diff --git a/data/03/9A/67/039A6736915AFFA8FC8DF8DBFBC491C5.xml b/data/03/9A/67/039A6736915AFFA8FC8DF8DBFBC491C5.xml new file mode 100644 index 00000000000..4f40030f884 --- /dev/null +++ b/data/03/9A/67/039A6736915AFFA8FC8DF8DBFBC491C5.xml @@ -0,0 +1,357 @@ + + + +Anatomical and genetic data reveal that Rivularia Heude, 1890 belongs to Viviparinae (Gastropoda: Viviparidae) + + + +Author + +Bocxlaer, Bert Van + + + +Author + +Strong, Ellen E. + + + +Author + +Richter, Romy + + + +Author + +Stelbrink, Björn + + + +Author + +Rintelen, Thomas Von + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +1 +23 + + + +journal article +0024-4082 + + + + + + + +RIVULARIA +AURICULATA + +( +VON +MARTENS +, 1875) + + + + + + + + + +Paludina (Melantho) auriculata +von Martens, 1875a: 2 + + +; + +1875b: 186 + + + + + +Table 1. +Specimens of + +Rivularia auriculata + +examined in anatomical studies (all individuals belong to variety ‘a’ of +von Martens, 1875b +) + + +Organ system Specimens examined + + +Gross morphology All specimens (116176-1M, 116176-2M, 116176-3F, 116176-4M, 116176-5M, 116176-6F, 116176-7F, 116176-8M, 116176- 9M, 116176-10M, 116176-11M, 192196-1F, 192196-2M, 192196-3F, 192196-4F [BVB, ES, RR]) +Operculum 116176-3 (RR); 116176-1 (BVB); 116176-6 (BVB); 116176-10 (BVB) +Pallial organs (general) 116176-3 (RR); 116176-4 (RR); 116176-7 (BVB, RR); 116176-10 (BVB) +Respiratory system 116176-3 (gill, osphradium [RR]); 116176-4 (gill [BVB]); 116176-5 (gill, gill leaflet [ES]); 116176-7 (gill and osphradium [BVB]); 116176-8 (gill and osphradium [BVB]); 116176-10 (pallial circulatory system; gill leaflet [BVB]) +Alimentary system 116176-1 (radula [BVB, RR]); 116176-2 (gastric chamber, radula [BVB, RR]; gross morphology visceral alimentary organs [BVB]); 116176-3 (buccal apparatus, exterior and interior, digestive gland, gastric chamber [RR]; style sac, intestine [ES]); 116176-4 (buccal apparatus, exterior and interior, gastric chamber [BVB, RR]; buccal muscles, salivary ducts, radula sac, rectum [BVB]); 116176-5 (gastric chamber, radula [BVB, RR]); 116176-7 (buccal apparatus, exterior and interior [ES, RR]; gastric chamber [RR]; salivary glands [ES]; food groove [BVB]); 116176-8 (general alimentary gross morphology, food groove, buccal apparatus, buccal glands, mid-oesophagus, oesophagus, salivary glands, rectum [BVB]); 116176-10 (digestive gland, gastric chamber [BVB]); 116176-11 (gastric chamber [ES]); 192196-1 (radula [BVB, RR]); 192196-2 (buccal apparatus [RR]; radula [BVB, RR]) +Reno-pericardial system 116176-1 (pericardium, rectal blood sinus, kidney, pores, kidney-ureter connection, heart [BVB]); 116176-3 (pericardium [RR]); 116176-5 (kidney, heart [RR]); 116176-7 (pericardium [RR]; kidney [BVB, RR]; ureter, kidney-ureter connection [BVB]); 116176-8 (pericardium, heart, ureter, kidney [BVB]); 116176-10 (pericardium, heart, kidney, circulatory system of the reno-pericardial system, ureter [BVB]) + +Nervous system +116176-4 (nerve ring [BVB, RR]); 116176-7 (nerve ring [ES, RR]; supra- and sub-oesophageal ganglia, visceral ganglion [ES]); 116176-8 (nerve ring and its position compared to the buccal apparatus, buccal ganglia, pedal +nervous system +; supra- and sub-oesophageal ganglea, statocysts [BVB]) + +Male reproductive system 116176-1 (testis, visceral vas deferens [BVB]); 116176-2 (penis, prostate [RR]); 116176-4 (penis, prostate, pallial vas deferens, testis [BVB, RR]); 116176-5 (general male reproductive anatomy, penis, prostate, proximal pallial vas deferens, testis, visceral vas deferens [RR]); 116176-8 (all pallial reproductive organs [BVB]); 116176-10 (testis [BVB]); 192196-2 (proximal pallial vas deferens, testis, visceral vas deferens [BVB]) +Female reproductive system 116176-3 (general female reproductive anatomy [RR, BVB]; juvenile [RR]); 116176-7 (brood pouch, capsule gland, albumen gland, seminal receptacle, renal oviduct [BVB, ES, RR]; visceral oviduct, ovary [BVB, ES]; juvenile [BVB]) 192196-1 (brood pouch, capsule gland, albumen gland, seminal receptacle, renal oviduct, visceral oviduct [BVB]) +Most organ systems were subjected to comparative studies in males and females. Individuals are identified by extending the six digit ZMB museum numbers with unique specimen numbers. On the first row (gross morphology) ‘M’ or ‘F’ indicates the sex of each specimen. The investigating author(s) for each organ system are indicated by their initials. + + +Table 2. +Primers and PCR conditions used in the present study + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
GenePrimer name Nucleotide sequence (5′–3′)Source
+COI +LCO1490 GGTCAACAAATCATAAGATATTGG + +Folmer +et al. +(1994) + +
HCO2198var TAWACTTCTGGGTGKCCAAARAAT + +von Rintelen +et al. +(2004) + +
+28S +28S-Fmod ACCCGCTGAATTTAAGCATAT +Modified from +Littlewood (1994) +
28S-Rmod GCTATCCTGACGGAAACTTCThis study
+H3 +H3F ATGGCTCGTACCAAGCAGACVGC +Colgan, Ponder & Eggler (2000) +
H3R ATATCCTTRGGCATRATRGTGAC + +Colgan +et al. +(2000) + +
FragmentPCR conditions
+COI +Initial D: 3 min, 94 °C; 35 cycles with D: 30 s, 94 °C; A: 60 s, 40/45 °C; E: 90 s, 72 °C; final E: 5 min.
+28S +Initial D: 3 min, 94 °C; 35 cycles with D: 30 s, 94 °C; A: 60 s, 60-52 °C (–1 °C/cycle); E: 120 s, 72 °C; final
E: 5 min.
+H3 +Initial D: 3 min, 94 °C; 40 cycles with D: 30 s, 94 °C; A: 60 s, 50 °C; E: 60 s, 72 °C; final E: 5 min.
+ +Abbreviations for PCR conditions: D = denaturation, A = amplification, E = elongation. + + +Paludina auriculata +(Melantho) + +– +von Martens, 1870 +– 1876: 155, pl. 135, figs 4–6. + + + + + + +Rivularia auricularis + +– + +Heude, 1890: 178 + +, pl. 40, figs 16 & 16a. + + + + + +Rivularia auriculata + +– + +Kobelt, 1909: 178 + +, pl. 35, figs 1–7; 12–16. + + + + + +Type material + + +Lectotype +ZMB 31048c, here designated ( +Fig. 2A +); +14 paralectotypes +ZMB 31048a, b ( +Fig. 2D +). + + +Type locality + + +Siangkiang [Xiang] River, +Hunan +, +China +. + + +Remarks +von Martens (1875a) +did not report where the type material had been deposited in the original description; however, ZMB 31048 was part of von Martens’ collection, was collected by von Richthofen, the collector of the type material and is from the reported type locality. Furthermore, it was split into ZMB 31048a and b, which correspond to the two varieties into which +von Martens (1875b: 186) +subdivided the species. These lots also contain specimens that seem to have been used for the first illustrations of the species [ +von Martens (1870 +–1876: pl. 135, figs 4–6); +Heude (1890 +: pl. 40, figs 16, 16a) and reproduced by +Kobelt (1909 +: pl. 35, fig. 1)]. Furthermore, the measurements reported by von Martens for +two specimens +match individuals from lot ZMB 31048a and b. Therefore, the largest specimen reported by von Martens is designated as the +lectotype +(from variety a; +Fig. 2A +) and is numbered ZMB 31048c. ZMB 31048a and b contain 14 additional specimens which then become +paralectotypes +( +ZMB +31048a, b; +Fig. 2D +). + + +As mentioned von Martens subdivided + +R. auriculata + +into two varieties: variety a with obsolete spiral sculpture and variety b with distinct spiral sculpture. Under Art. 72.4.1 of the +Code +, reference to distinct varieties could exclude specimens from the type series of a new nominal taxon. As all the specimens known to von Martens at the time were attributed to one of the two varieties, with no nominotypical form, the type series of + +R. auriculata + +comprises all the material mentioned and, hence, is eligible for +lectotype +designation. The +lectotype +and +paralectotype +illustrated here span the morphological variation of the sample (see Shell morphology). Further variations have been described in the literature, as forms ( +Smith, 1900 +), or subspecies ( +Kobelt, 1909 +). A number of additional species have also been assigned to + +Rivularia + +( +Heude, 1890 +; +Kobelt, 1909 +). + + +Because of its characteristic shell morphology, + +Rivularia + +is a relatively well-defined genus ( +Heude, 1890 +) that has been maintained as distinct by most authors ( +Heude, 1890 +; +Yen, 1943 +), although assignments to + +Vivipara + +, + +Paludina + +and other taxa were commonplace in the early literature ( +Bachmann & Gredler, 1894 +; +Smith, 1900 +). + + + + \ No newline at end of file diff --git a/data/03/9A/67/039A6736915AFFAEFC79F9BFFA8892D1.xml b/data/03/9A/67/039A6736915AFFAEFC79F9BFFA8892D1.xml new file mode 100644 index 00000000000..9ecf6f28fe9 --- /dev/null +++ b/data/03/9A/67/039A6736915AFFAEFC79F9BFFA8892D1.xml @@ -0,0 +1,88 @@ + + + +Anatomical and genetic data reveal that Rivularia Heude, 1890 belongs to Viviparinae (Gastropoda: Viviparidae) + + + +Author + +Bocxlaer, Bert Van + + + +Author + +Strong, Ellen E. + + + +Author + +Richter, Romy + + + +Author + +Stelbrink, Björn + + + +Author + +Rintelen, Thomas Von + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +1 +23 + + + +journal article +0024-4082 + + + + + +GENUS + + +RIVULARIA + + +HEUDE +, 1890 + + + + + + + + +Type +species: + + +Paludina auriculata +von Martens, 1875 + +, by subsequent designation ( +Crosse, 1891 +). + + + + \ No newline at end of file diff --git a/data/03/AD/29/03AD2972A941FFF7FC010FA9F6E7B18E.xml b/data/03/AD/29/03AD2972A941FFF7FC010FA9F6E7B18E.xml new file mode 100644 index 00000000000..2f663199a72 --- /dev/null +++ b/data/03/AD/29/03AD2972A941FFF7FC010FA9F6E7B18E.xml @@ -0,0 +1,392 @@ + + + +Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae) + + + +Author + +Riva, Ignacio De La + + + +Author + +Chaparro, Juan C. + + + +Author + +Castroviejo-Fisher, Santiago + + + +Author + +Padial, José M. + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +129 +172 + + + +journal article +0024-4082 +B2DCFB0-BF1A-47A1-911C-726876890892 + + + + + + +MICROKAYLA +CHILINA + + + +SP +. +NOV +. + + + + + + + +( + +FIG +. 