, see Table 6. In the BSP, the median estimate (black solid line) and 95% HPD limits (grey solid line) are indicated. The maximum time is the upper 95% HPD of the root height. Dotted lines correspond to the approximate onset of the expansion events. The main glaciations over the last 200 thousand years are shaded in grey: MIS6 (190130 ka), MIS4 (7060 ka) and MIS2 (2414 ka; Cohen &amp; Gibbard, 2011)." pageId="19" pageNumber="379">7B</figureCitation>
). Thus, during those interglacial periods, the sea-level rise may have weakened the Amazon barrier (see the discussion below), increasing habitat availability and allowing the dispersal from Caribbean to
<collectingCountry id="BCEA7610FFAD1218FD99F93AFDC2AEAA" box="[525,596,1700,1722]" name="Brazil" pageId="19" pageNumber="379">Brazil</collectingCountry>
for
<taxonomicName id="03FD4D03FFAD1218FD10F93AFF75AEC8" authority="and" authorityName="AND" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="19" pageNumber="379" phylum="Chordata" rank="species" species="soporator">
<emphasis id="F689EA92FFAD1218FD10F93AFD00AEA9" box="[644,662,1700,1721]" italics="true" pageId="19" pageNumber="379">B</emphasis>
.
<emphasis id="F689EA92FFAD1218FD30F93AFF27AEC8" italics="true" pageId="19" pageNumber="379">soporator</emphasis>
and
</taxonomicName>
from
<collectingCountry id="BCEA7610FFAD1218FEB1F95CFEFDAEC8" box="[293,363,1730,1752]" name="Brazil" pageId="19" pageNumber="379">Brazil</collectingCountry>
to the Caribbean for
<taxonomicName id="03FD4D03FFAD1218FDCAF95DFD65AEC8" authorityName="Tornabene, Baldwin &amp; Pezold" authorityYear="2010" box="[606,755,1731,1752]" family="Gobiidae" genus="Bathygobius" kingdom="Animalia" order="Perciformes" pageId="19" pageNumber="379" phylum="Chordata" rank="species" species="geminatus">
<emphasis id="F689EA92FFAD1218FDCAF95DFDE6AEC8" box="[606,624,1731,1752]" italics="true" pageId="19" pageNumber="379">B</emphasis>
.
<emphasis id="F689EA92FFAD1218FDE9F95DFD65AEC8" box="[637,755,1731,1752]" italics="true" pageId="19" pageNumber="379">geminatus</emphasis>
</taxonomicName>
. Demographic expansion events have also been detected during interglacial periods in several reef fishes in the Atlantic [e.g. in the squirrelfishes
<taxonomicName id="03FD4D03FFAD1218FD8FF881FD6FAF23" authorityName="Cuvier" authorityYear="1829" box="[539,761,1822,1844]" family="Holocentridae" genus="Myripristis" kingdom="Animalia" order="Beryciformes" pageId="19" pageNumber="379" phylum="Chordata" rank="species" species="jacobus">
<emphasis id="F689EA92FFAD1218FD8FF881FD6FAF23" box="[539,761,1822,1844]" italics="true" pageId="19" pageNumber="379">Myripristis jacobus</emphasis>
</taxonomicName>
and
<taxonomicName id="03FD4D03FFAD1218FF51F8A3FD45AF42" authority="(Bowen et al., 2006)" baseAuthorityName="Bowen" baseAuthorityYear="2006" box="[197,723,1853,1875]" family="Holocentridae" genus="Holocentrus" kingdom="Animalia" order="Beryciformes" pageId="19" pageNumber="379" phylum="Chordata" rank="species" species="ascensionis">
<emphasis id="F689EA92FFAD1218FF51F8A3FE76AF42" box="[197,480,1853,1874]" italics="true" pageId="19" pageNumber="379">Holocentrus ascensionis</emphasis>
(
<bibRefCitation id="A06C4B71FFAD1218FE64F8A3FD5CAF43" author="Bowen BW &amp; Bass AL &amp; Muss A &amp; Carlin J &amp; Robertson DR" box="[496,714,1853,1875]" pageId="19" pageNumber="379" pagination="899 - 913" refId="ref17070" refString="Bowen BW, Bass AL, Muss A, Carlin J, Robertson DR. 2006. Phylogeography of two Atlantic squirrelfishes (Family Holocentridae): exploring links between pelagic larval duration and population connectivity. Marine Biology 149: 899-913." type="journal article" year="2006">
Bowen
<emphasis id="F689EA92FFAD1218FDDCF8A0FD15AF42" box="[584,643,1853,1875]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2006
</bibRefCitation>
)
</taxonomicName>
; in the sand goby
<taxonomicName id="03FD4D03FFAD1218FC47FF5BFB7DA8CA" baseAuthorityName="Pallas" baseAuthorityYear="1770" box="[979,1259,197,218]" family="Gobiidae" genus="Pomatoschistus" kingdom="Animalia" order="Perciformes" pageId="19" pageNumber="379" phylum="Chordata" rank="species" species="minutes">
<emphasis id="F689EA92FFAD1218FC47FF5BFB7DA8CA" box="[979,1259,197,218]" italics="true" pageId="19" pageNumber="379">Pomatoschistus minutes</emphasis>
</taxonomicName>
(
<bibRefCitation id="A06C4B71FFAD1218FB68FF5BFCF6A8E9" author="Gysels ES &amp; Hellemans B &amp; Patarnello T &amp; Volckaert FAM" pageId="19" pageNumber="379" pagination="561 - 576" refId="ref18203" refString="Gysels ES, Hellemans B, Patarnello T, Volckaert FAM. 2004. Current and historic gene flow of the sand goby Pomatoschistus minutus on the European Continental Shelf and in the Mediterranean Sea. Biological Journal of the Linnean Society 83: 561-576." type="journal article" year="2004">
Gysels
<emphasis id="F689EA92FFAD1218FAC5FF58FA1DA8CA" box="[1361,1419,197,219]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2004
</bibRefCitation>
;
<bibRefCitation id="A06C4B71FFAD1218FCF8FF7AFBE4A8E9" author="Larmuseau MHD &amp; Van Houdt JKJ &amp; Guelinckx J &amp; Hellemans B &amp; Volckaert FAM" box="[876,1138,227,249]" pageId="19" pageNumber="379" pagination="1138 - 1151" refId="ref18602" refString="Larmuseau MHD, Van Houdt JKJ, Guelinckx J, Hellemans B, Volckaert FAM. 2009. Distributional and demographic consequences of Pleistocene climate fluctuations for a marine demersal fish in the north-eastern Atlantic. Journal of Biogeography 36: 1138-1151." type="journal article" year="2009">
Larmuseau
<emphasis id="F689EA92FFAD1218FC62FF7AFBB8A8E8" box="[1014,1070,227,249]" italics="true" pageId="19" pageNumber="379">et al.</emphasis>
, 2009
</bibRefCitation>
)].
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,155 @@
<document id="BB036C047A77C4324AC8428839CCB4FD" ID-DOI="10.1093/zoolinnean/zlx018" ID-ISSN="0024-4082" ID-Zenodo-Dep="14812581" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779248170" checkinUser="plazi" docAuthor="White, William T, Corrigan, Shannon, Yang, Lei, Henderson, Aaron C, Bazinet, Adam L, Swofford, David L &amp; Naylor, Gavin J P" docDate="2018" docId="733644600C416879FF44FA4CFD943CDB" docLanguage="en" docName="zlx018.pdf" docOrigin="Zoological Journal of the Linnean Society 182 (1)" docSource="http://academic.oup.com/zoolinnean/article/182/1/50/3886052" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Mobula kuhlii" docType="treatment" docVersion="2" lastPageNumber="58" masterDocId="8F0F3C180C496871FFA6FFABFFD43A06" masterDocTitle="Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family" masterLastPageNumber="75" masterPageNumber="50" pageNumber="58" updateTime="1738779746131" updateUser="ExternalLinkService">
<mods:mods id="DA20C6CF7AEB094982E98FB644AF8ECB" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="8D30A71C3E10DC8DE1D6B9FE0288B178">
<mods:title id="51ABDFB31C54CBF5DFF64713A9A0909A">Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family</mods:title>
</mods:titleInfo>
<mods:name id="5563C8F9DF80F24D21AC4891A64A3389" type="personal">
<mods:role id="C2538D9F033853103AEB698294C0D67D">
<mods:roleTerm id="927E277A0EC97F0B218191B2F359A0C2">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="D6F6E982208BEE7F81DDA7E8AED2B5DC">White, William T</mods:namePart>
</mods:name>
<mods:name id="D8876DF6D047A1A219645A444BDE0F9D" type="personal">
<mods:role id="1BA5C228036404C5D093BA38FA4E7F8E">
<mods:roleTerm id="1C86B37D2AC7C9858E7EE7E74F62EE35">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="8B9C338DA7B962B7A67DFEEFBE2E6F0D">Corrigan, Shannon</mods:namePart>
</mods:name>
<mods:name id="EDD0E380C22B15114FFFF4D726220841" type="personal">
<mods:role id="C729F914B0341AABCFE41FAAF90D1D7A">
<mods:roleTerm id="E1CFD9DAABA82BE2D9CEA97A8B3E4556">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="D68BFBA5F816DC38374E4BDD1996F15B">Yang, Lei</mods:namePart>
</mods:name>
<mods:name id="B736D33808979E34F1E14C8BF2ACB86C" type="personal">
<mods:role id="9EC0DCA6AA32ED6F1412DABBF9504426">
<mods:roleTerm id="F5AE12F234D3123C954D9AEE6814D9A4">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="6D4E7EE749FB2EA02B22653456B33689">Henderson, Aaron C</mods:namePart>
</mods:name>
<mods:name id="0EF4DF3995BBC8908A0DF827036A0359" type="personal">
<mods:role id="3FFBCE5E5BA5D19D170BA9214B9D6C79">
<mods:roleTerm id="466D34B356B3408C2A7AE872106F8B69">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="AD7A47DD985AAD84CC26C68D7D122A03">Bazinet, Adam L</mods:namePart>
</mods:name>
<mods:name id="E42ED27AA04A05C23F74858145FB11D4" type="personal">
<mods:role id="940B0198DB885810CE01A827014F89E7">
<mods:roleTerm id="78767F7816EDEF64FE46DEE0AA1BDD8C">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="F315359E36396D64CAF6A7D3393CC6EE">Swofford, David L</mods:namePart>
</mods:name>
<mods:name id="349EAA32AE2F5AB97F3876F9000A6094" type="personal">
<mods:role id="94A98F2FD589AF6792F8C0691A25D10A">
<mods:roleTerm id="9E7DC3EC1DA3299841DA4DC0DCF93C62">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="6C03BBF4A92CE5999E9DDD8AA4D2A73A">Naylor, Gavin J P</mods:namePart>
</mods:name>
<mods:typeOfResource id="233EF83A844C8DE193FC2A01C0A95F82">text</mods:typeOfResource>
<mods:relatedItem id="CDFD0221F702A6749B4B1AA186E82F2E" type="host">
<mods:titleInfo id="4EAC21ED07A4EAFAF063124ECEDF1581">
<mods:title id="E86FDC7948CE734BB1A8020C23A783B5">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="ABF01E6C7B2F5658AA2A269B06A72216">
<mods:date id="1D8DDD3160EFCFB07B361D5F80FAF2E7">2018</mods:date>
<mods:detail id="94C9E06C5DAB800379DB4B73146E4095" type="pubDate">
<mods:number id="283358BF233D3D60DC2967D1D5D8251C">2018-01-31</mods:number>
</mods:detail>
<mods:detail id="742BE30AB8CE0C21C13E57DC1BEEA0A2" type="volume">
<mods:number id="2E2599859EEC45AD366773CFB6F925A0">182</mods:number>
</mods:detail>
<mods:detail id="4163DE51B099A68A9AD5B6D216F0392B" type="issue">
<mods:number id="25459D6AA692F971AAC654AD1EE6462E">1</mods:number>
</mods:detail>
<mods:extent id="38A0DE1BCF4359550A13AD70A5DD0AA5" unit="page">
<mods:start id="30BF9E4CA32F90855D7D9D7DCE53162F">50</mods:start>
<mods:end id="15FB1C5C5AB0EF74E144B6BF6F2CA98A">75</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="DB20E65B8F5C11B9F2C10611C1D3E6BE">
<mods:url id="57EB3FCF40846C513228A61A6A9DAA20">http://academic.oup.com/zoolinnean/article/182/1/50/3886052</mods:url>
</mods:location>
<mods:classification id="526FB15D477F2C51B89E8714B9E19469">journal article</mods:classification>
<mods:identifier id="4E30E00765C8E1695E46814AB548C680" type="DOI">10.1093/zoolinnean/zlx018</mods:identifier>
<mods:identifier id="0B2D1BCC9C1BAC083300FE5112398FC3" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="FA366FE3671D2AF21BED4335CB82D7E4" type="Zenodo-Dep">14812581</mods:identifier>
</mods:mods>
<treatment id="733644600C416879FF44FA4CFD943CDB" LSID="urn:lsid:plazi:treatment:733644600C416879FF44FA4CFD943CDB" httpUri="http://treatment.plazi.org/id/733644600C416879FF44FA4CFD943CDB" lastPageNumber="58" pageId="8" pageNumber="58">
<subSubSection id="B385A6FD0C416879FF44FA4CFD1F3FF9" box="[226,715,1510,1535]" pageId="8" pageNumber="58" type="nomenclature">
<paragraph id="FB20F5760C416879FF44FA4CFD1F3FF9" blockId="8.[226,715,1510,1535]" box="[226,715,1510,1535]" pageId="8" pageNumber="58">
<heading id="A068421A0C416879FF44FA4CFD1F3FF9" box="[226,715,1510,1535]" centered="true" fontSize="9" level="2" pageId="8" pageNumber="58" reason="2">
<taxonomicName id="3C9F8EF50C416879FF44FA4CFD1F3FF9" ID-CoL="73N5R" authority="(MULLER &amp; HENLE, 1841)" baseAuthorityName="Muller &amp; Henle" baseAuthorityYear="1841" box="[226,715,1510,1535]" class="Elasmobranchii" family="Myliobatidae" genus="Mobula" kingdom="Animalia" order="Myliobatiformes" pageId="8" pageNumber="58" phylum="Chordata" rank="species" species="kuhlii">
<emphasis id="C9EB29640C416879FF44FA4CFE4E3FFB" box="[226,410,1511,1534]" italics="true" pageId="8" pageNumber="58">
<smallCapsWord id="FDC663AA0C416879FF44FA4CFE913FF8" baselines="1528,1529" box="[226,325,1511,1534]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Mobula" pageId="8" pageNumber="58">MOBULA</smallCapsWord>
<smallCapsWord id="FDC663AA0C416879FEEAFA40FE4E3FFB" baselines="1528" box="[332,410,1515,1533]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="kuhlii" pageId="8" pageNumber="58">KUHLII</smallCapsWord>
</emphasis>
(
<bibRefCitation id="9F0E88870C416879FE0CFA4DFD103FF9" author="Muller J &amp; Henle FGJ" box="[426,708,1510,1535]" pageId="8" pageNumber="58" pagination="103 - 200" refId="ref21218" refString="Muller J, Henle FGJ. 1841. Systematische Beschreibung der Plagiostomen. Berlin: Verlag Von Veit Und Comp. pp. 103-200." type="book chapter" year="1841">
<smallCapsWord id="FDC663AA0C416879FE0CFA4DFDDE3FF8" baselines="1529,1529" box="[426,522,1510,1535]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Muller" pageId="8" pageNumber="58">MÜLLER</smallCapsWord>
&amp;
<smallCapsWord id="FDC663AA0C416879FD8BFA4DFDA93FF8" baselines="1529,1529" box="[557,637,1510,1535]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Henle" pageId="8" pageNumber="58">HENLE</smallCapsWord>
, 1841
</bibRefCitation>
)
</taxonomicName>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="B385A6FD0C416879FF05F9A4FD943CDB" pageId="8" pageNumber="58" type="reference_group">
<paragraph id="FB20F5760C416879FF05F9A4FD573C45" blockId="8.[163,779,1551,1757]" pageId="8" pageNumber="58">
<treatmentCitationGroup id="DB8FD2580C416879FF05F9A4FD573C45" pageId="8" pageNumber="58">
<treatmentCitation id="7A3ED3670C416879FF05F9A4FD6A3C23" author="Muller J &amp; Henle FGJ" box="[163,702,1551,1573]" page="185" pageId="8" pageNumber="58" year="1841">
<taxonomicName id="3C9F8EF50C416879FF05F9A4FD6A3C23" ID-CoL="5XJ4R" authority="Muller &amp; Henle, 1841: 185" authorityName="Muller &amp; Henle" authorityPageNumber="185" authorityYear="1841" box="[163,702,1551,1573]" class="Elasmobranchii" family="Myliobatidae" genus="Cephaloptera" kingdom="Animalia" order="Myliobatiformes" pageId="8" pageNumber="58" phylum="Chordata" rank="species" species="kuhlii">
<emphasis id="C9EB29640C416879FF05F9A4FE533C22" box="[163,391,1551,1572]" italics="true" pageId="8" pageNumber="58">Cephaloptera kuhlii</emphasis>
<materialsCitation id="4BF7FF2B0C416879FE28F9A4FD6A3C23" box="[398,702,1551,1573]" collectionCode="MNHN" country="India" location="India" pageId="8" pageNumber="58" specimenCount="1" typeStatus="lectotype">
<bibRefCitation id="9F0E88870C416879FE28F9A4FD6A3C23" author="Muller J &amp; Henle FGJ" box="[398,702,1551,1573]" pageId="8" pageNumber="58" pagination="103 - 200" refId="ref21218" refString="Muller J, Henle FGJ. 1841. Systematische Beschreibung der Plagiostomen. Berlin: Verlag Von Veit Und Comp. pp. 103-200." type="book chapter" year="1841">Müller &amp; Henle, 1841: 185</bibRefCitation>
</materialsCitation>
</taxonomicName>
</treatmentCitation>
, Pl. 59 (left) (
<collectingCountry id="8388B5E60C416879FEA6F985FEEB3C42" box="[256,319,1582,1604]" name="India" pageId="8" pageNumber="58">India</collectingCountry>
;
<typeStatus id="24244BD40C416879FEECF985FE643C42" box="[330,432,1582,1604]" pageId="8" pageNumber="58" type="lectotype">lectotype</typeStatus>
MNHN 000-1596)
</treatmentCitationGroup>
</paragraph>
<paragraph id="FB20F5760C416879FF05F9E7FEFA3CA6" blockId="8.[163,779,1551,1757]" pageId="8" pageNumber="58">
<treatmentCitationGroup id="DB8FD2580C416879FF05F9E7FEFA3CA6" pageId="8" pageNumber="58">
<treatmentCitation id="7A3ED3670C416879FF05F9E7FD4C3C67" author="Cantor TE" box="[163,664,1612,1633]" page="1420" pageId="8" pageNumber="58" year="1849">
<taxonomicName id="3C9F8EF50C416879FF05F9E7FD4C3C67" ID-CoL="35JMY" authority="Cantor, 1849: 1420" authorityName="Cantor, 1849:" authorityPageNumber="1420" authorityYear="1420" box="[163,664,1612,1633]" class="Elasmobranchii" family="Myliobatidae" genus="Dicerobatis" kingdom="Animalia" order="Myliobatiformes" pageId="8" pageNumber="58" phylum="Chordata" rank="species" species="eregoodoo">
<emphasis id="C9EB29640C416879FF05F9E7FE7E3C67" box="[163,426,1612,1633]" italics="true" pageId="8" pageNumber="58">Dicerobatis eregoodoo</emphasis>
<materialsCitation id="4BF7FF2B0C416879FE12F9E7FD4C3C67" box="[436,664,1612,1633]" country="Malaysia" location="Coromandel" pageId="8" pageNumber="58" specimenCount="1" stateProvince="Pulau Pinang" typeStatus="syntype">
<bibRefCitation id="9F0E88870C416879FE12F9E7FD4C3C67" author="Cantor TE" box="[436,664,1612,1633]" pageId="8" pageNumber="58" pagination="983 - 1443" refId="ref19618" refString="Cantor TE. 1849. Catalogue of Malayan fishes. Journal of the Asiatic Society of Bengal 18: 983-1443." type="journal article" year="1849">Cantor, 1849: 1420</bibRefCitation>
</materialsCitation>
</taxonomicName>
</treatmentCitation>
(
<collectingRegion id="395B3B940C416879FD0DF9E7FCD23C67" box="[683,774,1612,1633]" country="Malaysia" name="Pulau Pinang" pageId="8" pageNumber="58">Penang</collectingRegion>
,
<collectingCountry id="8388B5E60C416879FF1DF9C0FEF23C87" box="[187,294,1643,1665]" name="Malaysia" pageId="8" pageNumber="58">Malaysia</collectingCountry>
and
<location id="FE40A3AD0C416879FEC4F9C0FE263C87" LSID="urn:lsid:plazi:treatment:733644600C416879FF44FA4CFD943CDB:FE40A3AD0C416879FEC4F9C0FE263C87" box="[354,498,1643,1665]" country="Malaysia" name="Coromandel" pageId="8" pageNumber="58" stateProvince="Pulau Pinang">Coromandel</location>
,
<collectingCountry id="8388B5E60C416879FE59F9C0FDEB3C87" box="[511,575,1643,1665]" name="India" pageId="8" pageNumber="58">India</collectingCountry>
;
<typeStatus id="24244BD40C416879FDEDF9C0FD723C86" box="[587,678,1643,1664]" pageId="8" pageNumber="58" type="syntype">syntype</typeStatus>
location unknown)
</treatmentCitationGroup>
</paragraph>
<paragraph id="FB20F5760C416879FF05F903FD943CDB" blockId="8.[163,779,1551,1757]" pageId="8" pageNumber="58">
<taxonomicName id="3C9F8EF50C416879FF05F903FDEB3CBB" ID-CoL="35JMX" authority="Gunther, 1872: 422" authorityName="Gunther" authorityPageNumber="422" authorityYear="1872" box="[163,575,1704,1726]" class="Elasmobranchii" family="Myliobatidae" genus="Dicerobatis" kingdom="Animalia" order="Myliobatiformes" pageId="8" pageNumber="58" phylum="Chordata" rank="species" species="draco">
<emphasis id="C9EB29640C416879FF05F903FEB23CBB" box="[163,358,1704,1725]" italics="true" pageId="8" pageNumber="58">Dicerobatis draco</emphasis>
<materialsCitation id="4BF7FF2B0C416879FECDF903FDEB3CBB" box="[363,575,1704,1726]" collectionCode="BMNH" country="Indonesia" location="Misol" pageId="8" pageNumber="58" specimenCount="1" typeStatus="syntype">Günther, 1872: 422</materialsCitation>
</taxonomicName>
(
<location id="FE40A3AD0C416879FDEDF903FD583CB8" LSID="urn:lsid:plazi:treatment:733644600C416879FF44FA4CFD943CDB:FE40A3AD0C416879FDEDF903FD583CB8" box="[587,652,1704,1726]" country="Indonesia" name="Misol" pageId="8" pageNumber="58">Misol</location>
,
<collectingCountry id="8388B5E60C416879FD33F903FCD33CB8" box="[661,775,1704,1726]" name="Indonesia" pageId="8" pageNumber="58">Indonesia</collectingCountry>
;
<typeStatus id="24244BD40C416879FF1DF96CFECB3CDA" box="[187,287,1735,1756]" pageId="8" pageNumber="58" type="syntype">syntypes</typeStatus>
BMNH 1870.8.31.6869)
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,164 @@
<document id="1F383A796C729CD70B5A778AEDC30A83" ID-DOI="10.1093/zoolinnean/zlx018" ID-ISSN="0024-4082" ID-Zenodo-Dep="14812581" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779248170" checkinUser="plazi" docAuthor="White, William T, Corrigan, Shannon, Yang, Lei, Henderson, Aaron C, Bazinet, Adam L, Swofford, David L &amp; Naylor, Gavin J P" docDate="2018" docId="733644600C4E6876FCDEFE9CFB5838A0" docLanguage="en" docName="zlx018.pdf" docOrigin="Zoological Journal of the Linnean Society 182 (1)" docSource="http://academic.oup.com/zoolinnean/article/182/1/50/3886052" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Mobula hypostoma" docType="treatment" docVersion="2" lastPageNumber="57" masterDocId="8F0F3C180C496871FFA6FFABFFD43A06" masterDocTitle="Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family" masterLastPageNumber="75" masterPageNumber="50" pageNumber="57" updateTime="1738779746131" updateUser="ExternalLinkService">
<mods:mods id="76D30335D6F67097B1E9169CDA2AC05D" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="D485C151A9D7DE93B5C8CAD63A70D0BA">
<mods:title id="357A0D31F05A741E69EDF5E82F082A63">Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family</mods:title>
</mods:titleInfo>
<mods:name id="ED7EEBCD02A9982D82A729ABA4D01472" type="personal">
<mods:role id="D82851F37B6F45F797649CC8116AB93E">
<mods:roleTerm id="80B431E0E670C7790BC0915DE17CCF82">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="5FA81410944DA09307C49A9D4EB7AB8E">White, William T</mods:namePart>
</mods:name>
<mods:name id="48BDB6648CF37FB3963C8CB174B9AA92" type="personal">
<mods:role id="46A8AEFF8F67F534178F486185295A57">
<mods:roleTerm id="6DB39A816AF2E6F4F686823BEC9EF7F7">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="A154EF83C2E531C2F3EA1B41133AE064">Corrigan, Shannon</mods:namePart>
</mods:name>
<mods:name id="E4222B6C7B68AEA36CE09F65250455D3" type="personal">
<mods:role id="8CDDAF0BA318DE1BB76F044DF7648D5F">
<mods:roleTerm id="A66A4B95AA68CFEB0FA7D11EB254506F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="D3F532E81F0079F4972F6E5D5D2E9DB7">Yang, Lei</mods:namePart>
</mods:name>
<mods:name id="4D99B833EE92953998567B1FD01E9DE3" type="personal">
<mods:role id="ED43106D69E5442E94E4AB0AD49CF043">
<mods:roleTerm id="CEB40C32DE0D39BBA832DEE7708ECBFF">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="B8C896F29F05D4BF6B62DFD570E0B2B1">Henderson, Aaron C</mods:namePart>
</mods:name>
<mods:name id="6178A18CCC2BA7E4D9AE634849B07975" type="personal">
<mods:role id="A13500BDEC573214AA2EC46F4B703DB4">
<mods:roleTerm id="D58BB200BC881FEF33852DA9FD89734F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="063BEBC9315D4AFA3558C326286799F1">Bazinet, Adam L</mods:namePart>
</mods:name>
<mods:name id="DB27582FB8D5CF73D286BDDDBA014F9B" type="personal">
<mods:role id="14CEDB793F14FE0D9E7B4C71393966BD">
<mods:roleTerm id="0432521E5624A2ECDF157DABEDA85E6D">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="7257C42A25EC17AA0BFA6EAA3AC01B93">Swofford, David L</mods:namePart>
</mods:name>
<mods:name id="82CDA61A76D4DA4F235C74F0EE480A14" type="personal">
<mods:role id="5FDEE1A73EDDEF64A37002E16B9EDD54">
<mods:roleTerm id="EA5C8B03960D29A6D737936BAE50FF9F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3A29598ADC8B8DFCAC4DFFDC17E9604A">Naylor, Gavin J P</mods:namePart>
</mods:name>
<mods:typeOfResource id="77F734F529CA6EA676D1412BDE0DB89F">text</mods:typeOfResource>
<mods:relatedItem id="7BCC6A76D18484E0DFB3C432B7368FEB" type="host">
<mods:titleInfo id="A75A675FE8874454B8EF269F15BE3F32">
<mods:title id="A62E293B3886E02D9A7B6895D9F6F56B">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="1942ED73FF6DFDA1F9F95D4FE57B454D">
<mods:date id="B6830CE12BE9DC34E6756B36631D1602">2018</mods:date>
<mods:detail id="10435A00862AD01CB0B27A36E7E7E84F" type="pubDate">
<mods:number id="0BBACA8C591047858FDC4553CB2F4205">2018-01-31</mods:number>
</mods:detail>
<mods:detail id="090AAFB3BD453795C1A222BD34C3B9D3" type="volume">
<mods:number id="E25C42509CF3BA77BBFCBBE6698E8DBA">182</mods:number>
</mods:detail>
<mods:detail id="331DD2B2E41BDBCEC6381D5FD04CE6CC" type="issue">
<mods:number id="CB657DE616C00D43B607FC78012AECF1">1</mods:number>
</mods:detail>
<mods:extent id="CF0BE4A5B36381329C9E0EEFF46F95DC" unit="page">
<mods:start id="C308023D5D89B590E72CD71E0D7EAA67">50</mods:start>
<mods:end id="B70BEC1FC948CD8BD540558350D6D5FD">75</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="CC73F4F9C60CF4932ED3A68D8CE4B3E2">
<mods:url id="9715686A941DE9BCD30DB2009EC0B65C">http://academic.oup.com/zoolinnean/article/182/1/50/3886052</mods:url>
</mods:location>
<mods:classification id="3779D6D0E58DFEAB1014B76345387420">journal article</mods:classification>
<mods:identifier id="9970B2B6889D4982B35FB14E25B46089" type="DOI">10.1093/zoolinnean/zlx018</mods:identifier>
<mods:identifier id="F53ED3D2BEC1857E69653F84BFD93379" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="8CAF4DB4B0C7223652A8062D0E054DDF" type="Zenodo-Dep">14812581</mods:identifier>
</mods:mods>
<treatment id="733644600C4E6876FCDEFE9CFB5838A0" ID-DOI="http://doi.org/10.5281/zenodo.14812588" ID-Zenodo-Dep="14812588" LSID="urn:lsid:plazi:treatment:733644600C4E6876FCDEFE9CFB5838A0" httpUri="http://treatment.plazi.org/id/733644600C4E6876FCDEFE9CFB5838A0" lastPageNumber="57" pageId="7" pageNumber="57">
<subSubSection id="B385A6FD0C4E6876FCDEFE9CFA953B49" box="[888,1345,310,335]" pageId="7" pageNumber="57" type="nomenclature">
<paragraph id="FB20F5760C4E6876FCDEFE9CFA953B49" blockId="7.[888,1345,310,335]" box="[888,1345,310,335]" pageId="7" pageNumber="57">
<heading id="A068421A0C4E6876FCDEFE9CFA953B49" box="[888,1345,310,335]" centered="true" fontSize="9" level="2" pageId="7" pageNumber="57" reason="2">
<taxonomicName id="3C9F8EF50C4E6876FCDEFE9CFA953B49" ID-CoL="6RN5R" authority="(BANCROFT, 1831)" baseAuthorityName="Bancroft" baseAuthorityYear="1831" box="[888,1345,310,335]" class="Elasmobranchii" family="Myliobatidae" genus="Mobula" kingdom="Animalia" order="Myliobatiformes" pageId="7" pageNumber="57" phylum="Chordata" rank="species" species="hypostoma">
<emphasis id="C9EB29640C4E6876FCDEFE9CFBBF3B48" box="[888,1131,311,334]" italics="true" pageId="7" pageNumber="57">
<smallCapsWord id="FDC663AA0C4E6876FCDEFE9CFC0F3B48" baselines="328,329" box="[888,987,311,334]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Mobula" pageId="7" pageNumber="57">MOBULA</smallCapsWord>
<smallCapsWord id="FDC663AA0C4E6876FC44FE91FBBF3B48" baselines="329" box="[994,1131,314,334]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="hypostoma" pageId="7" pageNumber="57">HYPOSTOMA</smallCapsWord>
</emphasis>
(
<smallCapsWord id="FDC663AA0C4E6876FBDCFE9DFB273B48" baselines="329,329" box="[1146,1267,310,335]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Bancroft" pageId="7" pageNumber="57">BANCROFT</smallCapsWord>
, 1831)
</taxonomicName>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="B385A6FD0C4E6876FC8FFEF5FB5838A0" pageId="7" pageNumber="57" type="reference_group">
<paragraph id="FB20F5760C4E6876FC8FFEF5FB143B95" blockId="7.[809,1425,350,679]" pageId="7" pageNumber="57">
<taxonomicName id="3C9F8EF50C4E6876FC8FFEF5FA5B3B72" ID-CoL="69J4X" authority="Bancroft, 1831: 134" authorityName="Bancroft" authorityPageNumber="134" authorityYear="1831" box="[809,1423,350,372]" class="Elasmobranchii" family="Myliobatidae" genus="Cephalopterus" kingdom="Animalia" order="Myliobatiformes" pageId="7" pageNumber="57" phylum="Chordata" rank="species" species="hypostomus">
<emphasis id="C9EB29640C4E6876FC8FFEF5FB573B75" box="[809,1155,350,371]" italics="true" pageId="7" pageNumber="57">Cephalopterus hypostomus</emphasis>
<materialsCitation id="4BF7FF2B0C4E6876FB36FEF5FA5B3B72" box="[1168,1423,350,372]" country="Jamaica" location="Jamaica" pageId="7" pageNumber="57" specimenCount="1" typeStatus="holotype">Bancroft, 1831: 134</materialsCitation>
</taxonomicName>
(
<collectingCountry id="8388B5E60C4E6876FCEFFED6FC7E3B95" box="[841,938,381,403]" name="Jamaica" pageId="7" pageNumber="57">Jamaica</collectingCountry>
;
<typeStatus id="24244BD40C4E6876FC13FED6FBC23B95" box="[949,1046,381,403]" pageId="7" pageNumber="57" type="holotype">holotype</typeStatus>
not preserved)
</paragraph>
<paragraph id="FB20F5760C4E6876FC8FFE37FB9F3BE9" blockId="7.[809,1425,350,679]" pageId="7" pageNumber="57">
<treatmentCitationGroup id="DB8FD2580C4E6876FC8FFE37FB9F3BE9" pageId="7" pageNumber="57">
<treatmentCitation id="7A3ED3670C4E6876FC8FFE37FAF13BB7" author="Muller J" box="[809,1317,412,434]" page="311" pageId="7" pageNumber="57" year="1836">
<taxonomicName id="3C9F8EF50C4E6876FC8FFE37FAF13BB7" ID-CoL="69J4R" authority="Muller, 1836: 311" authorityName="Muller" authorityPageNumber="311" authorityYear="1836" box="[809,1317,412,434]" class="Elasmobranchii" family="Myliobatidae" genus="Cephaloptera" kingdom="Animalia" order="Myliobatiformes" pageId="7" pageNumber="57" phylum="Chordata" rank="species" species="olfersii">
<emphasis id="C9EB29640C4E6876FC8FFE37FBE33BB7" box="[809,1079,412,433]" italics="true" pageId="7" pageNumber="57">Cephaloptera olfersii</emphasis>
<materialsCitation id="4BF7FF2B0C4E6876FBE5FE37FAF13BB7" box="[1091,1317,412,434]" collectionCode="MNHN" country="Brazil" location="Brazil" pageId="7" pageNumber="57" specimenCode="ZMB 31636, ZMB 8923" specimenCount="1" typeStatus="syntype">
<bibRefCitation id="9F0E88870C4E6876FBE5FE37FAF13BB7" author="Muller J" box="[1091,1317,412,434]" pageId="7" pageNumber="57" pagination="65 - 340" refId="ref21181" refString="Muller J. 1836. Vergleichende Anatomie der Myxinoiden, der Cyclostomen mit durchbohrtem Gaumen. Erster Theil. Osteologie und Myologie. Abhandlungen der Koniglichen Akademie der Wissenschaften zu Berlin 1834: 65-340." type="journal article" year="1836">Müller, 1836: 311</bibRefCitation>
</materialsCitation>
</taxonomicName>
</treatmentCitation>
(
<collectingCountry id="8388B5E60C4E6876FA9DFE37FA5F3BB4" box="[1339,1419,412,434]" name="Brazil" pageId="7" pageNumber="57">Brazil</collectingCountry>
;
<typeStatus id="24244BD40C4E6876FCE7FE10FC6F3BD6" box="[833,955,443,464]" pageId="7" pageNumber="57" type="syntype">syntypes</typeStatus>
MNHN A- 9966,?
<specimenCode id="AB395D0D0C4E6876FB10FE10FA833BD6" box="[1206,1367,442,464]" collectionCode="ZMB" country="Germany" httpUri="http://grbio.org/cool/8syf-d21i" name="Museum für Naturkunde Berlin (Zoological Collections)" pageId="7" pageNumber="57" type="Museum">ZMB 31636</specimenCode>
[ex
<specimenCode id="AB395D0D0C4E6876FCE7FE71FC633BE8" box="[833,951,473,495]" collectionCode="ZMB" country="Germany" httpUri="http://grbio.org/cool/8syf-d21i" name="Museum für Naturkunde Berlin (Zoological Collections)" pageId="7" pageNumber="57" type="Museum">ZMB 8923</specimenCode>
],?ZM 31637)
</treatmentCitationGroup>
</paragraph>
<paragraph id="FB20F5760C4E6876FC8FFE53FC2F382A" blockId="7.[809,1425,350,679]" pageId="7" pageNumber="57">
<taxonomicName id="3C9F8EF50C4E6876FC8FFE53FACC3808" ID-CoL="5XJ53" authority="Hill, 1862: 176" authorityName="Hill" authorityPageNumber="176" authorityYear="1862" box="[809,1304,504,526]" class="Elasmobranchii" family="Myliobatidae" genus="Cephaloptera" kingdom="Animalia" order="Myliobatiformes" pageId="7" pageNumber="57" phylum="Chordata" rank="species" species="massenoidea">
<emphasis id="C9EB29640C4E6876FC8FFE53FBB6380B" box="[809,1122,504,525]" italics="true" pageId="7" pageNumber="57">Cephaloptera massenoidea</emphasis>
<materialsCitation id="4BF7FF2B0C4E6876FBCDFE53FACC3808" box="[1131,1304,504,526]" country="Jamaica" location="Jamaica" pageId="7" pageNumber="57" specimenCount="1">Hill, 1862: 176</materialsCitation>
</taxonomicName>
(
<collectingCountry id="8388B5E60C4E6876FA8EFE53FA583808" box="[1320,1420,504,526]" name="Jamaica" pageId="7" pageNumber="57">Jamaica</collectingCountry>
; no
<typeStatus id="24244BD40C4E6876FCC2FDBCFC75382A" box="[868,929,535,556]" pageId="7" pageNumber="57">types</typeStatus>
known)
</paragraph>
<paragraph id="FB20F5760C4E6876FC8FFD9EFC20386C" blockId="7.[809,1425,350,679]" pageId="7" pageNumber="57">
<treatmentCitationGroup id="DB8FD2580C4E6876FC8FFD9EFC20386C" pageId="7" pageNumber="57">
<treatmentCitation id="7A3ED3670C4E6876FC8FFD9EFAF7384C" author="Vaillant LL" box="[809,1315,565,587]" page="187" pageId="7" pageNumber="57" year="1879">
<taxonomicName id="3C9F8EF50C4E6876FC8FFD9EFAF7384C" ID-CoL="69J53" authority="Vaillant, 1879: 187" authorityName="Vaillant" authorityPageNumber="187" authorityYear="1879" box="[809,1315,565,587]" class="Elasmobranchii" family="Myliobatidae" genus="Cephaloptera" kingdom="Animalia" order="Myliobatiformes" pageId="7" pageNumber="57" phylum="Chordata" rank="species" species="rochebrunei">
<emphasis id="C9EB29640C4E6876FC8FFD9EFB98384C" box="[809,1100,565,586]" italics="true" pageId="7" pageNumber="57">Cephaloptera rochebrunei</emphasis>
<bibRefCitation id="9F0E88870C4E6876FBF7FD9EFAF7384C" author="Vaillant LL" box="[1105,1315,565,587]" pageId="7" pageNumber="57" pagination="187 - 188" refId="ref21982" refString="Vaillant LL 1879. Note sur une nouvelle espece d'elasmobranche hypotreme, le Cephaloptera rochebrunei. Bulletin de la Societe philomathique de Paris (7 th Serie) 3: 187-188." type="journal article" year="1879">Vaillant, 1879: 187</bibRefCitation>
</taxonomicName>
</treatmentCitation>
(
<collectingCountry id="8388B5E60C4E6876FA96FD9EFA58384D" box="[1328,1420,565,587]" name="Senegal" pageId="7" pageNumber="57">Senegal</collectingCountry>
; MNHN A-9967)
</treatmentCitationGroup>
</paragraph>
<paragraph id="FB20F5760C4E6876FC8FFDD9FB5838A0" blockId="7.[809,1425,350,679]" pageId="7" pageNumber="57">
<taxonomicName id="3C9F8EF50C4E6876FC8FFDD9FACC388E" ID-CoL="5XL3V" authority="Boulenger, 1897: 227" authorityName="Boulenger" authorityPageNumber="227" authorityYear="1897" box="[809,1304,626,648]" class="Elasmobranchii" family="Myliobatidae" genus="Ceratobatis" kingdom="Animalia" order="Myliobatiformes" pageId="7" pageNumber="57" phylum="Chordata" rank="species" species="robertsii">
<emphasis id="C9EB29640C4E6876FC8FFDD9FBCE3881" box="[809,1050,626,647]" italics="true" pageId="7" pageNumber="57">Ceratobatis robertsii</emphasis>
<materialsCitation id="4BF7FF2B0C4E6876FB85FDD9FACC388E" box="[1059,1304,626,648]" collectionCode="BMNH" country="Jamaica" location="Jamaica" pageId="7" pageNumber="57" specimenCount="1" typeStatus="holotype">Boulenger, 1897: 227</materialsCitation>
</taxonomicName>
(
<collectingCountry id="8388B5E60C4E6876FA8EFDD9FA58388E" box="[1320,1420,626,648]" name="Jamaica" pageId="7" pageNumber="57">Jamaica</collectingCountry>
;
<typeStatus id="24244BD40C4E6876FCE7FD3AFC7638A1" box="[833,930,657,679]" pageId="7" pageNumber="57" type="holotype">holotype</typeStatus>
BMNH 1897.7.1.40)
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,110 @@
<document id="ABA460A92FE17EA7DF2D776D4428AE61" ID-DOI="10.1093/zoolinnean/zlx018" ID-ISSN="0024-4082" ID-Zenodo-Dep="14812581" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779248170" checkinUser="plazi" docAuthor="White, William T, Corrigan, Shannon, Yang, Lei, Henderson, Aaron C, Bazinet, Adam L, Swofford, David L &amp; Naylor, Gavin J P" docDate="2018" docId="733644600C5A6862FEA3F9B2FEDC3CD7" docLanguage="en" docName="zlx018.pdf" docOrigin="Zoological Journal of the Linnean Society 182 (1)" docSource="http://academic.oup.com/zoolinnean/article/182/1/50/3886052" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Mobula alfredi" docType="treatment" docVersion="2" lastPageNumber="69" masterDocId="8F0F3C180C496871FFA6FFABFFD43A06" masterDocTitle="Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family" masterLastPageNumber="75" masterPageNumber="50" pageNumber="69" updateTime="1738779746131" updateUser="ExternalLinkService">
<mods:mods id="9525F87CAAC93790A24742621C7FCB5F" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="E2410DA5C5443CE5A99703B24F6AC2DF">
<mods:title id="A17493C12446AC10EBE20096E3C31E81">Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family</mods:title>
</mods:titleInfo>
<mods:name id="E3B59230E61B9B7CE34D609ACA872A4C" type="personal">
<mods:role id="F3638B65F1009ED5469E820B24C6D6ED">
<mods:roleTerm id="DAC486A866E2AEC054A7F4E17C8D0127">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3B245BF8C23241829778D3EE7A5B1101">White, William T</mods:namePart>
</mods:name>
<mods:name id="E8A473E8E51BDE4B6C0BAA527A09E384" type="personal">
<mods:role id="5A30C7A1917F390BAA8C117D2335BA1B">
<mods:roleTerm id="C0478F5E5580F1148277BA37D2877AEB">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="806FB810F59360ECFD1AA1743277E5B2">Corrigan, Shannon</mods:namePart>
</mods:name>
<mods:name id="E699EB07C2488A09A048C7FBDB6180FB" type="personal">
<mods:role id="18C9ACC215520B675A44E219340AEBC2">
<mods:roleTerm id="BCB1DA4B66803E29372E1AE714E8EFD1">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="4A3796B9069E07BE5F7F34EBE1D12970">Yang, Lei</mods:namePart>
</mods:name>
<mods:name id="B8F78CC5937EAD2B86560806E6E05932" type="personal">
<mods:role id="1242428CA5A8F77F3DB29AFFC6B07CF8">
<mods:roleTerm id="74391FE50D5A459D9DC9DD2DB14B9D78">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3DF0B1E531E4BBC34C1852F5EC5FD5DC">Henderson, Aaron C</mods:namePart>
</mods:name>
<mods:name id="6FBFA87FCB8D9D9435FDDE2BEE927B48" type="personal">
<mods:role id="C63405593D84038041C42996F11D725C">
<mods:roleTerm id="B947F5394A9488D4D09D251263F5B105">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="54C3D7AEBC8D43D22AE36E19222CA32B">Bazinet, Adam L</mods:namePart>
</mods:name>
<mods:name id="D1FE0ADBDBB05587D78576B19D5AA90E" type="personal">
<mods:role id="F6652B7B407FA3586EB3BB07782A2E6D">
<mods:roleTerm id="7D669B8A9FBCD86FAEEC5C2B316BE9BA">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3FBB4C34AD8FA1817B2904C69236AAF9">Swofford, David L</mods:namePart>
</mods:name>
<mods:name id="5D36F9E31A09319EEFC712B08B09C21A" type="personal">
<mods:role id="6973439AF67B82F1EB4F9EC50CEF6CDA">
<mods:roleTerm id="7F2948F7886372B93F63225F3510EC83">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="28F3C484ABE9CBD73D532851D244DC1C">Naylor, Gavin J P</mods:namePart>
</mods:name>
<mods:typeOfResource id="41C6EA316D188FB4792DAD4DE5781FD6">text</mods:typeOfResource>
<mods:relatedItem id="4A7BAC1D6C62515C6D4C920A3F194ED3" type="host">
<mods:titleInfo id="35166A19F81A431C1FAFC7A6C4BDC88D">
<mods:title id="51B77A7581DEAAFE09AFACFC3BC2BF73">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="DC566D063C38CEDD49C46A01AEA66293">
<mods:date id="A5C6638639E00D079682F45EA44AF85D">2018</mods:date>
<mods:detail id="75945CA75D65C29380FFCECB695A2CD4" type="pubDate">
<mods:number id="0DB7D98DC52ED4F4543882F49D9A0DBC">2018-01-31</mods:number>
</mods:detail>
<mods:detail id="2C44D7772517305846424BDD0FCD2F9C" type="volume">
<mods:number id="8275B1D6AC1750EDBF446515B46C3EA1">182</mods:number>
</mods:detail>
<mods:detail id="5BCD2317A9B9F91B3191F9312C7ACEB6" type="issue">
<mods:number id="9B2C44E124508B3D5D65B854E3119663">1</mods:number>
</mods:detail>
<mods:extent id="C7062286F631197CE211B5C4417D604A" unit="page">
<mods:start id="19232AF0D56222CBAD9F49D1DB11E743">50</mods:start>
<mods:end id="E9A19142DE792026333E5B90BAF48187">75</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="580475F9D8AE79994FEFA4282F9BF756">
<mods:url id="C89B844A6E4C36B06C5733B588BA220F">http://academic.oup.com/zoolinnean/article/182/1/50/3886052</mods:url>
</mods:location>
<mods:classification id="A79A89FA0207C24CB9AABE083DC9F8B0">journal article</mods:classification>
<mods:identifier id="E68A72049EEA66095EFFFBBDDC7B7F21" type="DOI">10.1093/zoolinnean/zlx018</mods:identifier>
<mods:identifier id="D408F4B2BDDBB5AF0B9CBA6FEFBBA5D4" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="40F3420B40ECFF59AA070D0AC9118790" type="Zenodo-Dep">14812581</mods:identifier>
</mods:mods>
<treatment id="733644600C5A6862FEA3F9B2FEDC3CD7" ID-DOI="http://doi.org/10.5281/zenodo.14812600" ID-Zenodo-Dep="14812600" LSID="urn:lsid:plazi:treatment:733644600C5A6862FEA3F9B2FEDC3CD7" httpUri="http://treatment.plazi.org/id/733644600C5A6862FEA3F9B2FEDC3CD7" lastPageNumber="69" pageId="19" pageNumber="69">
<subSubSection id="B385A6FD0C5A6862FEA3F9B2FF0A3C92" pageId="19" pageNumber="69" type="nomenclature">
<paragraph id="FB20F5760C5A6862FEA3F9B2FD513C34" blockId="19.[261,645,1561,1586]" box="[261,645,1561,1586]" pageId="19" pageNumber="69">
<heading id="A068421A0C5A6862FEA3F9B2FD513C34" box="[261,645,1561,1586]" centered="true" fontSize="9" level="2" pageId="19" pageNumber="69" reason="2">
<taxonomicName id="3C9F8EF50C5A6862FEA3F9B2FD513C34" ID-CoL="43STZ" authority="(KREFFT, 1868)" baseAuthorityName="Krefft" baseAuthorityYear="1868" box="[261,645,1561,1586]" class="Elasmobranchii" family="Myliobatidae" genus="Mobula" kingdom="Animalia" order="Myliobatiformes" pageId="19" pageNumber="69" phylum="Chordata" rank="species" species="alfredi">
<emphasis id="C9EB29640C5A6862FEA3F9B2FE1A3C36" box="[261,462,1561,1584]" italics="true" pageId="19" pageNumber="69">
<smallCapsWord id="FDC663AA0C5A6862FEA3F9B2FEBC3C36" baselines="1578,1579" box="[261,360,1561,1584]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Mobula" pageId="19" pageNumber="69">MOBULA</smallCapsWord>
<smallCapsWord id="FDC663AA0C5A6862FEC9F9B7FE1A3C36" baselines="1579" box="[367,462,1564,1584]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="alfredi" pageId="19" pageNumber="69">ALFREDI</smallCapsWord>
</emphasis>
(
<smallCapsWord id="FDC663AA0C5A6862FE7AF9B2FDE33C36" baselines="1580,1579" box="[476,567,1561,1586]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Krefft" pageId="19" pageNumber="69">KREFFT</smallCapsWord>
, 1868)
</taxonomicName>
</heading>
</paragraph>
<paragraph id="FB20F5760C5A6862FF37F9E9FF0A3C92" blockId="19.[145,760,1601,1745]" pageId="19" pageNumber="69">
<emphasis id="C9EB29640C5A6862FF37F9E9FDD03C50" box="[145,516,1601,1623]" italics="true" pageId="19" pageNumber="69">Not retained, tissue sampled</emphasis>
: Tissue accessions GN15457, GN15458, GN15459 and GN15460,
<collectingCountry id="8388B5E60C5A6862FD15F9CBFF0E3C92" name="South Africa" pageId="19" pageNumber="69">South Africa</collectingCountry>
.
</paragraph>
</subSubSection>
<subSubSection id="B385A6FD0C5A6862FF0FF936FEDC3CD7" pageId="19" pageNumber="69" type="description">
<paragraph id="FB20F5760C5A6862FF0FF936FEDC3CD7" blockId="19.[145,760,1601,1745]" pageId="19" pageNumber="69">
All specimens were nominally identified as
<taxonomicName id="3C9F8EF50C5A6862FF37F917FED53CD7" baseAuthorityName="Krefft" baseAuthorityYear="1868" box="[145,257,1724,1745]" class="Elasmobranchii" family="Myliobatidae" genus="Mobula" kingdom="Animalia" order="Myliobatiformes" pageId="19" pageNumber="69" phylum="Chordata" rank="species" species="alfredi">
<emphasis id="C9EB29640C5A6862FF37F917FED53CD7" box="[145,257,1724,1745]" italics="true" pageId="19" pageNumber="69">M. alfredi</emphasis>
</taxonomicName>
.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,316 @@
<document id="68B29B6C1AA7233456BA7C216031B052" ID-DOI="10.1093/zoolinnean/zlx018" ID-ISSN="0024-4082" ID-Zenodo-Dep="14812581" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779248170" checkinUser="plazi" docAuthor="White, William T, Corrigan, Shannon, Yang, Lei, Henderson, Aaron C, Bazinet, Adam L, Swofford, David L &amp; Naylor, Gavin J P" docDate="2018" docId="733644600C5A6862FF4AF8A4FC6739FD" docLanguage="en" docName="zlx018.pdf" docOrigin="Zoological Journal of the Linnean Society 182 (1)" docSource="http://academic.oup.com/zoolinnean/article/182/1/50/3886052" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Mobula birostris" docType="treatment" docVersion="2" lastPageNumber="69" masterDocId="8F0F3C180C496871FFA6FFABFFD43A06" masterDocTitle="Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family" masterLastPageNumber="75" masterPageNumber="50" pageNumber="69" updateTime="1738779746131" updateUser="ExternalLinkService">
<mods:mods id="FAF93C4101A995AA004EC37209BC43E6" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="A0DA57B28D5EE373C27B1275DF71035F">
<mods:title id="24D9B6A33BF27B90DFCA5782C3C30D5B">Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family</mods:title>
</mods:titleInfo>
<mods:name id="BEEBDD040A2D174EAF599AA3B638ABD2" type="personal">
<mods:role id="E7B97AA9EE1A6C9FF1206E5B7D542D97">
<mods:roleTerm id="7BF79E64B3A87508A5F55BED3D575DE7">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="6900D4BAE0FC5639AD61B14A6E92613A">White, William T</mods:namePart>
</mods:name>
<mods:name id="77A6D5D9DA8C5DADE2CEAC63B0EECDFF" type="personal">
<mods:role id="BD5778A4C42B7D065AE1F5DC537B5801">
<mods:roleTerm id="5709BB034985F928F103DB6EA82AAD92">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="5492D1D48DC58A2A8C65C073650135C8">Corrigan, Shannon</mods:namePart>
</mods:name>
<mods:name id="26595D20FF66FEA26304C957656E376A" type="personal">
<mods:role id="728B0F72B25890FF0885DD0517849049">
<mods:roleTerm id="F234517D300181D445E3B577C2528D2F">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="D9F8AD6261DA36548E43DEFE9B94A2A5">Yang, Lei</mods:namePart>
</mods:name>
<mods:name id="5D43174858840E6E647134045472BF29" type="personal">
<mods:role id="0E2B7B2136BB622F2BD6993C5E0EAFAA">
<mods:roleTerm id="375D51BE74739A75AEF57C8FA8129750">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="D0CF61920403250D1CA6DF400487CBEB">Henderson, Aaron C</mods:namePart>
</mods:name>
<mods:name id="5B1839CDA03418B25CB18216AD98809C" type="personal">
<mods:role id="C09568A8AF8AB9B263802076A3168886">
<mods:roleTerm id="56D3E80CB62EB4139C0385C9B6DB2399">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3DD4BDF14540CC7595FCAEA2286437C7">Bazinet, Adam L</mods:namePart>
</mods:name>
<mods:name id="A62E581AB37FFD26E64F1567A13E9141" type="personal">
<mods:role id="FA1DBD0EB08E71108E17C07D3D1AC479">
<mods:roleTerm id="80FC466CF14292824C8BA64609AB1516">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="D7C93B08C8C36FF4F701816213A0550A">Swofford, David L</mods:namePart>
</mods:name>
<mods:name id="84A5496A7F690D47518F3DFEA7590784" type="personal">
<mods:role id="FE71958B9D9ED428EA22BF34E52F336B">
<mods:roleTerm id="BCFCC7062E323A94270BD9B62A683989">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="4963470530E6E2A2114C07561935B2B7">Naylor, Gavin J P</mods:namePart>
</mods:name>
<mods:typeOfResource id="D18FA7A81324EB0B623A85163B52D295">text</mods:typeOfResource>
<mods:relatedItem id="750500AA0A18E429032943D554180B9F" type="host">
<mods:titleInfo id="5C61E78496AFE1507D4751DB7833B9BF">
<mods:title id="B0328B59512A6ABECED729AEEA3A6898">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="AF206755574FA894BA65A1178CDDE332">
<mods:date id="7681F0695D5EFB82EBBA093774669ACB">2018</mods:date>
<mods:detail id="8BCC9D766F535C1F3D986F08C2C91AE2" type="pubDate">
<mods:number id="D88DAB58E52E46220286D1B6827F30D0">2018-01-31</mods:number>
</mods:detail>
<mods:detail id="95D10868EA2EA8E0723C92A1A5D62583" type="volume">
<mods:number id="9725E55E3C4B52D04475590CA98EE824">182</mods:number>
</mods:detail>
<mods:detail id="809983B3765C9200113221A99ADC50C8" type="issue">
<mods:number id="B679FBE24CAA4FB045B738976A24B26C">1</mods:number>
</mods:detail>
<mods:extent id="408EE030A0E4C17B5CCE6A8A8518CBE3" unit="page">
<mods:start id="6E35D2D737B1E6D69016D025AC05C774">50</mods:start>
<mods:end id="C39060B927616DBA676F34BED7696149">75</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="9B95B3FCCC6945C562C8401BCC377CF7">
<mods:url id="F5E1FC362DAD1D3379D538E1AE5B6ABA">http://academic.oup.com/zoolinnean/article/182/1/50/3886052</mods:url>
</mods:location>
<mods:classification id="1A67BBFE3FD33F6C547F6BB57A57DD2A">journal article</mods:classification>
<mods:identifier id="188586146412D10EEE1C0163D015188E" type="DOI">10.1093/zoolinnean/zlx018</mods:identifier>
<mods:identifier id="AA06167BD44331AFCCA2546FE24C3509" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="AE171E1F6B1B5FC8147FA4ECAF0A6547" type="Zenodo-Dep">14812581</mods:identifier>
</mods:mods>
<treatment id="733644600C5A6862FF4AF8A4FC6739FD" ID-DOI="http://doi.org/10.5281/zenodo.14812604" ID-Zenodo-Dep="14812604" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD" httpUri="http://treatment.plazi.org/id/733644600C5A6862FF4AF8A4FC6739FD" lastPageNumber="69" pageId="19" pageNumber="69">
<subSubSection id="B385A6FD0C5A6862FF4AF8A4FAEB3B30" pageId="19" pageNumber="69" type="nomenclature">
<paragraph id="FB20F5760C5A6862FF4AF8A4FD4A3D21" blockId="19.[236,670,1806,1831]" box="[236,670,1806,1831]" pageId="19" pageNumber="69">
<heading id="A068421A0C5A6862FF4AF8A4FD4A3D21" box="[236,670,1806,1831]" centered="true" fontSize="9" level="2" pageId="19" pageNumber="69" reason="2">
<taxonomicName id="3C9F8EF50C5A6862FF4AF8A4FD4A3D21" ID-CoL="73N5T" authority="(WALBAUM, 1792)" baseAuthorityName="Walbaum" baseAuthorityYear="1792" box="[236,670,1806,1831]" class="Elasmobranchii" family="Myliobatidae" genus="Mobula" kingdom="Animalia" order="Myliobatiformes" pageId="19" pageNumber="69" phylum="Chordata" rank="species" species="birostris">
<emphasis id="C9EB29640C5A6862FF4AF8A4FE1F3D20" box="[236,459,1807,1830]" italics="true" pageId="19" pageNumber="69">
<smallCapsWord id="FDC663AA0C5A6862FF4AF8A4FE9B3D20" baselines="1824,1825" box="[236,335,1807,1830]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Mobula" pageId="19" pageNumber="69">MOBULA</smallCapsWord>
<smallCapsWord id="FDC663AA0C5A6862FEF3F8B9FE1F3D20" baselines="1825" box="[341,459,1810,1830]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="birostris" pageId="19" pageNumber="69">BIROSTRIS</smallCapsWord>
</emphasis>
(
<bibRefCitation id="9F0E88870C5A6862FE7CF8A5FD423D21" author="Walbaum JJ" box="[474,662,1806,1831]" pageId="19" pageNumber="69" pagination="1 - 723" refId="ref22048" refString="Walbaum JJ. 1792. Petri Artedi sueci genera piscium. In quibus systema totum ichthyologiae proponitur cum classibus, ordinibus, generum characteribus, specierum differentiis, observationibus plurimis. Redactis speciebus 242 ad genera 52. Ichthyologiae pars III. Ant. Ferdin. Rose, Grypeswaldiae [Greifswald]. 3: 1-723." type="journal article" year="1792">
<smallCapsWord id="FDC663AA0C5A6862FE7CF8A5FD843D20" baselines="1825,1825" box="[474,592,1806,1831]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Walbaum" pageId="19" pageNumber="69">WALBAUM</smallCapsWord>
, 1792
</bibRefCitation>
)
</taxonomicName>
</heading>
</paragraph>
<paragraph id="FB20F5760C5A6862FF37F89CFAEB3B30" blockId="19.[145,760,1846,1899]" lastBlockId="19.[809,1425,197,311]" pageId="19" pageNumber="69">
<materialsCitation id="4BF7FF2B0C5A6862FF37F89CFF2A3D6D" collectionCode="CSIRO" pageId="19" pageNumber="69" specimenCode="H 6446-02" specimenCount="1">
<collectionCode id="9D8E6DB30C5A6862FF37F89CFF323D4A" box="[145,230,1847,1868]" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="19" pageNumber="69" type="Museum">CSIRO</collectionCode>
<specimenCode id="AB395D0D0C5A6862FF57F89CFEA73D4A" box="[241,371,1846,1868]" collectionCode="CSIRO" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="19" pageNumber="69" type="Museum">H 6446-02</specimenCode>
(one clasper only), adult male
<quantity id="3C6758930C5A6862FF37F8FEFF2A3D6D" box="[145,254,1877,1899]" metricMagnitude="0" metricUnit="m" metricValue="4.614" pageId="19" pageNumber="69" unit="cm" value="461.4">461.4 cm</quantity>
</materialsCitation>
<materialsCitation id="4BF7FF2B0C5A6862FEA1F8FDFB8A3ADD" box="[263,1118,197,1899]" collectingDate="2005-08-18" collectionCode="DW" country="Indonesia" location="Tanjung Luar" municipality="Lombok" pageId="19" pageNumber="69" specimenCount="1">
<collectionCode id="9D8E6DB30C5A6862FEA1F8FDFEE73D6D" box="[263,307,1878,1899]" pageId="19" pageNumber="69">DW</collectionCode>
,
<location id="FE40A3AD0C5A6862FEE6F8FEFE3C3D6D" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FEE6F8FEFE3C3D6D" box="[320,488,1877,1899]" country="Indonesia" municipality="Lombok" name="Tanjung Luar" pageId="19" pageNumber="69">Tanjung Luar</location>
landing site,
<collectingMunicipality id="1B446F0C0C5A6862FD35F8FEFD203D6D" box="[659,756,1877,1899]" pageId="19" pageNumber="69">Lombok</collectingMunicipality>
,
<collectingCountry id="8388B5E60C5A6862FC8FFF6EFC483ADD" box="[809,924,197,219]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5A6862FC0EFF6EFB8A3ADD" box="[936,1118,197,219]" pageId="19" pageNumber="69" value="2005-08-18">
<collectingDate id="9F652A5E0C5A6862FC0EFF6EFB8A3ADD" box="[936,1118,197,219]" pageId="19" pageNumber="69" value="2005-08-18">18 August 2005</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5A6862FBCCFF6EFC5F3AFC" collectionCode="CSIRO" country="Indonesia" pageId="19" pageNumber="69" specimenCode="H 7791-01" specimenCount="1">
<collectionCode id="9D8E6DB30C5A6862FBCCFF6EFB6F3ADC" box="[1130,1211,197,218]" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="19" pageNumber="69" type="Museum">CSIRO</collectionCode>
<specimenCode id="AB395D0D0C5A6862FB64FF6DFAEE3ADC" box="[1218,1338,197,219]" collectionCode="CSIRO" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="19" pageNumber="69" type="Museum">H 7791-01</specimenCode>
(dorsal fin only)
</materialsCitation>
,
<materialsCitation id="4BF7FF2B0C5A6862FC30FF4FFA593B1E" collectingDate="2009-10-05" collectionCode="CSIRO" country="Indonesia" location="Tanjung Luar" municipality="Lombok" pageId="19" pageNumber="69" specimenCode="H 7791-02" specimenCount="1">
<collectionCode id="9D8E6DB30C5A6862FC30FF4FFC333AFF" box="[918,999,228,249]" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="19" pageNumber="69" type="Museum">CSIRO</collectionCode>
<specimenCode id="AB395D0D0C5A6862FC49FF4FFBB23AFF" box="[1007,1126,228,249]" collectionCode="CSIRO" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="19" pageNumber="69" type="Museum">H 7791-02</specimenCode>
(dorsal fin only),
<location id="FE40A3AD0C5A6862FA94FF4FFCB53B1E" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FA94FF4FFCB53B1E" country="Indonesia" municipality="Lombok" name="Tanjung Luar" pageId="19" pageNumber="69">Tanjung Luar</location>
landing site,
<collectingMunicipality id="1B446F0C0C5A6862FC5DFEA9FB8C3B1E" box="[1019,1112,258,280]" pageId="19" pageNumber="69">Lombok</collectingMunicipality>
,
<collectingCountry id="8388B5E60C5A6862FBC5FEA9FB013B1E" box="[1123,1237,258,280]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5A6862FB46FEA9FA593B1E" box="[1248,1421,258,280]" pageId="19" pageNumber="69" value="2009-10-05">
<collectingDate id="9F652A5E0C5A6862FB46FEA9FA593B1E" box="[1248,1421,258,280]" pageId="19" pageNumber="69" value="2009-10-05">5 October 2009</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5A6862FC8FFE8AFAEF3B30" box="[809,1339,289,311]" collectingDate="2007-04-20" country="Philippines" location="Philippines" pageId="19" pageNumber="69" specimenCount="1">
field code BRU-043,
<collectingCountry id="8388B5E60C5A6862FBB6FE8AFB473B31" box="[1040,1171,289,311]" name="Philippines" pageId="19" pageNumber="69">Philippines</collectingCountry>
,
<date id="8F21D3B60C5A6862FB38FE8AFAEF3B30" box="[1182,1339,289,311]" pageId="19" pageNumber="69" value="2007-04-20">
<collectingDate id="9F652A5E0C5A6862FB38FE8AFAEF3B30" box="[1182,1339,289,311]" pageId="19" pageNumber="69" value="2007-04-20">20 April 2007</collectingDate>
</date>
</materialsCitation>
.