13 + +) + + +u r n: l s i d: z o o b a n k. org:act: +95C71601-FCC2-46A9-9A9B-6E7DDEB9B340 + + + + +Holotype + +: +MUBI 5355 +(field number 4580), adult male from the joint of rivers +Sayaco +and +Huacuyo +, province +Sandia +, department +Puno +, +Peru +, + +14°26 +′ +42.2 +″ +S + +, + +69°34 +′ +11.5 +″ +W + +, + +3792 m + +( +Fig. 10 +), collected on + +14 February 2006 + +by + +I. +De la Riva + +, +J. M. Padial +, +S. Castroviejo-Fisher +, +J. C. Chaparro +and +J. Bosch. + + + + + +Paratopotypes + +: +MUBI 5352 +(field number 4573) (male) + +; + +MUBI 5350-51 +, +5353 +(field numbers 4569, 4572, 4574) and + + +MNCN 43770–75 +(field numbers 4570, 4571, 4575, 4577, 4578, 4579) (females) + +; + +MUBI 5354 +(field number 4576) (juvenile), same data as the holotype + +. + + +Diagnosis +: + +Microkayla chilina + +is characterized by: (1) skin on dorsum warty to coarsely warty (warts round, low, subconical to conical), with slightly larger warts on flanks; conspicuous and incomplete dorsolateral ridges; belly, throat, groin and chest coarsely areolate; (2) tympanic membrane and annulus not discernible beneath the skin, tympanic fold prominent; (3) snout short, rounded in dorsal and lateral views; (4) upper eyelid lacking tubercles, bearing conical warts, cranial crests absent; (5) dentigerous processes of vomers absent; (6) vocal slits present, vocal sac subgular, nuptial pads absent; (7) Finger I slightly shorter than Finger II, tips of digits rounded, lacking circumferential grooves and ungual flap; (8) fingers lacking lateral fringes; (9) ulnar region bearing warts, sometimes coalescing in an irregular ridge; (10) heel lacking tubercles; tarsus warty, lacking tubercles and folds; (11) two metatarsal tubercles, inner slightly larger than outer; supernumerary plantar tubercles low, numerous; (12) toes markedly short, lacking lateral fringes; webbing absent; Toe III longer than V, tips of digits rounded, lacking circumferential grooves and ungual flap; (13) dorsal coloration from reddish-brown to dark brown or black, sometimes with scattered yellow irregular blotches; ventral coloration dark grey to black with greyish-white and orange irregular blotches; groin, axillae, shanks and distal portions of hands and feet with orange flash marks; (14) females larger than males, SVL +25.5 in +an adult female, +23.2–24.3 mm +in adult males ( +n += 4) ( +Table 3 +). + + + +Figure 12. +Oscillogram and sound spectrogram of the advertisement call of + + +Microkayla chapi + +sp. nov. + +(MNCN 43764), recorded on 10 February 2006 at Hirigache river valley, Sina, Puno, Peru. Air temperature, 10 °C. + + + + +Table 4. +Numerical parameters of the advertisement calls of two Peruvian species of +Microkayla + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
Sample size (specimens, calls)Call/minNote duration (ms)Dominant frequency (Hz)Change in intensity (Hz)°C Air (substrate)SVLVouchers
+ +M. boettgeri + +5, 278.3–21.6 (13.4)102–145 (120.4)2659–3043 (2793)0–231 (44.7)8 (–)17.9–19.2One from the series MNCN 43776-8
+ +M. chapi + +5, 142.6–10.4 (6.8)72–91 (83.4)3086–3171 (3146)–10 (12)16.3–19.1One from the series MNCN 43763-9
+ + + +Figure 13. +Live specimens of + + +Microkayla chilina + +sp. nov. + +from the confluence of rivers Sayaco and Huacuyo, Sandia, Peru. (A) Adult female (MUBI 5351; SVL 24.3 mm); (B) Adult male holotype (MUBI 5355, SVL 24.3 mm). (C–D) Adult male (MNCN 43775, SVL 23.6 mm) from the type locality. + + + +The sister and geographically closest species to + +M. chilina + +is + +M. boettgeri +( +Lehr, 2006 +) + +( +type +localities separated by +36.6 km +straight line distance). + +Microkayla boettgeri + +possesses a protruding snout, a sharp ulnar ridge formed by small conical granules, and sharp and protruding eyelids. + +Microkayla chilina + +has a more slen- der body than + +M. boettgeri + +, which has globular body shape ( +Fig. 14 +). In + +M. chilina + +the tympanic membrane and annulus are not discernible, while they are in + +M. boettgeri + +, in which the tympanic membrane reaches +c +. 50% of eye length in diameter. Some differences are also evident in coloration. + +Microkayla chilina + +often has irregular yellowish-cream blotches on dorsum, which are not present in + +M. boettgeri + +; this species usually has some reddish-orange coloration on venter, digits, axillae, and groins, while in + +M. chilina + +these areas are yellowish-orange. To the east, + +M. chapi + +sp. nov. +is found at +33.7 km +(straight line) from the +type +locality of + +M. chilina + +and is sister to the clade formed by + +M. boettgeri + +and + +M. chilina + +. + +Microkayla chilina + +is readily distinguished from + +M. chapi + +by having incomplete dorsolateral ridges (sharp and well-developed dorsolateral folds in + +M. chapi + +), tympanic membrane and annulus not discernible beneath the skin (a large and conspicuous tympanic membrane), and shorter toes, more areolate belly, and warty skin (smooth to granular). + + + +Description of the +holotype + +: An adult male, +24.3 mm +SVL. Body robust; dorsal skin warty, with small irregular warts scattered all over; ventral skin areolate; dorsolateral folds present, incomplete, running from above ocular region to level of midbody, from where they continue as interrupted ridges of warts; two oblique and inconspicuous middorsal folds on central part of dorsum; pectoral fold absent; head wider than long, HW 33.7% of SVL, HL 32.9% of SVL; snout moderately short, rounded in dorsal view and in profile; nostrils not prominent, closer to snout than to eyes; canthus rostralis straight in dorsal view, concave in profile; eye–nostril distance 74.2% of eye length; loreal region concave; cranial crests absent; tympanic membrane and tympanic annulus not visible externally; supratympanic fold barely visible; tongue large, oval; choanae small, rounded, broadly separated; dentigerous process of vomers absent; vocal slits present; a subgular vocal sac; ulnar tubercle and fold absent (a ridge formed by connected warts); inner palmar tubercle nearly oval, slightly smaller than round outer; no nuptial pads; fingers moderately short, not fringed, lacking circumferential grooves and ungual flap; subarticular tubercles round, bulky; supernumerary tubercles round, of variable sizes; first finger approximately equal or slightly shorter than second, relative length of fingers 1 ≤ 2 = 4 <3; limbs short; tibia length 30.0% of SVL; tarsal fold absent; two metatarsal tubercles, oval inner slightly larger than round outer; supernumerary and subarticular tubercles low, irregular; toes lacking basal webbing or lateral fringes, toe tips round, lacking circumferential grooves and ungual flap; relative length of toes 1 <2 <3 = 5 <4; foot length 37.4% of SVL. + + + +Figure 14. +Live specimens of + +Microkayla boettgeri + +from the type locality, Phara, Puno, Peru. (A–B) Adult male (MNCN 43778, SVL 18.6 mm); (C–D) Adult male (MNCN 43776, SVL 19.0 mm). + + +In preservative, dorsal surfaces uniformly grey, venter and throat brownish-grey with an irregular beige area in central part of venter; palmar and plantar surfaces and inner surface of forelimbs mostly brown, digits pale cream. In life, the dorsum was mostly uniformly brown above; there were small orange irregular blotches on axillae and groins; the venter was greyish-brown with an irregular dirty-yellow pattern; the digits were yellowish-orange; the iris was dark brown. + + +Measurements (in mm) of the +holotype + +: SVL, 24.3; HL, 8.0; HW, 8.2; IND, 2.4; END, 2.3; ED, 3.1; TL, 7.3; FL, 9.1. + + +Variation +: All specimens are nearly identical in skin texture and overall colour pattern. MNCN 43773, 43774, and, especially, 43775, have some small, irregular pale grey blotches on dorsum (dirty-yellowish in life); a dark brown spot can be present on the anterior surface of the forearm (e.g. MUBI 5351, MNCN 43771) and/or the inner surface of the shank (MNCN 43772). Males are small and lack vocal slits, external vocal sac and nuptial excrescences. + + +Distribution and natural history +: Known only from the +type +locality. Individuals were found during the day under stones in open wet puna. They were not common; almost two hours of collecting by five persons yielded only +12 specimens +. + + +Etymology +: The species epithet is used as a name in apposition, and derives from the Quechua word ‘chilina’, meaning the colour of a ripe orange (reddishyellow), and refers to the spots of this colour present in this new species. + + + + \ No newline at end of file diff --git a/data/03/AD/29/03AD2972A945FFF9FC7C0A0BF143B688.xml b/data/03/AD/29/03AD2972A945FFF9FC7C0A0BF143B688.xml new file mode 100644 index 00000000000..0534d0ad7dc --- /dev/null +++ b/data/03/AD/29/03AD2972A945FFF9FC7C0A0BF143B688.xml @@ -0,0 +1,548 @@ + + + +Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae) + + + +Author + +Riva, Ignacio De La + + + +Author + +Chaparro, Juan C. + + + +Author + +Castroviejo-Fisher, Santiago + + + +Author + +Padial, José M. + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +129 +172 + + + +journal article +0024-4082 +B2DCFB0-BF1A-47A1-911C-726876890892 + + + + + + +MICROKAYLA +CHAPI + + + +SP +. +NOV +. + + + + + + + +( + +FIG +. 9 + +) + + + +urn:lsid:zoobank.org:act: +A11DB6F2-E959-4570-A369- 00A7D64C8E13 + + + + + +Holotype + +: +MUBI 5326 +(field number 4516), adult female from +3.7 km +from +Sina, Hirigache River +valley, province +Sandia +, department +Puno +, +Peru +, + +14°30 +′ +09.7 +″ +S + +, + +69°15 +′ +44.3 +″ +W + +, + +3504 m + +( +Fig. 10 +), collected on + +10 February 2006 + +by + +I. +De la Riva + +, +J. M. Padial +, +S. Castroviejo-Fisher +, +J. C. Chaparro +, and +J. Bosch. + + + + + +Paratopotypes + +: +MUBI 5325 +, +5327 +, +5330 +, +5331 +(field numbers 4514, 4519, 4524, 4527) + +, + +MNCN 43763–65 +and 43767–69 (males) (field numbers 4515, 4517, 4518, 4522, 4525, 4526) + +; + +MNCN 43762 +and 43766 (field numbers 5183 and 5191) (females); and + + +MUBI 5328 +, +5329 +(field numbers 4520, 4523) (juveniles), same data as the holotype + +. + + +Diagnosis +: + +Microkayla chapi + +is characterized by: (1) skin on dorsum shagreen with large scattered sharp warts and short folds, sometimes coalescing into a pair of dorsolateral folds and/or incomplete middorsal and occipital folds; dorsal surface of extremities warty; flanks uniformly warty; ventral skin areolate, throat areolate; (2) tympanic membrane and tympanic annulus evident beneath the skin, supratympanic fold conspicuous; (3) snout short, rounded in dorsal and lateral views; (4) upper eyelid lacking tubercles, bearing small conical warts; (5) dentigerous process of vomers absent; (6) vocal slits and sac present, subgular; nuptial pads absent; (7) Finger I slightly shorter than Finger II; tips of digits rounded, lacking circumferential grooves and ungual flap; (8) fingers lacking lateral fringes; (9) ulnar region bearing warts, sometimes coalescing into a sharp ridge; (10) heel lacking tubercles, tarsus lacking tubercles and folds; (11) plantar surfaces of feet bearing two metatarsal tubercles, inner slightly larger than outer; supernumerary plantar tubercles low, inconspicuous; (12) toes lacking lateral fringes; webbing absent; Toe III slightly longer than V, tips of digits rounded, lacking circumferential grooves and ungual flap; (13) dorsal coloration with various shades of reddish-brown to dark brown or grey with metallic tones; ventral coloration variable, from grey with shades of red to dark grey with yellow spots; distal portions of hands and feet orange to red; groin with orange or red flash marks; (14) females slightly larger than males, SVL +19.9–21.6 in +adult females ( +n += 3), +16.3–19.1 mm +in adult males ( +n += 9) ( +Table 3 +). + + + +Figure 9. +Live specimens of + + +Microkayla chapi + +sp. nov. + +from the type locality in Sina, Peru. (A–B) Adult female holotype (MUBI 5326, SVL 19.9 mm). (C–D) Adult male (MNCN 43767, SVL 17.3 mm). + + + + +Microkayla chapi + +sp. nov. +is readily distinguished from both + +M. boettgeri + +and + +M. chilina + +sp. nov. +(the two other Peruvian species) by having sharp and well-developed dorsolateral folds, occipital and sacral sharp warts and folds, a large and conspicuous tympanic membrane that is longer than 50% of eye length, and longer toes, less areolate belly, and smooth to granular skin. On the Bolivian side of the Cordillera of Apolobamba, the species + +M. chaupi + +and + +M. katantika + +occur 37.6 and +39.8 km +straight line distance, respectively, from + +M. chapi + +. + +Microkayla chapi + +differs from + +M. chaupi + +mostly by having conspicuous dorsolateral folds (absent in + +P. chaupi + +), ventral coloration variable from grey with shades of red to dark grey with yellow spots (uniformly greyish-brown) and ventral skin areolate (finely granular). + +Microkayla chapi + +differs from + +M. katantika + +by being smaller (maximum SVL in + +M. chapi + +21.6 mm +, +27.7 mm +in + +M. katantika + +), having dorsolateral folds (absent) and dorsal and ventral coloration variable (uniformly dark brown or grey). In addition, + +M. chapi + +can be distinguished from all other species of + +Microkayla + +by its sharp dorsal ridges and warts, a conspicuous tympanic membrane, and red flash marks in the groin. + + + +Description of the +holotype + +: An adult female, +19.9 mm +SVL. Body robust; dorsal skin shagreen, with irregular warts scattered all over, and a pair of dorsolateral folds becoming inconspicuous ridges at level of midbody; ventral skin areolate pectoral fold absent; head wider than long, HW 34.7% of SVL, HL 31.1% of SVL; snout moderately short, rounded in dorsal view and in profile; nostrils not prominent, slightly closer to snout than to eyes; canthus rostralis sharp, straight in dorsal view and lateral profile; eye-nostril distance 58.3% of eye length; loreal region faintly concave; cranial crests absent; tympanic membrane and tympanic annulus perceptible beneath skin; supratympanic fold prominent; tongue large, oval; choanae small, broadly separated; dentigerous processes of vomers absent; limbs short; fingers short, lacking fringes, tips of digits round, lacking circumferential grooves and ungual flap; ulnar tubercle and fold absent, but a row of low warts forming a ridge; inner palmar tubercle oval, smaller than round outer; fingers moderately short, not fringed; subarticular tubercles of the base of fingers large, round, swollen; supernumerary tubercles round, barely visible; relative length of fingers 1 <2 <4 <3; tibia length 30.1% of SVL; tarsal fold absent; two metatarsal tubercles, oval inner slightly smaller than round outer; supernumerary tubercles round, poorly marked; subarticular tubercles round; toes lacking basal webbing or lateral fringes, toe tips round, lacking circumferential groves and ungual flap; relative length of toes 1 <2 <3 = 5 <4; foot length 36.2% of SVL. + + + +Figure 10. +Map of south-eastern Peru and central Bolivia showing the distribution (type localities only) of the three nominal species of + +Psychrophrynella + +(squares), and 24 nominal and four unnamed species of + + +Microkayla + +gen. nov. + +(circles). + +Psychrophrynella + +: (1) + +P. usurpator + +; (2) + +P. chirihampatu + +; (3) + +P. bagrecito +. +Microkayla + +: (1) + +M. boettgeri + +; (2) + + +M. chilina + +sp. nov. + +; (3) + + +M. chapi + +sp. nov. + +; (4) + +M. katantika + +; (5) + +M. chaupi + +; (6) + +M. colla + +; (7) + +M. melanocheira + +; (8) + +M. kallawaya + +; (9) + +M. guillei + +; (10) + +M. saltator + +; (11) + +M. iani + +; (12) + +M. illampu + +; (13) + +M. ankohuma + +; (14) + +M. condoriri + +; (15) + +M. teqta + +; (16) +M. +sp. ‘Coscapa’; (17) + +M. chacaltaya + +; (18) + +M. +aff. +chacaltaya + +; (19) + +M. wettsteini + +; (20) + +M. illimani + +; (21) + +M. pinguis + +; (22) + +M. quimsacruzis + +; (23) +M. +sp. ‘Khatu River’; (24) + +M. harveyi + +; (25) + +M. iatamasi + +; (26) +M. +sp. ‘Utururo’; (27) + +M. adenopleura + +; (28) +M. kempffi +. + + +In preservative, dorsum brown with a pale middorsal thin line; venter and throat mostly cream with irregular brown areas; a pair of large and conspicuous bold black lumbar spots surrounded by a thin white line; a white thin line along posterior surface of thigh, from cloaca to level of shanks; axillae, groins and inner surface of forearms and shanks cream. In life, the dorsum was mostly uniformly brown above, with some pale areas; it had small reddish-orange irregular areas on axillae and groins; the venter was pale brown with irregular darker areas; the digits were reddish-orange; the iris was dark brown below and greenish-yellow in the upper third, with fine black reticulation. + + +Measurements (in mm) of the +holotype + +: SVL, 19.9; HL, 6.2; HW, 6.9; IND, 1.6; END, 1.4; ED, 2.4; TL, 6.0; FL, 7.2. + + +Variation +: + +The +holotype +has less warty dorsal skin, but +other specimens +have larger and sharper warts and short folds, sometimes forming short discontinuous dorsolateral or middorsal ridges ( +MUBI 5327 +, +5328 +) + +. + +The overall coloration is more or less similar in all specimens examined, while venter varies from almost uniformly cream ( +MUBI 5331 +) + + +to almost uniformly dark greenish-brown ( +MUBI 5325 +, +5330 +) + + +and all intermediate patterns; the throat varies from cream ( +MUBI 5329 +) + + +to brown ( +MUBI 5330 +) + +; + +the pale lines of the posterior surface of thighs can be absent ( +MUBI 5330 +) + +; + +some specimens have an inguinal dark spot ( +MNCN 43765 +, +43766 +) + +; + +the tympanic annulus can be appreciable beneath the skin ( +MUBI 5330 +) + + +or not ( +MUBI 5327 +) + +. For morphometric variation, see +Table 3 +. + + +Distribution and natural history +: Known only from the +type +locality. Individuals were found by day under stones, in highly humid wet puna/elfin forest, and were common in only a very small area ( +c. +3 has), but no individuals were found beyond that point, despite the same kind of habitat being found over a larger area ( +Fig. 11 +). At night, with mist and full moon and an air