</paragraph>
</subSubSection>
<subSubSection id="B385A6FD0C5A6862FC8FFECBFC6739FD" pageId="19" pageNumber="69" type="description">
<paragraph id="FB20F5760C5A6862FC8FFECBFBB23947" blockId="19.[809,1425,352,834]" pageId="19" pageNumber="69">
<emphasis id="C9EB29640C5A6862FC8FFECBFBAA3B73" box="[809,1150,352,373]" italics="true" pageId="19" pageNumber="69">Photographed (not retained)</emphasis>
:
<materialsCitation id="4BF7FF2B0C5A6862FB28FECBFB123BD7" collectingDate="2002-03-25" collectionCode="DW" country="Indonesia" county="Lombok" location="Pelabuhanratu" municipality="Tanjung Luar" pageId="19" pageNumber="69" specimenCount="1" stateProvince="Jawa Barat">
male embryo
<quantity id="3C6758930C5A6862FA95FECBFA443B73" box="[1331,1424,352,374]" metricMagnitude="-1" metricUnit="m" metricValue="6.09" pageId="19" pageNumber="69" unit="cm" value="60.9">60.9 cm</quantity>
<collectionCode id="9D8E6DB30C5A6862FC8FFED4FC803B92" box="[809,852,383,404]" pageId="19" pageNumber="69">DW</collectionCode>
,
<location id="FE40A3AD0C5A6862FCFAFED5FBD33B92" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FCFAFED5FBD33B92" box="[860,1031,382,404]" country="Indonesia" county="Lombok" municipality="Tanjung Luar" name="Pelabuhanratu" pageId="19" pageNumber="69" stateProvince="Jawa Barat">Pelabuhanratu</location>
landing site,
<collectingRegion id="395B3B940C5A6862FB3BFED4FAC53B92" box="[1181,1297,383,404]" country="Indonesia" name="Jawa Barat" pageId="19" pageNumber="69">West Java</collectingRegion>
,
<collectingCountry id="8388B5E60C5A6862FABDFED5FA593B92" box="[1307,1421,382,404]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
; female
<quantity id="3C6758930C5A6862FC2CFE36FC313BB5" box="[906,997,413,435]" metricMagnitude="0" metricUnit="m" metricValue="4.93" pageId="19" pageNumber="69" unit="cm" value="493.0">493 cm</quantity>
<collectionCode id="9D8E6DB30C5A6862FC54FE35FBF43BB5" box="[1010,1056,414,435]" pageId="19" pageNumber="69">DW</collectionCode>
,
<collectingMunicipality id="1B446F0C0C5A6862FB89FE36FB353BB5" box="[1071,1249,413,435]" pageId="19" pageNumber="69">Tanjung Luar</collectingMunicipality>
landing site,
<collectingCounty id="12418DFA0C5A6862FC8FFE17FC5C3BD4" box="[809,904,444,466]" pageId="19" pageNumber="69">Lombok</collectingCounty>
,
<collectingCountry id="8388B5E60C5A6862FC32FE17FBDD3BD4" box="[916,1033,444,466]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5A6862FBB3FE17FB123BD7" box="[1045,1222,444,466]" pageId="19" pageNumber="69" value="2002-03-25">
<collectingDate id="9F652A5E0C5A6862FBB3FE17FB123BD7" box="[1045,1222,444,466]" pageId="19" pageNumber="69" value="2002-03-25">25 March 2002</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5A6862FB74FE17FC723808" collectingDate="2004-04-25" collectionCode="DW" country="Indonesia" location="Tanjung Luar" municipality="Lombok" pageId="19" pageNumber="69" specimenCount="1">
female
<quantity id="3C6758930C5A6862FA8EFE17FA453BD7" box="[1320,1425,444,466]" metricMagnitude="0" metricUnit="m" metricValue="4.126" pageId="19" pageNumber="69" unit="cm" value="412.6">412.6 cm</quantity>
<collectionCode id="9D8E6DB30C5A6862FC8FFE70FC803BF6" box="[809,852,475,496]" pageId="19" pageNumber="69">DW</collectionCode>
,
<location id="FE40A3AD0C5A6862FCFAFE71FC2D3BF6" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FCFAFE71FC2D3BF6" box="[860,1017,474,496]" country="Indonesia" municipality="Lombok" name="Tanjung Luar" pageId="19" pageNumber="69">Tanjung Luar</location>
landing site,
<collectingMunicipality id="1B446F0C0C5A6862FB34FE71FB3B3BF6" box="[1170,1263,474,496]" pageId="19" pageNumber="69">Lombok</collectingMunicipality>
,
<collectingCountry id="8388B5E60C5A6862FB5FFE71FABF3BF6" box="[1273,1387,474,496]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5A6862FAD3FE71FC723808" pageId="19" pageNumber="69" value="2004-04-25">
<collectingDate id="9F652A5E0C5A6862FAD3FE71FC723808" pageId="19" pageNumber="69" value="2004-04-25">25 April 2004</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5A6862FC14FE52FAE7382B" collectingDate="2004-04-26" collectionCode="DW" country="Indonesia" location="Tanjung Luar" municipality="Lombok" pageId="19" pageNumber="69" specimenCount="1">
female
<quantity id="3C6758930C5A6862FBA1FE52FBBA3809" box="[1031,1134,505,527]" metricMagnitude="0" metricUnit="m" metricValue="3.376" pageId="19" pageNumber="69" unit="cm" value="337.6">337.6 cm</quantity>
<collectionCode id="9D8E6DB30C5A6862FBD0FE51FB753809" box="[1142,1185,506,527]" pageId="19" pageNumber="69">DW</collectionCode>
,
<location id="FE40A3AD0C5A6862FB0AFE52FA993809" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FB0AFE52FA993809" box="[1196,1357,505,527]" country="Indonesia" municipality="Lombok" name="Tanjung Luar" pageId="19" pageNumber="69">Tanjung Luar</location>
landing site,
<collectingMunicipality id="1B446F0C0C5A6862FC32FDB3FC223828" box="[916,1014,536,558]" pageId="19" pageNumber="69">Lombok</collectingMunicipality>
,
<collectingCountry id="8388B5E60C5A6862FBA2FDB3FBA93828" box="[1028,1149,536,558]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5A6862FB2CFDB3FAE7382B" box="[1162,1331,536,558]" pageId="19" pageNumber="69" value="2004-04-26">
<collectingDate id="9F652A5E0C5A6862FB2CFDB3FAE7382B" box="[1162,1331,536,558]" pageId="19" pageNumber="69" value="2004-04-26">26 April 2004</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5A6862FAE6FDB3FB9B386C" collectingDate="2004-07-13" collectionCode="DW" country="Indonesia" location="Tanjung Luar" municipality="Lombok" pageId="19" pageNumber="69" specimenCount="1">
female
<quantity id="3C6758930C5A6862FC8FFD9CFC42384A" box="[809,918,567,588]" metricMagnitude="0" metricUnit="m" metricValue="3.7739999999999996" pageId="19" pageNumber="69" unit="cm" value="377.4">377.4 cm</quantity>
<collectionCode id="9D8E6DB30C5A6862FC39FD9CFC1F384A" box="[927,971,567,588]" pageId="19" pageNumber="69">DW</collectionCode>
,
<location id="FE40A3AD0C5A6862FC7EFD9DFB54384A" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FC7EFD9DFB54384A" box="[984,1152,566,588]" country="Indonesia" municipality="Lombok" name="Tanjung Luar" pageId="19" pageNumber="69">Tanjung Luar</location>
landing site,
<collectingMunicipality id="1B446F0C0C5A6862FA8DFD9DFA58384A" box="[1323,1420,566,588]" pageId="19" pageNumber="69">Lombok</collectingMunicipality>
,
<collectingCountry id="8388B5E60C5A6862FC8FFDFEFC76386D" box="[809,930,597,619]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5A6862FC16FDFEFB9B386C" box="[944,1103,597,619]" pageId="19" pageNumber="69" value="2004-07-13">
<collectingDate id="9F652A5E0C5A6862FC16FDFEFB9B386C" box="[944,1103,597,619]" pageId="19" pageNumber="69" value="2004-07-13">13 July 2004</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5A6862FBFBFDFEFC6238AE" collectingDate="2005-03-09" collectionCode="DW" country="Indonesia" location="Tanjung Luar" municipality="Lombok" pageId="19" pageNumber="69" specimenCount="1">
adult male
<quantity id="3C6758930C5A6862FB4DFDFEFA83386D" box="[1259,1367,597,619]" metricMagnitude="0" metricUnit="m" metricValue="3.406" pageId="19" pageNumber="69" unit="cm" value="340.6">340.6 cm</quantity>
<collectionCode id="9D8E6DB30C5A6862FAC7FDFDFA58386D" box="[1377,1420,598,619]" pageId="19" pageNumber="69">DW</collectionCode>
,
<location id="FE40A3AD0C5A6862FC8FFDDFFC01388F" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FC8FFDDFFC01388F" box="[809,981,628,650]" country="Indonesia" municipality="Lombok" name="Tanjung Luar" pageId="19" pageNumber="69">Tanjung Luar</location>
landing site,
<collectingMunicipality id="1B446F0C0C5A6862FB20FDDFFB3E388C" box="[1158,1258,628,650]" pageId="19" pageNumber="69">Lombok</collectingMunicipality>
,
<collectingCountry id="8388B5E60C5A6862FB5EFDDFFAA7388C" box="[1272,1395,628,650]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5A6862FA25FDDFFC6238AE" pageId="19" pageNumber="69" value="2005-03-09">
<collectingDate id="9F652A5E0C5A6862FA25FDDFFC6238AE" pageId="19" pageNumber="69" value="2005-03-09">9 March 2005</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5A6862FC64FD39FA9738C1" collectingDate="2005-03-11" collectionCode="DW" country="Indonesia" location="Tanjung Luar" municipality="Lombok" pageId="19" pageNumber="69" specimenCount="1">
male
<quantity id="3C6758930C5A6862FBA5FD38FBB838AE" box="[1027,1132,659,680]" metricMagnitude="0" metricUnit="m" metricValue="2.891" pageId="19" pageNumber="69" unit="cm" value="289.1">289.1 cm</quantity>
<collectionCode id="9D8E6DB30C5A6862FBD2FD38FB4B38AE" box="[1140,1183,659,680]" pageId="19" pageNumber="69">DW</collectionCode>
,
<location id="FE40A3AD0C5A6862FB0CFD39FA9838AE" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FB0CFD39FA9838AE" box="[1194,1356,658,680]" country="Indonesia" municipality="Lombok" name="Tanjung Luar" pageId="19" pageNumber="69">Tanjung Luar</location>
landing site,
<collectingMunicipality id="1B446F0C0C5A6862FC32FD1AFC2238C1" box="[916,1014,689,711]" pageId="19" pageNumber="69">Lombok</collectingMunicipality>
,
<collectingCountry id="8388B5E60C5A6862FBA2FD1AFBA938C1" box="[1028,1149,689,711]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5A6862FB2DFD1AFA9738C1" box="[1163,1347,689,711]" pageId="19" pageNumber="69" value="2005-03-11">
<collectingDate id="9F652A5E0C5A6862FB2DFD1AFA9738C1" box="[1163,1347,689,711]" pageId="19" pageNumber="69" value="2005-03-11">11 March 2005</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5A6862FAF7FD1AFB873902" collectingDate="2005-07-13" collectionCode="DW" country="Indonesia" location="Tanjung Luar" municipality="Lombok" pageId="19" pageNumber="69" specimenCount="1">
adult male
<quantity id="3C6758930C5A6862FCCEFD7BFC6D38E3" box="[872,953,720,742]" metricMagnitude="0" metricUnit="m" metricValue="3.96" pageId="19" pageNumber="69" unit="cm" value="396.0">396 cm</quantity>
<collectionCode id="9D8E6DB30C5A6862FC67FD7BFC3838E3" box="[961,1004,720,741]" pageId="19" pageNumber="69">DW</collectionCode>
,
<location id="FE40A3AD0C5A6862FC53FD7BFB4738E3" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FC53FD7BFB4738E3" box="[1013,1171,720,742]" country="Indonesia" municipality="Lombok" name="Tanjung Luar" pageId="19" pageNumber="69">Tanjung Luar</location>
landing site,
<collectingMunicipality id="1B446F0C0C5A6862FA89FD7BFA5938E0" box="[1327,1421,720,742]" pageId="19" pageNumber="69">Lombok</collectingMunicipality>
,
<collectingCountry id="8388B5E60C5A6862FC8FFD45FC773902" box="[809,931,750,772]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5A6862FC14FD44FB873902" box="[946,1107,750,772]" pageId="19" pageNumber="69" value="2005-07-13">
<collectingDate id="9F652A5E0C5A6862FC14FD44FB873902" box="[946,1107,750,772]" pageId="19" pageNumber="69" value="2005-07-13">13 July 2005</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5A6862FBC4FD45FBB63947" collectingDate="2008-10-19" collectionCode="DW" country="Indonesia" location="Cilacap" pageId="19" pageNumber="69" specimenCode="GN6791" specimenCount="1" stateProvince="Jawa Tengah">
male
<quantity id="3C6758930C5A6862FB01FD44FB2A3902" box="[1191,1278,751,772]" metricMagnitude="0" metricUnit="m" metricValue="2.7" pageId="19" pageNumber="69" unit="cm" value="270.0">270 cm</quantity>
<collectionCode id="9D8E6DB30C5A6862FAAFFD44FAE13902" box="[1289,1333,751,772]" pageId="19" pageNumber="69">DW</collectionCode>
(tissue accession
<specimenCode id="AB395D0D0C5A6862FC3FFCA6FC2D3925" box="[921,1017,781,803]" collectionCode="GN" pageId="19" pageNumber="69">GN6791</specimenCode>
),
<location id="FE40A3AD0C5A6862FBADFCA6FBB53925" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FBADFCA6FBB53925" box="[1035,1121,781,803]" country="Indonesia" name="Cilacap" pageId="19" pageNumber="69" stateProvince="Jawa Tengah">Cilacap</location>
landing site,
<collectingRegion id="395B3B940C5A6862FB5EFCA6FA583925" box="[1272,1420,781,803]" country="Indonesia" name="Jawa Tengah" pageId="19" pageNumber="69">Central Java</collectingRegion>
,
<collectingCountry id="8388B5E60C5A6862FC8FFC87FC4F3944" box="[809,923,812,834]" name="Indonesia" pageId="19" pageNumber="69">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5A6862FC03FC87FBB63947" box="[933,1122,812,834]" pageId="19" pageNumber="69" value="2008-10-19">
<collectingDate id="9F652A5E0C5A6862FC03FC87FBB63947" box="[933,1122,812,834]" pageId="19" pageNumber="69" value="2008-10-19">19 October 2008</collectingDate>
</date>
</materialsCitation>
.
</paragraph>
<paragraph id="FB20F5760C5A6862FC8FFCC0FC3D39BB" blockId="19.[809,1424,874,1019]" pageId="19" pageNumber="69">
<emphasis id="C9EB29640C5A6862FC8FFCC0FB483979" box="[809,1180,874,896]" italics="true" pageId="19" pageNumber="69">Not retained, tissue sampled</emphasis>
:
<materialsCitation id="4BF7FF2B0C5A6862FB09FCC1FC3039BB" collectingDate="2012-09-26" country="Japan" location="Tissue" pageId="19" pageNumber="69" specimenCount="1">
<location id="FE40A3AD0C5A6862FB09FCC1FAD53986" LSID="urn:lsid:plazi:treatment:733644600C5A6862FF4AF8A4FC6739FD:FE40A3AD0C5A6862FB09FCC1FAD53986" box="[1199,1281,874,896]" country="Japan" name="Tissue" pageId="19" pageNumber="69">Tissue</location>
accessions GN10559, GN10560, GN10561, GN10568,
<collectingCountry id="8388B5E60C5A6862FAB8FC21FAB33999" box="[1310,1383,906,927]" name="Japan" pageId="19" pageNumber="69">Japan</collectingCountry>
,
<date id="8F21D3B60C5A6862FAD3FC22FC3039BB" pageId="19" pageNumber="69" value="2012-09-26">
<collectingDate id="9F652A5E0C5A6862FAD3FC22FC3039BB" pageId="19" pageNumber="69" value="2012-09-26">26 September 2012</collectingDate>
</date>
</materialsCitation>
.
</paragraph>
<paragraph id="FB20F5760C5A6862FCE7FC6CFC6739FD" blockId="19.[809,1424,874,1019]" pageId="19" pageNumber="69">
All specimens were nominally identified as
<taxonomicName id="3C9F8EF50C5A6862FC8FFC4DFC7839FC" baseAuthorityName="Walbaum" baseAuthorityYear="1792" box="[809,940,997,1019]" class="Elasmobranchii" family="Myliobatidae" genus="Mobula" kingdom="Animalia" order="Myliobatiformes" pageId="19" pageNumber="69" phylum="Chordata" rank="species" species="birostris">
<emphasis id="C9EB29640C5A6862FC8FFC4DFC7839FC" box="[809,940,997,1019]" italics="true" pageId="19" pageNumber="69">M. birostris</emphasis>
</taxonomicName>
.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -0,0 +1,470 @@
<document id="2FBF5DB0439125B08C1C4D8252E3A0B0" ID-DOI="10.1093/zoolinnean/zlx018" ID-ISSN="0024-4082" ID-Zenodo-Dep="14812581" IM.bibliography_approvedBy="felipe" IM.illustrations_approvedBy="felipe" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="felipe" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="felipe" checkinTime="1738779248170" checkinUser="plazi" docAuthor="White, William T, Corrigan, Shannon, Yang, Lei, Henderson, Aaron C, Bazinet, Adam L, Swofford, David L &amp; Naylor, Gavin J P" docDate="2018" docId="733644600C5C6867FC34FA77FD1F3F2B" docLanguage="en" docName="zlx018.pdf" docOrigin="Zoological Journal of the Linnean Society 182 (1)" docSource="http://academic.oup.com/zoolinnean/article/182/1/50/3886052" docStyle="DocumentStyle:36B3BD6A90C22AB4F7F465C853188CC8.7:ZoolJLinnSoc.2017-2023.journal_article" docStyleId="36B3BD6A90C22AB4F7F465C853188CC8" docStyleName="ZoolJLinnSoc.2017-2023.journal_article" docStyleVersion="7" docTitle="Mobula thurstoni" docType="treatment" docVersion="2" lastPageNumber="72" masterDocId="8F0F3C180C496871FFA6FFABFFD43A06" masterDocTitle="Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family" masterLastPageNumber="75" masterPageNumber="50" pageNumber="71" updateTime="1738779746131" updateUser="ExternalLinkService">
<mods:mods id="14B6BF1C0FEC4672E9049FC1A9819BAE" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="E2A0CF9D6F4FB9DE11EC76207972E185">
<mods:title id="D98CEDC9773BD077F46A47502E22BFB9">Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family</mods:title>
</mods:titleInfo>
<mods:name id="DEE1DE8E2E718FBF894DD6446BE60937" type="personal">
<mods:role id="8438244FEA7BF9130BAD25174C1F17B3">
<mods:roleTerm id="3B5B149B589229C8FF2CD4173E002D92">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="EF43B71444D6051D91E4BFA294A63DE7">White, William T</mods:namePart>
</mods:name>
<mods:name id="8D4F6A6ED818F4A02DD785EA8451805A" type="personal">
<mods:role id="8510469F11A76FF7FCEEFBD5F1D85F0D">
<mods:roleTerm id="E86535B3B7E26952B9BF7E8300B73CC5">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="A0B8C6D2D7896FDC66B97D32BD4C4A01">Corrigan, Shannon</mods:namePart>
</mods:name>
<mods:name id="21A3D1692F0055FB6C748D929A231FB1" type="personal">
<mods:role id="1C53189490046D352F30DABBB8631EC0">
<mods:roleTerm id="FA56411E578BF60262D2C54D1CBCA3A5">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="51C596D898C735F043E51982036FF5A8">Yang, Lei</mods:namePart>
</mods:name>
<mods:name id="17EE50037D87C2CF636756287F4C7995" type="personal">
<mods:role id="12EC380DAB75F5DAE2701DD170B41800">
<mods:roleTerm id="EDD0ECF132DE260AD20311B4AB0EF766">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="5E5124EAA90D3D04EA7D03FFD035A2BA">Henderson, Aaron C</mods:namePart>
</mods:name>
<mods:name id="FE1DC449956C765EF58AA5A702C47538" type="personal">
<mods:role id="D546E5A645E09D20148F91E71159AC85">
<mods:roleTerm id="166858BB7426E7BB84EAE0032626D278">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="38788694E31DA6EAA27C32005767481B">Bazinet, Adam L</mods:namePart>
</mods:name>
<mods:name id="6D661BF440485823B0578D60AEA69BB1" type="personal">
<mods:role id="6FF9551822EF50985E96291C5DCFFBD9">
<mods:roleTerm id="C6904829F7A721F51BA6C25EE2888A20">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="E3B8161204350E45FE8DF7C9C94E8790">Swofford, David L</mods:namePart>
</mods:name>
<mods:name id="00B47B8D75085CC17EF2A1389B4A5611" type="personal">
<mods:role id="2972D69A92C425663F02185842E011AB">
<mods:roleTerm id="B48356A8D396359AE263EC7CDC661500">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="4D16B830794A04414CD38A89798B148A">Naylor, Gavin J P</mods:namePart>
</mods:name>
<mods:typeOfResource id="C80C9E8ED26547F6AA34F7E9D7609C76">text</mods:typeOfResource>
<mods:relatedItem id="389C594401B6A66A5111DDD667FBA526" type="host">
<mods:titleInfo id="1C2EA40565112003E7E7C86D5A34A2B3">
<mods:title id="004FBB2C51424F4134B6AB647AF3EBFC">Zoological Journal of the Linnean Society</mods:title>
</mods:titleInfo>
<mods:part id="B8FBF082DE634F8FA5B17449E5089619">
<mods:date id="188DC673ED092377F107B09F7590E93A">2018</mods:date>
<mods:detail id="1E177A13621CBE6B2119145AE4456458" type="pubDate">
<mods:number id="B9FCCE98D4316A9401ABFB6E3064DD2E">2018-01-31</mods:number>
</mods:detail>
<mods:detail id="9BFFDF298AC41F5629C8D786CBEFAA64" type="volume">
<mods:number id="F92DB627BCAC8184CD7BD9139065EDF8">182</mods:number>
</mods:detail>
<mods:detail id="DB4D6B497099B2691991094911640628" type="issue">
<mods:number id="56BE943C3F8DC7261AFF78AF52A7E389">1</mods:number>
</mods:detail>
<mods:extent id="F6F0E59C7E89BE091AA91C6C40638303" unit="page">
<mods:start id="CCE2FC6901EE0BDEE5A2726689F812DB">50</mods:start>
<mods:end id="CE4E6A67C245675DB11A0ADCA86D5A06">75</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location id="9F6949FA276D4D30289EA427EB43D171">
<mods:url id="746AD069A468D347BC5F9BA65F767EF5">http://academic.oup.com/zoolinnean/article/182/1/50/3886052</mods:url>
</mods:location>
<mods:classification id="73378FA99B3CC6597495152145D20A20">journal article</mods:classification>
<mods:identifier id="E0F05B1535AEB8E26641601796EBB311" type="DOI">10.1093/zoolinnean/zlx018</mods:identifier>
<mods:identifier id="722E0CABFCC29EEE64E3D0CDC45ACC11" type="ISSN">0024-4082</mods:identifier>
<mods:identifier id="483ABABA7E45CE84B3DC79018010169E" type="Zenodo-Dep">14812581</mods:identifier>
</mods:mods>
<treatment id="733644600C5C6867FC34FA77FD1F3F2B" ID-DOI="http://doi.org/10.5281/zenodo.14812606" ID-Zenodo-Dep="14812606" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B" httpUri="http://treatment.plazi.org/id/733644600C5C6867FC34FA77FD1F3F2B" lastPageId="22" lastPageNumber="72" pageId="21" pageNumber="71">
<subSubSection id="B385A6FD0C5C6867FC34FA77FD653B1E" lastPageId="22" lastPageNumber="72" pageId="21" pageNumber="71" type="nomenclature">
<paragraph id="FB20F5760C5C6864FC34FA77FAFC3FF2" blockId="21.[914,1320,1499,1524]" box="[914,1320,1499,1524]" pageId="21" pageNumber="71">
<heading id="A068421A0C5C6864FC34FA77FAFC3FF2" box="[914,1320,1499,1524]" centered="true" fontSize="9" level="2" pageId="21" pageNumber="71" reason="2">
<taxonomicName id="3C9F8EF50C5C6864FC34FA77FAFC3FF2" ID-CoL="73MTP" authority="(LLOYD, 1908)" baseAuthorityName="Lloyd" baseAuthorityYear="1908" box="[914,1320,1499,1524]" class="Elasmobranchii" family="Myliobatidae" genus="Mobula" kingdom="Animalia" order="Myliobatiformes" pageId="21" pageNumber="71" phylum="Chordata" rank="species" species="thurstoni">
<emphasis id="C9EB29640C5C6864FC34FA77FBAB3FF5" box="[914,1151,1500,1523]" italics="true" pageId="21" pageNumber="71">
<smallCapsWord id="FDC663AA0C5C6864FC34FA77FC213FF5" baselines="1517,1518" box="[914,1013,1500,1523]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Mobula" pageId="21" pageNumber="71">MOBULA</smallCapsWord>
<smallCapsWord id="FDC663AA0C5C6864FC5AFA74FBAB3FF5" baselines="1518" box="[1020,1151,1503,1523]" lowerCaseFontSize="8" mainFontSize="10" normCase="lower" normString="thurstoni" pageId="21" pageNumber="71">THURSTONI</smallCapsWord>
</emphasis>
(
<smallCapsWord id="FDC663AA0C5C6864FB28FA70FB0E3FF5" baselines="1518,1518" box="[1166,1242,1499,1524]" lowerCaseFontSize="8" mainFontSize="10" normCase="title" normString="Lloyd" pageId="21" pageNumber="71">LLOYD</smallCapsWord>
, 1908)
</taxonomicName>
</heading>
</paragraph>
<paragraph id="FB20F5760C5C6867FC8FF9AFFD653B1E" blockId="21.[809,1425,1540,1899]" lastBlockId="22.[163,779,197,280]" lastPageId="22" lastPageNumber="72" pageId="21" pageNumber="71">
<materialsCitation id="4BF7FF2B0C5C6867FC8FF9AFFD653B1E" collectingDate="1989-08-24" collectingDateMax="2009-10-07" collectingDateMin="1989-08-24" collectionCode="CSIRO, DW, RMNH, SMEC" country="Indonesia" lastPageId="22" lastPageNumber="72" location="Lombok" municipality="Tanjung Luar" pageId="21" pageNumber="71" specimenCode="H 7774-01, H 7775-01, H 7775-02, HUMZ 114050, MZB 15007, MZB 15037, MZB 15444, GN11237, KBU 1" specimenCount="1" stateProvince="Sabah">
<collectionCode id="9D8E6DB30C5C6864FC8FF9AFFCAD3C1F" box="[809,889,1540,1561]" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="21" pageNumber="71" type="Museum">CSIRO</collectionCode>
<specimenCode id="AB395D0D0C5C6864FCD9F9AFFC213C1F" box="[895,1013,1540,1561]" collectionCode="CSIRO" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="21" pageNumber="71" type="Museum">H 7774-01</specimenCode>
(juvenile male
<quantity id="3C6758930C5C6864FB04F9AFFB2D3C1F" box="[1186,1273,1540,1561]" metricMagnitude="-1" metricUnit="m" metricValue="7.87" pageId="21" pageNumber="71" unit="cm" value="78.7">78.7 cm</quantity>
<collectionCode id="9D8E6DB30C5C6864FB59F9AFFAFE3C1F" box="[1279,1322,1540,1561]" pageId="21" pageNumber="71">DW</collectionCode>
,
<collectingMunicipality id="1B446F0C0C5C6864FA94F9AFFCB63C3E" pageId="21" pageNumber="71">Tanjung Luar</collectingMunicipality>
landing site,
<location id="FE40A3AD0C5C6864FBA3F989FBB13C3E" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5C6864FBA3F989FBB13C3E" box="[1029,1125,1570,1592]" country="Indonesia" municipality="Tanjung Luar" name="Lombok" pageId="21" pageNumber="71" stateProvince="Sabah">Lombok</location>
,
<collectingCountry id="8388B5E60C5C6864FBD7F989FB323C3E" box="[1137,1254,1570,1592]" name="Indonesia" pageId="21" pageNumber="71">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5C6864FB55F988FA583C3E" box="[1267,1420,1570,1592]" pageId="21" pageNumber="71" value="2005-07-14">
<collectingDate id="9F652A5E0C5C6864FB55F988FA583C3E" box="[1267,1420,1570,1592]" pageId="21" pageNumber="71" value="2005-07-14">14 July 2005</collectingDate>
</date>
;
<collectionCode id="9D8E6DB30C5C6864FC8FF9EAFCAF3C50" box="[809,891,1601,1622]" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="21" pageNumber="71" type="Museum">CSIRO</collectionCode>
<specimenCode id="AB395D0D0C5C6864FC22F9E9FC2A3C51" box="[900,1022,1601,1623]" collectionCode="CSIRO" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="21" pageNumber="71" type="Museum">H 7775-01</specimenCode>
(head only), ~
<quantity id="3C6758930C5C6864FB0EF9EAFB2A3C51" box="[1192,1278,1601,1623]" metricMagnitude="0" metricUnit="m" metricValue="2.1" pageId="21" pageNumber="71" unit="cm" value="210.0">210 cm</quantity>
<collectionCode id="9D8E6DB30C5C6864FAA1F9E9FAE73C51" box="[1287,1331,1602,1623]" pageId="21" pageNumber="71">DW</collectionCode>
,
<collectionCode id="9D8E6DB30C5C6864FA98F9EAFA443C50" box="[1342,1424,1601,1622]" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="21" pageNumber="71" type="Museum">CSIRO</collectionCode>
<specimenCode id="AB395D0D0C5C6864FC8FF9CBFC713C70" box="[809,933,1632,1654]" collectionCode="CSIRO" country="Australia" httpUri="http://grbio.org/cool/0k2v-y6wz" name="Australian National Fish Collection" pageId="21" pageNumber="71" type="Museum">H 7775-02</specimenCode>
, ~
<quantity id="3C6758930C5C6864FC66F9CBFBC03C73" box="[960,1044,1632,1654]" metricMagnitude="0" metricUnit="m" metricValue="1.66" pageId="21" pageNumber="71" unit="cm" value="166.0">166 cm</quantity>
<collectionCode id="9D8E6DB30C5C6864FBBBF9CBFB9C3C73" box="[1053,1096,1632,1653]" pageId="21" pageNumber="71">DW</collectionCode>
, Tanjung Luar landing site, Lombok,
<collectingCountry id="8388B5E60C5C6864FC30F9D5FBD83C92" box="[918,1036,1662,1684]" name="Indonesia" pageId="21" pageNumber="71">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5C6864FBBFF9D4FB043C92" box="[1049,1232,1662,1684]" pageId="21" pageNumber="71" value="2009-10-07">
<collectingDate id="9F652A5E0C5C6864FBBFF9D4FB043C92" box="[1049,1232,1662,1684]" pageId="21" pageNumber="71" value="2009-10-07">7 October 2009</collectingDate>
</date>
;
<specimenCode id="AB395D0D0C5C6864FB7AF9D4FA593C92" box="[1244,1421,1662,1684]" collectionCode="HUMZ" country="Japan" httpUri="http://grbio.org/cool/8gr0-wfn9" name="Hokkaido University, Laboratory of Marine Zoology" pageId="21" pageNumber="71">HUMZ 114050</specimenCode>
, juvenile male
<quantity id="3C6758930C5C6864FC6DF936FBDB3CB5" box="[971,1039,1693,1715]" metricMagnitude="-1" metricUnit="m" metricValue="8.6" pageId="21" pageNumber="71" unit="cm" value="86.0">86 cm</quantity>
<collectionCode id="9D8E6DB30C5C6864FBB0F935FB953CB5" box="[1046,1089,1694,1715]" pageId="21" pageNumber="71">DW</collectionCode>
,
<quantity id="3C6758930C5C6864FBEAF936FB663CB5" box="[1100,1202,1693,1715]" metricMagnitude="0" metricUnit="m" metricValue="1.191" pageId="21" pageNumber="71" unit="cm" value="119.1">119.1 cm</quantity>
TL, Usujiri,
<collectingCountry id="8388B5E60C5C6864FAE3F935FA593CB5" box="[1349,1421,1694,1715]" name="Japan" pageId="21" pageNumber="71">Japan</collectingCountry>
,
<date id="8F21D3B60C5C6864FC8FF917FC0B3CD7" box="[809,991,1724,1745]" pageId="21" pageNumber="71" value="1989-08-24">
<collectingDate id="9F652A5E0C5C6864FC8FF917FC0B3CD7" box="[809,991,1724,1745]" pageId="21" pageNumber="71" value="1989-08-24">24 August 1989</collectingDate>
</date>
;
<specimenCode id="AB395D0D0C5C6864FC4DF917FBA63CD4" box="[1003,1138,1724,1746]" collectionCode="MZB" country="Indonesia" httpUri="http://grbio.org/cool/b9gz-izvg" name="Museum Zoologicum Bogoriense" pageId="21" pageNumber="71" type="Museum">MZB 15007</specimenCode>
, juvenile female
<quantity id="3C6758930C5C6864FA91F917FA443CD7" box="[1335,1424,1724,1746]" metricMagnitude="-1" metricUnit="m" metricValue="8.26" pageId="21" pageNumber="71" unit="cm" value="82.6">82.6 cm</quantity>
<collectionCode id="9D8E6DB30C5C6864FC8FF970FC803CF6" box="[809,852,1755,1776]" pageId="21" pageNumber="71">DW</collectionCode>
, Tanjung Luar landing site, Lombok,
<collectingCountry id="8388B5E60C5C6864FB5FF971FABF3CF6" box="[1273,1387,1754,1776]" name="Indonesia" pageId="21" pageNumber="71">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5C6864FAD3F970FC4C3D08" pageId="21" pageNumber="71" value="2004-07-13">
<collectingDate id="9F652A5E0C5C6864FAD3F970FC4C3D08" pageId="21" pageNumber="71" value="2004-07-13">13 July 2004</collectingDate>
</date>
;
<specimenCode id="AB395D0D0C5C6864FC06F951FBF73D09" box="[928,1059,1785,1807]" collectionCode="MZB" country="Indonesia" httpUri="http://grbio.org/cool/b9gz-izvg" name="Museum Zoologicum Bogoriense" pageId="21" pageNumber="71" type="Museum">MZB 15037</specimenCode>
, female
<quantity id="3C6758930C5C6864FBDBF952FB6B3D09" box="[1149,1215,1785,1807]" metricMagnitude="-1" metricUnit="m" metricValue="9.4" pageId="21" pageNumber="71" unit="cm" value="94.0">94 cm</quantity>
<collectionCode id="9D8E6DB30C5C6864FB65F951FB3A3D09" box="[1219,1262,1786,1807]" pageId="21" pageNumber="71">DW</collectionCode>
, Tanjung Luar landing site, Lombok,
<collectingCountry id="8388B5E60C5C6864FB89F8B3FB703D28" box="[1071,1188,1816,1838]" name="Indonesia" pageId="21" pageNumber="71">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5C6864FB14F8B3FA9F3D28" box="[1202,1355,1816,1838]" pageId="21" pageNumber="71" value="2005-07-12">
<collectingDate id="9F652A5E0C5C6864FB14F8B3FA9F3D28" box="[1202,1355,1816,1838]" pageId="21" pageNumber="71" value="2005-07-12">12 July 2005</collectingDate>
</date>
;
<specimenCode id="AB395D0D0C5C6864FAFEF8B3FCBA3D4A" collectionCode="MZB" country="Indonesia" httpUri="http://grbio.org/cool/b9gz-izvg" name="Museum Zoologicum Bogoriense" pageId="21" pageNumber="71" type="Museum">MZB 15444</specimenCode>
(tissue accession
<specimenCode id="AB395D0D0C5C6864FB92F89CFB773D4A" box="[1076,1187,1847,1868]" collectionCode="GN" pageId="21" pageNumber="71">GN11237</specimenCode>
), female
<quantity id="3C6758930C5C6864FAA0F89DFA893D4A" box="[1286,1373,1846,1868]" metricMagnitude="-1" metricUnit="m" metricValue="9.15" pageId="21" pageNumber="71" unit="cm" value="91.5">91.5 cm</quantity>
<collectionCode id="9D8E6DB30C5C6864FAC5F89CFA5A3D4A" box="[1379,1422,1847,1868]" pageId="21" pageNumber="71">DW</collectionCode>
, Cilacap landing site, Central Java,
<collectingCountry id="8388B5E60C5C6864FB1CF8FEFAF83D6D" box="[1210,1324,1877,1899]" name="Indonesia" pageId="21" pageNumber="71">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5C6867FA91F8FEFF093ADC" lastPageId="22" lastPageNumber="72" pageId="21" pageNumber="71" value="2002-06-11">
<collectingDate id="9F652A5E0C5C6867FA91F8FEFF093ADC" lastPageId="22" lastPageNumber="72" pageId="21" pageNumber="71" value="2002-06-11">11 June 2002</collectingDate>
</date>
;
<collectionCode id="9D8E6DB30C5F6867FF4EFF6DFEEE3ADD" box="[232,314,198,219]" country="Netherlands" httpUri="http://biocol.org/urn:lsid:biocol.org:col:34992" lsid="urn:lsid:biocol.org:col:34992" name="National Museum of Natural History, Naturalis" pageId="22" pageNumber="72" type="Museum">RMNH</collectionCode>
unregistered, male embryo ~
<quantity id="3C6758930C5F6867FD29FF6EFD003ADD" box="[655,724,197,219]" metricMagnitude="-1" metricUnit="m" metricValue="4.2" pageId="22" pageNumber="72" unit="cm" value="42.0">42 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FD7AFF6DFCD33ADD" box="[732,775,198,219]" pageId="22" pageNumber="72">DW</collectionCode>
, no collection data;
<collectionCode id="9D8E6DB30C5F6867FEDDFF4FFE123AFF" box="[379,454,228,249]" pageId="22" pageNumber="72">SMEC</collectionCode>
<specimenCode id="AB395D0D0C5F6867FE6BFF4FFDC83AFF" box="[461,540,228,249]" collectionCode="KBU" pageId="22" pageNumber="72">KBU 1</specimenCode>
15397, male embryo
<quantity id="3C6758930C5F6867FF05FEA8FF2F3B1E" box="[163,251,259,280]" metricMagnitude="-1" metricUnit="m" metricValue="3.47" pageId="22" pageNumber="72" unit="cm" value="34.7">34.7 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FEA7FEA8FEF83B1E" box="[257,300,259,280]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectingRegion id="395B3B940C5F6867FE90FEA9FEAB3B1E" box="[310,383,258,280]" country="Malaysia" name="Sabah" pageId="22" pageNumber="72">Sabah</collectingRegion>
,
<collectingCountry id="8388B5E60C5F6867FE2DFEA9FE213B1E" box="[395,501,258,280]" name="Malaysia" pageId="22" pageNumber="72">Malaysia</collectingCountry>
,
<date id="8F21D3B60C5F6867FDA6FEA9FD793B1E" box="[512,685,258,280]" pageId="22" pageNumber="72" value="1997-03-15">
<collectingDate id="9F652A5E0C5F6867FDA6FEA9FD793B1E" box="[512,685,258,280]" pageId="22" pageNumber="72" value="1997-03-15">15 March 1997</collectingDate>
</date>
.