temperature of 10 °C, males called with low intensity from inside moss on the ground and on stones. The call consisted of a single non-pulsed note, modulated in amplitude, with most intensity distributed between 3000 and 3300 Hz, a duration of 72–91 ms, emitted at a rate of 2.6–10.4 notes/minute ( +Fig. 12 +, +Table 4 +) (call record number 8217, www.fonozoo.com). + + + +Figure 11. +Habitat at the type locality of + + +Microkayla chapi + +sp. nov. + +near +Sina, Hirigache River +valley, province Sandia, department Puno, Peru, 3504 m a.s.l. + + + +Etymology +: The species epithet is used as a name in apposition, and derives from the word ‘chapi’, meaning tin in Quechua, or ‘Ch +′ +api’, meaning thorn in Aymara. We use the two meanings of chapi to refer to the ‘thorns’ in the skin of the new species and to the tin roofs of the miner’s shacks in ‘La Rinconada’ ( +5100 m +), a gold mine and the highest village in the world, close to the +type +locality of this species. Chapi is also the name of a mountain ( +5400 m +) near La Rinconada, on the border of the districts of Ananea and Sina, in the cordillera of Apolobamba. + + + + \ No newline at end of file diff --git a/data/03/AD/29/03AD2972A94FFFF5FC2D08ABF7C2B60D.xml b/data/03/AD/29/03AD2972A94FFFF5FC2D08ABF7C2B60D.xml new file mode 100644 index 00000000000..5599c579f9c --- /dev/null +++ b/data/03/AD/29/03AD2972A94FFFF5FC2D08ABF7C2B60D.xml @@ -0,0 +1,197 @@ + + + +Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae) + + + +Author + +Riva, Ignacio De La + + + +Author + +Chaparro, Juan C. + + + +Author + +Castroviejo-Fisher, Santiago + + + +Author + +Padial, José M. + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +129 +172 + + + +journal article +0024-4082 +B2DCFB0-BF1A-47A1-911C-726876890892 + + + + + + + +MICROKAYLA +BOETTGERI + +( + +LEHR +, 2006 + +) + + + + + + +Remarks +: On +16 February 2006 +we sampled the wet puna around the village of Phara (district of Limbani, province Sandia, department +Puno +), and found a population of + +Microkayla + +that corresponds to what was originally named as + +Phrynopus boettgeri + +by +Lehr (2006) +based on specimens collected in 2004 by J. Boettger at the very same locality. Specimens were found under rocks during the day and calling at night from within moss on the ground or on stones. Among the specimens we collected (MUBI 5363-5, MNCN 43776-78; 14), some characters are observed that complement those described by +Lehr (2006) +, and we provide a brief description of those as well as of the undescribed advertisement call of this species. + + +Lehr (2006) +mentioned the lack of vocal sac and vocal slits, but male specimens collected by us do have a vocal sac and vocal slits. Also, several specimens possess a protruding, translucent callosity on the tip of the snout, that covers the anterior area of the snout and part of the upper lip. So far, in +Holoadeninae +, this structure has been only described in males of the Bolivian species + +M. teqta +( +De la Riva & Burrowes, 2014 +) + +. Those males were guarding egg clutches in subterranean chambers under stones; thus, the mentioned peculiar rostral morphology is probably a structure for digging ( +De la Riva & Burrowes, 2014 +). Also, we found colour variants lacking in those described by +Lehr (2006) +. +One specimen +(MNCN 43778; +Fig. 14A– B +) has a bright orange to bright red belly reticulated with black and metallic blue. The underside of thighs and shanks also posses metallic blue blotches. Orange and red flash marks also extend to the groin, axillae, and hands and feet. Another specimen (MNCN 43776; +Fig. 14C, D +), is mostly white ventrally, with bold black reticulations and spots, shades of bright orange to red in the posterior part of the belly, and a few blue blotches on the ventral sides of shanks and thighs. + + + +Figure 15. +Oscillogram and sound spectrogram of the advertisement call of + +Microkayla boettgeri + +(specimen nor collected), recorded on 16 February 2006 at Phara, Puno, Peru. Air temperature, 8 °C. + + + +We recorded the call of + +M. boettgeri + +at its +type +locality on +16 February 2006 +, at 19:40 h, at an air temperature of 8 °C. The call consists of a single non-pulsed note with duration of 102–145 ms, emitted at a rate of 8.3–21.6 notes/minute ( +Table 4 +; +Fig. 15 +) (call record numbers 8227–28, www.fonozoo.com). It is modulated in amplitude, with most intensity distributed between 2500 and 3000 Hz. There was a weak modulation in intensity (increasing to the end) in one of the specimens recorded. The difference in intensity reached 231 Hz from the beginning to the end of the call. The call of + +M. boettgeri + +differs from that of + +M. chapi + +by having a longer note with higher repetition rate and lower dominant frequency. + + +GENUS + + +PSYCHROPHRYNELLA + +HEDGES +, +DUELLMAN +, & +HEINICKE +, 2008 + +, +EMENDED + + +Included species +: + +Psychrophrynella bagrecito +( +Lynch, 1986 +) + +( +type +species), + +P. chirihampatu +Catenazzi & Ttito, 2016 + +, and + +P. usurpator +De la Riva, Chaparro & Padial, 2008 + +. + + +Diagnosis +: (1) head narrow, not as wide as body, extremities relatively long; (2) tympanic membrane and annulus differentiated (annulus and membrane visible beneath skin); (3) cranial crests absent; (4) prevomerine teeth, dentigerous process of vomers, and dentigerous ramus absent; pterygoid not in contact with parasphenoid; anterior parasphenoid ramus short, not reaching palatines; ear fully developed; (5) pectoral girdle anatomically arciferal but functionally firmisternal (halves of the epicoracoid cartilages fused); (6) nasal bones widely separated medially; (7) tongue long and narrow, much longer than wide; (8) tips of digits narrow and rounded, not expanded, lacking circumferential groves and pads; (9) terminal phalanges T-shaped to knobbed; phalangeal formulae of hands and feet 2-2-3-3 and 2-2-3-4-3, respectively; (10) Finger I equal to or slightly shorter than Finger II; (11) two subarticular tubercles on Finger IV; (12) Toe V slightly longer than Toe III; (13) lateral fringes and webbing absent on digits; (14) two metatarsal tubercles both prominent and subconical; inner edge of tarsus bearing a prominent, elongate, sigmoid-shaped or fold-like tubercle not contiguous with inner metatarsal tubercle ( +Fig. 8 +); (15) dorsum finely shagreen; belly smooth; (16) trigeminal nerve passing external to +m. adductor mandibulae externus +(‘S’ condition; +Lynch, 1986 +); (17) eggs large, not pigmented; (18) males with median subgular vocal sac and lacking nuptial asperities; (19) mating call composed of a series of notes. + + + + \ No newline at end of file diff --git a/data/03/AD/29/03AD2972A959FFFFFC190DAAF13EB43F.xml b/data/03/AD/29/03AD2972A959FFFFFC190DAAF13EB43F.xml new file mode 100644 index 00000000000..9e0ae24504f --- /dev/null +++ b/data/03/AD/29/03AD2972A959FFFFFC190DAAF13EB43F.xml @@ -0,0 +1,268 @@ + + + +Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae) + + + +Author + +Riva, Ignacio De La + + + +Author + +Chaparro, Juan C. + + + +Author + +Castroviejo-Fisher, Santiago + + + +Author + +Padial, José M. + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +129 +172 + + + +journal article +0024-4082 +B2DCFB0-BF1A-47A1-911C-726876890892 + + + + + + +BRYOPHRYNE +WILAKUNKA + + + +SP +. +NOV +. + + + + + + + +( + +FIG +. 6 + +) + + +h t t p: / / z o o b a n k. o r g / u r n: l s i d: z o o b a n k. org:act: +F655DAB0-847F-4612-8803-30980E3D688A + + + + +Holotype + +: +MUBI 5425 +(field number 4704), adult female from +Ayapata valley +, province +Carabaya +, department +Puno +, +Peru +, + +13°51 +′ +10.6 +″ +S + +, + +70°18 +′ +52.2 +″ +W + +, + +3947 m + +( +Fig. 3 +), collected on + +24 February 2006 + +by + +I. +De la Riva + +, +J. M. Padial +, +S. Castroviejo-Fisher +, and +J. C. Chaparro. + + + + + +Paratopotype + +: +MNCN 43788 +(field number 4705) (adult male), same data as the holotype + +. + + +Diagnosis +: + +Bryophryne wilakunka + +is characterized by: (1) skin on dorsal surfaces, including extremities and head, densely and uniformly warty (warts irregular in shape, low and flat to conical); flanks more densely warty and with larger and sharper warts than dorsum; dorsal folds absent; skin on belly and throat areolate (apparently smooth in preservative); (2) tympanic membrane and annulus small, slightly differentiated, tympanic fold conspicuous; (3) snout short, rounded in dorsal and lateral views; (4) upper eyelid covered with small low warts, cranial crests absent; (5) dentigerous process of vomers absent; (6) vocal slits present, nuptial pads absent; (7) Finger I equal to Finger II, tips of digits rounded, lacking circumferential grooves, ungual flaps and pads; (8) fingers lacking lateral fringes; (9) ulnar region bearing warts; (10) heel lacking tubercles, tarsus lacking tubercles and folds; (11) plantar surfaces of feet bearing two metatarsal tubercles, inner slightly larger than outer; supernumerary plantar tubercles low, weakly defined; (12) toes short and broad, lacking lateral fringes; feet webbing absent; Toe III equal to V, tips of digits rounded, lacking ungual flap and pads; (13) dorsal coloration dark grey to dark brown and black; ventral coloration orange to bright dark red with irregular orange spots on shanks, groins, and