</materialsCitation>
</paragraph>
</subSubSection>
<subSubSection id="B385A6FD0C5F6867FF05FEEAFD1F3F2B" pageId="22" pageNumber="72" type="description">
<paragraph id="FB20F5760C5F6867FF05FEEAFD263998" blockId="22.[163,779,321,926]" pageId="22" pageNumber="72">
<emphasis id="C9EB29640C5F6867FF05FEEAFE3B3B50" box="[163,495,321,342]" italics="true" pageId="22" pageNumber="72">Photographed (not retained)</emphasis>
:
<materialsCitation id="4BF7FF2B0C5F6867FE59FEEAFD573B92" collectingDate="1993-08-29" collectionCode="DW" collectorName="Loreto" country="Mexico" location="Gulf of California" pageId="22" pageNumber="72" specimenCode="GN5263" specimenCount="1">
Field code BJ-330 (tissue accession
<specimenCode id="AB395D0D0C5F6867FEE0FECBFE7C3B70" box="[326,424,352,374]" collectionCode="GN" pageId="22" pageNumber="72">GN5263</specimenCode>
), male
<quantity id="3C6758930C5F6867FE5AFECBFD943B73" box="[508,576,352,374]" metricMagnitude="-1" metricUnit="m" metricValue="9.6" pageId="22" pageNumber="72" unit="cm" value="96.0">96 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FDEEFECBFDA73B73" box="[584,627,352,373]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FDD9FECBFD183B73" box="[639,716,352,373]" pageId="22" pageNumber="72">Loreto</collectorName>
,
<location id="FE40A3AD0C5F6867FD71FECBFE913B92" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5F6867FD71FECBFE913B92" country="Mexico" name="Gulf of California" pageId="22" pageNumber="72">Gulf of California</location>
,
<collectingCountry id="8388B5E60C5F6867FEF2FED5FE783B92" box="[340,428,382,404]" name="Mexico" pageId="22" pageNumber="72">Mexico</collectingCountry>
,
<date id="8F21D3B60C5F6867FE1AFED4FD573B92" box="[444,643,383,404]" pageId="22" pageNumber="72" value="1993-08-29">
<collectingDate id="9F652A5E0C5F6867FE1AFED4FD573B92" box="[444,643,383,404]" pageId="22" pageNumber="72" value="1993-08-29">29 August 1993</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FD35FED5FE0F3BD7" collectingDate="1993-09-01" collectionCode="DW" collectorName="Loreto" country="Mexico" location="Gulf of California" pageId="22" pageNumber="72" specimenCount="1">
field code BJ-360, male
<quantity id="3C6758930C5F6867FEEFFE36FE453BB5" box="[329,401,413,435]" metricMagnitude="-1" metricUnit="m" metricValue="8.3" pageId="22" pageNumber="72" unit="cm" value="83.0">83 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FE3CFE35FE123BB5" box="[410,454,414,435]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FE74FE35FDF53BB5" box="[466,545,414,435]" pageId="22" pageNumber="72">Loreto</collectorName>
,
<location id="FE40A3AD0C5F6867FD89FE36FCD23BB5" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5F6867FD89FE36FCD23BB5" box="[559,774,413,435]" country="Mexico" name="Gulf of California" pageId="22" pageNumber="72">Gulf of California</location>
,
<collectingCountry id="8388B5E60C5F6867FF05FE17FF233BD4" box="[163,247,444,466]" name="Mexico" pageId="22" pageNumber="72">Mexico</collectingCountry>
,
<date id="8F21D3B60C5F6867FEA5FE17FE0F3BD7" box="[259,475,444,466]" pageId="22" pageNumber="72" value="1993-09-01">
<collectingDate id="9F652A5E0C5F6867FEA5FE17FE0F3BD7" box="[259,475,444,466]" pageId="22" pageNumber="72" value="1993-09-01">1 September 1993</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FE4EFE17FD593808" collectingDate="1993-09-25" collectionCode="DW" collectorName="La Paz" country="Mexico" location="Gulf of California" pageId="22" pageNumber="72" specimenCode="GN5284" specimenCount="1">
field code BJ-429 (tissue accession
<specimenCode id="AB395D0D0C5F6867FEBEFE71FEAF3BF6" box="[280,379,474,496]" collectionCode="GN" pageId="22" pageNumber="72">GN5284</specimenCode>
), female
<quantity id="3C6758930C5F6867FE43FE70FDEC3BF6" box="[485,568,475,496]" metricMagnitude="0" metricUnit="m" metricValue="1.8" pageId="22" pageNumber="72" unit="cm" value="180.0">180 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FDE7FE70FDB83BF6" box="[577,620,475,496]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FDDEFE70FD1F3BF6" box="[632,715,475,496]" pageId="22" pageNumber="72">La Paz</collectorName>
,
<location id="FE40A3AD0C5F6867FD71FE71FEEE3809" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5F6867FD71FE71FEEE3809" country="Mexico" name="Gulf of California" pageId="22" pageNumber="72">Gulf of California</location>
,
<collectingCountry id="8388B5E60C5F6867FEE1FE52FE4F3809" box="[327,411,505,527]" name="Mexico" pageId="22" pageNumber="72">Mexico</collectingCountry>
,
<date id="8F21D3B60C5F6867FE01FE52FD593808" box="[423,653,505,527]" pageId="22" pageNumber="72" value="1993-09-25">
<collectingDate id="9F652A5E0C5F6867FE01FE52FD593808" box="[423,653,505,527]" pageId="22" pageNumber="72" value="1993-09-25">25 September 1993</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FD3CFE52FE36384A" collectingDate="1993-09-26" collectionCode="DW" collectorName="La Paz" country="Mexico" location="Gulf of California" pageId="22" pageNumber="72" specimenCount="1">
field code BJ-434, female
<quantity id="3C6758930C5F6867FEF2FDB3FE71382B" box="[340,421,536,557]" metricMagnitude="0" metricUnit="m" metricValue="1.49" pageId="22" pageNumber="72" unit="cm" value="149.0">149 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FE0AFDB3FE03382B" box="[428,471,536,557]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FE47FDB3FDE6382B" box="[481,562,536,557]" pageId="22" pageNumber="72">La Paz</collectorName>
,
<location id="FE40A3AD0C5F6867FD9BFDB3FCD33828" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5F6867FD9BFDB3FCD33828" box="[573,775,536,558]" country="Mexico" name="Gulf of California" pageId="22" pageNumber="72">Gulf of California</location>
,
<collectingCountry id="8388B5E60C5F6867FF05FD9DFF22384A" box="[163,246,566,588]" name="Mexico" pageId="22" pageNumber="72">Mexico</collectingCountry>
,
<date id="8F21D3B60C5F6867FEA7FD9DFE36384A" box="[257,482,566,588]" pageId="22" pageNumber="72" value="1993-09-26">
<collectingDate id="9F652A5E0C5F6867FEA7FD9DFE36384A" box="[257,482,566,588]" pageId="22" pageNumber="72" value="1993-09-26">26 September 1993</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FE49FD9DFD5638AE" collectingDate="1996-06-13" collectionCode="DW" collectorName="Santa Rosalia" country="Mexico" location="Gulf of California" pageId="22" pageNumber="72" specimenCode="GN1560, GN1561" specimenCount="1">
field code BJ-705 (tissue accession
<specimenCode id="AB395D0D0C5F6867FEBEFDFEFEAE386D" box="[280,378,597,619]" collectionCode="GN" pageId="22" pageNumber="72">GN1560</specimenCode>
), male
<quantity id="3C6758930C5F6867FE69FDFEFDF6386D" box="[463,546,597,619]" metricMagnitude="0" metricUnit="m" metricValue="1.72" pageId="22" pageNumber="72" unit="cm" value="172.0">172 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FD8DFDFDFD82386D" box="[555,598,598,619]" pageId="22" pageNumber="72">DW</collectionCode>
, BJ-706 (tissue accession
<specimenCode id="AB395D0D0C5F6867FEB1FDDFFEAD388C" box="[279,377,628,650]" collectionCode="GN" pageId="22" pageNumber="72">GN1561</specimenCode>
), male
<quantity id="3C6758930C5F6867FE69FDDFFDF6388F" box="[463,546,628,650]" metricMagnitude="0" metricUnit="m" metricValue="1.69" pageId="22" pageNumber="72" unit="cm" value="169.0">169 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FD8CFDDFFD81388F" box="[554,597,628,649]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FDC7FDDFFCD2388C" box="[609,774,628,650]" pageId="22" pageNumber="72">Santa Rosalia</collectorName>
,
<location id="FE40A3AD0C5F6867FF05FD39FEA138AE" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5F6867FF05FD39FEA138AE" box="[163,373,658,680]" country="Mexico" name="Gulf of California" pageId="22" pageNumber="72">Gulf of California</location>
,
<collectingCountry id="8388B5E60C5F6867FE24FD39FE0238AE" box="[386,470,658,680]" name="Mexico" pageId="22" pageNumber="72">Mexico</collectingCountry>
,
<date id="8F21D3B60C5F6867FE45FD38FD5638AE" box="[483,642,658,680]" pageId="22" pageNumber="72" value="1996-06-13">
<collectingDate id="9F652A5E0C5F6867FE45FD38FD5638AE" box="[483,642,658,680]" pageId="22" pageNumber="72" value="1996-06-13">13 June 1996</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FD29FD39FDB938E3" collectingDate="1994-07-18" country="Mexico" location="Gulf of California" pageId="22" pageNumber="72" specimenCount="1">
field codes SP-10, female
<quantity id="3C6758930C5F6867FEE9FD1AFE6C38C1" box="[335,440,689,711]" metricMagnitude="0" metricUnit="m" metricValue="1.155" pageId="22" pageNumber="72" unit="cm" value="115.5">115.5 cm</quantity>
TL, SP-11, male
<quantity id="3C6758930C5F6867FD21FD1AFD0F38C1" box="[647,731,689,711]" metricMagnitude="0" metricUnit="m" metricValue="1.26" pageId="22" pageNumber="72" unit="cm" value="126.0">126 cm</quantity>
TL,
<location id="FE40A3AD0C5F6867FF05FD7BFEBB38E0" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5F6867FF05FD7BFEBB38E0" box="[163,367,720,742]" country="Mexico" name="Gulf of California" pageId="22" pageNumber="72">Gulf of California</location>
,
<collectingCountry id="8388B5E60C5F6867FEDDFD7BFE1938E0" box="[379,461,720,742]" name="Mexico" pageId="22" pageNumber="72">Mexico</collectingCountry>
,
<date id="8F21D3B60C5F6867FE7EFD7BFDB938E3" box="[472,621,720,742]" pageId="22" pageNumber="72" value="1994-07-18">
<collectingDate id="9F652A5E0C5F6867FE7EFD7BFDB938E3" box="[472,621,720,742]" pageId="22" pageNumber="72" value="1994-07-18">18 July 1994</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FDDFFD7BFEB63924" collectingDate="2004-09-10" collectionCode="DW" collectorName="Tanjung Luar &amp; Lombok" country="Indonesia" location="Indonesia" pageId="22" pageNumber="72" specimenCount="1">
male
<quantity id="3C6758930C5F6867FD1FFD7BFCDE38E3" box="[697,778,720,742]" metricMagnitude="0" metricUnit="m" metricValue="1.45" pageId="22" pageNumber="72" unit="cm" value="145.0">145 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FF05FD44FF1A3902" box="[163,206,751,772]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FF70FD45FEA73902" box="[214,371,750,772]" pageId="22" pageNumber="72">Tanjung Luar</collectorName>
landing site,
<collectorName id="566A90A00C5F6867FDAAFD45FDBD3902" box="[524,617,750,772]" pageId="22" pageNumber="72">Lombok</collectorName>
,
<collectingCountry id="8388B5E60C5F6867FDD5FD45FD313902" box="[627,741,750,772]" name="Indonesia" pageId="22" pageNumber="72">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5F6867FD49FD44FEB63924" pageId="22" pageNumber="72" value="2004-09-10">
<collectingDate id="9F652A5E0C5F6867FD49FD44FEB63924" pageId="22" pageNumber="72" value="2004-09-10">10 September 2004</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FEC8FCA6FCD13947" collectingDate="2004-10-12" collectionCode="DW" collectorName="Tanjung Luar &amp; Lombok" country="Indonesia" location="Indonesia" pageId="22" pageNumber="72" specimenCount="1">
female
<quantity id="3C6758930C5F6867FE62FCA6FDFF3925" box="[452,555,781,803]" metricMagnitude="0" metricUnit="m" metricValue="1.071" pageId="22" pageNumber="72" unit="cm" value="107.1">107.1 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FD95FCA5FD8A3925" box="[563,606,782,803]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FDCFFCA6FCDF3925" box="[617,779,781,803]" pageId="22" pageNumber="72">Tanjung Luar</collectorName>
landing site,
<collectorName id="566A90A00C5F6867FEE2FC87FE723944" box="[324,422,812,834]" pageId="22" pageNumber="72">Lombok</collectorName>
,
<collectingCountry id="8388B5E60C5F6867FE13FC87FDFA3944" box="[437,558,812,834]" name="Indonesia" pageId="22" pageNumber="72">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5F6867FD9AFC87FCD13947" box="[572,773,812,834]" pageId="22" pageNumber="72" value="2004-10-12">
<collectingDate id="9F652A5E0C5F6867FD9AFC87FCD13947" box="[572,773,812,834]" pageId="22" pageNumber="72" value="2004-10-12">12 October 2004</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FF05FCE1FE653979" collectingDate="2005-07-07" collectionCode="DW" collectorName="Kedonganan" country="Indonesia" location="Bali" pageId="22" pageNumber="72" specimenCount="1" stateProvince="Bali">
male
<quantity id="3C6758930C5F6867FF40FCE1FE863966" box="[230,338,842,864]" metricMagnitude="0" metricUnit="m" metricValue="1.115" pageId="22" pageNumber="72" unit="cm" value="111.5">111.5 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FEFAFCE0FE5C3966" box="[348,392,843,864]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FE33FCE1FDF83966" box="[405,556,842,864]" pageId="22" pageNumber="72">Kedonganan</collectorName>
fish market,
<collectingRegion id="395B3B940C5F6867FD75FCE1FCD23966" box="[723,774,842,864]" country="Indonesia" name="Bali" pageId="22" pageNumber="72">Bali</collectingRegion>
,
<collectingCountry id="8388B5E60C5F6867FF05FCC2FECD3979" box="[163,281,873,895]" name="Indonesia" pageId="22" pageNumber="72">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5F6867FE83FCC1FE653979" box="[293,433,873,895]" pageId="22" pageNumber="72" value="2005-07-07">
<collectingDate id="9F652A5E0C5F6867FE83FCC1FE653979" box="[293,433,873,895]" pageId="22" pageNumber="72" value="2005-07-07">7 July 2005</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FE18FCC2FD3A3998" collectingDate="2005-07-12" collectionCode="DW" collectorName="Tanjung Luar &amp; Lombok" country="Indonesia" location="Indonesia" pageId="22" pageNumber="72" specimenCount="1">
female
<quantity id="3C6758930C5F6867FDB3FCC2FDBD3979" box="[533,617,873,895]" metricMagnitude="0" metricUnit="m" metricValue="1.13" pageId="22" pageNumber="72" unit="cm" value="113.0">113 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FDD4FCC1FD4A3979" box="[626,670,874,895]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FD0FFCC2FF0F399B" pageId="22" pageNumber="72">Tanjung Luar</collectorName>
landing site,
<collectorName id="566A90A00C5F6867FED3FC23FE063998" box="[373,466,904,926]" pageId="22" pageNumber="72">Lombok</collectorName>
,
<collectingCountry id="8388B5E60C5F6867FE7BFC23FD9B3998" box="[477,591,904,926]" name="Indonesia" pageId="22" pageNumber="72">Indonesia</collectingCountry>
,
<date id="8F21D3B60C5F6867FDFCFC23FD3A3998" box="[602,750,904,926]" pageId="22" pageNumber="72" value="2005-07-12">
<collectingDate id="9F652A5E0C5F6867FDFCFC23FD3A3998" box="[602,750,904,926]" pageId="22" pageNumber="72" value="2005-07-12">12 July 2005</collectingDate>
</date>
</materialsCitation>
.
</paragraph>
<paragraph id="FB20F5760C5F6867FF05FC6CFD1F3F2B" blockId="22.[163,779,966,1326]" pageId="22" pageNumber="72">
<emphasis id="C9EB29640C5F6867FF05FC6CFE2639DD" box="[163,498,966,988]" italics="true" pageId="22" pageNumber="72">Not retained, tissue sampled</emphasis>
:
<materialsCitation id="4BF7FF2B0C5F6867FDA7FC6DFD5E3E1F" collectingDate="1993-09-01" collectionCode="DW" collectorName="Loreto" country="Mexico" location="Gulf of California" pageId="22" pageNumber="72" specimenCode="GN5268" specimenCount="1">
Field code BJ-351 (tissue accession
<specimenCode id="AB395D0D0C5F6867FEE0FC4EFE7C39FD" box="[326,424,997,1019]" collectionCode="GN" pageId="22" pageNumber="72">GN5268</specimenCode>
), male
<quantity id="3C6758930C5F6867FE5AFC4EFD9439FD" box="[508,576,997,1019]" metricMagnitude="-1" metricUnit="m" metricValue="8.9" pageId="22" pageNumber="72" unit="cm" value="89.0">89 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FDEEFC4DFDA739FD" box="[584,627,998,1019]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FDD9FC4DFD1839FD" box="[639,716,998,1019]" pageId="22" pageNumber="72">Loreto</collectorName>
,
<location id="FE40A3AD0C5F6867FD71FC4EFEE93E1C" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5F6867FD71FC4EFEE93E1C" country="Mexico" name="Gulf of California" pageId="22" pageNumber="72">Gulf of California</location>
,
<collectingCountry id="8388B5E60C5F6867FEEDFBAFFE753E1C" box="[331,417,1028,1050]" name="Mexico" pageId="22" pageNumber="72">Mexico</collectingCountry>
,
<date id="8F21D3B60C5F6867FE08FBAFFD5E3E1F" box="[430,650,1028,1050]" pageId="22" pageNumber="72" value="1993-09-01">
<collectingDate id="9F652A5E0C5F6867FE08FBAFFD5E3E1F" box="[430,650,1028,1050]" pageId="22" pageNumber="72" value="1993-09-01">1 September 1993</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FD3FFBAFFCD23E50" collectingDate="1993-09-06" collectionCode="DW" collectorName="La Paz" country="Mexico" location="Gulf of California" pageId="22" pageNumber="72" specimenCode="GN5270" specimenCount="1">
field code BJ-378 (tissue accession
<specimenCode id="AB395D0D0C5F6867FE6EFB89FDF83E3E" box="[456,556,1058,1080]" collectionCode="GN" pageId="22" pageNumber="72">GN5270</specimenCode>
), male
<quantity id="3C6758930C5F6867FD26FB88FD073E3E" box="[640,723,1059,1080]" metricMagnitude="0" metricUnit="m" metricValue="1.7" pageId="22" pageNumber="72" unit="cm" value="170.0">170 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FD7DFB88FCD23E3E" box="[731,774,1059,1080]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FF05FBE9FF273E51" box="[163,243,1090,1111]" pageId="22" pageNumber="72">La Paz</collectorName>
,
<location id="FE40A3AD0C5F6867FF59FBEAFE1F3E51" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5F6867FF59FBEAFE1F3E51" box="[255,459,1089,1111]" country="Mexico" name="Gulf of California" pageId="22" pageNumber="72">Gulf of California</location>
,
<collectingCountry id="8388B5E60C5F6867FE71FBEAFDFD3E51" box="[471,553,1089,1111]" name="Mexico" pageId="22" pageNumber="72">Mexico</collectingCountry>
,
<date id="8F21D3B60C5F6867FD93FBEAFCD23E50" box="[565,774,1089,1111]" pageId="22" pageNumber="72" value="1993-09-06">
<collectingDate id="9F652A5E0C5F6867FD93FBEAFCD23E50" box="[565,774,1089,1111]" pageId="22" pageNumber="72" value="1993-09-06">6 September 1993</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FF05FBCBFEB03EB4" collectingDate="1993-09-11" collectionCode="DW" collectorName="La Paz" country="Mexico" location="Gulf of California" pageId="22" pageNumber="72" specimenCode="GN5277" specimenCount="1">
field code BJ-411 (tissue accession
<specimenCode id="AB395D0D0C5F6867FDF3FBCBFD6F3E70" box="[597,699,1120,1142]" collectionCode="GN" pageId="22" pageNumber="72">GN5277</specimenCode>
), male
<quantity id="3C6758930C5F6867FF05FBD5FF2D3E92" box="[163,249,1150,1172]" metricMagnitude="0" metricUnit="m" metricValue="1.71" pageId="22" pageNumber="72" unit="cm" value="171.0">171 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FEA5FBD4FEFB3E92" box="[259,303,1151,1172]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FE9BFBD4FE473E92" box="[317,403,1151,1172]" pageId="22" pageNumber="72">La Paz</collectorName>
,
<location id="FE40A3AD0C5F6867FE07FBD5FDA83E92" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5F6867FE07FBD5FDA83E92" box="[417,636,1150,1172]" country="Mexico" name="Gulf of California" pageId="22" pageNumber="72">Gulf of California</location>
,
<collectingCountry id="8388B5E60C5F6867FD2CFBD5FD343E92" box="[650,736,1150,1172]" name="Mexico" pageId="22" pageNumber="72">Mexico</collectingCountry>
,
<date id="8F21D3B60C5F6867FD48FBD5FEB03EB4" pageId="22" pageNumber="72" value="1993-09-11">
<collectingDate id="9F652A5E0C5F6867FD48FBD5FEB03EB4" pageId="22" pageNumber="72" value="1993-09-11">11 September 1993</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FED7FB36FE0A3EE9" collectingDate="1993-09-25" collectionCode="DW" collectorName="La Paz" country="Mexico" location="Gulf of California" pageId="22" pageNumber="72" specimenCode="GN5286" specimenCount="1">
field code BJ-431 (tissue accession
<specimenCode id="AB395D0D0C5F6867FF05FB17FED73ED4" box="[163,259,1212,1234]" collectionCode="GN" pageId="22" pageNumber="72">GN5286</specimenCode>
), male
<quantity id="3C6758930C5F6867FEF3FB17FE723ED7" box="[341,422,1212,1233]" metricMagnitude="0" metricUnit="m" metricValue="1.72" pageId="22" pageNumber="72" unit="cm" value="172.0">172 cm</quantity>
<collectionCode id="9D8E6DB30C5F6867FE0BFB17FE0C3ED7" box="[429,472,1212,1233]" pageId="22" pageNumber="72">DW</collectionCode>
,
<collectorName id="566A90A00C5F6867FE44FB17FDE63ED7" box="[482,562,1212,1233]" pageId="22" pageNumber="72">La Paz</collectorName>
,
<location id="FE40A3AD0C5F6867FD9BFB17FCD33ED4" LSID="urn:lsid:plazi:treatment:733644600C5C6867FC34FA77FD1F3F2B:FE40A3AD0C5F6867FD9BFB17FCD33ED4" box="[573,775,1212,1234]" country="Mexico" name="Gulf of California" pageId="22" pageNumber="72">Gulf of California</location>
,
<collectingCountry id="8388B5E60C5F6867FF05FB71FF213EF6" box="[163,245,1242,1264]" name="Mexico" pageId="22" pageNumber="72">Mexico</collectingCountry>
,
<date id="8F21D3B60C5F6867FEA6FB71FE0A3EE9" box="[256,478,1242,1264]" pageId="22" pageNumber="72" value="1993-09-25">
<collectingDate id="9F652A5E0C5F6867FEA6FB71FE0A3EE9" box="[256,478,1242,1264]" pageId="22" pageNumber="72" value="1993-09-25">25 September 1993</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FE4FFB71FD983F08" collectingDate="2010-08-03" country="Oman" location="Oman" pageId="22" pageNumber="72" specimenCount="1">
tissue accession GN9725, male, Muttrah,
<collectingCountry id="8388B5E60C5F6867FEF2FB52FE483F08" box="[340,412,1273,1294]" name="Oman" pageId="22" pageNumber="72">Oman</collectingCountry>
,
<date id="8F21D3B60C5F6867FE01FB52FD983F08" box="[423,588,1273,1294]" pageId="22" pageNumber="72" value="2010-08-03">
<collectingDate id="9F652A5E0C5F6867FE01FB52FD983F08" box="[423,588,1273,1294]" pageId="22" pageNumber="72" value="2010-08-03">3 August 2010</collectingDate>
</date>
</materialsCitation>
;
<materialsCitation id="4BF7FF2B0C5F6867FDF0FB52FD133F2B" collectingDate="2010-08-17" country="Oman" location="Oman" pageId="22" pageNumber="72" specimenCount="1">
tissue accession GN9728, male, Muttrah,
<collectingCountry id="8388B5E60C5F6867FE66FAB3FDDC3F2B" box="[448,520,1304,1325]" name="Oman" pageId="22" pageNumber="72">Oman</collectingCountry>
,
<date id="8F21D3B60C5F6867FDB5FAB3FD133F2B" box="[531,711,1304,1325]" pageId="22" pageNumber="72" value="2010-08-17">
<collectingDate id="9F652A5E0C5F6867FDB5FAB3FD133F2B" box="[531,711,1304,1325]" pageId="22" pageNumber="72" value="2010-08-17">17 August 2010</collectingDate>
</date>
</materialsCitation>
.
</paragraph>
</subSubSection>
</treatment>
</document>

View file

@ -1,66 +1,66 @@
<document id="2BA46F8D061E43C45999B81DF07ED6E6" ID-CLB-Dataset="298671" ID-DOI="10.5852/ejt.2024.938.2565" ID-GBIF-Dataset="b7c20ad6-4993-48e2-b202-3646dcad0714" ID-ISSN="2118-9773" ID-Zenodo-Dep="12106502" ID-ZooBank="A7C46449-1DA9-4D01-A145-04AA66BBAA63" IM.bibliography_approvedBy="valdenar" IM.illustrations_approvedBy="valdenar" IM.materialsCitations_approvedBy="valdenar" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="valdenar" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="valdenar" checkinTime="1718730770205" checkinUser="plazi" docAuthor="Awad, Jessica, Zimmermann, Dominique &amp; Talamas, Elijah" docDate="2024" docId="7C416C21FFC8F011FDE6FA85FD69FB26" docLanguage="en" docName="EJT.2024.938.1-58.pdf" docOrigin="European Journal of Taxonomy 938" docSource="https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639" docStyle="DocumentStyle:EF2B578F1D15862ADE45B0C07C620911.14:EJT.2018-.journal_article.type1" docStyleId="EF2B578F1D15862ADE45B0C07C620911" docStyleName="EJT.2018-.journal_article.type1" docStyleVersion="14" docTitle="Gryon Haliday 1833" docType="treatment" docVersion="7" lastPageNumber="21" masterDocId="80781459FFDBF005FF92FFEBFFDDFFF3" masterDocTitle="A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna" masterLastPageNumber="58" masterPageNumber="1" pageNumber="20" updateTime="1732564944665" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0" zenodo-license-figures="CC-BY-4.0" zenodo-license-treatments="UNSPECIFIED"> <document id="A32167BB995F7B9B252A83AF00457160" ID-CLB-Dataset="298671" ID-DOI="10.5852/ejt.2024.938.2565" ID-GBIF-Dataset="b7c20ad6-4993-48e2-b202-3646dcad0714" ID-ISSN="2118-9773" ID-Zenodo-Dep="12106502" ID-ZooBank="A7C46449-1DA9-4D01-A145-04AA66BBAA63" IM.bibliography_approvedBy="valdenar" IM.illustrations_approvedBy="valdenar" IM.materialsCitations_approvedBy="valdenar" IM.metadata_approvedBy="felipe" IM.tables_approvedBy="jonas" IM.taxonomicNames_approvedBy="jonas" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="valdenar" checkinTime="1718730770205" checkinUser="plazi" docAuthor="Awad, Jessica, Zimmermann, Dominique &amp; Talamas, Elijah" docDate="2024" docId="7C416C21FFC8F011FDE6FA85FD69FB26" docLanguage="en" docName="EJT.2024.938.1-58.pdf" docOrigin="European Journal of Taxonomy 938" docSource="https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639" docStyle="DocumentStyle:EF2B578F1D15862ADE45B0C07C620911.14:EJT.2018-.journal_article.type1" docStyleId="EF2B578F1D15862ADE45B0C07C620911" docStyleName="EJT.2018-.journal_article.type1" docStyleVersion="14" docTitle="Gryon Haliday 1833" docType="treatment" docVersion="9" lastPageNumber="21" masterDocId="80781459FFDBF005FF92FFEBFFDDFFF3" masterDocTitle="A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna" masterLastPageNumber="58" masterPageNumber="1" pageNumber="20" updateTime="1738779448810" updateUser="jonas" zenodo-license-document="CC-BY-4.0" zenodo-license-figures="CC-BY-4.0" zenodo-license-treatments="UNSPECIFIED">
<mods:mods id="E6DC2E2A96809E879DCDBA9CA7A76DE3" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="36D373118790442E9318EB99D663A911" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="4922932FCF24FE7D04046BE9DE2B42C0"> <mods:titleInfo id="C5F6F3F75761B20D047FEA8514965EE3">
<mods:title id="28F8CFD83C7D0FA247A3694873FFAAD0">A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna</mods:title> <mods:title id="42B989044EEDF0FEB7B256DF07568360">A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="C251E676E647B61A18B92C10F5F4B08E" type="personal"> <mods:name id="AEE99C6DAAFACEA59D513C756EDD12BB" type="personal">
<mods:role id="29B2E93298644AFF91E154E970395DB6"> <mods:role id="832C0F6386E2F78B39B88BC841F87403">
<mods:roleTerm id="BDE5CA883566C144CBA53B5F656851E0">Author</mods:roleTerm> <mods:roleTerm id="1FC9EC0C7E70D3E2D9E037E4BEF130AD">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="3430917D7D173CD2B6736A7576827752">Awad, Jessica</mods:namePart> <mods:namePart id="6C86E3752054CD4FB1DE3C3752F4EED5">Awad, Jessica</mods:namePart>
<mods:nameIdentifier id="A73A3AE6F7770F32B4735E1AB2876509" type="LSID">0F70AC80-70B4-4AED-BF6E-A191DF4F68BB</mods:nameIdentifier> <mods:nameIdentifier id="189FE71EA53CFB183AB5F229D184D0B1" type="LSID">0F70AC80-70B4-4AED-BF6E-A191DF4F68BB</mods:nameIdentifier>
<mods:affiliation id="2522B03F82FD5E6284E0A8BCF67A2231">State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany.</mods:affiliation> <mods:affiliation id="5EF4C00424BEAE7E8C2094834EDD5C20">State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany.</mods:affiliation>
<mods:nameIdentifier id="955F03E15B0FF3AAF29BA34641028C81" type="email">jessica.awad@smns-bw.de</mods:nameIdentifier> <mods:nameIdentifier id="CDDA1F4FAE931D1F7E73CCD4B159D553" type="email">jessica.awad@smns-bw.de</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="737391A74A02D1946024ED525F04983C" type="personal"> <mods:name id="553C46F543E073A117D6AD6AB73587F6" type="personal">
<mods:role id="C79FBA3D20143955BB3B4E63E0D8FDD2"> <mods:role id="C8F21315A97FEF1127628894BF4FD252">
<mods:roleTerm id="FAF4AEB07736B94E9AC3FC5DD9FBAE51">Author</mods:roleTerm> <mods:roleTerm id="187CDEBF718637ADF7F2AC2F1CBAE657">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="A099290A4191B77149B1E69C875F9529">Zimmermann, Dominique</mods:namePart> <mods:namePart id="B883797C678E1C01B3A726CB1E3B1C85">Zimmermann, Dominique</mods:namePart>
<mods:nameIdentifier id="1210FDF29F18ABAE4A2668619AC4C2FB" type="LSID">57F2F5FE-84D9-43DE-AC26-4720B313B0BD</mods:nameIdentifier> <mods:nameIdentifier id="1DDA24CCC061F79D687661DA3C106517" type="LSID">57F2F5FE-84D9-43DE-AC26-4720B313B0BD</mods:nameIdentifier>
<mods:affiliation id="C8D02AB7FCABE7C66BF7B06C93AA1A6A">History Museum Vienna, Burgring 7, 1010 Vienna, Austria.</mods:affiliation> <mods:affiliation id="B4D35B5B0B1B84BB9D398ABC0F98DC01">History Museum Vienna, Burgring 7, 1010 Vienna, Austria.</mods:affiliation>
<mods:nameIdentifier id="B386622E8D7A5B0CEA3F3F0040D0FD30" type="email">dominique.zimmermann@nhm-wien.ac.at</mods:nameIdentifier> <mods:nameIdentifier id="732AF5BEE6F4949C0E217A9AD1B9C486" type="email">dominique.zimmermann@nhm-wien.ac.at</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="61C92251C5C23A0223CB16B13F5744E4" type="personal"> <mods:name id="FDD71AE4EE212E8876810B621E11398A" type="personal">
<mods:role id="C5230B879C14D2DE6A6D9FA50EF30834"> <mods:role id="5F884C931B98E1A1454A8E51A267AFE3">
<mods:roleTerm id="72A589FAFCAE215A1591C83B1CC14A93">Author</mods:roleTerm> <mods:roleTerm id="77A1CAA02EA7A9F8B8B666EB32D40042">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="C47FE07408B2E5647C9FA131F8AFB97F">Talamas, Elijah</mods:namePart> <mods:namePart id="9CE679B23492A5A024F6A33D749E0E89">Talamas, Elijah</mods:namePart>
<mods:nameIdentifier id="F7434B9571241987BDFE8ECAC39407F9" type="LSID">FDE12E40-BFCE-444A-AFAD-9A214A129345</mods:nameIdentifier> <mods:nameIdentifier id="6A4C74CA6DC3FAA818E7C8D4F2C24C9A" type="LSID">FDE12E40-BFCE-444A-AFAD-9A214A129345</mods:nameIdentifier>
<mods:affiliation id="62C843667C0FA72F3FC92B8DC6554DC4">Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA.</mods:affiliation> <mods:affiliation id="4F8872D93938BB33AB1BF3C8F8A746EC">Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA.</mods:affiliation>
<mods:nameIdentifier id="3AE9D8A0083C2016A78924840CC50D8A" type="email">elijah.talamas@fdacs.gov</mods:nameIdentifier> <mods:nameIdentifier id="4A5334158E2C491878BDD3AF0070218F" type="email">elijah.talamas@fdacs.gov</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:typeOfResource id="D882CA1D324B157B9E8DAA3CD1132A02">text</mods:typeOfResource> <mods:typeOfResource id="20823CF1D137B6CDC71D087DDBE36C4E">text</mods:typeOfResource>
<mods:relatedItem id="6769364D14225F06189D8CD57EF31FAA" type="host"> <mods:relatedItem id="8E663ECB7F61E77AC7EEDF84FFF7FD25" type="host">
<mods:titleInfo id="FA54BBB576094459FB35BCDC17E34DB4"> <mods:titleInfo id="2019B0C53EDCBC72377B7722845F9041">
<mods:title id="71D272C02EDE05C6F38BB5D3CC25F643">European Journal of Taxonomy</mods:title> <mods:title id="D7A545596265728B6B65DDDE79A7C529">European Journal of Taxonomy</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="57DB6A695F34B1B001EA4A98AE5DE309"> <mods:part id="55261B9BD1816DED6FAFD7F031D1B0E7">
<mods:date id="CD9E3891A9538D79C14B670881ED48EA">2024</mods:date> <mods:date id="F15FC53B9511176EFF20947AF877A531">2024</mods:date>
<mods:detail id="ED7CBE0306649A14BA2C9D96C66E9A38" type="pubDate"> <mods:detail id="1E637CB7FD011A8DFB4AC1F580D7FCFA" type="pubDate">
<mods:number id="8F6E7576DF4CE5991FF8C2B74CF6749F">2024-06-18</mods:number> <mods:number id="6D3B315070F5478F87BF1F950161B6EA">2024-06-18</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="323A840A9DE76C6E309C6B51D5F6BCE8" type="volume"> <mods:detail id="CAB760B9834B996C1339DF9A8D996699" type="volume">
<mods:number id="E83A492501BF45E80E12DE9370EF481A">938</mods:number> <mods:number id="E0D5108BCAD2638068C8ECE7C07F8DA2">938</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="8A925A98216DB97851F8EEEA994326A6" unit="page"> <mods:extent id="0D659BEB5D01772E5A466C4732B1BDD2" unit="page">
<mods:start id="2218B16F282CA2B9CB8338EB55DAC3AC">1</mods:start> <mods:start id="09D3740D7FA325E7B4A1A03A8909FE18">1</mods:start>
<mods:end id="695B4AEF8D613C0DD0667A70F3748F75">58</mods:end> <mods:end id="334364644E2D604FF5C9AC342172CBF5">58</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="8778A885BA1E0087496E0F474BC5D9BE"> <mods:location id="5D6D65A79C40D766AB3C92A98520BB91">
<mods:url id="A7AD68BBCED8D7532C032418EDC6D571">https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639</mods:url> <mods:url id="3DD78D1B540DF0F0778F2F54D07D28B0">https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639</mods:url>
</mods:location> </mods:location>
<mods:classification id="DDEAAA7781D823E861BADB7FE5DE7CD8">journal article</mods:classification> <mods:classification id="C8682FB1EC91948B7C73DD82326BA333">journal article</mods:classification>
<mods:identifier id="DCC10B0BDD2EA7AB37B1746A56B8327F" type="CLB-Dataset">298671</mods:identifier> <mods:identifier id="496CE2DE58F053254DF6F06B7DADC1E2" type="CLB-Dataset">298671</mods:identifier>
<mods:identifier id="5D6BD6E9F91B5ACC4F657C3F8DF6883F" type="DOI">10.5852/ejt.2024.938.2565</mods:identifier> <mods:identifier id="A4849F5BFF552EC4A32421CC8894CE9E" type="DOI">10.5852/ejt.2024.938.2565</mods:identifier>
<mods:identifier id="BEE373FDAE448386B32D3A60C21D8B21" type="GBIF-Dataset">b7c20ad6-4993-48e2-b202-3646dcad0714</mods:identifier> <mods:identifier id="E31DEC21DB2754D0AF37A14AC0554F40" type="GBIF-Dataset">b7c20ad6-4993-48e2-b202-3646dcad0714</mods:identifier>
<mods:identifier id="4D2F23F9A11D5C16209DCE04315C502E" type="ISSN">2118-9773</mods:identifier> <mods:identifier id="2862A24CEB7D71576DF37D6FE689C6CD" type="ISSN">2118-9773</mods:identifier>
<mods:identifier id="D660FC20F6638901D367EA82EB104349" type="Zenodo-Dep">12106502</mods:identifier> <mods:identifier id="33D08CC0740DDDF734EDB52468D32AB4" type="Zenodo-Dep">12106502</mods:identifier>
<mods:identifier id="AEF1575776967A871B96B98C2828E69C" type="ZooBank">A7C46449-1DA9-4D01-A145-04AA66BBAA63</mods:identifier> <mods:identifier id="D6D7E0B6641DD35E8ACA5F08239E703F" type="ZooBank">A7C46449-1DA9-4D01-A145-04AA66BBAA63</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="7C416C21FFC8F011FDE6FA85FD69FB26" ID-GBIF-Taxon="233237501" LSID="urn:lsid:plazi:treatment:7C416C21FFC8F011FDE6FA85FD69FB26" httpUri="http://treatment.plazi.org/id/7C416C21FFC8F011FDE6FA85FD69FB26" lastPageId="20" lastPageNumber="21" pageId="19" pageNumber="20" scope_class="Insecta" scope_family="Scelionidae" scope_order="Hymenoptera" scope_superFamily="Platygastroidea"> <treatment id="7C416C21FFC8F011FDE6FA85FD69FB26" ID-DOI="http://doi.org/10.5281/zenodo.14224987" ID-GBIF-Taxon="233237501" ID-Zenodo-Dep="14224987" LSID="urn:lsid:plazi:treatment:7C416C21FFC8F011FDE6FA85FD69FB26" httpUri="http://treatment.plazi.org/id/7C416C21FFC8F011FDE6FA85FD69FB26" lastPageId="20" lastPageNumber="21" pageId="19" pageNumber="20" scope_class="Insecta" scope_family="Scelionidae" scope_order="Hymenoptera" scope_superFamily="Platygastroidea">
<subSubSection id="BCF28EBCFFC8F016FDE6FA85FC62FA7B" box="[628,959,1390,1416]" pageId="19" pageNumber="20" type="nomenclature"> <subSubSection id="BCF28EBCFFC8F016FDE6FA85FC62FA7B" box="[628,959,1390,1416]" pageId="19" pageNumber="20" type="nomenclature">
<paragraph id="F457DD37FFC8F016FDE6FA85FC62FA7B" blockId="19.[628,959,1390,1416]" box="[628,959,1390,1416]" pageId="19" pageNumber="20"> <paragraph id="F457DD37FFC8F016FDE6FA85FC62FA7B" blockId="19.[628,959,1390,1416]" box="[628,959,1390,1416]" pageId="19" pageNumber="20">
<heading id="AF1F6A5BFFC8F016FDE6FA85FC62FA7B" box="[628,959,1390,1416]" centered="true" fontSize="11" level="2" pageId="19" pageNumber="20" reason="2"> <heading id="AF1F6A5BFFC8F016FDE6FA85FC62FA7B" box="[628,959,1390,1416]" centered="true" fontSize="11" level="2" pageId="19" pageNumber="20" reason="2">
@ -259,7 +259,7 @@ Szabó, 1966: 422
, 442. , 442.
<typeStatus id="2B536395FFCFF011FDD9FEBBFD58FE99" box="[587,645,336,362]" pageId="20" pageNumber="21">Type</typeStatus> <typeStatus id="2B536395FFCFF011FDD9FEBBFD58FE99" box="[587,645,336,362]" pageId="20" pageNumber="21">Type</typeStatus>
species species
<taxonomicName id="33E8A6B4FFCFF011FD7AFEA4FB7FFE99" authority="Masner, 1958" authorityName="Masner" authorityYear="1958" box="[744,1186,335,362]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="20" pageNumber="21" phylum="Arthropoda" rank="species" species="lymantriae"> <taxonomicName id="33E8A6B4FFCFF011FD7AFEA4FB7FFE99" authority="Masner, 1958" authorityName="Masner" authorityYear="1958" box="[744,1186,335,362]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="20" pageNumber="21" phylum="Arthropoda" rank="species" species="lymantriae">
<emphasis id="C69C0125FFCFF011FD7AFEA4FC27FE9A" box="[744,1018,335,361]" italics="true" pageId="20" pageNumber="21">Hadronotus lymantriae</emphasis> <emphasis id="C69C0125FFCFF011FD7AFEA4FC27FE9A" box="[744,1018,335,361]" italics="true" pageId="20" pageNumber="21">Hadronotus lymantriae</emphasis>
Masner, 1958 Masner, 1958
</taxonomicName> </taxonomicName>
@ -331,7 +331,7 @@ by original designation.
<bibRefCitation id="9079A0C6FFCFF011FE1AFD41FD83FD36" author="Kieffer J. J." box="[392,606,682,709]" pageId="20" pageNumber="21" refId="ref22139" refString="Kieffer J. J. 1926. Das Tierreich. Vol. 48: Hymenoptera, Proctotrupoidea, Scelionidae. Walter de Gruyter, Berlin / Leipzig. https: // doi. org / 10.1515 / 9783111432939" type="book" year="1926">Kieffer 1926: 453</bibRefCitation> <bibRefCitation id="9079A0C6FFCFF011FE1AFD41FD83FD36" author="Kieffer J. J." box="[392,606,682,709]" pageId="20" pageNumber="21" refId="ref22139" refString="Kieffer J. J. 1926. Das Tierreich. Vol. 48: Hymenoptera, Proctotrupoidea, Scelionidae. Walter de Gruyter, Berlin / Leipzig. https: // doi. org / 10.1515 / 9783111432939" type="book" year="1926">Kieffer 1926: 453</bibRefCitation>
</treatmentCitation> </treatmentCitation>
(junior synonym of (junior synonym of
<taxonomicName id="33E8A6B4FFCFF011FCCBFD41FB4DFD36" ID-CoL="8HK83" authority="Forster, 1856" authorityName="Forster" authorityYear="1856" box="[857,1168,682,709]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="20" pageNumber="21" phylum="Arthropoda" rank="genus"> <taxonomicName id="33E8A6B4FFCFF011FCCBFD41FB4DFD36" ID-CoL="8HK83" authority="Forster, 1856" authorityName="Forster" authorityYear="1856" box="[857,1168,682,709]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="20" pageNumber="21" phylum="Arthropoda" rank="genus">
<emphasis id="C69C0125FFCFF011FCCBFD41FC39FD37" box="[857,996,682,708]" italics="true" pageId="20" pageNumber="21">Hadronotus</emphasis> <emphasis id="C69C0125FFCFF011FCCBFD41FC39FD37" box="[857,996,682,708]" italics="true" pageId="20" pageNumber="21">Hadronotus</emphasis>
<bibRefCitation id="9079A0C6FFCFF011FC7CFD40FB4DFD36" author="Forster A." box="[1006,1168,682,709]" pageId="20" pageNumber="21" refId="ref20844" refString="Forster A. 1856. Hymenopterologische Studien. II. Heft. Chalcidiae und Proctotrupii. Ernst ter Meer, Aachen." type="book" year="1856">Förster, 1856</bibRefCitation> <bibRefCitation id="9079A0C6FFCFF011FC7CFD40FB4DFD36" author="Forster A." box="[1006,1168,682,709]" pageId="20" pageNumber="21" refId="ref20844" refString="Forster A. 1856. Hymenopterologische Studien. II. Heft. Chalcidiae und Proctotrupii. Ernst ter Meer, Aachen." type="book" year="1856">Förster, 1856</bibRefCitation>
</taxonomicName> </taxonomicName>

View file

@ -1,70 +1,70 @@
<document id="59DB7367B14D1F2A563B5FC3FDA61CEF" ID-CLB-Dataset="298671" ID-DOI="10.5852/ejt.2024.938.2565" ID-GBIF-Dataset="b7c20ad6-4993-48e2-b202-3646dcad0714" ID-ISSN="2118-9773" ID-Zenodo-Dep="12106502" ID-ZooBank="A7C46449-1DA9-4D01-A145-04AA66BBAA63" IM.bibliography_approvedBy="valdenar" IM.illustrations_approvedBy="valdenar" IM.materialsCitations_approvedBy="valdenar" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="valdenar" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="valdenar" checkinTime="1718730770205" checkinUser="plazi" docAuthor="Awad, Jessica, Zimmermann, Dominique &amp; Talamas, Elijah" docDate="2024" docId="7C416C21FFCDF012FDDDF97FFE72FE2A" docLanguage="en" docName="EJT.2024.938.1-58.pdf" docOrigin="European Journal of Taxonomy 938" docSource="https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639" docStyle="DocumentStyle:EF2B578F1D15862ADE45B0C07C620911.14:EJT.2018-.journal_article.type1" docStyleId="EF2B578F1D15862ADE45B0C07C620911" docStyleName="EJT.2018-.journal_article.type1" docStyleVersion="14" docTitle="Hadronotus laticeps Kieffer 1908" docType="treatment" docVersion="7" lastPageNumber="24" masterDocId="80781459FFDBF005FF92FFEBFFDDFFF3" masterDocTitle="A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna" masterLastPageNumber="58" masterPageNumber="1" pageNumber="23" updateTime="1719332526003" updateUser="valdenar" zenodo-license-document="CC-BY-4.0" zenodo-license-figures="CC-BY-4.0" zenodo-license-treatments="UNSPECIFIED"> <document id="946AE1D8AE31F4C5EDA8249603938186" ID-CLB-Dataset="298671" ID-DOI="10.5852/ejt.2024.938.2565" ID-GBIF-Dataset="b7c20ad6-4993-48e2-b202-3646dcad0714" ID-ISSN="2118-9773" ID-Zenodo-Dep="12106502" ID-ZooBank="A7C46449-1DA9-4D01-A145-04AA66BBAA63" IM.bibliography_approvedBy="valdenar" IM.illustrations_approvedBy="valdenar" IM.materialsCitations_approvedBy="valdenar" IM.metadata_approvedBy="felipe" IM.tables_approvedBy="jonas" IM.taxonomicNames_approvedBy="jonas" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="valdenar" checkinTime="1718730770205" checkinUser="plazi" docAuthor="Awad, Jessica, Zimmermann, Dominique &amp; Talamas, Elijah" docDate="2024" docId="7C416C21FFCDF012FDDDF97FFE72FE2A" docLanguage="en" docName="EJT.2024.938.1-58.pdf" docOrigin="European Journal of Taxonomy 938" docSource="https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639" docStyle="DocumentStyle:EF2B578F1D15862ADE45B0C07C620911.14:EJT.2018-.journal_article.type1" docStyleId="EF2B578F1D15862ADE45B0C07C620911" docStyleName="EJT.2018-.journal_article.type1" docStyleVersion="14" docTitle="Hadronotus laticeps Kieffer 1908" docType="treatment" docVersion="9" lastPageNumber="24" masterDocId="80781459FFDBF005FF92FFEBFFDDFFF3" masterDocTitle="A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna" masterLastPageNumber="58" masterPageNumber="1" pageNumber="23" updateTime="1738779448810" updateUser="jonas" zenodo-license-document="CC-BY-4.0" zenodo-license-figures="CC-BY-4.0" zenodo-license-treatments="UNSPECIFIED">
<mods:mods id="0A3395DBD678DCFA19E2C27D57A0FB29" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="5B5C73E6DF1822D4E75B124C4B148DD8" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="AC1674CBB73FCF911431C64188F84BCD"> <mods:titleInfo id="B54C1CC325502E71C36F97BD4E1B86C0">
<mods:title id="0B1737063D91628860D5A9FDC8DCE508">A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna</mods:title> <mods:title id="C0722998D916E4D98D7C40C6B17DB961">A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="04C6E0DD348CEDE7F02E6159CDB863D5" type="personal"> <mods:name id="C0BD977717C110CB20F9C7EB9430025D" type="personal">
<mods:role id="B65C84F64FBE373BA21806D0B7A313C1"> <mods:role id="98BB6E2EFFF0F84CF7B703E43B512B86">
<mods:roleTerm id="2E6A8CD3D47D64CD2942FFC966DCA6A2">Author</mods:roleTerm> <mods:roleTerm id="2529BB58046978343EA686872BB43E05">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="05308E73C83406926C8DAEECDE9E98F3">Awad, Jessica</mods:namePart> <mods:namePart id="CE27B7677B9D850188672EBFFC9A559D">Awad, Jessica</mods:namePart>
<mods:nameIdentifier id="706A86232EF7CC011888B25A71B1F197" type="LSID">0F70AC80-70B4-4AED-BF6E-A191DF4F68BB</mods:nameIdentifier> <mods:nameIdentifier id="543D7070972094911C74A5A04857C1C4" type="LSID">0F70AC80-70B4-4AED-BF6E-A191DF4F68BB</mods:nameIdentifier>
<mods:affiliation id="53ED62C34BDB871B8358F6BD005568EE">State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany.</mods:affiliation> <mods:affiliation id="BA8530EF5B7178C430E4FCCD211C49B4">State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany.</mods:affiliation>
<mods:nameIdentifier id="046191FBC2C90E473D9E5B48216BC88B" type="email">jessica.awad@smns-bw.de</mods:nameIdentifier> <mods:nameIdentifier id="32C4BAD805EE7F3054226ABA592338BF" type="email">jessica.awad@smns-bw.de</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="EDE8A14BF1E467D9AB353E1EAAFC81F5" type="personal"> <mods:name id="1B3A599C8BCA3E5BEB146F93BEED707C" type="personal">
<mods:role id="148F17D6D6AE6B5DC6C50BCCB0811032"> <mods:role id="7172C00382635531EF8083B327601E9F">
<mods:roleTerm id="70C7645C597FAE05C39BD7B4B794B51B">Author</mods:roleTerm> <mods:roleTerm id="9865A104CE52859A09BCCF0AC0E3DC84">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="7E5219C7E7FE20CA993D169B95E288A8">Zimmermann, Dominique</mods:namePart> <mods:namePart id="F3A6F4ECEC03FF77B7F24ED9B3CEEED0">Zimmermann, Dominique</mods:namePart>
<mods:nameIdentifier id="F05BBC35DDB74025A49DCFC825809DB7" type="LSID">57F2F5FE-84D9-43DE-AC26-4720B313B0BD</mods:nameIdentifier> <mods:nameIdentifier id="A47EE68781CE6569747E3D9D85D413AC" type="LSID">57F2F5FE-84D9-43DE-AC26-4720B313B0BD</mods:nameIdentifier>
<mods:affiliation id="61A30F7157F4167572F1FC53BF183508">History Museum Vienna, Burgring 7, 1010 Vienna, Austria.</mods:affiliation> <mods:affiliation id="A921762930BD1116B432871B0F2BCE75">History Museum Vienna, Burgring 7, 1010 Vienna, Austria.</mods:affiliation>
<mods:nameIdentifier id="03FE2F38B8739B6B7A90579533709461" type="email">dominique.zimmermann@nhm-wien.ac.at</mods:nameIdentifier> <mods:nameIdentifier id="B964FAAD468B60E1249090D311A967E6" type="email">dominique.zimmermann@nhm-wien.ac.at</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="C690B8BD48A72C18FE5896E5D04C1D1C" type="personal"> <mods:name id="7FAACAE308856549C939A564AB12EA27" type="personal">
<mods:role id="2673F456259AF0759876DA05D6B8AA92"> <mods:role id="37DD83F3CC58185C7723DF94ED4B3833">
<mods:roleTerm id="E1C73D39DA9D0483F1A628EDAB291620">Author</mods:roleTerm> <mods:roleTerm id="51B293B1F8F565EEB3608811E033007E">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="114EDCAED75A245AFA2DFEE3F20CFBC7">Talamas, Elijah</mods:namePart> <mods:namePart id="6E92E7F55714AF942A7C771A125CB2E9">Talamas, Elijah</mods:namePart>
<mods:nameIdentifier id="C1172D333C036BBA923A35FDBDAC7F91" type="LSID">FDE12E40-BFCE-444A-AFAD-9A214A129345</mods:nameIdentifier> <mods:nameIdentifier id="F6E1E657CE062381CCBC319AA6D5D24E" type="LSID">FDE12E40-BFCE-444A-AFAD-9A214A129345</mods:nameIdentifier>
<mods:affiliation id="FCD9215C4C96730EEF602186EC96E147">Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA.</mods:affiliation> <mods:affiliation id="8D791A02C6D331C41ACC27827FCAF23D">Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA.</mods:affiliation>
<mods:nameIdentifier id="68FF39843A90B4DB355648E1D9CE2120" type="email">elijah.talamas@fdacs.gov</mods:nameIdentifier> <mods:nameIdentifier id="DB9D5768F4E1A79E55A3AF4DBEB171BA" type="email">elijah.talamas@fdacs.gov</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:typeOfResource id="ED888A84DA74B018A840FFE78A81D576">text</mods:typeOfResource> <mods:typeOfResource id="8AB2701030987CC913AA190554338C0E">text</mods:typeOfResource>
<mods:relatedItem id="AC3EB7134903ACE497140CD2971B96A9" type="host"> <mods:relatedItem id="C482F2CE65C12B07346C793EC323A8FD" type="host">
<mods:titleInfo id="77E6A4877A12629D9CFBA73727D413BA"> <mods:titleInfo id="3DDDDF14549C7C484B579ACF8B1EEDF5">
<mods:title id="46654306294BFF4520A55EA37F27F748">European Journal of Taxonomy</mods:title> <mods:title id="A2D1A43509E3182F6163DC4BE8ADF200">European Journal of Taxonomy</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="A40BF875AB5D39BE0900E2DCB6C241F9"> <mods:part id="36E03FC07F34BDDF5C9F9C7BBA071E9A">
<mods:date id="026F1CACAC51294A76CF3AD985E9A47D">2024</mods:date> <mods:date id="9ED1D05ACA9A034573ED3F5560CAB7AE">2024</mods:date>
<mods:detail id="D9987CB1FE11964DF2FCB2EC2254B0AA" type="pubDate"> <mods:detail id="15227CA6A13EA750D482C33D6A42BD50" type="pubDate">
<mods:number id="F65C0A1838635956E9B4ADC18EFE6E69">2024-06-18</mods:number> <mods:number id="BD23203EB66100C705E4548BA11EDA10">2024-06-18</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="FD30B2C011D226D07AA38F19F67BFE74" type="volume"> <mods:detail id="643DCAB8AD2ED7B6A8844B9DECAC58EA" type="volume">
<mods:number id="1CD2DC75074CD6F79EDA2A7400C47A17">938</mods:number> <mods:number id="C40BBF3DE9160397E22487EB0AF1AE2C">938</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="2880275B1E78D2E2653C7B0C6E852C6D" unit="page"> <mods:extent id="431E4D3685A97CBC2AB528EDC43976E3" unit="page">
<mods:start id="D5BEE9054D05D0C98E78EDCEA66996E2">1</mods:start> <mods:start id="45B08D0A243B2B96334E3BD5B002F2A6">1</mods:start>
<mods:end id="A5BF49AA557172DA21EC313C4AF46FDE">58</mods:end> <mods:end id="5A9CC5F90AB3A4DB5070134D044CE3C0">58</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="17010BDEB811AD2FAD03525F61D2EFE8"> <mods:location id="F44C048C44542DBD27BEA4D331B27227">
<mods:url id="17BACEB7AD5110D4BECDE9360FC04EAA">https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639</mods:url> <mods:url id="E88833251273D79660CA75623FEA25B6">https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639</mods:url>
</mods:location> </mods:location>
<mods:classification id="56140952FC7B3ADFDA083A4A6E6C4698">journal article</mods:classification> <mods:classification id="A550D8A3004E3EC7BFB65578F7794C8A">journal article</mods:classification>
<mods:identifier id="F7611612E87DB00587C07E548BF3D33B" type="CLB-Dataset">298671</mods:identifier> <mods:identifier id="E4277B3A5A8B7CBE5FB56AADE6BF2A99" type="CLB-Dataset">298671</mods:identifier>
<mods:identifier id="73BD63135A775E426D41F41935DC2349" type="DOI">10.5852/ejt.2024.938.2565</mods:identifier> <mods:identifier id="A87E87CFA008294DBABBCB6B39B71FC7" type="DOI">10.5852/ejt.2024.938.2565</mods:identifier>
<mods:identifier id="CFD844AFE807D767480AFBF0CBB1E511" type="GBIF-Dataset">b7c20ad6-4993-48e2-b202-3646dcad0714</mods:identifier> <mods:identifier id="81288895BF08DBBFCADA3F802CF78A10" type="GBIF-Dataset">b7c20ad6-4993-48e2-b202-3646dcad0714</mods:identifier>
<mods:identifier id="32C2F60751AB18AF7AF23F8CF79BA8F2" type="ISSN">2118-9773</mods:identifier> <mods:identifier id="57F967B896E57876D9298E909DDA89A6" type="ISSN">2118-9773</mods:identifier>
<mods:identifier id="E20E0AF39B9F5CB767B4D407D59F12D7" type="Zenodo-Dep">12106502</mods:identifier> <mods:identifier id="960B754543D9BBE47D2523A3DAE9F500" type="Zenodo-Dep">12106502</mods:identifier>
<mods:identifier id="029DF5CDF214066A288C574EC46AF8ED" type="ZooBank">A7C46449-1DA9-4D01-A145-04AA66BBAA63</mods:identifier> <mods:identifier id="0641E9A32F76E024E6F7B35B60D1BB39" type="ZooBank">A7C46449-1DA9-4D01-A145-04AA66BBAA63</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="7C416C21FFCDF012FDDDF97FFE72FE2A" ID-DOI="http://doi.org/10.5281/zenodo.12107293" ID-GBIF-Taxon="233237422" ID-Zenodo-Dep="12107293" LSID="urn:lsid:plazi:treatment:7C416C21FFCDF012FDDDF97FFE72FE2A" httpUri="http://treatment.plazi.org/id/7C416C21FFCDF012FDDDF97FFE72FE2A" lastPageId="23" lastPageNumber="24" pageId="22" pageNumber="23"> <treatment id="7C416C21FFCDF012FDDDF97FFE72FE2A" ID-DOI="http://doi.org/10.5281/zenodo.12107293" ID-GBIF-Taxon="233237422" ID-Zenodo-Dep="12107293" LSID="urn:lsid:plazi:treatment:7C416C21FFCDF012FDDDF97FFE72FE2A" httpUri="http://treatment.plazi.org/id/7C416C21FFCDF012FDDDF97FFE72FE2A" lastPageId="23" lastPageNumber="24" pageId="22" pageNumber="23" scope_class="Insecta" scope_family="Scelionidae" scope_order="Hymenoptera" scope_superFamily="Platygastroidea">
<subSubSection id="BCF28EBCFFCDF013FDDDF97FFC38F95C" box="[591,997,1684,1711]" pageId="22" pageNumber="23" type="nomenclature"> <subSubSection id="BCF28EBCFFCDF013FDDDF97FFC38F95C" box="[591,997,1684,1711]" pageId="22" pageNumber="23" type="nomenclature">
<paragraph id="F457DD37FFCDF013FDDDF97FFC38F95C" blockId="22.[591,997,1684,1711]" box="[591,997,1684,1711]" pageId="22" pageNumber="23"> <paragraph id="F457DD37FFCDF013FDDDF97FFC38F95C" blockId="22.[591,997,1684,1711]" box="[591,997,1684,1711]" pageId="22" pageNumber="23">
<heading id="AF1F6A5BFFCDF013FDDDF97FFC38F95C" box="[591,997,1684,1711]" centered="true" fontSize="11" level="2" pageId="22" pageNumber="23" reason="2"> <heading id="AF1F6A5BFFCDF013FDDDF97FFC38F95C" box="[591,997,1684,1711]" centered="true" fontSize="11" level="2" pageId="22" pageNumber="23" reason="2">
<taxonomicName id="33E8A6B4FFCDF013FDDDF97FFC38F95C" authority="Kieffer, 1908" authorityName="Kieffer" authorityYear="1908" box="[591,997,1684,1711]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="laticeps"> <taxonomicName id="33E8A6B4FFCDF013FDDDF97FFC38F95C" authority="Kieffer, 1908" authorityName="Kieffer" authorityYear="1908" box="[591,997,1684,1711]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="laticeps">
<emphasis id="C69C0125FFCDF013FDDDF97FFC9FF95C" bold="true" box="[591,834,1684,1711]" italics="true" pageId="22" pageNumber="23">Hadronotus laticeps</emphasis> <emphasis id="C69C0125FFCDF013FDDDF97FFC9FF95C" bold="true" box="[591,834,1684,1711]" italics="true" pageId="22" pageNumber="23">Hadronotus laticeps</emphasis>
<bibRefCitation id="9079A0C6FFCDF013FCD8F97EFC38F95C" author="Kieffer J. J." box="[842,997,1685,1711]" pageId="22" pageNumber="23" pagination="111 - 250" refId="ref21906" refString="Kieffer J. J. 1908. Revision des Scelionidae (Hymenopteres) Annales de la Societe Scientifique de Bruxelles 32: 111 - 250." type="journal article" year="1908">Kieffer, 1908</bibRefCitation> <bibRefCitation id="9079A0C6FFCDF013FCD8F97EFC38F95C" author="Kieffer J. J." box="[842,997,1685,1711]" pageId="22" pageNumber="23" pagination="111 - 250" refId="ref21906" refString="Kieffer J. J. 1908. Revision des Scelionidae (Hymenopteres) Annales de la Societe Scientifique de Bruxelles 32: 111 - 250." type="journal article" year="1908">Kieffer, 1908</bibRefCitation>
</taxonomicName> </taxonomicName>
@ -75,7 +75,7 @@
<paragraph id="F457DD37FFCDF013FF2FF93DFB89F903" blockId="22.[189,1108,1750,1777]" box="[189,1108,1750,1777]" pageId="22" pageNumber="23"> <paragraph id="F457DD37FFCDF013FF2FF93DFB89F903" blockId="22.[189,1108,1750,1777]" box="[189,1108,1750,1777]" pageId="22" pageNumber="23">
<treatmentCitationGroup id="D4F8FA19FFCDF013FF2FF93DFB89F903" box="[189,1108,1750,1777]" pageId="22" pageNumber="23"> <treatmentCitationGroup id="D4F8FA19FFCDF013FF2FF93DFB89F903" box="[189,1108,1750,1777]" pageId="22" pageNumber="23">
<treatmentCitation id="7549FB26FFCDF013FF2FF93DFD1AF902" author="Kieffer J. J." box="[189,711,1750,1777]" page="145" pageId="22" pageNumber="23" year="1908"> <treatmentCitation id="7549FB26FFCDF013FF2FF93DFD1AF902" author="Kieffer J. J." box="[189,711,1750,1777]" page="145" pageId="22" pageNumber="23" year="1908">
<taxonomicName id="33E8A6B4FFCDF013FF2FF93DFD1AF902" authority="Kieffer, 1908: 144 - 145" authorityName="Kieffer" authorityPageNumber="144 - 145" authorityYear="1908" box="[189,711,1750,1777]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="laticeps"> <taxonomicName id="33E8A6B4FFCDF013FF2FF93DFD1AF902" authority="Kieffer, 1908: 144 - 145" authorityName="Kieffer" authorityPageNumber="144 - 145" authorityYear="1908" box="[189,711,1750,1777]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="laticeps">
<emphasis id="C69C0125FFCDF013FF2FF93DFE77F903" box="[189,426,1750,1776]" italics="true" pageId="22" pageNumber="23">Hadronotus laticeps</emphasis> <emphasis id="C69C0125FFCDF013FF2FF93DFE77F903" box="[189,426,1750,1776]" italics="true" pageId="22" pageNumber="23">Hadronotus laticeps</emphasis>
<bibRefCitation id="9079A0C6FFCDF013FE20F93DFD1AF902" author="Kieffer J. J." box="[434,711,1750,1777]" pageId="22" pageNumber="23" pagination="111 - 250" refId="ref21906" refString="Kieffer J. J. 1908. Revision des Scelionidae (Hymenopteres) Annales de la Societe Scientifique de Bruxelles 32: 111 - 250." type="journal article" year="1908">Kieffer, 1908: 144145</bibRefCitation> <bibRefCitation id="9079A0C6FFCDF013FE20F93DFD1AF902" author="Kieffer J. J." box="[434,711,1750,1777]" pageId="22" pageNumber="23" pagination="111 - 250" refId="ref21906" refString="Kieffer J. J. 1908. Revision des Scelionidae (Hymenopteres) Annales de la Societe Scientifique de Bruxelles 32: 111 - 250." type="journal article" year="1908">Kieffer, 1908: 144145</bibRefCitation>
</taxonomicName> </taxonomicName>
@ -101,7 +101,7 @@ locality:
</paragraph> </paragraph>
<paragraph id="F457DD37FFCDF013FF2FF8D0FD2DF8A6" blockId="22.[189,752,1816,1877]" box="[189,752,1851,1877]" pageId="22" pageNumber="23"> <paragraph id="F457DD37FFCDF013FF2FF8D0FD2DF8A6" blockId="22.[189,752,1816,1877]" box="[189,752,1851,1877]" pageId="22" pageNumber="23">
<treatmentCitationGroup id="D4F8FA19FFCDF013FF2FF8D0FD2DF8A6" box="[189,752,1851,1877]" pageId="22" pageNumber="23"> <treatmentCitationGroup id="D4F8FA19FFCDF013FF2FF8D0FD2DF8A6" box="[189,752,1851,1877]" pageId="22" pageNumber="23">
<taxonomicName id="33E8A6B4FFCDF013FF2FF8D0FE77F8A6" authorityName="Kieffer" authorityYear="1908" box="[189,426,1851,1877]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="laticeps"> <taxonomicName id="33E8A6B4FFCDF013FF2FF8D0FE77F8A6" authorityName="Kieffer" authorityYear="1908" box="[189,426,1851,1877]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="laticeps">
<emphasis id="C69C0125FFCDF013FF2FF8D0FE77F8A6" box="[189,426,1851,1877]" italics="true" pageId="22" pageNumber="23">Hadronotus laticeps</emphasis> <emphasis id="C69C0125FFCDF013FF2FF8D0FE77F8A6" box="[189,426,1851,1877]" italics="true" pageId="22" pageNumber="23">Hadronotus laticeps</emphasis>
</taxonomicName> </taxonomicName>

View file

@ -1,70 +1,70 @@
<document id="24F2D863CD8D4EC09085DC4AFD43A9D2" ID-CLB-Dataset="298671" ID-DOI="10.5852/ejt.2024.938.2565" ID-GBIF-Dataset="b7c20ad6-4993-48e2-b202-3646dcad0714" ID-ISSN="2118-9773" ID-Zenodo-Dep="12106502" ID-ZooBank="A7C46449-1DA9-4D01-A145-04AA66BBAA63" IM.bibliography_approvedBy="valdenar" IM.illustrations_approvedBy="valdenar" IM.materialsCitations_approvedBy="valdenar" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="valdenar" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="valdenar" checkinTime="1718730770205" checkinUser="plazi" docAuthor="Awad, Jessica, Zimmermann, Dominique &amp; Talamas, Elijah" docDate="2024" docId="7C416C21FFCDF013FDABFB38FB97F9BC" docLanguage="en" docName="EJT.2024.938.1-58.pdf" docOrigin="European Journal of Taxonomy 938" docSource="https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639" docStyle="DocumentStyle:EF2B578F1D15862ADE45B0C07C620911.14:EJT.2018-.journal_article.type1" docStyleId="EF2B578F1D15862ADE45B0C07C620911" docStyleName="EJT.2018-.journal_article.type1" docStyleVersion="14" docTitle="Hadronotus exsculptus Forstelr 1861" docType="treatment" docVersion="7" lastPageNumber="23" masterDocId="80781459FFDBF005FF92FFEBFFDDFFF3" masterDocTitle="A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna" masterLastPageNumber="58" masterPageNumber="1" pageNumber="23" updateTime="1719332526003" updateUser="valdenar" zenodo-license-document="CC-BY-4.0" zenodo-license-figures="CC-BY-4.0" zenodo-license-treatments="UNSPECIFIED"> <document id="3EE24EB9293F535F959AFD65C747837F" ID-CLB-Dataset="298671" ID-DOI="10.5852/ejt.2024.938.2565" ID-GBIF-Dataset="b7c20ad6-4993-48e2-b202-3646dcad0714" ID-ISSN="2118-9773" ID-Zenodo-Dep="12106502" ID-ZooBank="A7C46449-1DA9-4D01-A145-04AA66BBAA63" IM.bibliography_approvedBy="valdenar" IM.illustrations_approvedBy="valdenar" IM.materialsCitations_approvedBy="valdenar" IM.metadata_approvedBy="felipe" IM.tables_approvedBy="jonas" IM.taxonomicNames_approvedBy="jonas" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="valdenar" checkinTime="1718730770205" checkinUser="plazi" docAuthor="Awad, Jessica, Zimmermann, Dominique &amp; Talamas, Elijah" docDate="2024" docId="7C416C21FFCDF013FDABFB38FB97F9BC" docLanguage="en" docName="EJT.2024.938.1-58.pdf" docOrigin="European Journal of Taxonomy 938" docSource="https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639" docStyle="DocumentStyle:EF2B578F1D15862ADE45B0C07C620911.14:EJT.2018-.journal_article.type1" docStyleId="EF2B578F1D15862ADE45B0C07C620911" docStyleName="EJT.2018-.journal_article.type1" docStyleVersion="14" docTitle="Hadronotus exsculptus Forstelr 1861" docType="treatment" docVersion="9" lastPageNumber="23" masterDocId="80781459FFDBF005FF92FFEBFFDDFFF3" masterDocTitle="A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna" masterLastPageNumber="58" masterPageNumber="1" pageNumber="23" updateTime="1738779448810" updateUser="jonas" zenodo-license-document="CC-BY-4.0" zenodo-license-figures="CC-BY-4.0" zenodo-license-treatments="UNSPECIFIED">
<mods:mods id="79C7461BB4D4CE7C799C14887FD06F5C" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="B6613EDEF3F2EB64F156F041C2EB7915" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="482CF400376B9DD757174E005BE615F1"> <mods:titleInfo id="E71C8DFB44EAB483E91362EE626371EB">
<mods:title id="E45F6C834EF0D5FDB40D14BC3C1303C1">A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna</mods:title> <mods:title id="AE655AB9A82CFCD0B956B831E36AD8F7">A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="EE5A1BC953A6C7D48F721FEF5CBB8CA0" type="personal"> <mods:name id="6F9DC78EF89C9C20F16030BA70517F40" type="personal">
<mods:role id="DDD330F67C644D6BB4057BFEE45C8345"> <mods:role id="47B353E3B91B05B4AD087EB321F3EBBD">
<mods:roleTerm id="8E5669EF5EAF9B523E15A681F98FE910">Author</mods:roleTerm> <mods:roleTerm id="C29256617094A85E3C9777A4A5096995">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="A4CF48306CA57899B4B392AAD1E0966A">Awad, Jessica</mods:namePart> <mods:namePart id="608E9C49BC2E08DB018604ADEFB8096F">Awad, Jessica</mods:namePart>
<mods:nameIdentifier id="32A044147D44FCAEEBABF5F4CC1856B3" type="LSID">0F70AC80-70B4-4AED-BF6E-A191DF4F68BB</mods:nameIdentifier> <mods:nameIdentifier id="154A0C01381C064E9616AF5A7577D2FF" type="LSID">0F70AC80-70B4-4AED-BF6E-A191DF4F68BB</mods:nameIdentifier>
<mods:affiliation id="8EBE3315B9CFC3D37BD3903D9ADD9808">State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany.</mods:affiliation> <mods:affiliation id="ECB90B3034CE050C4D17EF9230A13412">State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany.</mods:affiliation>
<mods:nameIdentifier id="398B5CC2215043ECFF879DC17EC5DC4C" type="email">jessica.awad@smns-bw.de</mods:nameIdentifier> <mods:nameIdentifier id="2E2A530E6B6E5034B65FAD5EAA5252BA" type="email">jessica.awad@smns-bw.de</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="C455A985317F8CD1695B449A914C8E31" type="personal"> <mods:name id="A880CFC689F4DEB71BC43F94E26B4857" type="personal">
<mods:role id="21B1ED772A814872BB5D9AAF2C3BBA46"> <mods:role id="4E1122197C39CCD3D9A08E9F9ACA73A5">
<mods:roleTerm id="782790D5D15940741D77D43E8B757130">Author</mods:roleTerm> <mods:roleTerm id="E9BC5C8ECCD447220D20E8EB12230013">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="8CDDBEDA8AF7080FD1BE4667E13D459D">Zimmermann, Dominique</mods:namePart> <mods:namePart id="823B9FE855B158BC51FA84BAAC0678F6">Zimmermann, Dominique</mods:namePart>
<mods:nameIdentifier id="2033D307282EAA5BCDC72C6A37646D9B" type="LSID">57F2F5FE-84D9-43DE-AC26-4720B313B0BD</mods:nameIdentifier> <mods:nameIdentifier id="F3C74CB3BD9B0A193040A1525CEFBF78" type="LSID">57F2F5FE-84D9-43DE-AC26-4720B313B0BD</mods:nameIdentifier>