throat; palmar and plantar surfaces, and inner dorsal surfaces the same colour as belly; (14) females larger than males, SVL 17.9 ( +one adult +male) to 24.6 ( +one adult +female) ( +Table 3 +). + + + +Figure 5. +Habitat at the type locality of + + +Bryophryne tocra + +sp. nov. + +along the Ollachea-Macusani road, province Carabaya, department Puno, Peru, 3213 m a.s.l. + + + +The sister species and also the geographically closest species to + +B. wilakunka + +is + +B. tocra + +sp. nov. +( +type +localities separated by +19.8 km +straight line distance), from which it differs by having slightly areolate belly (coarsely areolate in + +B. tocra + +), densely warty head and extremities (slightly warty to smooth), a dark grey to black dorsal coloration (dark brown with metallic hues), bright dark red to orange ventral coloration (white with black spots or marbled with black stripes), and reddish-orange blotches on flanks, groins, and axillae (groins, axillae and posterior surfaces of thighs with yellow flash marks surrounded by bold black). Two other species, + +B. quellokunka + +and + +B. zonalis + +occur in the Marcapata Valley, +80 km +northwest of + +B. wilakunka +. + +From + +B. quellokunka +, +B. wilakunka + +differs by having skin on head densely and uniformly warty (shagreen to smooth in + +B. quellokunka + +), ventral coloration orange to bright dark red (variable, from greyish-purple with diffuse black blotches to brown), and iris dark brown (two inferior thirds dark brown and upper third metallic bluish-grey). From + +B. zonalis +, +B. wilakunka + +differs by lacking dorsolateral folds (present in + +B. zonalis + +), having tympanic membrane and annulus slightly differentiated (absent), vocal slits present in males (absent) and ventral coloration orange to bright dark red (dark grey with white flecks). + + + +Description of the +holotype + +: An adult female, +24.6 mm +SVL. Body moderately robust; dorsal skin warty, especially in posterior third of body and flanks; ventral skin slightly areolate, but with large and flat glandular warts; complete dorsolateral folds absent, faintly visible folds in the anterior third of body; pectoral fold absent; head wider than long; HW 34.5% of SVL, HL 31.3% of SVL; snout short, rounded in dorsal view and in profile; nostrils prominent, closer to snout than to eyes; canthus rostralis straight in dorsal view, rounded in profile; eye–nostril distance 57.6% of eye length; loreal region concave; cranial crests absent; tympanic membrane and tympanic annulus small, differentiated beneath the skin; supratympanic fold conspicuous in life; tongue large, oval; choanae small, rounded, broadly separated; dentigerous processes of vomers absent; limbs moderately short; tips of digits round, not expanded laterally, lacking circumferential groves and ungual flap; ulnar tubercle and fold absent; inner palmar tubercle single, round, slightly smaller than oval outer; fingers moderately short, not fringed; +Variation +: The male MNCN 43788 is smaller than the +holotype +(see +Table 3 +), but otherwise highly similar in all other respects; it lacks nuptial pads. In life, the +paratype +was greenish-brown, with ventral surfaces cream instead of reddish-orange. + + +Distribution and natural history +: Known only from the +type +locality. Individuals were found during the day under rocks in open wet puna at almost +4000 m +( +Fig. 7 +); they moved quite fast and were able to make short leaps (something unusual in other species of this genus). + + +Etymology +: The species epithet is used as a name in apposition and derives from the Aymara ‘Wila Kunka’, meaning red throat (wila = red, kunka = throat), which we use to refer to the bright dark red to orange ventral coloration of this species. Wila Kunka is also the name of a mountain ( +5350 m +) in the Kallawaya mountain range of +Puno +, +Peru +. + + + + \ No newline at end of file diff --git a/data/03/AD/29/03AD2972A95BFFE1FC070D6BF1A4B487.xml b/data/03/AD/29/03AD2972A95BFFE1FC070D6BF1A4B487.xml new file mode 100644 index 00000000000..dcba154a513 --- /dev/null +++ b/data/03/AD/29/03AD2972A95BFFE1FC070D6BF1A4B487.xml @@ -0,0 +1,318 @@ + + + +Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae) + + + +Author + +Riva, Ignacio De La + + + +Author + +Chaparro, Juan C. + + + +Author + +Castroviejo-Fisher, Santiago + + + +Author + +Padial, José M. + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +129 +172 + + + +journal article +0024-4082 +B2DCFB0-BF1A-47A1-911C-726876890892 + + + + + + +BRYOPHRYNE +TOCRA + + + +SP +. +NOV +. + + + + + + + +( + +FIG +. 4 + +) + + +u r n: l s i d: z o o b a n k. org:act: +22B3787A-AC6A-4936-A1AF-338AA34FE6DA + + + + +Holotype + +: +MUBI 5420 +(field number 4697), adult female from a point between +Ollachea +and the junction to +Corani +on the +Ollachea–Macusani +road, province +Carabaya +, department +Puno +, +Peru +, + +13°50 +′ +31.2 +″ +S + +, + +70°29 +′ +51.7 +″ +W + +, + +3213 m + +( +Fig. 3 +), collected on + +24 February 2006 + +by + +I. +De la Riva + +, +J. M. Padial +, +S. Castroviejo-Fisher +and +J. C. Chaparro. + + + + + +Paratopotypes + +: +MUBI 5418–19 +, (field numbers 4693, 4695) and + + +MNCN 43785–87 +(field numbers 4692, 4694, 4696) (males), same data as the holotype + +; + +MNCN 44214 +(field number 4783) (female) and + + +MUBI 5696 +(field number 4784) (male) from the type locality, collected on + +4 February 2007 + +by I. +De la Riva +, +J. M. Padial +, +S. Castroviejo-Fisher +, and +J. C. Chaparro + +. + + +Diagnosis +: + +Bryophryne tocra + +is characterized by: (1) skin on dorsum coarsely shagreen with scattered warts to warty (warts small, round to elongate); flanks coarsely warty, with some enlarged conical warts; head and forearms smooth to slightly shagreen; dorsal folds absent, a row of large warts from behind the eye to sacral region in some specimens; ventral skin coarsely areolate, throat areolate, chest smooth; (2) tympanic membrane and tympanic annulus small, differentiable beneath the skin; supratympanic fold short, conspicuous; (3) snout short, rounded in dorsal and lateral views; (4) upper eyelid lacking tubercles, cranial crests absent; (5) dentigerous process of vomers absent; (6) vocal slits present, nuptial pads absent; (7) Finger I slightly shorter than Finger II, tips of digits rounded, lacking circumferential grooves and ungual flap; (8) fingers lacking lateral fringes; (9) ulnar region bearing warts; (10) heel lacking tubercles, tarsus lacking tubercles and folds; (11) plantar surfaces of feet bearing two metatarsal tubercles, inner slightly larger than outer; supernumerary plantar tubercles low, weakly defined; (12) toes lacking lateral fringes; webbing absent; Toe III equal to V, tips of digits rounded, lacking circumferential grooves and ungual flap; (13) dorsal coloration dark brown to grey, with metallic tones; ventral coloration white with black spots or marbled with black stripes; groins, axillae and posterior surfaces of thighs with yellow flash marks surrounded by bold black; (14) females larger than males, SVL +27.2–27.6 in +adult females ( +n += 2), 18.4–20.0 mm in adult males ( +n += 5) ( +Table 3 +). + + + +Figure 4. +Live specimens of + + +Bryophryne tocra + +sp. nov. + +from near Ollachea, Peru. (A–B) Adult female (MNCN 44214, SVL 27.6 mm), from the type locality. (C–D) Adult female holotype (MUBI 5420, SVL 27.2 mm). (E–F) Adult male (MNCN 43786, SVL 19.3 mm), from the type locality. + + + +The sister and geographically closest species to + +B. tocra + +is + +B. wilakunka + +( +type +localities separated by +19.8 km +straight line distance). Differences between them are listed below under + +B. wilakunka + +. Two species, + +B. quellokunka + +and + +B. zonalis + +occur at the Marcapata Valley, +65 km +northwest of + +B. tocra + +. From + +B. quellokunka + +, + +B. tocra + +differs by having throat areolate (smooth in + +B. quellokunka + +), chest smooth (areolate), yellow blotches surrounded by black on groins, axillae and posterior surfaces of thighs (absent), and venter white with black spots or stripes (variable from greyish-purple with diffuse black blotches to brown); additionally, the iris of + +B. tocra + +in life is brown with fine black reticulations (two inferior thirds of iris dark brown and upper third metallic bluish-grey in + +B. quellokunka + +). From + +B. zonalis + +, + +B. tocra + +differs by having tympanum and tympanic annulus visible (absent in + +B. zonalis + +), and groins, axillae and posterior surfaces of thighs with yellow flash marks surrounded by bold black (yellow marks absent). + + + +Description of the +holotype + +: An adult female, +27.2 mm +SVL. Body moderately robust; dorsal skin coarsely shagreen with scattered warts of different sizes; ventral skin areolate; dorsolateral folds absent; pectoral fold present; head slightly wider than long; HW 30.8% of SVL, HL 29.8% of SVL; snout moderately short, rounded in dorsal view and in profile; nostrils slightly prominent, closer to snout than to eyes; canthus rostralis straight in dorsal view and in profile; eye–nostril distance 62.0% of eye length; loreal region concave; cranial crests absent; tympanic membrane and tympanic annulus small, barely perceptible beneath the skin; skin of tympanic area covered by large