<mods:affiliation id="2285F42DC11E6658D0518976A1F38C57">History Museum Vienna, Burgring 7, 1010 Vienna, Austria.</mods:affiliation> <mods:affiliation id="63869A15ED3B82A16A6EB7E6F27D023A">History Museum Vienna, Burgring 7, 1010 Vienna, Austria.</mods:affiliation>
<mods:nameIdentifier id="7B7FABB48CC1934EA2D9143F7A430E79" type="email">dominique.zimmermann@nhm-wien.ac.at</mods:nameIdentifier> <mods:nameIdentifier id="7364843EBB3F6B2692EA3299792B6618" type="email">dominique.zimmermann@nhm-wien.ac.at</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="3AC1CEF1B7ABC162D6DED4C193965098" type="personal"> <mods:name id="88402F1C8CA5A3AE2F8CAE79121CE790" type="personal">
<mods:role id="6CB23FA2DB3A0B79B6F8FFD29C9D7C7E"> <mods:role id="07A10C368B667B4938F7E36384E09CA0">
<mods:roleTerm id="7ACBDFB7DCBA58C1540BA7782B862740">Author</mods:roleTerm> <mods:roleTerm id="2D554CC962F8FCE1F2C9EB18BA43E734">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="F2B5941CAA39FD7D8F290A2D447D3F53">Talamas, Elijah</mods:namePart> <mods:namePart id="FCA36B9A27629035F0EAC70616865867">Talamas, Elijah</mods:namePart>
<mods:nameIdentifier id="CBFF592D8115C3E8C0F0A66E84B9C729" type="LSID">FDE12E40-BFCE-444A-AFAD-9A214A129345</mods:nameIdentifier> <mods:nameIdentifier id="DC00E40428DC226F9D93B2875A96FD43" type="LSID">FDE12E40-BFCE-444A-AFAD-9A214A129345</mods:nameIdentifier>
<mods:affiliation id="C8553AF12885E7552782BB4E7E792DFF">Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA.</mods:affiliation> <mods:affiliation id="9D6E7E45FB3A4613BABB05904D228DB2">Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA.</mods:affiliation>
<mods:nameIdentifier id="56637A5DD098F4D6945E89EF3C98D5ED" type="email">elijah.talamas@fdacs.gov</mods:nameIdentifier> <mods:nameIdentifier id="10E9F309E58E3E2429162A23EDA37ECC" type="email">elijah.talamas@fdacs.gov</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:typeOfResource id="73EB482E1470D610EBB27F0E56987B57">text</mods:typeOfResource> <mods:typeOfResource id="C19E0AB743CFB4C8B5D36CEE5CB649C6">text</mods:typeOfResource>
<mods:relatedItem id="67AB451FF4C18416E6F66708783CBF4B" type="host"> <mods:relatedItem id="29B8C702216CF1CBCFB23FF8F65B511A" type="host">
<mods:titleInfo id="D00A668A7DCC015B34DDF207C2260B89"> <mods:titleInfo id="7C1497BF7912C1BDCB3FDC3953FEADB8">
<mods:title id="6FCDF5BD325E431D80FD1941F30C6418">European Journal of Taxonomy</mods:title> <mods:title id="1E1C16031318E29ACD290D820D5AD64F">European Journal of Taxonomy</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="562A1F884393A3E525AD6969DB667FBF"> <mods:part id="0F984309F14DB72C89195A23188E8307">
<mods:date id="7C0EF0D3136151EE4AF9D1CD37C5ADC6">2024</mods:date> <mods:date id="C946D26A942736A1C27DA60E9B0F6839">2024</mods:date>
<mods:detail id="B45FAC487E29ED92FDB65ABFB025A4C8" type="pubDate"> <mods:detail id="8E6E99942A8089F5E41FE78FD63862F5" type="pubDate">
<mods:number id="D99A1C56EDD8351B5A0D112F64E35382">2024-06-18</mods:number> <mods:number id="C8DAD8A5EA6D8D3E128881BF9BAC7A70">2024-06-18</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="7710E413474A2C843D1088B2243A31E6" type="volume"> <mods:detail id="C9DEB30466D576EED4835F495ECCA9A4" type="volume">
<mods:number id="C89DD8DB590AA9181120904D1D6B5DE3">938</mods:number> <mods:number id="3651D85CB2D73B95CC40F63A89F0BCB6">938</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="CFB01D95909589F7314319B8A8E404A3" unit="page"> <mods:extent id="76B210E38924E0C302ECF3DE372CADFA" unit="page">
<mods:start id="68E1100C61B92FE40FBBDE008721362E">1</mods:start> <mods:start id="BFD019FE7ADAD60BF7B86DF2CDC5D69B">1</mods:start>
<mods:end id="C18317CCF9C0F7F5C465FDB7CA0B46BE">58</mods:end> <mods:end id="ABAB02BC5E8B974FFAAE1CA04EB1F747">58</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="48ED0D548E7F95FFE7BDB61077184E2C"> <mods:location id="E57501AFD5774FC65ACB4F1B4BAF9567">
<mods:url id="3D5B3FB1D76C2CD7A79347A1D2692B34">https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639</mods:url> <mods:url id="1EDE901FC223F17E963402C89DE769B2">https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639</mods:url>
</mods:location> </mods:location>
<mods:classification id="40AE15BA055EEBBED2C656A82DAFAD98">journal article</mods:classification> <mods:classification id="601370A1F8D739300A86C342F211A544">journal article</mods:classification>
<mods:identifier id="F566E78BDBA1C99F3197600207942F4B" type="CLB-Dataset">298671</mods:identifier> <mods:identifier id="C718298947B762B69A9CBFBF299BA264" type="CLB-Dataset">298671</mods:identifier>
<mods:identifier id="809FF3F66369AFE8E065593F42EBF220" type="DOI">10.5852/ejt.2024.938.2565</mods:identifier> <mods:identifier id="F66B65CA316FE67E5E3BD08561482EB3" type="DOI">10.5852/ejt.2024.938.2565</mods:identifier>
<mods:identifier id="F1F3450010EC08268AE3357E3EED0CC6" type="GBIF-Dataset">b7c20ad6-4993-48e2-b202-3646dcad0714</mods:identifier> <mods:identifier id="C620A12E5AA574BCB78DFD8A2740FC7B" type="GBIF-Dataset">b7c20ad6-4993-48e2-b202-3646dcad0714</mods:identifier>
<mods:identifier id="FE76EDB6179328B45618D3F2A43A8EF5" type="ISSN">2118-9773</mods:identifier> <mods:identifier id="45CD7F04B7C6873E1952756F0B95F13C" type="ISSN">2118-9773</mods:identifier>
<mods:identifier id="30474AD2191E8E1EFFC6D04ACC74CA1C" type="Zenodo-Dep">12106502</mods:identifier> <mods:identifier id="C1022CAAFDC04F24603ACA5A3FA3F7C4" type="Zenodo-Dep">12106502</mods:identifier>
<mods:identifier id="A857D71851A2280E39FCC854C49958F5" type="ZooBank">A7C46449-1DA9-4D01-A145-04AA66BBAA63</mods:identifier> <mods:identifier id="43363B8DB5C977E3E0C6B87E69E0B469" type="ZooBank">A7C46449-1DA9-4D01-A145-04AA66BBAA63</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="7C416C21FFCDF013FDABFB38FB97F9BC" ID-DOI="http://doi.org/10.5281/zenodo.12107289" ID-GBIF-Taxon="233237423" ID-Zenodo-Dep="12107289" LSID="urn:lsid:plazi:treatment:7C416C21FFCDF013FDABFB38FB97F9BC" httpUri="http://treatment.plazi.org/id/7C416C21FFCDF013FDABFB38FB97F9BC" lastPageNumber="23" pageId="22" pageNumber="23"> <treatment id="7C416C21FFCDF013FDABFB38FB97F9BC" ID-DOI="http://doi.org/10.5281/zenodo.12107289" ID-GBIF-Taxon="233237423" ID-Zenodo-Dep="12107289" LSID="urn:lsid:plazi:treatment:7C416C21FFCDF013FDABFB38FB97F9BC" httpUri="http://treatment.plazi.org/id/7C416C21FFCDF013FDABFB38FB97F9BC" lastPageNumber="23" pageId="22" pageNumber="23" scope_class="Insecta" scope_family="Scelionidae" scope_order="Hymenoptera" scope_superFamily="Platygastroidea">
<subSubSection id="BCF28EBCFFCDF013FDABFB38FC26FB1D" box="[569,1019,1235,1262]" pageId="22" pageNumber="23" type="nomenclature"> <subSubSection id="BCF28EBCFFCDF013FDABFB38FC26FB1D" box="[569,1019,1235,1262]" pageId="22" pageNumber="23" type="nomenclature">
<paragraph id="F457DD37FFCDF013FDABFB38FC26FB1D" blockId="22.[569,1019,1235,1262]" box="[569,1019,1235,1262]" pageId="22" pageNumber="23"> <paragraph id="F457DD37FFCDF013FDABFB38FC26FB1D" blockId="22.[569,1019,1235,1262]" box="[569,1019,1235,1262]" pageId="22" pageNumber="23">
<heading id="AF1F6A5BFFCDF013FDABFB38FC26FB1D" box="[569,1019,1235,1262]" centered="true" fontSize="11" level="2" pageId="22" pageNumber="23" reason="2"> <heading id="AF1F6A5BFFCDF013FDABFB38FC26FB1D" box="[569,1019,1235,1262]" centered="true" fontSize="11" level="2" pageId="22" pageNumber="23" reason="2">
<taxonomicName id="33E8A6B4FFCDF013FDABFB38FC26FB1D" authority="Forstelr, 1861" authorityName="Forstelr" authorityYear="1861" box="[569,1019,1235,1262]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="exsculptus"> <taxonomicName id="33E8A6B4FFCDF013FDABFB38FC26FB1D" authority="Forstelr, 1861" authorityName="Forstelr" authorityYear="1861" box="[569,1019,1235,1262]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="exsculptus">
<emphasis id="C69C0125FFCDF013FDABFB38FC8DFB1D" bold="true" box="[569,848,1235,1262]" italics="true" pageId="22" pageNumber="23">Hadronotus exsculptus</emphasis> <emphasis id="C69C0125FFCDF013FDABFB38FC8DFB1D" bold="true" box="[569,848,1235,1262]" italics="true" pageId="22" pageNumber="23">Hadronotus exsculptus</emphasis>
Förstelr, 1861 Förstelr, 1861
</taxonomicName> </taxonomicName>
@ -75,7 +75,7 @@ Förstelr, 1861
<paragraph id="F457DD37FFCDF013FF2FFAFEFBB7FAC3" blockId="22.[189,1130,1301,1328]" box="[189,1130,1301,1328]" pageId="22" pageNumber="23"> <paragraph id="F457DD37FFCDF013FF2FFAFEFBB7FAC3" blockId="22.[189,1130,1301,1328]" box="[189,1130,1301,1328]" pageId="22" pageNumber="23">
<treatmentCitationGroup id="D4F8FA19FFCDF013FF2FFAFEFBB7FAC3" box="[189,1130,1301,1328]" pageId="22" pageNumber="23"> <treatmentCitationGroup id="D4F8FA19FFCDF013FF2FFAFEFBB7FAC3" box="[189,1130,1301,1328]" pageId="22" pageNumber="23">
<treatmentCitation id="7549FB26FFCDF013FF2FFAFEFD40FADC" author="Forster A." box="[189,669,1301,1328]" page="41" pageId="22" pageNumber="23" year="1861"> <treatmentCitation id="7549FB26FFCDF013FF2FFAFEFD40FADC" author="Forster A." box="[189,669,1301,1328]" page="41" pageId="22" pageNumber="23" year="1861">
<taxonomicName id="33E8A6B4FFCDF013FF2FFAFEFD40FADC" authority="Forster, 1861: 41" authorityName="Forstelr" authorityPageNumber="41" authorityYear="1861" box="[189,669,1301,1328]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="exsculptus"> <taxonomicName id="33E8A6B4FFCDF013FF2FFAFEFD40FADC" authority="Forster, 1861: 41" authorityName="Forstelr" authorityPageNumber="41" authorityYear="1861" box="[189,669,1301,1328]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="exsculptus">
<emphasis id="C69C0125FFCDF013FF2FFAFEFE14FADC" box="[189,457,1301,1327]" italics="true" pageId="22" pageNumber="23">Hadronotus exsculptus</emphasis> <emphasis id="C69C0125FFCDF013FF2FFAFEFE14FADC" box="[189,457,1301,1327]" italics="true" pageId="22" pageNumber="23">Hadronotus exsculptus</emphasis>
<bibRefCitation id="9079A0C6FFCDF013FE43FAFDFD40FADC" author="Forster A." box="[465,669,1301,1328]" pageId="22" pageNumber="23" refId="ref20866" refString="Forster A. 1861. Ein Tag in den hoch Alpen. Programm der Realschule zu Aachen fur das Schuljahr 1860 / 61. J. J. Beaufort, Aachen." type="book" year="1861">Förster, 1861: 41</bibRefCitation> <bibRefCitation id="9079A0C6FFCDF013FE43FAFDFD40FADC" author="Forster A." box="[465,669,1301,1328]" pageId="22" pageNumber="23" refId="ref20866" refString="Forster A. 1861. Ein Tag in den hoch Alpen. Programm der Realschule zu Aachen fur das Schuljahr 1860 / 61. J. J. Beaufort, Aachen." type="book" year="1861">Förster, 1861: 41</bibRefCitation>
</taxonomicName> </taxonomicName>

View file

@ -1,71 +1,71 @@
<document id="06155E27439687F2B86A0AAE7C3E624E" ID-CLB-Dataset="298671" ID-DOI="10.5852/ejt.2024.938.2565" ID-GBIF-Dataset="b7c20ad6-4993-48e2-b202-3646dcad0714" ID-ISSN="2118-9773" ID-Zenodo-Dep="12106502" ID-ZooBank="A7C46449-1DA9-4D01-A145-04AA66BBAA63" IM.bibliography_approvedBy="valdenar" IM.illustrations_approvedBy="valdenar" IM.materialsCitations_approvedBy="valdenar" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="GgImagineBatch" IM.taxonomicNames_approvedBy="valdenar" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="valdenar" checkinTime="1718730770205" checkinUser="plazi" docAuthor="Awad, Jessica, Zimmermann, Dominique &amp; Talamas, Elijah" docDate="2024" docId="7C416C21FFCEF013FDC5F8BEFD00FB7D" docLanguage="en" docName="EJT.2024.938.1-58.pdf" docOrigin="European Journal of Taxonomy 938" docSource="https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639" docStyle="DocumentStyle:EF2B578F1D15862ADE45B0C07C620911.14:EJT.2018-.journal_article.type1" docStyleId="EF2B578F1D15862ADE45B0C07C620911" docStyleName="EJT.2018-.journal_article.type1" docStyleVersion="14" docTitle="Hadronotus Forster 1856" docType="treatment" docVersion="7" lastPageNumber="23" masterDocId="80781459FFDBF005FF92FFEBFFDDFFF3" masterDocTitle="A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna" masterLastPageNumber="58" masterPageNumber="1" pageNumber="22" updateTime="1732564944665" updateUser="ExternalLinkService" zenodo-license-document="CC-BY-4.0" zenodo-license-figures="CC-BY-4.0" zenodo-license-treatments="UNSPECIFIED"> <document id="02B0B23BBD817B856C1213FCF6FB05D4" ID-CLB-Dataset="298671" ID-DOI="10.5852/ejt.2024.938.2565" ID-GBIF-Dataset="b7c20ad6-4993-48e2-b202-3646dcad0714" ID-ISSN="2118-9773" ID-Zenodo-Dep="12106502" ID-ZooBank="A7C46449-1DA9-4D01-A145-04AA66BBAA63" IM.bibliography_approvedBy="valdenar" IM.illustrations_approvedBy="valdenar" IM.materialsCitations_approvedBy="valdenar" IM.metadata_approvedBy="felipe" IM.tables_approvedBy="jonas" IM.taxonomicNames_approvedBy="jonas" IM.treatmentCitations_approvedBy="felipe" IM.treatments_approvedBy="valdenar" checkinTime="1718730770205" checkinUser="plazi" docAuthor="Awad, Jessica, Zimmermann, Dominique &amp; Talamas, Elijah" docDate="2024" docId="7C416C21FFCEF013FDC5F8BEFD00FB7D" docLanguage="en" docName="EJT.2024.938.1-58.pdf" docOrigin="European Journal of Taxonomy 938" docSource="https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639" docStyle="DocumentStyle:EF2B578F1D15862ADE45B0C07C620911.14:EJT.2018-.journal_article.type1" docStyleId="EF2B578F1D15862ADE45B0C07C620911" docStyleName="EJT.2018-.journal_article.type1" docStyleVersion="14" docTitle="Hadronotus Forster 1856" docType="treatment" docVersion="9" lastPageNumber="23" masterDocId="80781459FFDBF005FF92FFEBFFDDFFF3" masterDocTitle="A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna" masterLastPageNumber="58" masterPageNumber="1" pageNumber="22" updateTime="1738779448810" updateUser="jonas" zenodo-license-document="CC-BY-4.0" zenodo-license-figures="CC-BY-4.0" zenodo-license-treatments="UNSPECIFIED">
<mods:mods id="3D5F124711B56CDEACC1577CCC2DE1AC" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="FEFA8056D4C4A3BB91731BD7228B969C" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="4878EE56FDA0BAD03987825F2003040A"> <mods:titleInfo id="85FD24B6C74A4DEC66FABD5E6501DBC2">
<mods:title id="C7D86C405953A20CED861ABFCAA2F7DF">A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna</mods:title> <mods:title id="165A20F36CD4E58576D36643BD22BE92">A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="89AD9728A06C19854937071230AC615D" type="personal"> <mods:name id="F9802F442EEB46095A496EE7E309437F" type="personal">
<mods:role id="28A2F275DF5DDBEB3F7F36CFB5ACBE57"> <mods:role id="196BA7F7F10571E3E59667FB2AEACDD5">
<mods:roleTerm id="6A1C0E9E60ED4FF1777442991EE87C19">Author</mods:roleTerm> <mods:roleTerm id="17E8EF54FC4D94C91A4BF8C7A701260F">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="1D5F3F214B85E0EDFB7D5FAB4A582D72">Awad, Jessica</mods:namePart> <mods:namePart id="3DD5ECD3855E7C73C2D748A4B269C58E">Awad, Jessica</mods:namePart>
<mods:nameIdentifier id="0A86BAB8438B20E5A1D73643212971B6" type="LSID">0F70AC80-70B4-4AED-BF6E-A191DF4F68BB</mods:nameIdentifier> <mods:nameIdentifier id="003257028F4346456CA12522F783C2A4" type="LSID">0F70AC80-70B4-4AED-BF6E-A191DF4F68BB</mods:nameIdentifier>
<mods:affiliation id="AC97C612CE52565F2AE2B5E5776ABAAA">State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany.</mods:affiliation> <mods:affiliation id="FC7CDFD34E149D8B41EB60B95EB20BFC">State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany.</mods:affiliation>
<mods:nameIdentifier id="E602888D5F5F499489B3B5B25CC52496" type="email">jessica.awad@smns-bw.de</mods:nameIdentifier> <mods:nameIdentifier id="C79548CAF2A5147FEDBC1C0392AF3524" type="email">jessica.awad@smns-bw.de</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="9B5ED1DAB0013DE20BCD0A233C6F00F4" type="personal"> <mods:name id="64FDBDFDE13040B5188BF3E9671E9D7B" type="personal">
<mods:role id="2441666E3F87058F1D09BCF50C9E8985"> <mods:role id="15CC6A2C49EDD0680378711E232E3630">
<mods:roleTerm id="CE72602BA08D073D35073F0DB83C6EA7">Author</mods:roleTerm> <mods:roleTerm id="F2A7E6DFD46CC7229F670A97FE685F86">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="43DACFBC8623DDA713B3BF97DFAB9950">Zimmermann, Dominique</mods:namePart> <mods:namePart id="A47600F91CBDF31108EDBBAF64F36DB6">Zimmermann, Dominique</mods:namePart>
<mods:nameIdentifier id="7FEE126959DCF37FD2B54EBC07C385FD" type="LSID">57F2F5FE-84D9-43DE-AC26-4720B313B0BD</mods:nameIdentifier> <mods:nameIdentifier id="F6912A7251EB8B36848E150C4E7136C6" type="LSID">57F2F5FE-84D9-43DE-AC26-4720B313B0BD</mods:nameIdentifier>
<mods:affiliation id="258F3F7A81F11E9279DC159F50691370">History Museum Vienna, Burgring 7, 1010 Vienna, Austria.</mods:affiliation> <mods:affiliation id="2F8794B7A8FC10A824671657E0789126">History Museum Vienna, Burgring 7, 1010 Vienna, Austria.</mods:affiliation>
<mods:nameIdentifier id="7270A76F6510C674B4D2B88DD65D7D26" type="email">dominique.zimmermann@nhm-wien.ac.at</mods:nameIdentifier> <mods:nameIdentifier id="F2E50134439C334585D35495B308EDE6" type="email">dominique.zimmermann@nhm-wien.ac.at</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:name id="C1A19E89A78D946F00B7EB83F62F7EC4" type="personal"> <mods:name id="8DC2B495576B9C2A7D9EC1F719A4660F" type="personal">
<mods:role id="8ACCB38B13F7037028655C78C0684AF3"> <mods:role id="235A2BB9482F9CC4107B820DCCD632F8">
<mods:roleTerm id="1025029D1F5C681E2E7C5A1711611567">Author</mods:roleTerm> <mods:roleTerm id="EA0F6B65B456254F44D9D3B73143F1A5">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="79458BAFFFAB3271D48208CEE9536D0D">Talamas, Elijah</mods:namePart> <mods:namePart id="8C800626289112063259403C42A84181">Talamas, Elijah</mods:namePart>
<mods:nameIdentifier id="ED5652E5D9133B63C6A98B63D3908893" type="LSID">FDE12E40-BFCE-444A-AFAD-9A214A129345</mods:nameIdentifier> <mods:nameIdentifier id="CDA33DF64C79D2713275ED5DDA57470A" type="LSID">FDE12E40-BFCE-444A-AFAD-9A214A129345</mods:nameIdentifier>
<mods:affiliation id="5B4498CC9D44EA8E140F3F71660AF4CA">Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA.</mods:affiliation> <mods:affiliation id="C207F999DF78AA7F3D16265CA20C5B3D">Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA.</mods:affiliation>
<mods:nameIdentifier id="02F4A76AD5E5E0E50387117C2476C99C" type="email">elijah.talamas@fdacs.gov</mods:nameIdentifier> <mods:nameIdentifier id="4BA69FC1CA78516A4B31EE3C853DB8D6" type="email">elijah.talamas@fdacs.gov</mods:nameIdentifier>
</mods:name> </mods:name>
<mods:typeOfResource id="7E968870B9BF9EC08544F7845CCAA78C">text</mods:typeOfResource> <mods:typeOfResource id="08FA4C6BE0057E8610ADB3BEDC3948B3">text</mods:typeOfResource>
<mods:relatedItem id="FFA4781C9A574D0179EFD443E4DA44FE" type="host"> <mods:relatedItem id="933D3F09A1EB087D7E200DD4DDA7C6EE" type="host">
<mods:titleInfo id="AF2B0F8CEE0269FCC7FD6082FB513FBD"> <mods:titleInfo id="BAECD262887B97A04223BD9B1C585A85">
<mods:title id="A553F098F8B39C6CC05C3B23F0543C7E">European Journal of Taxonomy</mods:title> <mods:title id="6D1AC952D4FE9042F15A110DF8666194">European Journal of Taxonomy</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="B86134735BFF57A2A3C2EBDAA47C1B57"> <mods:part id="0F173DB9EE08C65193672800F418A487">
<mods:date id="779CFDA0A5244DAD323677B95F012D60">2024</mods:date> <mods:date id="69720949A1A5BF97125C8B1BCE0E5AC1">2024</mods:date>
<mods:detail id="02CA550C4606E53F0E9F21F1F642E506" type="pubDate"> <mods:detail id="AE7212166EA2C6677172FAE31B9B6B9B" type="pubDate">
<mods:number id="1337E94744750A6C686D167DC8056FB3">2024-06-18</mods:number> <mods:number id="C36F7F012361D290BF175B02DF681EC2">2024-06-18</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="77795E3A5131BAA7CDB6079D891204DD" type="volume"> <mods:detail id="B7BE7A63B5FB5AD86D8F245D41B0FF4C" type="volume">
<mods:number id="77649AD2E6729D8D404B3A4D860A7BA9">938</mods:number> <mods:number id="3F11D3A236A175711CBFD6C020BD0D17">938</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="11D6E97583FAD55AA89E191889A0E59B" unit="page"> <mods:extent id="187E828522834A12E6E47904A96D7836" unit="page">
<mods:start id="CA62CF4B1CECF32A899428023E918211">1</mods:start> <mods:start id="8688C9742AACBCA9F145551D88F20A99">1</mods:start>
<mods:end id="C8F1359951F1A44A687E1F618E055B88">58</mods:end> <mods:end id="5FEB75FFB78963E05924C36A920E1426">58</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:location id="61E6DFCB20673F5AB4E706E32D2D44D5"> <mods:location id="CBFC89520F2A52D39484071FE17825E4">
<mods:url id="B95E2FE7459DD0E81BF165134752B9E4">https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639</mods:url> <mods:url id="70DA6473095FF9C8057BF3C5A637290A">https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639</mods:url>
</mods:location> </mods:location>
<mods:classification id="1895EA77B365A8CE1B61FB1EF3A45C9A">journal article</mods:classification> <mods:classification id="B4D06E79AA3865B7CE2C5218B41466FF">journal article</mods:classification>
<mods:identifier id="B890023C1974B28C58AC0FB1F07E63EF" type="CLB-Dataset">298671</mods:identifier> <mods:identifier id="D353B1CA64171B5435531B6973722351" type="CLB-Dataset">298671</mods:identifier>
<mods:identifier id="3987732BB5591443B887FF27EFF1586A" type="DOI">10.5852/ejt.2024.938.2565</mods:identifier> <mods:identifier id="C8A4B1B81194E495415F4A2A0B4D66DB" type="DOI">10.5852/ejt.2024.938.2565</mods:identifier>
<mods:identifier id="BABEDB7E5107A93273E9A2659BBFE67B" type="GBIF-Dataset">b7c20ad6-4993-48e2-b202-3646dcad0714</mods:identifier> <mods:identifier id="33E7955FB56897E7E6C7B6DB3B976ED3" type="GBIF-Dataset">b7c20ad6-4993-48e2-b202-3646dcad0714</mods:identifier>
<mods:identifier id="8AC5D0E6963EEDC36F712116592B6475" type="ISSN">2118-9773</mods:identifier> <mods:identifier id="8D97937C0479D7D7F1B38F829E21B135" type="ISSN">2118-9773</mods:identifier>
<mods:identifier id="B444E733A347DC88EA97EF33BF3DE719" type="Zenodo-Dep">12106502</mods:identifier> <mods:identifier id="838B64B32C20A651B6EBC9B2420ACC8E" type="Zenodo-Dep">12106502</mods:identifier>
<mods:identifier id="3FD6FCDD1BD10CC3343A08F4A45264EC" type="ZooBank">A7C46449-1DA9-4D01-A145-04AA66BBAA63</mods:identifier> <mods:identifier id="8E48445F2261119AC50CAC0576583844" type="ZooBank">A7C46449-1DA9-4D01-A145-04AA66BBAA63</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="7C416C21FFCEF013FDC5F8BEFD00FB7D" ID-GBIF-Taxon="233237420" LSID="urn:lsid:plazi:treatment:7C416C21FFCEF013FDC5F8BEFD00FB7D" httpUri="http://treatment.plazi.org/id/7C416C21FFCEF013FDC5F8BEFD00FB7D" lastPageId="22" lastPageNumber="23" pageId="21" pageNumber="22" scope_class="Insecta" scope_family="Scelionidae" scope_order="Hymenoptera" scope_superFamily="Platygastroidea"> <treatment id="7C416C21FFCEF013FDC5F8BEFD00FB7D" ID-DOI="http://doi.org/10.5281/zenodo.14224994" ID-GBIF-Taxon="233237420" ID-Zenodo-Dep="14224994" LSID="urn:lsid:plazi:treatment:7C416C21FFCEF013FDC5F8BEFD00FB7D" httpUri="http://treatment.plazi.org/id/7C416C21FFCEF013FDC5F8BEFD00FB7D" lastPageId="22" lastPageNumber="23" pageId="21" pageNumber="22" scope_class="Insecta" scope_family="Scelionidae" scope_order="Hymenoptera" scope_superFamily="Platygastroidea">
<subSubSection id="BCF28EBCFFCEF010FDC5F8BEFC00F883" box="[599,989,1877,1904]" pageId="21" pageNumber="22" type="nomenclature"> <subSubSection id="BCF28EBCFFCEF010FDC5F8BEFC00F883" box="[599,989,1877,1904]" pageId="21" pageNumber="22" type="nomenclature">
<paragraph id="F457DD37FFCEF010FDC5F8BEFC00F883" blockId="21.[599,989,1877,1904]" box="[599,989,1877,1904]" pageId="21" pageNumber="22"> <paragraph id="F457DD37FFCEF010FDC5F8BEFC00F883" blockId="21.[599,989,1877,1904]" box="[599,989,1877,1904]" pageId="21" pageNumber="22">
<heading id="AF1F6A5BFFCEF010FDC5F8BEFC00F883" box="[599,989,1877,1904]" centered="true" fontSize="11" level="2" pageId="21" pageNumber="22" reason="2"> <heading id="AF1F6A5BFFCEF010FDC5F8BEFC00F883" box="[599,989,1877,1904]" centered="true" fontSize="11" level="2" pageId="21" pageNumber="22" reason="2">
Genus Genus
<taxonomicName id="33E8A6B4FFCEF010FD3BF8BEFC00F883" ID-CoL="8HK83" authority="Forster, 1856" authorityName="Forster" authorityYear="1856" box="[681,989,1877,1904]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="21" pageNumber="22" phylum="Arthropoda" rank="genus"> <taxonomicName id="33E8A6B4FFCEF010FD3BF8BEFC00F883" ID-CoL="8HK83" authority="Forster, 1856" authorityName="Forster" authorityYear="1856" box="[681,989,1877,1904]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="21" pageNumber="22" phylum="Arthropoda" rank="genus">
<emphasis id="C69C0125FFCEF010FD3BF8BEFCE7F883" bold="true" box="[681,826,1877,1904]" italics="true" pageId="21" pageNumber="22">Hadronotus</emphasis> <emphasis id="C69C0125FFCEF010FD3BF8BEFCE7F883" bold="true" box="[681,826,1877,1904]" italics="true" pageId="21" pageNumber="22">Hadronotus</emphasis>
<bibRefCitation id="9079A0C6FFCEF010FCD3F8BDFC00F883" author="Forster A." box="[833,989,1877,1904]" pageId="21" pageNumber="22" refId="ref20844" refString="Forster A. 1856. Hymenopterologische Studien. II. Heft. Chalcidiae und Proctotrupii. Ernst ter Meer, Aachen." type="book" year="1856">Förster, 1856</bibRefCitation> <bibRefCitation id="9079A0C6FFCEF010FCD3F8BDFC00F883" author="Forster A." box="[833,989,1877,1904]" pageId="21" pageNumber="22" refId="ref20844" refString="Forster A. 1856. Hymenopterologische Studien. II. Heft. Chalcidiae und Proctotrupii. Ernst ter Meer, Aachen." type="book" year="1856">Förster, 1856</bibRefCitation>
</taxonomicName> </taxonomicName>
@ -76,7 +76,7 @@ Genus
<paragraph id="F457DD37FFCEF010FF2FF87DFE3AF827" blockId="21.[189,1399,1942,2004]" pageId="21" pageNumber="22"> <paragraph id="F457DD37FFCEF010FF2FF87DFE3AF827" blockId="21.[189,1399,1942,2004]" pageId="21" pageNumber="22">
<treatmentCitationGroup id="D4F8FA19FFCEF010FF2FF87DFE3AF827" pageId="21" pageNumber="22"> <treatmentCitationGroup id="D4F8FA19FFCEF010FF2FF87DFE3AF827" pageId="21" pageNumber="22">
<treatmentCitation id="7549FB26FFCEF010FF2FF87DFD9DF842" author="Forster A." box="[189,576,1942,1969]" page="101" pageId="21" pageNumber="22" year="1856"> <treatmentCitation id="7549FB26FFCEF010FF2FF87DFD9DF842" author="Forster A." box="[189,576,1942,1969]" page="101" pageId="21" pageNumber="22" year="1856">
<taxonomicName id="33E8A6B4FFCEF010FF2FF87DFD9DF842" ID-CoL="8HK83" authority="Forster, 1856: 101" authorityName="Forster" authorityPageNumber="101" authorityYear="1856" box="[189,576,1942,1969]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="21" pageNumber="22" phylum="Arthropoda" rank="genus"> <taxonomicName id="33E8A6B4FFCEF010FF2FF87DFD9DF842" ID-CoL="8HK83" authority="Forster, 1856: 101" authorityName="Forster" authorityPageNumber="101" authorityYear="1856" box="[189,576,1942,1969]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="21" pageNumber="22" phylum="Arthropoda" rank="genus">
<emphasis id="C69C0125FFCEF010FF2FF87DFE95F843" box="[189,328,1942,1968]" italics="true" pageId="21" pageNumber="22">Hadronotus</emphasis> <emphasis id="C69C0125FFCEF010FF2FF87DFE95F843" box="[189,328,1942,1968]" italics="true" pageId="21" pageNumber="22">Hadronotus</emphasis>
<bibRefCitation id="9079A0C6FFCEF010FEC5F87CFD9DF842" author="Forster A." box="[343,576,1942,1969]" pageId="21" pageNumber="22" refId="ref20844" refString="Forster A. 1856. Hymenopterologische Studien. II. Heft. Chalcidiae und Proctotrupii. Ernst ter Meer, Aachen." type="book" year="1856">Förster, 1856: 101</bibRefCitation> <bibRefCitation id="9079A0C6FFCEF010FEC5F87CFD9DF842" author="Forster A." box="[343,576,1942,1969]" pageId="21" pageNumber="22" refId="ref20844" refString="Forster A. 1856. Hymenopterologische Studien. II. Heft. Chalcidiae und Proctotrupii. Ernst ter Meer, Aachen." type="book" year="1856">Förster, 1856: 101</bibRefCitation>
</taxonomicName> </taxonomicName>
@ -84,7 +84,7 @@ Genus
, 105. , 105.