subconical warts; supratympanic fold well marked, short; tongue large, oval; choanae small, rounded, broadly separated; dentigerous process of vomers absent; ulnar tubercle and fold absent; inner palmar tubercle single, oval, slightly smaller than outer; fingers moderately short, not fringed, lacking circumferential grooves and ungual flap; subarticular tubercles round, poorly marked; supernumerary tubercles irregular and poorly defined; first finger slightly shorter than second, relative length of fingers 1 <2 <4 <3; tibia length 35.6% of SVL; tarsal fold absent; two metatarsal tubercles, oval inner slightly larger than rounded outer; supernumerary and subarticular tubercles low, poorly defined; toe tips round, not expanded laterally, lacking circumferential grooves and ungual flap, toes lacking basal webbing or lateral fringes; relative length of toes 1 <2 <3 = 5 <4; foot length 40.0% of SVL. + + +In preservative, dorsum greyish-brown, venter pale cream with brown, small, irregular blotches; throat cream; large cream blotches on groin surrounded by dark brown; palmar and plantar surfaces cream. In life, the dorsum of the +holotype +was mostly uniformly brown above; there were large pale yellow blotches surrounded by black in axillae, flanks and posterior surface of thighs, with a similar, more attenuated pattern on flanks and lower surfaces of hind limbs; the venter was grey with irregular brown dots and the throat was yellowish-cream; palmar and plantar surfaces were dirty orange; the iris was brown with fine black reticulation. + + + +Measurements (in mm) of the +holotype + +: SVL, 27.2; HL, 8.1; HW, 8.4; IND, 2.4; END, 2.1; ED, 3.4; TL, 9.7; FL, 10.9. + + +Variation +: Males are smaller than females ( +Table 3 +), and have vocal slits but lack nuptial pads. In preservative, they are grey–brown above with a pale grey dorsal triangle between eyes and snout, and a brown canthal stripe that in MUBI 5419 and MUBI 5696 extends to the tympanic region; ventral coloration is variable, from finely dotted with brown (MUBI 5418, MNCN 43785, 43787) to brown with a marbled cream pattern (MUBI 5696 and MNCN 43786) to mostly uniformly brown (MUBI 5419); MNCN 43785 has irregular dark grey blotches on dorsum, outlined by pale grey margins; males have vocal slits and lack nuptial pads. In life, these males were uniformly brown with small orange blotches on groin, which can be present on the lower surface of the shanks and the posterior surfaces of thighs too. In preservative, female MNCN 44214 is similar to the +holotype +but with a marbled venter forming a brown and cream pattern, including the throat; the palmar and plantar surfaces are pale brown instead of cream, and the pale blotches on groin, axillae, lower belly and flanks are smaller; in life, these blotches were yellow, and the venter consisted of a reticulated pattern of dark brown and greenish-cream. + + +Distribution and natural history +: Known only from the type locality. Individuals were found during the day under stones in open wet puna ( +Fig. 5 +). The +holotype +bears mature unpigmented eggs. When disturbed, individuals were able to make small leaps (something unusual in other species of this genus). + + +Etymology +: The species epithet is used as a name in apposition, and derives from the Quechua word T’uqra for faded, discoloured, pale, and we use it to refer to the white belly of the new species. T’uqra is also the name of a mountain ( +5000 m +) in the Willkanuta mountain range in the Andes of +Puno +, +Peru +. + + + + \ No newline at end of file diff --git a/data/03/AD/29/03AD2972A95CFFE3FF5D0C45F0B9B5DC.xml b/data/03/AD/29/03AD2972A95CFFE3FF5D0C45F0B9B5DC.xml new file mode 100644 index 00000000000..206411bb3bd --- /dev/null +++ b/data/03/AD/29/03AD2972A95CFFE3FF5D0C45F0B9B5DC.xml @@ -0,0 +1,672 @@ + + + +Underestimated anuran radiations in the high Andes: five new species and a new genus of Holoadeninae, and their phylogenetic relationships (Anura: Craugastoridae) + + + +Author + +Riva, Ignacio De La + + + +Author + +Chaparro, Juan C. + + + +Author + +Castroviejo-Fisher, Santiago + + + +Author + +Padial, José M. + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +129 +172 + + + +journal article +0024-4082 +B2DCFB0-BF1A-47A1-911C-726876890892 + + + + + + +BRYOPHRYNE +QUELLOKUNKA + + + +SP +. +NOV +. + + + + + + + +( + +FIG +. 2 + +) + + + +urn:lsid:zoobank.org:act: +0396BD77-2426-4541-93DE- D22D858AD292 + + + + + +Holotype + +: +MUBI 5380 +(field number 4626), adult female from +Qorpinte +, +2 km +from +Tambopampa +towards +Marcapata +, +Palquilla river +valley, province +Quispicanchis +, department +Cusco +, +Peru +, + +13°36 +′ +18.8 +″ +S + +, + +71°03 +′ +8.8 +″ +W + +, + +3964 m + +( +Fig. 3 +), collected on + +20 February 2006 + +by + +I. +De la Riva + +, +J. M. Padial +, +S. Castroviejo-Fisher +, and +J. C. Chaparro. + + + + + +Paratopotypes + +: +MUBI 5374 +, +5375 +, +5377 +(field numbers 4617, 4618, 4620), and + + +MNCN 43780 +, +43782 +(field numbers 4616, 4622) (adult males) + +; + +MNCN 43784 +(field number 4627) (adult female) + +; + +MUBI 5376 +, +5378 +, +5379 +(field numbers 4619, 4624, 4625) and + + +MNCN 43799 +, +43781 +, +43783 +(field numbers 4615, 4621, 4623) (juveniles), same data as the holotype + +. + + +Diagnosis +: + +Bryophryne quellokunka + +is characterized by: (1) skin on dorsum uniformly warty, warts round to conical and low, with two incomplete dorsolateral folds barely reaching midbody and continuing sometimes as an irregular row of warts; skin of head shagreen to smooth, warty dorsally; belly and chest areolate, throat smooth; (2) tympanic membrane and tympanic annulus slightly perceptible beneath skin, smaller than 2/3 of EL, supratympanic fold composed of a row of warts; (3) snout short, round in dorsal view, blunt in lateral view; (4) upper eyelid lacking tubercles, bearing small conical warts; (5) dentigerous process of vomers absent; (6) vocal slits and sac present, nuptial pads absent; (7) Finger I shorter than Finger II, tips of digits rounded, lacking ungual flap and circumferential grooves; (8) fingers lacking lateral fringes; (9) ulnar region bearing warts; (10) heel lacking tubercles, tarsus lacking tubercles and folds; (11) two metatarsal tubercles, inner slightly larger than outer; supernumerary tubercles inconspicuous; (12) toes lacking lateral fringes; webbing absent; Toe III longer than V, tips of digits rounded, lacking ungual flap and circumferential grooves; (13) dorsal coloration reddish-brown to dark brown, sometimes with a blackish-grey interorbital and/or middorsal mark; ventral coloration variable, from greyish-purple with diffuse black blotches to brown, throat and plantar surfaces orange to yellow, axillae and groins without flash marks; (14) females larger than males, SVL +27.6–28.2 in +adult females ( +n += 2), 18.0– +20.3 mm +in adult males ( +n += 5) ( +Table 3 +). + + + +Figure 2. +Live specimens of + + +Bryophryne quellokunka + +sp. nov. + +from Qorpinte, Marcapata, Peru. (A–B) Adult female holotype (MUBI 5380, SVL 28.2 mm). (C–D) Adult male (MNCN 43782, SVL 20.1 mm), from the type locality. + + + + +Figure 3. +Map of the Andes of southern Peru around department of Cusco showing the distribution (type localities only) of the 12 nominal species of + +Bryophryne + +described hitherto: (1) + +B. flammiventris + +; (2) + +B. abramalagae + +; (3) + +B. bustamantei + +; (4) + +B. bakersfield + +; (5) + +B. cophites + +; (6) + +B. hanssaueri + +; (7) + +B. nubilosus + +; (8) + +B. gymnotis + +; (9) + + +B. quellokunka + +sp. nov. + +; (10) + +B. zonalis + +; (11) + + +B. tocra + +sp. nov. + +; (12) + +B. wilakunka + +sp. nov. + + + + +Bryophryne quellokunka + +is sister to + +B. cophites + +, and this clade is in turn sister to + +B. bakersfield + +. The three species in this clade are similar but have some morphological differences. + +Bryophryne bakersfield + +has complete dorsolateral folds and short but conspicuous dorsal and occipital fold, and the dorsal skin is less homogeneously warty. Also, while the coloration of + +B. quellokunka + +is mostly homogeneously brown, colour patterns in + +B. bakersfield + +are diverse (orange, yellow, black, olive green, etc.). + +Bryophryne cophites + +has a less warty dorsal skin, almost smooth or with low warts, while the skin of + +B. quellokunka + +is conspicuously and homogeneously warty and has two incomplete dorsolateral folds sometimes shown as an irregular row of warts. Another species, + +B. zonalis + +, is known from near the +type +locality of + +B. quellokunka + +but at a lower elevation (Kusillochayoc, +3129 m +; +Lehr & Catenazzi, 2009 +), and both species have marked differences. + +Bryophryne zonalis + +has metallic blue to metallic orange spots surrounded by bold black in the lower part of the belly + + + +Table 3. +Morphometrics for new Peruvian species of + +Bryophryne + +and + +Microkayla + +(range, in parenthesis, follows mean; AM, adult males; AF, adult females) + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ +B. wilakunka + + + +B. quellokunka + + + +B. tocra + + + +M. chilina + + + +M. chapi + +
AMAFAMAFAMAFAMAFAMAF
MNCNMUBI +n += 5 + +n += 2 + +n += 5 + +n += 2 + +n += 4 +MUBI +n += 9 + +n += 3 +
4378854255350
SVL17.924.619.3 (18.0–20.3)27.9 (27.6–28.2)19.3 (18.4–20.0)27.4 (27.2–27.6)23.8 (23.2–24.3)25.517.8 (16.3–19.1)20.8 (19.9–21.6)
HL6.17.76.2 (5.3–6.8)8.8 (8.7–9.0)6.0 (5.4–6.4)8.1 (8.1–8.1)7.8 (7.5–8.0)7.45.9 (5.4–6.4)6.6 (6.2–6.8)
HW6.18.56.3 (5.7–6.8)9.1 (8.9–9.3)6.6 (5.8–7.1)9.0 (8.4–9.5)8.1 (8.0–8.2)7.76.2 (5.7–6.9)6.9 (6.8–7.0)
IND1.92.01.9 (1.7–2.0)2.1 (2.1–2.2)2.0 (1.8–2.2)2.5 (2.4–2.5)2.3 (2.0–2.5)2.31.7 (1.4–1.9)1.6 (1.5–1.8)
END1.51.91.6 (1.5–1.9)2.1 (2.1–2.2)1.6 (1.5–1.9)2.3 (2.1–2.5)1.9 (1.7–2.3)2.11.5 (1.3–1.7)1.5 (1.4–1.6)
ED2.63.32.6 (2.4–2.8)3.7 (3.7–3.7)2.6 (2.3–2.9)3.5 (3.4–3.6)3.0 (2.8–3.2)3.42.4 (2.0–2.7)2.5 (2.4–2.7)
TL6.98.36.8 (6.3–7.5)9.2 (9.0–9.3)7.2 (6.6–7.8)9.9 (9.7–10.0)7.3 (6.9–7.7)7.75.6 (4.9–6.0)6.5 (6.0–7.0)
FL7.610.27.9 (7.2–8.6)10.5 (9.9–11.0)8.2 (7.9–8.5)10.9 (10.9–10.9)8.8 (7.6–9.4)9.56.6 (6.0–7.0)7.4 (7.2–7.6)
HL/SVL0.30.30.3 (0.3–0.3)0.3 (0.3–0.3)0.3 (0.3–0.3)0.3 (0.3–0.3)0.3 (0.3–0.3)0.30.3 (0.3–0.4)0.3 (0.3–0.3)
HW/SVL0.30.30.3 (0.3–0.3)0.3 (0.3–0.3)0.3 (0.3–0.4)0.3 (0.3–0.4)0.3 (0.3–0.3)0.30.3 (0.3–0.4)0.3 (0.3–0.3)
END/ED0.60.60.6 (0.6–0.7)0.6 (0.6–0.6)0.6 (0.5–0.7)0.6 (0.6–0.7)0.6 (0.6–0.7)0.60.6 (0.5–0.7)0.6 (0.6–0.6)
TL/SVL0.40.30.4 (0.3–0.4)0.3 (0.3–0.3)0.4 (0.4–0.4)0.4 (0.4–0.4)0.3 (0.3–0.3)0.30.3 (0.3–0.3)0.3 (0.3–0.3)
FL/SVL0.40.40.4 (0.4–0.4)0.4 (0.4–0.4)0.4 (0.4–0.5)0.4 (0.4–0.4)0.4 (0.3–0.4)0.40.4 (0.3–0.4)0.4 (0.3–0.4)
+ +SVL, snout-vent length; HL, head length; HW, head width; IND, internarial distance; END, distance from eye to nostril; ED, eye diameter; TL, tibia length; FL, foot length. + +and ventral parts of shanks, lacking in + +B. quellokunka + +. It has a shagreen to smooth dorsal skin, and the upper third of iris is golden with fine black reticulations (bluish-grey in + +B. quellokunka + +). Also, + +B. quellokunka + +is larger in size (maximum SVL of females +28.2 mm +vs. +24.4 mm +). + + + +Description of the +holotype + +: An adult female, +28.2 mm +SVL. Body robust; dorsal skin homogeneously warty; ventral skin areolate; dorsolateral folds present, incomplete; pectoral fold absent; head wider than long; HW 32.9% of SVL, HL 31.9% of SVL; snout moderately short, rounded in dorsal view and in profile; nostrils not prominent, closer to snout than to eyes; canthus rostralis barely marked; eye–nostril distance 59.4% of eye length; loreal region slightly concave; cranial crests absent; tympanic membrane and tympanic annulus small, slightly evident beneath the skin; supratympanic fold absent; tongue large, oval; choanae small, oval, broadly separated; dentigerous processes of vomers absent; limbs short; tips of digits round, not expanded laterally; ulnar tubercle and fold absent; inner palmar tubercle oval, flattened, poorly defined, the same size as round outer; fingers moderately short, not fringed, tips rounded and lacking circumferential grooves and ungual flap; subarticular tubercles at the base of fingers round, large; supernumerary tubercles round, poorly marked; first finger slightly shorter than second, relative length of fingers 1 <2 <4 <3; tibia length 32.9% of SVL; tarsal fold absent; two round metatarsal tubercles, inner approximately the same size as outer; supernumerary tubercles flat, not well marked; subarticular tubercles round, moderately swollen; toes lacking basal webbing or lateral fringes, toe tips round, lacking circumferential groves and ungual flap; relative length of toes 1 <2 <3 <5 <4; foot length 39.0% of SVL. + +In preservative, dorsum uniformly brown, venter and throat pale brown with a uniform, fine marbled cream pattern; digits cream. In life, the dorsum was uniformly brown with some reddish-brown warts, the venter was grey with irregular brown markings, the throat was yellowish orange, and the digits were orange; there were small orange irregular blotches on axillae and groins; the venter was greyish-brown with irregular dirty-yellow patterns; the digits were yellowish-orange; the two inferior thirds of the iris were dark brown while the upper third was metallic bluish-grey. + + +Measurements (in mm) of the +holotype + +: SVL, 28.2; HL, 9.0; HW, 9.3; IND, 2.2; END, 2.2; ED, 3.7; TL, 9.3; FL, 11.0. + + +Variation +: + +Dorsal colour pattern is similar in all specimens; some of them (e.g. +MUBI 5375 +, +5377 +) have irregular, feeble dark brown markings on the sides of the scapular region, above the groins, on limbs and on the canthal region; the venter and throat vary from almost uniformly brown ( +MUBI 5376 +) to almost uniformly cream ( +MUBI 5375 +). Only +two specimens +out of 13 did not have the bluish-grey upper third of the iris, having it brown as the rest of the eye. For morphometric variation, see +Table 3 + +. + + +Distribution and natural history +: Known only from the +type +locality ( +Fig. 3 +). Individuals were found during the day under stones in wet puna. + + +Etymology +: The species epithet is used as a name in apposition, and derives from the Quechua word Q’ello Kunka meaning yellow throat (q’ello yellow, kunka throat), and refers to the yellowish throat of the species. Q’ello Kunka is also the name of a mountain ( +5100 m +) in the Quispicanchis province, Marcapata district, that belongs to the Vilcanota (Willkamayu) mountain range. + + + + \ No newline at end of file diff --git a/data/03/FE/87/03FE8787D950FFEE03C2970DFB0BC86C.xml b/data/03/FE/87/03FE8787D950FFEE03C2970DFB0BC86C.xml new file mode 100644 index 00000000000..6559351eda3 --- /dev/null +++ b/data/03/FE/87/03FE8787D950FFEE03C2970DFB0BC86C.xml @@ -0,0 +1,202 @@ + + + +A new family of neotropical freshwater fishes from deep fossorial Amazonian habitat, with a reappraisal of morphological characiform phylogeny (Teleostei: Ostariophysi) + + + +Author + +Pinna, Mário De + + + +Author + +Zuanon, Jansen + + + +Author + +Py-Daniel, Lucia Rapp + + + +Author + +Petry, Paulo + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +76 +106 + + + +journal article +0024-4082 +D3A2334-44D3-4ADA-AAC6-1130F3D7FD22 + + + + + + +TARUMANIIDAE + + + +FAM +. +NOV +. + + + + + + + + +Type +genus: +Tarumania + +gen. nov. +described below. + + + +Species included: +Tarumania walkerae + +sp. nov. +( +Figs 1–3 +) described below. + + +Diagnosis: +Distinguished from all other families of Osteichthyes by the presence of a swimbladder composed of 11 longitudinally arranged interconnected compartments extending along most of the body, immediately ventral to the vertebral column ( +Fig. 4 +; vs. swimbladder with one or two compartments). Also unique among teleosts (except +Platytroctidae +) by the presence of reverse-imbricated scales (i.e. with free margins directed anteriorly) covering most of the head ( +Fig. 5 +; vs. scales with normal imbrication throughout body and head). Further distinguished from all other Ostariophysi by having two rows of teeth on the maxilla ( +Fig. 6 +; vs. single row). Uniquely diagnosed from all other +Characiformes +by each of the following characters: the numerous vertebrae (69–70; vs. 68 or fewer), pleural ribs (41–44; vs. 32 or fewer) and scales (244–267 along midlateral row and 25 rows on caudal peduncle; vs. 162 or fewer); the spatulate caudal peduncle ( +Fig. 1 +; vs. oblong or round in cross-section); the lanceolate caudal fin ( +Fig. 1 +; vs. bifurcated. emarginate or round); and the platybasic skull, with the parasphenoid expanded and conjoined with the remainder of the neurocranium, forming the floor of the braincase ( +Fig. 7 +; vs. skull tropibasic). Other characters not necessarily unique to the taxon but still rare or unusual across a wide taxonomic array include: pelvic fins long and in the living fish deflectable 180 degrees anteriorly ( +Fig. 3 +; arrow); a flexible ‘neck’ that can bend the head at a right angle relative to the trunk; the infraorbital bone series reduced to single plate-like element lacking a sensory canal; the interopercle with a large semicircular notch along the dorsal margin ( +Fig. 8 +); the presence of a single upper pharyngeal toothplate (corresponding to the posterior element in other characiforms) ( +Fig. 9 +); a large hypural-like bone located between haemal spines of second and third ural centra ( +Fig. 10 +). Other characters variably shared with a number of other clades but still useful to diagnose the taxon include the latero-sensory canal system mostly absent on the neurocranium and body but present in the nasal, dentary and preopercle; the teeth all unicuspidate, with two on each jaw hypertrophied and caniniform ( +Figs 5 +, +8 +); the eyes very small and located on the anterior portion of the head ( +Figs 1–3 +); the external notochord and larval pectoral fin persistent, the former in specimens up to 50-mm SL and the latter up to 30-mm SL; the cranial fontanels closed ( +Fig. 7 +); the central part of the frontals and parietals elevated and exposed on the surface of the head in large specimens, forming an ornamented platform ( +Fig. 7 +); the post-temporal fossae absent ( +Fig. 7 +); the intercalar absent ( +Fig. 7 +); the frontals expanded laterally, forming shelves along the anterior half of the skull ( +Fig. 7 +); the mesethmoid anteriorly expanded ( +Fig. 7 +); the quadrate-metapterygoid foramen absent or not differentiated ( +Fig. 8 +); the postcleithra and suprapreopercle absent; the supraoccipital spine deeply sunk in the anterior trunk musculature. + + + + +Figure 1. + +Tarumania