<typeStatus id="2B536395FFCEF010FD05F87CFD0CF842" box="[663,721,1943,1969]" pageId="21" pageNumber="22">Type</typeStatus> <typeStatus id="2B536395FFCEF010FD05F87CFD0CF842" box="[663,721,1943,1969]" pageId="21" pageNumber="22">Type</typeStatus>
species species
<taxonomicName id="33E8A6B4FFCEF010FCD7F87DFAD0F843" authority="Forster, 1861" authorityName="Forstelr" authorityYear="1861" box="[837,1293,1942,1969]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="21" pageNumber="22" phylum="Arthropoda" rank="species" species="exsculptus"> <taxonomicName id="33E8A6B4FFCEF010FCD7F87DFAD0F843" authority="Forster, 1861" authorityName="Forstelr" authorityYear="1861" box="[837,1293,1942,1969]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="21" pageNumber="22" phylum="Arthropoda" rank="species" species="exsculptus">
<emphasis id="C69C0125FFCEF010FCD7F87DFB87F843" box="[837,1114,1942,1968]" italics="true" pageId="21" pageNumber="22">Hadronotus exsculptus</emphasis> <emphasis id="C69C0125FFCEF010FCD7F87DFB87F843" box="[837,1114,1942,1968]" italics="true" pageId="21" pageNumber="22">Hadronotus exsculptus</emphasis>
<bibRefCitation id="9079A0C6FFCEF010FBFBF87CFAD0F843" author="Forster A." box="[1129,1293,1942,1969]" pageId="21" pageNumber="22" refId="ref20866" refString="Forster A. 1861. Ein Tag in den hoch Alpen. Programm der Realschule zu Aachen fur das Schuljahr 1860 / 61. J. J. Beaufort, Aachen." type="book" year="1861">Förster, 1861</bibRefCitation> <bibRefCitation id="9079A0C6FFCEF010FBFBF87CFAD0F843" author="Forster A." box="[1129,1293,1942,1969]" pageId="21" pageNumber="22" refId="ref20866" refString="Forster A. 1861. Ein Tag in den hoch Alpen. Programm der Realschule zu Aachen fur das Schuljahr 1860 / 61. J. J. Beaufort, Aachen." type="book" year="1861">Förster, 1861</bibRefCitation>
</taxonomicName> </taxonomicName>
@ -113,7 +113,7 @@ Dodd, 1913: 171
. .
<typeStatus id="2B536395FFCDF013FDDFFEC6FD5AFEB4" box="[589,647,301,327]" pageId="22" pageNumber="23">Type</typeStatus> <typeStatus id="2B536395FFCDF013FDDFFEC6FD5AFEB4" box="[589,647,301,327]" pageId="22" pageNumber="23">Type</typeStatus>
species species
<taxonomicName id="33E8A6B4FFCDF013FD7DFEC7FB43FEB5" authority="Dodd, 1913" authorityName="Dodd" authorityYear="1913" box="[751,1182,300,326]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="pentatomus"> <taxonomicName id="33E8A6B4FFCDF013FD7DFEC7FB43FEB5" authority="Dodd, 1913" authorityName="Dodd" authorityYear="1913" box="[751,1182,300,326]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="species" species="pentatomus">
<emphasis id="C69C0125FFCDF013FD7DFEC7FBD7FEB5" box="[751,1034,300,326]" italics="true" pageId="22" pageNumber="23">Hadronotus pentatomus</emphasis> <emphasis id="C69C0125FFCDF013FD7DFEC7FBD7FEB5" box="[751,1034,300,326]" italics="true" pageId="22" pageNumber="23">Hadronotus pentatomus</emphasis>
Dodd, 1913 Dodd, 1913
</taxonomicName> </taxonomicName>
@ -189,7 +189,7 @@ by monotypy.
</paragraph> </paragraph>
<paragraph id="F457DD37FFCDF013FF2FFD41FDF3FD1B" blockId="22.[189,1399,682,1167]" pageId="22" pageNumber="23"> <paragraph id="F457DD37FFCDF013FF2FFD41FDF3FD1B" blockId="22.[189,1399,682,1167]" pageId="22" pageNumber="23">
<treatmentCitationGroup id="D4F8FA19FFCDF013FF2FFD41FDF3FD1B" pageId="22" pageNumber="23"> <treatmentCitationGroup id="D4F8FA19FFCDF013FF2FFD41FDF3FD1B" pageId="22" pageNumber="23">
<taxonomicName id="33E8A6B4FFCDF013FF2FFD41FE95FD37" ID-CoL="8HK83" authorityName="Forster" authorityYear="1856" box="[189,328,682,708]" class="Insecta" family="Curculionidae" genus="Hadronotus" kingdom="Animalia" order="Coleoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="genus"> <taxonomicName id="33E8A6B4FFCDF013FF2FFD41FE95FD37" ID-CoL="8HK83" authorityName="Forster" authorityYear="1856" box="[189,328,682,708]" class="Insecta" family="Scelionidae" genus="Hadronotus" kingdom="Animalia" order="Hymenoptera" pageId="22" pageNumber="23" phylum="Arthropoda" rank="genus">
<emphasis id="C69C0125FFCDF013FF2FFD41FE95FD37" box="[189,328,682,708]" italics="true" pageId="22" pageNumber="23">Hadronotus</emphasis> <emphasis id="C69C0125FFCDF013FF2FFD41FE95FD37" box="[189,328,682,708]" italics="true" pageId="22" pageNumber="23">Hadronotus</emphasis>
</taxonomicName> </taxonomicName>

View file

@ -1,58 +1,59 @@
<document id="DF91B7069CBB96BE05227604F1489E85" ID="10.11646/zootaxa.4137.1.7" ID-DOI="10.11646/zootaxa.4137.1.7" ID-GBIF-Dataset="f88ca779-0496-4982-95e8-826d29bbc163" ID-ISSN="1175-5326" ID-Zenodo-Dep="255201" ID-ZooBank="EA49068A-884D-4B79-AF5F-82910028EE23" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" checkinTime="1467960133845" checkinUser="plazi" docAuthor="Martin, Sarah K., Skidmore, Luke I. &amp; Stilwell, Jeffrey D." docDate="2016" docId="EA0487FAFFDFFFCBEA912BC92869279E" docLanguage="en" docName="zootaxa.4137.1.7.pdf" docOrigin="Zootaxa 4137 (1)" docStyle="DocumentStyle:647186512141C8FC8976D5BCC54AEB7D.9:Zootaxa.2013-.journal_article" docStyleId="647186512141C8FC8976D5BCC54AEB7D" docStyleName="Zootaxa.2013-.journal_article" docStyleVersion="9" docTitle="Koonwarraphis rotundafrons Martin, Skidmore &amp; Stilwell, 2016, sp. nov." docType="treatment" docVersion="7" lastPageNumber="102" masterDocId="163DFF82FFDCFFCCEA062F252D1B234B" masterDocTitle="A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria" masterLastPageNumber="107" masterPageNumber="95" pageNumber="98" updateTime="1698364052722" updateUser="plazi"> <document id="F84799C5E63D55F93925D6F5496CCC7F" ID="10.11646/zootaxa.4137.1.7" ID-CLB-Dataset="38613" ID-DOI="10.11646/zootaxa.4137.1.7" ID-GBIF-Dataset="f88ca779-0496-4982-95e8-826d29bbc163" ID-ISSN="1175-5326" ID-Zenodo-Dep="255201" ID-ZooBank="EA49068A-884D-4B79-AF5F-82910028EE23" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="guilherme" checkinTime="1467960133845" checkinUser="plazi" docAuthor="Martin, Sarah K., Skidmore, Luke I. &amp; Stilwell, Jeffrey D." docDate="2016" docId="EA0487FAFFDFFFCBEA912BC92869279E" docLanguage="en" docName="zootaxa.4137.1.7.pdf" docOrigin="Zootaxa 4137 (1)" docStyle="DocumentStyle:647186512141C8FC8976D5BCC54AEB7D.9:Zootaxa.2013-.journal_article" docStyleId="647186512141C8FC8976D5BCC54AEB7D" docStyleName="Zootaxa.2013-.journal_article" docStyleVersion="9" docTitle="Koonwarraphis rotundafrons Martin, Skidmore &amp; Stilwell, 2016, sp. nov." docType="treatment" docVersion="11" lastPageNumber="102" masterDocId="163DFF82FFDCFFCCEA062F252D1B234B" masterDocTitle="A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria" masterLastPageNumber="107" masterPageNumber="95" pageNumber="98" updateTime="1738779617075" updateUser="ExternalLinkService">
<mods:mods id="6EAE07604E8C14408FA62E3992B5A3D4" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="C07749BA8CD616524D12880947058D66" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="B7CEE44DABA9CF44E39A4FE0215AD3EF"> <mods:titleInfo id="33F6C8FC5210991F34AD6E1DBEF1EE93">
<mods:title id="A033D539E9691E8BAFA5389A2DACCAC1">A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria</mods:title> <mods:title id="9CD770D8E03BDE2356B464FC7F42F18E">A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="8FC5F0809EC8C7C8C823194CA406173B" type="personal"> <mods:name id="9ACD6A46FE064067773D3947B68D3B0A" type="personal">
<mods:role id="9594CEC67FCA0D7CE6A565E7D1377CC8"> <mods:role id="032F324C2B01A632E3D86EACF4F65CB3">
<mods:roleTerm id="AFFE3E0FA579A4C40C3DCC783262A131">Author</mods:roleTerm> <mods:roleTerm id="ADE2F7FE3F75FF900A6EF4DE0733338B">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="D51B8BBFEEC4CA92F4F38BD7D7211485">Martin, Sarah K.</mods:namePart> <mods:namePart id="385A36969EF7210322E02EDCA3F8D9AE">Martin, Sarah K.</mods:namePart>
</mods:name> </mods:name>
<mods:name id="758330FA85D15E27BBFFFA835010F2F8" type="personal"> <mods:name id="CCEE6DAC6D04ECF14372EA7FCECB131F" type="personal">
<mods:role id="B88FE911BC7E1CB5699ACE7F7F2FBAC9"> <mods:role id="D5A58BB8BA5A5D7C5C5F30978426ECD2">
<mods:roleTerm id="9E9FBDF54226D888A4833F4522BB529E">Author</mods:roleTerm> <mods:roleTerm id="717111993CA66AA345C651DC5D728B97">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="8B1A62DB2BF1CC1F2A9A6B1C9E77A6F5">Skidmore, Luke I.</mods:namePart> <mods:namePart id="0036039506A2C4AD82D190B5595137AD">Skidmore, Luke I.</mods:namePart>
</mods:name> </mods:name>
<mods:name id="7522498B683DF804051C81635A80B784" type="personal"> <mods:name id="189CDEA8B3CEF84D8B995E367508EDE8" type="personal">
<mods:role id="23393AFFFCDBD068A66813AA0A2467B9"> <mods:role id="3B5BE6A1A0A67F82FDB585F9B6130C5B">
<mods:roleTerm id="6348E052DF3F5DB7406097A05054E7AC">Author</mods:roleTerm> <mods:roleTerm id="38500E8622F3E0DBA6B73713A56D780E">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="25CD95294CE159B8ABC2943582B21531">Stilwell, Jeffrey D.</mods:namePart> <mods:namePart id="9CDF9396D89C9A3C278C3A2B7AAEFC95">Stilwell, Jeffrey D.</mods:namePart>
</mods:name> </mods:name>
<mods:typeOfResource id="C026110F4954C0E42A0E2C76BF53C6EA">text</mods:typeOfResource> <mods:typeOfResource id="8103BB2C7AEAC3A80C969F2982815466">text</mods:typeOfResource>
<mods:relatedItem id="5F31F1664EEFC61724DFBAF924A18D6D" type="host"> <mods:relatedItem id="A9CB9FB10CDE8981B6923CBB20EE9B26" type="host">
<mods:titleInfo id="E0B9F1F64DF914B6CEC0F8F5BE1218FE"> <mods:titleInfo id="68517F245C30C545408D3F257D5CCC55">
<mods:title id="DF73AE37CDC1D3EB32EBBC3FA3921C59">Zootaxa</mods:title> <mods:title id="26A97AA2AA01733C85504D555769C90E">Zootaxa</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="BA7B19D86208EBABD274AFE1DCD33790"> <mods:part id="B6B9EB745A87EC8409557A6F9FF02BFA">
<mods:date id="C6947B29AEAAA28C66D88AFCD4E3300A">2016</mods:date> <mods:date id="899A8AB179CC314B7E91BCED5BFEA40F">2016</mods:date>
<mods:detail id="A4989662E275C9A6C2E832198DBD7D0C" type="volume"> <mods:detail id="C1876250A782D4C225DDE0DB173526DC" type="volume">
<mods:number id="EDE6E4F6E988520E148ADF3C4EB8FA6F">4137</mods:number> <mods:number id="E248D8C245C215864CD80B515A4F976C">4137</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="04AF285F96BD559DFACEE53E3BFF6564" type="issue"> <mods:detail id="A1BD01BECF193081B167FCE6C0AEEB1A" type="issue">
<mods:number id="DB766424AAED531AFD4BE34C207D2166">1</mods:number> <mods:number id="061754498EDEEF7F092FF1237FC856A6">1</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="F4294EF8F00D9BEEF2CB459DB6E8A5BE" unit="page"> <mods:extent id="043081426702A7FC49D67F5FB93BC178" unit="page">
<mods:start id="AC93972E9580B7FFCEA2C0A6E9D5DE38">95</mods:start> <mods:start id="C21873D2753DA6EECC2A4A1CA8FB0D08">95</mods:start>
<mods:end id="2B29EAFC9A16D25F1D570C67D5F8BBF6">107</mods:end> <mods:end id="C6998914E03F789E3315C872E8C4D395">107</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:classification id="E45F9128578E17DC326D85A5D5072D70">journal article</mods:classification> <mods:classification id="6177CE0432B493E26B9C7481E205FF6B">journal article</mods:classification>
<mods:identifier id="BE07832D329E4EB5AA65831C7ADDB714" type="DOI">10.11646/zootaxa.4137.1.7</mods:identifier> <mods:identifier id="9422FEC99D7800643A1909EE7C8D5A99" type="CLB-Dataset">38613</mods:identifier>
<mods:identifier id="4B7965F109D0D4EC6D5F1CFD39D2F021" type="GBIF-Dataset">f88ca779-0496-4982-95e8-826d29bbc163</mods:identifier> <mods:identifier id="D77A0CD853FB7A1E1141512D94A48F37" type="DOI">10.11646/zootaxa.4137.1.7</mods:identifier>
<mods:identifier id="7A68728F3CBCA0FCCFE5DD4C566A399C" type="ISSN">1175-5326</mods:identifier> <mods:identifier id="11D6737B62D5198264937DABD3F153DD" type="GBIF-Dataset">f88ca779-0496-4982-95e8-826d29bbc163</mods:identifier>
<mods:identifier id="4DBF5CE20C67D6FEC8C64FF3EDC51F8A" type="Zenodo-Dep">255201</mods:identifier> <mods:identifier id="11A2FB5526BF863C88BF580728E8F8B6" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="F0E189BCA4D102697417B18F1583F6C6" type="ZooBank">EA49068A-884D-4B79-AF5F-82910028EE23</mods:identifier> <mods:identifier id="70C07574F3135AC64958CC1D96D44693" type="Zenodo-Dep">255201</mods:identifier>
<mods:identifier id="AF0A3F4A02E97722E5808677778215EB" type="ZooBank">EA49068A-884D-4B79-AF5F-82910028EE23</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="EA0487FAFFDFFFCBEA912BC92869279E" ID-DOI="http://doi.org/10.5281/zenodo.6079583" ID-GBIF-Taxon="121546085" ID-Zenodo-Dep="6079583" LSID="urn:lsid:plazi:treatment:EA0487FAFFDFFFCBEA912BC92869279E" httpUri="http://treatment.plazi.org/id/EA0487FAFFDFFFCBEA912BC92869279E" lastPageId="7" lastPageNumber="102" pageId="3" pageNumber="98"> <treatment id="EA0487FAFFDFFFCBEA912BC92869279E" ID-DOI="http://doi.org/10.5281/zenodo.6079583" ID-GBIF-Taxon="121546085" ID-Zenodo-Dep="6079583" LSID="urn:lsid:plazi:treatment:EA0487FAFFDFFFCBEA912BC92869279E" httpUri="http://treatment.plazi.org/id/EA0487FAFFDFFFCBEA912BC92869279E" lastPageId="7" lastPageNumber="102" pageId="3" pageNumber="98" scope_infraOrder="Aphidomorpha" scope_order="Hemiptera">
<subSubSection id="2AB76567FFDFFFCFEA912BC92C10266C" pageId="3" pageNumber="98" type="nomenclature"> <subSubSection id="2AB76567FFDFFFCFEA912BC92C10266C" pageId="3" pageNumber="98" type="nomenclature">
<paragraph id="621236ECFFDFFFCFEA912BC92F45264D" blockId="3.[151,606,1260,1320]" box="[151,606,1260,1286]" pageId="3" pageNumber="98"> <paragraph id="621236ECFFDFFFCFEA912BC92F45264D" blockId="3.[151,606,1260,1320]" box="[151,606,1260,1286]" pageId="3" pageNumber="98">
<heading id="395A8180FFDFFFCFEA912BC92F45264D" bold="true" box="[151,606,1260,1286]" fontSize="11" level="1" pageId="3" pageNumber="98" reason="1"> <heading id="395A8180FFDFFFCFEA912BC92F45264D" bold="true" box="[151,606,1260,1286]" fontSize="11" level="1" pageId="3" pageNumber="98" reason="1">
<emphasis id="50D9EAFEFFDFFFCFEA912BC92F45264D" bold="true" box="[151,606,1260,1286]" pageId="3" pageNumber="98"> <emphasis id="50D9EAFEFFDFFFCFEA912BC92F45264D" bold="true" box="[151,606,1260,1286]" pageId="3" pageNumber="98">
<taxonomicName id="A5AD4D6FFFDFFFCFEA912BC92CE2264D" box="[151,505,1260,1286]" class="Insecta" family="Hydrophilidae" genus="Koonwarraphis" kingdom="Animalia" order="Coleoptera" pageId="3" pageNumber="98" phylum="Arthropoda" rank="species" species="rotundafrons" status="sp. nov."> <taxonomicName id="A5AD4D6FFFDFFFCFEA912BC92CE2264D" ID-CoL="3RCWK" box="[151,505,1260,1286]" class="Insecta" genus="Koonwarraphis" kingdom="Animalia" order="Hemiptera" pageId="3" pageNumber="98" phylum="Arthropoda" rank="species" species="rotundafrons" status="sp. nov.">
<emphasis id="50D9EAFEFFDFFFCFEA912BC92CE2264D" bold="true" box="[151,505,1260,1286]" italics="true" pageId="3" pageNumber="98">Koonwarraphis rotundafrons</emphasis> <emphasis id="50D9EAFEFFDFFFCFEA912BC92CE2264D" bold="true" box="[151,505,1260,1286]" italics="true" pageId="3" pageNumber="98">Koonwarraphis rotundafrons</emphasis>
</taxonomicName> </taxonomicName>
<taxonomicNameLabel id="4BEA5785FFDFFFCFE8062BC92F45264D" box="[512,606,1260,1286]" pageId="3" pageNumber="98" rank="species">sp. nov.</taxonomicNameLabel> <taxonomicNameLabel id="4BEA5785FFDFFFCFE8062BC92F45264D" box="[512,606,1260,1286]" pageId="3" pageNumber="98" rank="species">sp. nov.</taxonomicNameLabel>
@ -61,7 +62,7 @@
</paragraph> </paragraph>
<paragraph id="621236ECFFDFFFCFEA912A2A2C10266C" blockId="3.[151,606,1260,1320]" box="[151,267,1295,1320]" pageId="3" pageNumber="98"> <paragraph id="621236ECFFDFFFCFEA912A2A2C10266C" blockId="3.[151,606,1260,1320]" box="[151,267,1295,1320]" pageId="3" pageNumber="98">
( (
<figureCitation id="FA962A69FFDFFFCFEA992A2A2C18266C" box="[159,259,1295,1320]" captionStart-0="FIGURE 2" captionStart-1="FIGURE 3" captionStart-2="FIGURE 4" captionStartId-0="4.[151,250,1965,1987]" captionStartId-1="5.[151,250,1606,1628]" captionStartId-2="6.[151,250,1933,1955]" captionTargetBox-0="[238,1349,193,1943]" captionTargetBox-1="[151,1436,193,1583]" captionTargetBox-2="[482,1104,193,1911]" captionTargetId-0="figure@4.[238,1349,193,1944]" captionTargetId-1="figure@5.[151,1436,193,1585]" captionTargetId-2="figure@6.[482,1104,193,1912]" captionTargetPageId-0="4" captionTargetPageId-1="5" captionTargetPageId-2="6" captionText-0="FIGURE 2. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Photomicrograph of the entire fossil; B. same image under SEM. Scale bar: 1 mm." captionText-1="FIGURE 3. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct 2 = mesoscutum, scl 2 = mesoscutellum, pra = praealare, pn 2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F." captionText-2="FIGURE 4. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A C. left forewing, A. photomicrograph, B. interpretative sketch of venation, C. SEM image; D E. right forewing, C. photomicrograph, B. sketch of venation. Scale bar: 1 mm." httpUri-0="https://zenodo.org/record/255203/files/figure.png" httpUri-1="https://zenodo.org/record/255205/files/figure.png" httpUri-2="https://zenodo.org/record/255206/files/figure.png" pageId="3" pageNumber="98">Figs 24</figureCitation> <figureCitation id="FA962A69FFDFFFCFEA992A2A2C18266C" box="[159,259,1295,1320]" captionStart-0="FIGURE 2" captionStart-1="FIGURE 3" captionStart-2="FIGURE 4" captionStartId-0="4.[151,250,1965,1987]" captionStartId-1="5.[151,250,1606,1628]" captionStartId-2="6.[151,250,1933,1955]" captionTargetBox-0="[238,1349,193,1943]" captionTargetBox-1="[151,1436,193,1583]" captionTargetBox-2="[482,1104,193,1911]" captionTargetId-0="figure@4.[238,1349,193,1944]" captionTargetId-1="figure@5.[151,1436,193,1585]" captionTargetId-2="figure@6.[482,1104,193,1912]" captionTargetPageId-0="4" captionTargetPageId-1="5" captionTargetPageId-2="6" captionText-0="FIGURE 2. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Photomicrograph of the entire fossil; B. same image under SEM. Scale bar: 1 mm." captionText-1="FIGURE 3. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct 2 = mesoscutum, scl 2 = mesoscutellum, pra = praealare, pn 2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F." captionText-2="FIGURE 4. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A C. left forewing, A. photomicrograph, B. interpretative sketch of venation, C. SEM image; D E. right forewing, C. photomicrograph, B. sketch of venation. Scale bar: 1 mm." figureDoi-0="http://doi.org/10.5281/zenodo.255203" figureDoi-1="http://doi.org/10.5281/zenodo.255205" figureDoi-2="http://doi.org/10.5281/zenodo.255206" httpUri-0="https://zenodo.org/record/255203/files/figure.png" httpUri-1="https://zenodo.org/record/255205/files/figure.png" httpUri-2="https://zenodo.org/record/255206/files/figure.png" pageId="3" pageNumber="98">Figs 24</figureCitation>
) )
</paragraph> </paragraph>
</subSubSection> </subSubSection>
@ -92,14 +93,14 @@ From the Latin words
<paragraph id="621236ECFFDFFFCFEAC129202CED2509" blockId="3.[151,1437,1361,2034]" pageId="3" pageNumber="98"> <paragraph id="621236ECFFDFFFCFEAC129202CED2509" blockId="3.[151,1437,1361,2034]" pageId="3" pageNumber="98">
<emphasis id="50D9EAFEFFDFFFCFEAC129202C422555" bold="true" box="[199,345,1541,1566]" pageId="3" pageNumber="98">Description.</emphasis> <emphasis id="50D9EAFEFFDFFFCFEAC129202C422555" bold="true" box="[199,345,1541,1566]" pageId="3" pageNumber="98">Description.</emphasis>
Body ( Body (
<figureCitation id="FA962A69FFDFFFCFEBAC29202CF42555" box="[426,495,1541,1566]" captionStart="FIGURE 2" captionStartId="4.[151,250,1965,1987]" captionTargetBox="[238,1349,193,1943]" captionTargetId="figure@4.[238,1349,193,1944]" captionTargetPageId="4" captionText="FIGURE 2. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Photomicrograph of the entire fossil; B. same image under SEM. Scale bar: 1 mm." httpUri="https://zenodo.org/record/255203/files/figure.png" pageId="3" pageNumber="98">Fig. 2</figureCitation> <figureCitation id="FA962A69FFDFFFCFEBAC29202CF42555" box="[426,495,1541,1566]" captionStart="FIGURE 2" captionStartId="4.[151,250,1965,1987]" captionTargetBox="[238,1349,193,1943]" captionTargetId="figure@4.[238,1349,193,1944]" captionTargetPageId="4" captionText="FIGURE 2. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Photomicrograph of the entire fossil; B. same image under SEM. Scale bar: 1 mm." figureDoi="http://doi.org/10.5281/zenodo.255203" httpUri="https://zenodo.org/record/255203/files/figure.png" pageId="3" pageNumber="98">Fig. 2</figureCitation>
). ).
<quantity id="A5559B09FFDFFFCFE80529202F422555" box="[515,601,1541,1566]" metricMagnitude="-3" metricUnit="m" metricValue="2.5" pageId="3" pageNumber="98" unit="mm" value="2.5">2.5 mm</quantity> <quantity id="A5559B09FFDFFFCFE80529202F422555" box="[515,601,1541,1566]" metricMagnitude="-3" metricUnit="m" metricValue="2.5" pageId="3" pageNumber="98" unit="mm" value="2.5">2.5 mm</quantity>
long; forewings displaced and partially crumpled, obscuring some parts of the venation and body features. long; forewings displaced and partially crumpled, obscuring some parts of the venation and body features.
</paragraph> </paragraph>
<paragraph id="621236ECFFDFFFCFEAC129682F8824B9" blockId="3.[151,1437,1361,2034]" pageId="3" pageNumber="98"> <paragraph id="621236ECFFDFFFCFEAC129682F8824B9" blockId="3.[151,1437,1361,2034]" pageId="3" pageNumber="98">
Head ( Head (
<figureCitation id="FA962A69FFDFFFCFEB1529682C4C252D" box="[275,343,1613,1638]" captionStart="FIGURE 3" captionStartId="5.[151,250,1606,1628]" captionTargetBox="[151,1436,193,1583]" captionTargetId="figure@5.[151,1436,193,1585]" captionTargetPageId="5" captionText="FIGURE 3. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct 2 = mesoscutum, scl 2 = mesoscutellum, pra = praealare, pn 2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F." httpUri="https://zenodo.org/record/255205/files/figure.png" pageId="3" pageNumber="98">Fig. 3</figureCitation> <figureCitation id="FA962A69FFDFFFCFEB1529682C4C252D" box="[275,343,1613,1638]" captionStart="FIGURE 3" captionStartId="5.[151,250,1606,1628]" captionTargetBox="[151,1436,193,1583]" captionTargetId="figure@5.[151,1436,193,1585]" captionTargetPageId="5" captionText="FIGURE 3. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct 2 = mesoscutum, scl 2 = mesoscutellum, pra = praealare, pn 2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F." figureDoi="http://doi.org/10.5281/zenodo.255205" httpUri="https://zenodo.org/record/255205/files/figure.png" pageId="3" pageNumber="98">Fig. 3</figureCitation>
AD,F). Maximum width AD,F). Maximum width
<quantity id="A5559B09FFDFFFCFE88229682FC7252D" box="[644,732,1613,1638]" metricMagnitude="-4" metricUnit="m" metricValue="5.0" pageId="3" pageNumber="98" unit="mm" value="0.5">0.5 mm</quantity> <quantity id="A5559B09FFDFFFCFE88229682FC7252D" box="[644,732,1613,1638]" metricMagnitude="-4" metricUnit="m" metricValue="5.0" pageId="3" pageNumber="98" unit="mm" value="0.5">0.5 mm</quantity>
, widest at compound eyes; head wider than long, length 0.5x width. Frons enlarged, bulging apically in a gently rounded curve, with prominent v shaped ornament positioned in front of ocelli and extending to posterior margin of head; lateral sutures faint, extending from the lateral margins between the compound eyes and ocelli; epicranial suture short and relatively faint, extending forward from lateral sutures but apparently not reaching front of frons. Antenna , widest at compound eyes; head wider than long, length 0.5x width. Frons enlarged, bulging apically in a gently rounded curve, with prominent v shaped ornament positioned in front of ocelli and extending to posterior margin of head; lateral sutures faint, extending from the lateral margins between the compound eyes and ocelli; epicranial suture short and relatively faint, extending forward from lateral sutures but apparently not reaching front of frons. Antenna
@ -110,10 +111,10 @@ long,
<quantity id="A5559B09FFDFFFCFE81728932F7C2485" box="[529,615,1974,1998]" metricMagnitude="-4" metricUnit="m" metricValue="1.0" pageId="3" pageNumber="98" unit="mm" value="0.1">0.1 mm</quantity> <quantity id="A5559B09FFDFFFCFE81728932F7C2485" box="[529,615,1974,1998]" metricMagnitude="-4" metricUnit="m" metricValue="1.0" pageId="3" pageNumber="98" unit="mm" value="0.1">0.1 mm</quantity>
wide, extending 0.6x length of body, just posterior of hind coxae. Distal end of rostrum apparently narrowed, divided. wide, extending 0.6x length of body, just posterior of hind coxae. Distal end of rostrum apparently narrowed, divided.
</paragraph> </paragraph>
<caption id="36D26664FFD8FFC8EA912888299824A9" httpUri="https://zenodo.org/record/255203/files/figure.png" pageId="4" pageNumber="99" targetBox="[238,1349,193,1943]" targetPageId="4"> <caption id="36D26664FFD8FFC8EA912888299824A9" ID-DOI="http://doi.org/10.5281/zenodo.255203" httpUri="https://zenodo.org/record/255203/files/figure.png" pageId="4" pageNumber="99" targetBox="[238,1349,193,1943]" targetPageId="4">
<paragraph id="621236ECFFD8FFC8EA912888299824A9" blockId="4.[151,1436,1965,2018]" pageId="4" pageNumber="99"> <paragraph id="621236ECFFD8FFC8EA912888299824A9" blockId="4.[151,1436,1965,2018]" pageId="4" pageNumber="99">
<emphasis id="50D9EAFEFFD8FFC8EA9128882C0C2488" bold="true" box="[151,279,1965,1987]" pageId="4" pageNumber="99">FIGURE 2.</emphasis> <emphasis id="50D9EAFEFFD8FFC8EA9128882C0C2488" bold="true" box="[151,279,1965,1987]" pageId="4" pageNumber="99">FIGURE 2.</emphasis>
<taxonomicName id="A5AD4D6FFFD8FFC8EB2728882F562488" box="[289,589,1965,1987]" class="Insecta" family="Hydrophilidae" genus="Koonwarraphis" kingdom="Animalia" order="Coleoptera" pageId="4" pageNumber="99" phylum="Arthropoda" rank="species" species="rotundafrons"> <taxonomicName id="A5AD4D6FFFD8FFC8EB2728882F562488" box="[289,589,1965,1987]" class="Insecta" genus="Koonwarraphis" kingdom="Animalia" order="Hemiptera" pageId="4" pageNumber="99" phylum="Arthropoda" rank="species" species="rotundafrons">
<emphasis id="50D9EAFEFFD8FFC8EB2728882F562488" box="[289,589,1965,1987]" italics="true" pageId="4" pageNumber="99">Koonwarraphis rotundafrons</emphasis> <emphasis id="50D9EAFEFFD8FFC8EB2728882F562488" box="[289,589,1965,1987]" italics="true" pageId="4" pageNumber="99">Koonwarraphis rotundafrons</emphasis>
</taxonomicName> </taxonomicName>
<emphasis id="50D9EAFEFFD8FFC8E85E288B2E182488" bold="true" box="[600,771,1965,1987]" pageId="4" pageNumber="99">gen. &amp; sp. nov.</emphasis> <emphasis id="50D9EAFEFFD8FFC8E85E288B2E182488" bold="true" box="[600,771,1965,1987]" pageId="4" pageNumber="99">gen. &amp; sp. nov.</emphasis>
@ -122,10 +123,10 @@ wide, extending 0.6x length of body, just posterior of hind coxae. Distal end of
. A. Photomicrograph of the entire fossil; B. same image under SEM. Scale bar: 1 mm. . A. Photomicrograph of the entire fossil; B. same image under SEM. Scale bar: 1 mm.
</paragraph> </paragraph>
</caption> </caption>
<caption id="36D26664FFD9FFC9EA912963293B245C" httpUri="https://zenodo.org/record/255205/files/figure.png" pageId="5" pageNumber="100" targetBox="[151,1436,193,1583]" targetPageId="5"> <caption id="36D26664FFD9FFC9EA912963293B245C" ID-DOI="http://doi.org/10.5281/zenodo.255205" httpUri="https://zenodo.org/record/255205/files/figure.png" pageId="5" pageNumber="100" targetBox="[151,1436,193,1583]" targetPageId="5">
<paragraph id="621236ECFFD9FFC9EA912963293B245C" blockId="5.[151,1436,1606,1815]" pageId="5" pageNumber="100"> <paragraph id="621236ECFFD9FFC9EA912963293B245C" blockId="5.[151,1436,1606,1815]" pageId="5" pageNumber="100">
<emphasis id="50D9EAFEFFD9FFC9EA9129632C0C2517" bold="true" box="[151,279,1606,1628]" pageId="5" pageNumber="100">FIGURE 3.</emphasis> <emphasis id="50D9EAFEFFD9FFC9EA9129632C0C2517" bold="true" box="[151,279,1606,1628]" pageId="5" pageNumber="100">FIGURE 3.</emphasis>
<taxonomicName id="A5AD4D6FFFD9FFC9EB2729632F562517" box="[289,589,1606,1628]" class="Insecta" family="Hydrophilidae" genus="Koonwarraphis" kingdom="Animalia" order="Coleoptera" pageId="5" pageNumber="100" phylum="Arthropoda" rank="species" species="rotundafrons"> <taxonomicName id="A5AD4D6FFFD9FFC9EB2729632F562517" box="[289,589,1606,1628]" class="Insecta" genus="Koonwarraphis" kingdom="Animalia" order="Hemiptera" pageId="5" pageNumber="100" phylum="Arthropoda" rank="species" species="rotundafrons">
<emphasis id="50D9EAFEFFD9FFC9EB2729632F562517" box="[289,589,1606,1628]" italics="true" pageId="5" pageNumber="100">Koonwarraphis rotundafrons</emphasis> <emphasis id="50D9EAFEFFD9FFC9EB2729632F562517" box="[289,589,1606,1628]" italics="true" pageId="5" pageNumber="100">Koonwarraphis rotundafrons</emphasis>
</taxonomicName> </taxonomicName>
<emphasis id="50D9EAFEFFD9FFC9E85E29622E182517" bold="true" box="[600,771,1606,1628]" pageId="5" pageNumber="100">gen. &amp; sp. nov.</emphasis> <emphasis id="50D9EAFEFFD9FFC9E85E29622E182517" bold="true" box="[600,771,1606,1628]" pageId="5" pageNumber="100">gen. &amp; sp. nov.</emphasis>
@ -134,10 +135,10 @@ wide, extending 0.6x length of body, just posterior of hind coxae. Distal end of
. A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct2 = mesoscutum, scl2 = mesoscutellum, pra = praealare, pn2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F. . A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct2 = mesoscutum, scl2 = mesoscutellum, pra = praealare, pn2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F.
</paragraph> </paragraph>
</caption> </caption>
<caption id="36D26664FFDAFFCAEA9128A82E7C24AA" httpUri="https://zenodo.org/record/255206/files/figure.png" pageId="6" pageNumber="101" targetBox="[482,1104,193,1911]" targetPageId="6"> <caption id="36D26664FFDAFFCAEA9128A82E7C24AA" ID-DOI="http://doi.org/10.5281/zenodo.255206" httpUri="https://zenodo.org/record/255206/files/figure.png" pageId="6" pageNumber="101" targetBox="[482,1104,193,1911]" targetPageId="6">
<paragraph id="621236ECFFDAFFCAEA9128A82E7C24AA" blockId="6.[151,1436,1933,2017]" pageId="6" pageNumber="101"> <paragraph id="621236ECFFDAFFCAEA9128A82E7C24AA" blockId="6.[151,1436,1933,2017]" pageId="6" pageNumber="101">
<emphasis id="50D9EAFEFFDAFFCAEA9128A82C0C24E8" bold="true" box="[151,279,1933,1955]" pageId="6" pageNumber="101">FIGURE 4.</emphasis> <emphasis id="50D9EAFEFFDAFFCAEA9128A82C0C24E8" bold="true" box="[151,279,1933,1955]" pageId="6" pageNumber="101">FIGURE 4.</emphasis>
<taxonomicName id="A5AD4D6FFFDAFFCAEB2728A82F5624E8" box="[289,589,1933,1955]" class="Insecta" family="Hydrophilidae" genus="Koonwarraphis" kingdom="Animalia" order="Coleoptera" pageId="6" pageNumber="101" phylum="Arthropoda" rank="species" species="rotundafrons"> <taxonomicName id="A5AD4D6FFFDAFFCAEB2728A82F5624E8" box="[289,589,1933,1955]" class="Insecta" genus="Koonwarraphis" kingdom="Animalia" order="Hemiptera" pageId="6" pageNumber="101" phylum="Arthropoda" rank="species" species="rotundafrons">
<emphasis id="50D9EAFEFFDAFFCAEB2728A82F5624E8" box="[289,589,1933,1955]" italics="true" pageId="6" pageNumber="101">Koonwarraphis rotundafrons</emphasis> <emphasis id="50D9EAFEFFDAFFCAEB2728A82F5624E8" box="[289,589,1933,1955]" italics="true" pageId="6" pageNumber="101">Koonwarraphis rotundafrons</emphasis>
</taxonomicName> </taxonomicName>
<emphasis id="50D9EAFEFFDAFFCAE85E28AB2E1824E8" bold="true" box="[600,771,1933,1955]" pageId="6" pageNumber="101">gen. &amp; sp. nov.</emphasis> <emphasis id="50D9EAFEFFDAFFCAE85E28AB2E1824E8" bold="true" box="[600,771,1933,1955]" pageId="6" pageNumber="101">gen. &amp; sp. nov.</emphasis>
@ -148,7 +149,7 @@ wide, extending 0.6x length of body, just posterior of hind coxae. Distal end of
</caption> </caption>
<paragraph id="621236ECFFDBFFCBEAC12FB229EC212B" blockId="7.[151,1437,151,1237]" pageId="7" pageNumber="102"> <paragraph id="621236ECFFDBFFCBEAC12FB229EC212B" blockId="7.[151,1437,151,1237]" pageId="7" pageNumber="102">
Thorax ( Thorax (
<figureCitation id="FA962A69FFDBFFCBEB2C2FB22C7423FB" box="[298,367,151,176]" captionStart="FIGURE 3" captionStartId="5.[151,250,1606,1628]" captionTargetBox="[151,1436,193,1583]" captionTargetId="figure@5.[151,1436,193,1585]" captionTargetPageId="5" captionText="FIGURE 3. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct 2 = mesoscutum, scl 2 = mesoscutellum, pra = praealare, pn 2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F." httpUri="https://zenodo.org/record/255205/files/figure.png" pageId="7" pageNumber="102">Fig. 3</figureCitation> <figureCitation id="FA962A69FFDBFFCBEB2C2FB22C7423FB" box="[298,367,151,176]" captionStart="FIGURE 3" captionStartId="5.[151,250,1606,1628]" captionTargetBox="[151,1436,193,1583]" captionTargetId="figure@5.[151,1436,193,1585]" captionTargetPageId="5" captionText="FIGURE 3. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct 2 = mesoscutum, scl 2 = mesoscutellum, pra = praealare, pn 2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F." figureDoi="http://doi.org/10.5281/zenodo.255205" httpUri="https://zenodo.org/record/255205/files/figure.png" pageId="7" pageNumber="102">Fig. 3</figureCitation>
AB). Pronotum AB). Pronotum
<quantity id="A5559B09FFDBFFCBE83E2FB22F9523E4" box="[568,654,151,176]" metricMagnitude="-4" metricUnit="m" metricValue="5.0" pageId="7" pageNumber="102" unit="mm" value="0.5">0.5 mm</quantity> <quantity id="A5559B09FFDBFFCBE83E2FB22F9523E4" box="[568,654,151,176]" metricMagnitude="-4" metricUnit="m" metricValue="5.0" pageId="7" pageNumber="102" unit="mm" value="0.5">0.5 mm</quantity>
long; roughly trapezoidal, anterior width subequal to base of head, widening gently to become subequal to mesoscutum at posterior; central portion of pronotum more strongly sclerotized than laterally. Mesothorax anterior edge broader than head, praealare extended out into shoulders slightly wider than the remaining mesothorax; mesoscutum, mesopraescutum, and mesoscutellum strongly domed and clearly defined; mesopraescutum and paired mesoscutum plates large and triangular, mesoscutellum narrow, rectangular, apparently divided centrally; membranous area between paired mesoscutum plates and mesoscutellum large, triangular. Metanotum roughly rectangular in shape, narrow; similar in width to mesoscutellum, divided ventrally; other metathoracic segments difficult to discern individually. Combined thoracic segments ~ long; roughly trapezoidal, anterior width subequal to base of head, widening gently to become subequal to mesoscutum at posterior; central portion of pronotum more strongly sclerotized than laterally. Mesothorax anterior edge broader than head, praealare extended out into shoulders slightly wider than the remaining mesothorax; mesoscutum, mesopraescutum, and mesoscutellum strongly domed and clearly defined; mesopraescutum and paired mesoscutum plates large and triangular, mesoscutellum narrow, rectangular, apparently divided centrally; membranous area between paired mesoscutum plates and mesoscutellum large, triangular. Metanotum roughly rectangular in shape, narrow; similar in width to mesoscutellum, divided ventrally; other metathoracic segments difficult to discern individually. Combined thoracic segments ~
@ -177,7 +178,7 @@ wide; tarsi apparently short, tarsal segments and tarsal claws indistinct. Legs
</paragraph> </paragraph>
<paragraph id="621236ECFFDBFFCBEAC12D492E5F270E" blockId="7.[151,1437,151,1237]" pageId="7" pageNumber="102"> <paragraph id="621236ECFFDBFFCBEAC12D492E5F270E" blockId="7.[151,1437,151,1237]" pageId="7" pageNumber="102">
Wings ( Wings (
<figureCitation id="FA962A69FFDBFFCBEB272D492C7121CF" box="[289,362,620,645]" captionStart="FIGURE 4" captionStartId="6.[151,250,1933,1955]" captionTargetBox="[482,1104,193,1911]" captionTargetId="figure@6.[482,1104,193,1912]" captionTargetPageId="6" captionText="FIGURE 4. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A C. left forewing, A. photomicrograph, B. interpretative sketch of venation, C. SEM image; D E. right forewing, C. photomicrograph, B. sketch of venation. Scale bar: 1 mm." httpUri="https://zenodo.org/record/255206/files/figure.png" pageId="7" pageNumber="102">Fig. 4</figureCitation> <figureCitation id="FA962A69FFDBFFCBEB272D492C7121CF" box="[289,362,620,645]" captionStart="FIGURE 4" captionStartId="6.[151,250,1933,1955]" captionTargetBox="[482,1104,193,1911]" captionTargetId="figure@6.[482,1104,193,1912]" captionTargetPageId="6" captionText="FIGURE 4. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A C. left forewing, A. photomicrograph, B. interpretative sketch of venation, C. SEM image; D E. right forewing, C. photomicrograph, B. sketch of venation. Scale bar: 1 mm." figureDoi="http://doi.org/10.5281/zenodo.255206" httpUri="https://zenodo.org/record/255206/files/figure.png" pageId="7" pageNumber="102">Fig. 4</figureCitation>
). Forewing preserved length ). Forewing preserved length
<quantity id="A5559B09FFDBFFCBE8B92D492E0321CF" box="[703,792,620,645]" metricMagnitude="-3" metricUnit="m" metricValue="2.6" pageId="7" pageNumber="102" unit="mm" value="2.6">2.6 mm</quantity> <quantity id="A5559B09FFDBFFCBE8B92D492E0321CF" box="[703,792,620,645]" metricMagnitude="-3" metricUnit="m" metricValue="2.6" pageId="7" pageNumber="102" unit="mm" value="2.6">2.6 mm</quantity>
; wing triangular, costal margin gently curved, posterior margin straightened, apical margin incomplete. Both forewings missing apex; right forewing with costal region apparently twisted or crumpled, overprinting itself. Costal area of moderate width, R, M, and Cu stems fused basally (main vein), terminating in large, lozenge-shaped pterostigma ; wing triangular, costal margin gently curved, posterior margin straightened, apical margin incomplete. Both forewings missing apex; right forewing with costal region apparently twisted or crumpled, overprinting itself. Costal area of moderate width, R, M, and Cu stems fused basally (main vein), terminating in large, lozenge-shaped pterostigma
@ -192,7 +193,7 @@ centrally. M diverging from main vein roughly halfway between pterostigma and Cu
</paragraph> </paragraph>
<paragraph id="621236ECFFDBFFCBEAC12B752869279E" blockId="7.[151,1437,151,1237]" pageId="7" pageNumber="102"> <paragraph id="621236ECFFDBFFCBEAC12B752869279E" blockId="7.[151,1437,151,1237]" pageId="7" pageNumber="102">
Abdomen ( Abdomen (
<figureCitation id="FA962A69FFDBFFCBEB402B752C912722" box="[326,394,1104,1129]" captionStart="FIGURE 3" captionStartId="5.[151,250,1606,1628]" captionTargetBox="[151,1436,193,1583]" captionTargetId="figure@5.[151,1436,193,1585]" captionTargetPageId="5" captionText="FIGURE 3. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct 2 = mesoscutum, scl 2 = mesoscutellum, pra = praealare, pn 2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F." httpUri="https://zenodo.org/record/255205/files/figure.png" pageId="7" pageNumber="102">Fig. 3</figureCitation> <figureCitation id="FA962A69FFDBFFCBEB402B752C912722" box="[326,394,1104,1129]" captionStart="FIGURE 3" captionStartId="5.[151,250,1606,1628]" captionTargetBox="[151,1436,193,1583]" captionTargetId="figure@5.[151,1436,193,1585]" captionTargetPageId="5" captionText="FIGURE 3. Koonwarraphis rotundafrons gen. &amp; sp. nov., Lower Cretaceous Koonwarra Fossil Bed, holotype specimen AM F 72793. A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct 2 = mesoscutum, scl 2 = mesoscutellum, pra = praealare, pn 2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F." figureDoi="http://doi.org/10.5281/zenodo.255205" httpUri="https://zenodo.org/record/255205/files/figure.png" pageId="7" pageNumber="102">Fig. 3</figureCitation>
E). Rounded, as wide as or slightly wider than thoracic segments; maximum width E). Rounded, as wide as or slightly wider than thoracic segments; maximum width
<quantity id="A5559B09FFDBFFCBEF462B7428832723" box="[1344,1432,1105,1129]" metricMagnitude="-4" metricUnit="m" metricValue="9.0" pageId="7" pageNumber="102" unit="mm" value="0.9">0.9 mm</quantity> <quantity id="A5559B09FFDBFFCBEF462B7428832723" box="[1344,1432,1105,1129]" metricMagnitude="-4" metricUnit="m" metricValue="9.0" pageId="7" pageNumber="102" unit="mm" value="0.9">0.9 mm</quantity>
, length , length

View file

@ -1,59 +1,60 @@
<document id="B3B09055B7169F89297A373E0DE6F91A" ID="10.11646/zootaxa.4137.1.7" ID-DOI="10.11646/zootaxa.4137.1.7" ID-GBIF-Dataset="f88ca779-0496-4982-95e8-826d29bbc163" ID-ISSN="1175-5326" ID-Zenodo-Dep="255201" ID-ZooBank="EA49068A-884D-4B79-AF5F-82910028EE23" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" checkinTime="1467960133845" checkinUser="plazi" docAuthor="Martin, Sarah K., Skidmore, Luke I. &amp; Stilwell, Jeffrey D." docDate="2016" docId="EA0487FAFFDFFFCFEA912C3B280D27EF" docLanguage="en" docName="zootaxa.4137.1.7.pdf" docOrigin="Zootaxa 4137 (1)" docStyle="DocumentStyle:647186512141C8FC8976D5BCC54AEB7D.9:Zootaxa.2013-.journal_article" docStyleId="647186512141C8FC8976D5BCC54AEB7D" docStyleName="Zootaxa.2013-.journal_article" docStyleVersion="9" docTitle="Koonwarraphis Martin, Skidmore &amp; Stilwell, 2016, gen. nov." docType="treatment" docVersion="7" lastPageNumber="98" masterDocId="163DFF82FFDCFFCCEA062F252D1B234B" masterDocTitle="A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria" masterLastPageNumber="107" masterPageNumber="95" pageNumber="98" updateTime="1698364052722" updateUser="plazi"> <document id="DC251829A0C787F719FA2F64B82100D1" ID="10.11646/zootaxa.4137.1.7" ID-CLB-Dataset="38613" ID-DOI="10.11646/zootaxa.4137.1.7" ID-GBIF-Dataset="f88ca779-0496-4982-95e8-826d29bbc163" ID-ISSN="1175-5326" ID-Zenodo-Dep="255201" ID-ZooBank="EA49068A-884D-4B79-AF5F-82910028EE23" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="guilherme" checkinTime="1467960133845" checkinUser="plazi" docAuthor="Martin, Sarah K., Skidmore, Luke I. &amp; Stilwell, Jeffrey D." docDate="2016" docId="EA0487FAFFDFFFCFEA912C3B280D27EF" docLanguage="en" docName="zootaxa.4137.1.7.pdf" docOrigin="Zootaxa 4137 (1)" docStyle="DocumentStyle:647186512141C8FC8976D5BCC54AEB7D.9:Zootaxa.2013-.journal_article" docStyleId="647186512141C8FC8976D5BCC54AEB7D" docStyleName="Zootaxa.2013-.journal_article" docStyleVersion="9" docTitle="Koonwarraphis Martin, Skidmore &amp; Stilwell, 2016, gen. nov." docType="treatment" docVersion="10" lastPageNumber="98" masterDocId="163DFF82FFDCFFCCEA062F252D1B234B" masterDocTitle="A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria" masterLastPageNumber="107" masterPageNumber="95" pageNumber="98" updateTime="1738779304380" updateUser="guilherme">
<mods:mods id="63922E32C3BD6188415F3247B6B09469" xmlns:mods="http://www.loc.gov/mods/v3"> <mods:mods id="51CCF9D56CB1A2F43570760C61543811" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="60899FBCDAD4CBD9DD1064C0BD63157A"> <mods:titleInfo id="BC710517712A896C0A15E8F788FB1A50">
<mods:title id="80E8F49BA3890E97E8235EF38AF3F50A">A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria</mods:title> <mods:title id="A28943DE87ABBF409A26AD958A2097B6">A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:name id="0A2F466AD96EFD08E35FB3160BBFC24F" type="personal"> <mods:name id="77977B2F4C716C0577DEAE5D49BEF5D2" type="personal">
<mods:role id="89D0C51BB9CD8B54C66AB9DE8A23294E"> <mods:role id="45E82C8E1993D40B58FD0F133944F848">
<mods:roleTerm id="A3EBEF1E605D26B72B99FB6C1449F12C">Author</mods:roleTerm> <mods:roleTerm id="89078E6C06745F0FED139A63CF97075C">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="6EA93E8429AEE1B9CE31A6E85DF4C21E">Martin, Sarah K.</mods:namePart> <mods:namePart id="6A45A0ADFC4CCB9A0F603AA7F400E7E1">Martin, Sarah K.</mods:namePart>
</mods:name> </mods:name>
<mods:name id="4E2AC899F0D15C2A54BEBB57829214D2" type="personal"> <mods:name id="3E3E830871C1527EF7EB1BB1D2984D12" type="personal">
<mods:role id="0A58C9926509C4E13A54848CA6EF4778"> <mods:role id="55928510E4BABA26368949792B0D4D2D">
<mods:roleTerm id="0500DA54C386518C6AD2D72E3D3376CF">Author</mods:roleTerm> <mods:roleTerm id="8E21C2051705DDA111ED5E16ABE649E7">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="0BF79A83F8850EFFCF890741991A63D3">Skidmore, Luke I.</mods:namePart> <mods:namePart id="95967CE46764F7A95BFC176355882DFA">Skidmore, Luke I.</mods:namePart>
</mods:name> </mods:name>
<mods:name id="4048ED388A4AFADB9ADEECAA958E60F3" type="personal"> <mods:name id="790EDB415E1B1608EBF57B2731B2F973" type="personal">
<mods:role id="F09B8332B7D2ED7A9AB56998480BFBEC"> <mods:role id="F1150FD7A92A761FB63E86BCE5347687">
<mods:roleTerm id="12565154E43AF9743AD6CECC217DDBB0">Author</mods:roleTerm> <mods:roleTerm id="D4647FF651A92F6FE8D64576C3069901">Author</mods:roleTerm>
</mods:role> </mods:role>
<mods:namePart id="3A2FBEB4BF258C2F29902A27677613F8">Stilwell, Jeffrey D.</mods:namePart> <mods:namePart id="3EF6F125E9107D5D8AB88F4811167A9F">Stilwell, Jeffrey D.</mods:namePart>
</mods:name> </mods:name>
<mods:typeOfResource id="9232C9A599B5C948C2440405A3F70262">text</mods:typeOfResource> <mods:typeOfResource id="467F569ECA532DAFDBC09F7920661EED">text</mods:typeOfResource>
<mods:relatedItem id="50611F77FED950D37AA450338529A33D" type="host"> <mods:relatedItem id="8852688E501B355B19D2294FB3592971" type="host">
<mods:titleInfo id="9E7B26D3F4FCDEAF90CF5FA4A9AE2E6E"> <mods:titleInfo id="7829C9310E8731B25F548F11EE41793E">
<mods:title id="B8A248EC4659F77B2198701D0184B702">Zootaxa</mods:title> <mods:title id="1A841E2EB441A80C064365CEB7922D32">Zootaxa</mods:title>
</mods:titleInfo> </mods:titleInfo>
<mods:part id="45CA59FACC8E25E39F940F84BE947A55"> <mods:part id="C0782ED733D22A685A6B7EAFFE43EC87">
<mods:date id="9241DDAB0326214B5CD4E8924B5D85F6">2016</mods:date> <mods:date id="6E23CA333B7323B86C9044DBD6516F77">2016</mods:date>
<mods:detail id="61B708791431951E7A52B70261655D9E" type="volume"> <mods:detail id="D02BF1EACED8F2C487905D28BC662C0C" type="volume">
<mods:number id="8390CB2629282640197A1189245C54EA">4137</mods:number> <mods:number id="07F389800BB126DB1FC51B229B08BB68">4137</mods:number>
</mods:detail> </mods:detail>
<mods:detail id="316AE9BD09B7C25E1D6970361A1562AB" type="issue"> <mods:detail id="21719374BED125BE14368D225CED0429" type="issue">
<mods:number id="85221BD8F9223B2D22AD55F7F2C94DFA">1</mods:number> <mods:number id="B8CBD832753F3E84C05E9785F14676A0">1</mods:number>
</mods:detail> </mods:detail>
<mods:extent id="00C37817526CADC995B3CC6F583F376E" unit="page"> <mods:extent id="312CACF721A63152AC97D52EA823B002" unit="page">
<mods:start id="3820F8FA9A633CC9F932715165D4AB12">95</mods:start> <mods:start id="E170730143E1803AA267B9ECB644A9E0">95</mods:start>
<mods:end id="2918BD939E4431B67F2C2CF2FE7F9A07">107</mods:end> <mods:end id="C6A151B2BD98718B894FC17E80F5336F">107</mods:end>
</mods:extent> </mods:extent>
</mods:part> </mods:part>
</mods:relatedItem> </mods:relatedItem>
<mods:classification id="B4ADC4BEBCA4B0F4106549CBF146D4E2">journal article</mods:classification> <mods:classification id="9F5FA0902431886AB7CD4C2A0BCBD281">journal article</mods:classification>
<mods:identifier id="F88345D3A5B4C95EBF6A0D04BFC3E242" type="DOI">10.11646/zootaxa.4137.1.7</mods:identifier> <mods:identifier id="CEA370346D835C8B53AA284683605234" type="CLB-Dataset">38613</mods:identifier>
<mods:identifier id="FD60760AB727CF106D7A2063E5B05727" type="GBIF-Dataset">f88ca779-0496-4982-95e8-826d29bbc163</mods:identifier> <mods:identifier id="078FA39A4A0D264EF3E2AE12696835AD" type="DOI">10.11646/zootaxa.4137.1.7</mods:identifier>
<mods:identifier id="4CC67DF197449F2C18F31629B39528FA" type="ISSN">1175-5326</mods:identifier> <mods:identifier id="8F2815655CB008A1F59EC1C057B1FD78" type="GBIF-Dataset">f88ca779-0496-4982-95e8-826d29bbc163</mods:identifier>
<mods:identifier id="84CF9EBFD9F7A08BE61C0FAA2A0DCB66" type="Zenodo-Dep">255201</mods:identifier> <mods:identifier id="D42A5706C5131E67DD1D05A5A8F8AE53" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="EEC30B5F49D313B4746117BCC64D4E5E" type="ZooBank">EA49068A-884D-4B79-AF5F-82910028EE23</mods:identifier> <mods:identifier id="3862B1E41F419555AA8704CC97995082" type="Zenodo-Dep">255201</mods:identifier>
<mods:identifier id="2A3334DD302FAC69420324748B882EEF" type="ZooBank">EA49068A-884D-4B79-AF5F-82910028EE23</mods:identifier>
</mods:mods> </mods:mods>
<treatment id="EA0487FAFFDFFFCFEA912C3B280D27EF" ID-DOI="http://doi.org/10.5281/zenodo.6079581" ID-GBIF-Taxon="121546083" ID-Zenodo-Dep="6079581" LSID="urn:lsid:plazi:treatment:EA0487FAFFDFFFCFEA912C3B280D27EF" httpUri="http://treatment.plazi.org/id/EA0487FAFFDFFFCFEA912C3B280D27EF" lastPageNumber="98" pageId="3" pageNumber="98"> <treatment id="EA0487FAFFDFFFCFEA912C3B280D27EF" ID-DOI="http://doi.org/10.5281/zenodo.6079581" ID-GBIF-Taxon="121546083" ID-Zenodo-Dep="6079581" LSID="urn:lsid:plazi:treatment:EA0487FAFFDFFFCFEA912C3B280D27EF" httpUri="http://treatment.plazi.org/id/EA0487FAFFDFFFCFEA912C3B280D27EF" lastPageNumber="98" pageId="3" pageNumber="98" scope_infraOrder="Aphidomorpha" scope_order="Hemiptera">
<subSubSection id="2AB76567FFDFFFCFEA912C3B2F052073" box="[151,542,798,824]" pageId="3" pageNumber="98" type="nomenclature"> <subSubSection id="2AB76567FFDFFFCFEA912C3B2F052073" box="[151,542,798,824]" pageId="3" pageNumber="98" type="nomenclature">
<paragraph id="621236ECFFDFFFCFEA912C3B2F052073" blockId="3.[151,542,798,824]" box="[151,542,798,824]" pageId="3" pageNumber="98"> <paragraph id="621236ECFFDFFFCFEA912C3B2F052073" blockId="3.[151,542,798,824]" box="[151,542,798,824]" pageId="3" pageNumber="98">
<heading id="395A8180FFDFFFCFEA912C3B2F052073" bold="true" box="[151,542,798,824]" fontSize="11" level="1" pageId="3" pageNumber="98" reason="1"> <heading id="395A8180FFDFFFCFEA912C3B2F052073" bold="true" box="[151,542,798,824]" fontSize="11" level="1" pageId="3" pageNumber="98" reason="1">
<emphasis id="50D9EAFEFFDFFFCFEA912C3B2F052073" bold="true" box="[151,542,798,824]" pageId="3" pageNumber="98"> <emphasis id="50D9EAFEFFDFFFCFEA912C3B2F052073" bold="true" box="[151,542,798,824]" pageId="3" pageNumber="98">
Genus Genus
<taxonomicName id="A5AD4D6FFFDFFFCFEAE82C3B2CB12073" box="[238,426,798,824]" class="Insecta" family="Hydrophilidae" genus="Koonwarraphis" kingdom="Animalia" order="Coleoptera" pageId="3" pageNumber="98" phylum="Arthropoda" rank="genus" status="gen. nov."> <taxonomicName id="A5AD4D6FFFDFFFCFEAE82C3B2CB12073" ID-CoL="8NT7C" box="[238,426,798,824]" class="Insecta" genus="Koonwarraphis" kingdom="Animalia" order="Hemiptera" pageId="3" pageNumber="98" phylum="Arthropoda" rank="genus" status="gen. nov.">
<emphasis id="50D9EAFEFFDFFFCFEAE82C3B2CB12073" bold="true" box="[238,426,798,824]" italics="true" pageId="3" pageNumber="98">Koonwarraphis</emphasis> <emphasis id="50D9EAFEFFDFFFCFEAE82C3B2CB12073" bold="true" box="[238,426,798,824]" italics="true" pageId="3" pageNumber="98">Koonwarraphis</emphasis>
</taxonomicName> </taxonomicName>
<taxonomicNameLabel id="4BEA5785FFDFFFCFEBB62C3B2F052073" box="[432,542,798,824]" pageId="3" pageNumber="98" rank="genus">gen. nov.</taxonomicNameLabel> <taxonomicNameLabel id="4BEA5785FFDFFFCFEBB62C3B2F052073" box="[432,542,798,824]" pageId="3" pageNumber="98" rank="genus">gen. nov.</taxonomicNameLabel>
@ -65,7 +66,7 @@ Genus
<paragraph id="621236ECFFDFFFCFEA912C4329282030" blockId="3.[151,1075,869,891]" box="[151,1075,869,891]" pageId="3" pageNumber="98"> <paragraph id="621236ECFFDFFFCFEA912C4329282030" blockId="3.[151,1075,869,891]" box="[151,1075,869,891]" pageId="3" pageNumber="98">
<typeStatus id="BD16884EFFDFFFCFEA912C432DD22030" box="[151,201,870,891]" pageId="3" pageNumber="98">Type</typeStatus> <typeStatus id="BD16884EFFDFFFCFEA912C432DD22030" box="[151,201,870,891]" pageId="3" pageNumber="98">Type</typeStatus>
species. species.
<taxonomicName id="A5AD4D6FFFDFFFCFEB232C402F562030" box="[293,589,869,891]" class="Insecta" family="Hydrophilidae" genus="Koonwarraphis" kingdom="Animalia" order="Coleoptera" pageId="3" pageNumber="98" phylum="Arthropoda" rank="species" species="rotundafrons" status="sp. nov."> <taxonomicName id="A5AD4D6FFFDFFFCFEB232C402F562030" box="[293,589,869,891]" class="Insecta" genus="Koonwarraphis" kingdom="Animalia" order="Hemiptera" pageId="3" pageNumber="98" phylum="Arthropoda" rank="species" species="rotundafrons" status="sp. nov.">
<emphasis id="50D9EAFEFFDFFFCFEB232C402F562030" box="[293,589,869,891]" italics="true" pageId="3" pageNumber="98">Koonwarraphis rotundafrons</emphasis> <emphasis id="50D9EAFEFFDFFFCFEB232C402F562030" box="[293,589,869,891]" italics="true" pageId="3" pageNumber="98">Koonwarraphis rotundafrons</emphasis>
</taxonomicName> </taxonomicName>
<emphasis id="50D9EAFEFFDFFFCFE8552C402FB82031" bold="true" box="[595,675,869,890]" pageId="3" pageNumber="98"> <emphasis id="50D9EAFEFFDFFFCFE8552C402FB82031" bold="true" box="[595,675,869,890]" pageId="3" pageNumber="98">