walkerae + +gen. et sp. nov. + +, holotype, INPA 33737. + + + + + +Figure 2. + +Tarumania walkerae + +gen. et sp. nov. + +, holotype, INPA 33737. Dorsal (a) and ventral (b) views of head + + + + +Figure 3. +Live specimen, juvenile, of + +Tarumania walkerae + +, paratype, MZUSP 120543, shortly after collection. Arrow shows pelvic fins in anteriorly deflected position. + + + +Remarks: +As shown below, our investigation into the phylogenetic position of the new taxon concludes that it is the sister group to the family +Erythrinidae +. In purely nomenclatural terms, such positioning is compatible either with an expansion of the latter family or with the erection of a new family. Both choices result in exclusively monophyletic named taxa and therefore conform to the principles of phylogenetic classification. Given such flexibility, our choice for a new family rests on considerations additional to criteria of monophyly. First, the inclusion of + +Tarumania + +in +Erythrinidae +would result in profound modifications of the composition and range of morphological and biological variation seen in that family, which has been stable for more than a century. This would create information-retrieval problems with a vast amount of data in previous literature. Second, most of the traditionally recognized diagnostic characters in +Erythrinidae +are not present in + +Tarumania + +, rendering such familial allocation difficult to integrate with established taxonomic practice. Finally, the large phenotypic distance between + +Tarumania + +and species of +Erythrinidae +meets or exceeds that seen among characiform families in general, making a separate family for the genus a solution fitting the established classification of the order. Inclusion of + +Tarumania + +into an expanded +Erythrinidae +is clearly a less satisfactory solution and one that would incur more disturbance than necessary in the classification of characiforms. Recognition of a separate family more closely reflects the biological reality of the entities involved and better promotes nomenclatural stability. + + + + \ No newline at end of file diff --git a/data/03/FE/87/03FE8787D952FFE103A096A0FE95CEA8.xml b/data/03/FE/87/03FE8787D952FFE103A096A0FE95CEA8.xml new file mode 100644 index 00000000000..7c4d639599c --- /dev/null +++ b/data/03/FE/87/03FE8787D952FFE103A096A0FE95CEA8.xml @@ -0,0 +1,424 @@ + + + +A new family of neotropical freshwater fishes from deep fossorial Amazonian habitat, with a reappraisal of morphological characiform phylogeny (Teleostei: Ostariophysi) + + + +Author + +Pinna, Mário De + + + +Author + +Zuanon, Jansen + + + +Author + +Py-Daniel, Lucia Rapp + + + +Author + +Petry, Paulo + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +76 +106 + + + +journal article +0024-4082 +D3A2334-44D3-4ADA-AAC6-1130F3D7FD22 + + + + + + +TARUMANIA +WALKERAE + + + +SP +. +NOV +. + + + + + + + +[ + +FIGS +1–3 + +] + + + + +Holotype +: + +INPA 33737 +, +81.6 +-mm SL, marginal pool of +Igarapé Tarumã-Mirim +(tributary to +Rio Negro +), +Amazonas State +, +Manaus +, +Brazil +( +02.90965°S +60.22915°W +), coll. +L. Rapp Py-Daniel +, J. Zuanon and +M. de Pinna +, + +2 September 2006 + +. + + + + + +Paratypes +(all from +Brazil +, +State +of +Amazonas +): + +INPA 16563 +, +1 +ex, +c +. 23-mm SL, +Igarapé do Camarão +, +Igarapé Tarumã-Mirim + +, + +col. +Ilse Walker +, + +28 January 1999 + +; +INPA 25747 +, +3 specimens +(1 c&s), 87.3- to 151.2-mm SL, +Rio Negro +at +Parque Nacional das Anavilhanas +, paraná do +Lago do Prato +, +Novo Airão +(~ +02.72°S +60.75°W +) + +, + +coll. +J. Zuanon +, + +22 August 2001 + +; +INPA 26241 +, +3 +ex, 44.9- to 51.2-mm SL, same data as holotype + +, + +but at +2.90830°S +60.22873°W +; +INPA 26245 +, +11 +ex, 38.4- to 61.5-mm SL (56.35–62.02 mm), collected with holotype + +; + +INPA 26246 +, +2 +ex, 44.7- to 45.2-mm SL, collected with holotype + +; + +INPA 26248 +, +1 +ex, 63.5-mm SL, same data as holotype + +, + +but +02.89637°S +60.22833°W +; +INPA 33733 +, +3 +ex, 58.5- to 102.8-mm SL same locality as holotype + +, + +coll. +J. Zuanon +et al +., + +11 February 2002 + +; 35585, 11 ex, 17.5- to 99.9-mm SL, +Manaus +, +Igarapé Tarumã-Mirim + +, + +col. +J. Zuanon +, + +3 February 2010 + +; +INPA 42299 +, +7 +ex, 57.5- to 87.0-mm SL, +Manaus +, +Igarapé Tarumã-Mirim +, pool inside forest + +, + +col. +J. Zuanon +et al +., + +20 December 2011 + +; +INPA 42302 +, +6 +ex, 26.7- to 37.6- mm SL, +Manaus +, +Igarapé Tarumã-Mirim +( + +02°54 +′ +35 +″ +S + + +60°13 +′ +45 +″ +W + +) + +, + +col. +J. Zuanon +et al +., + +27 January 2010 + +; +INPA 52935 +, +1 +ex, 22.9-mm SL, +Parque Nacional das Anavilhanas +, +Igarapé Açu +(tributary to +Rio Negro +), +Novo Airão +( +−2.8220100000 +−60.8708600000 +) + +, + +coll. +D. Bastos +et al +., + +4 May 2016 + +; +INPA 53174 +, +1 +ex, 73.0-mm SL, +Manaus +, pool near +Rio Tarumã +( +−2.9016380000 +−60.2292800000 +) + +, + +col. +D. Bastos +et al +., + +12 October 2016 + +; +MZUSP 120543 +, +11 +ex (1 c&s), 42.2- to 76.1-mm SL, collected with holotype + +; + +MZUSP 120544 +, +1 +ex C&S, 98.4-mm SL, collected with holotype (preserved after 2 years in captivity) + +; + +MZUSP 120545 +, +3 +ex (1 c&s), 46.4- to 52.6-mm SL, same data as INPA + +26241. + + + +Figure 4. +Schematic representation of swimbladder of + +Tarumania walkerae + +, based mostly on INPA 26241, 51.5-mm SL. ac, anterior swimbladder chamber; sd, sinusoid swimbladder duct. Roman numerals II–XI represent sequential swimbladder chambers. + + + + +Figure 5. + +Tarumania walkerae + +, paratype, INPA 21603, lateral view of head showing reverse-imbricated scales. Specimen cleaned of superficial mucus. + + + +Etymology: +The specific name honours eminent limnologist Ilse Walker [Instituto Nacional de Pesquisas da Amazônia, Manaus (INPA)], not only for her lifelong contribution to the knowledge of Amazonian ecology but also for having collected the first (and for some years, only) known specimen. The epithet is a noun in the genitive feminine case. + + +Diagnosis: +As for the family. + + +Description: +Body greatly elongate (BD ~9% of SL) and approximately oval in cross-section, ending in highly compressed, spatulate caudal peduncle deeper than rest of body. Proportional measurements provided in +Table 1 +. Anal and urogenital openings located immediately anterior to origin of anal fin. Myotomes narrow and numerous. Head small (~15% of SL), its profile continuous with that of the body in live and recently preserved specimens (partly dehydrated specimens with well-defined groove dorsally between head and trunk). Dorsal trunk musculature produced anteriorly to cover posterior part of cranium. Snout blunt, ending anteriorly in large and slightly upturned mouth, with lower jaw longer than upper one. Posterior margin of upper jaw reaching to vertical through posterior margin of eye. Eye small, located on anterior fifth of head in lateral view. Anterior and posterior nares not juxtaposed, separated from each other by considerable distance, longer than eye diameter. Anterior naris positioned immediately dorsal to upper lip and produced on surface of the head as small mound. Branchiostegal membranes united to each other, free from isthmus, forming wide branchial opening. Maxilla with two rows of conical teeth, straight or slightly curved, for part of its dentate surface. Jaw dentition described in ‘Selected osteological features’. Infraorbital latero-sensory canal absent. Skull roof without cranial fontanels. Part of frontal and parietal bones prominent and exposed on dorsal surface of the head in large specimens. Numerous neuromast lines over head and anterior part of the body. Body neuromasts mostly arranged as short vertical rows of five or six elements. Supraoccipital spine invisible externally. Dorsal fin short-based and lanceolate, i or ii + 4–6, its origin at ~70% of SL. Pectoral fin short, i or ii + 7–10, its length approximately half of HL, attached on ventral fourth of thorax. First pectoral-fin ray approximately half as long as others, adpressed to second ray. Pelvic fin large, i + 5 or 6 (i.e. all rays branched), extending posteriorly to vertical through base of dorsal fin. Anal fin ii + 9 + i, its base more than twice as long as that of dorsal fin and its origin slightly anterior to vertical through tip of adducted dorsal fin. Caudal fin lanceolate or oblong and no differentiation between upper and lower lobes, with 8 + 10 principal rays plus four accessory rays in lower lobe. Caudal-fin attachment area more extensive ventrally than dorsally. Adipose fin absent. Squamation fine and extremely uniform in size, covering entire body in regular narrow rows, as well as most of the head (including entire perimeter of orbit), except lips and exposed top of skull. Scales on head similar in morphology to those on body, but with different imbrication, that is free margins not directed posteriorly. Imbrication pattern changes along limit between trunk musculature and head. Scales at interface with free margins directed laterally or ventrally. Such orientation maintained in scales over gill covers and posterior portion of cheeks. Free scale margins shifting to progressively more anterior orientation over anterior portion of cheeks, until completely reversed on dorsal part of head ( +Fig. 5 +). Scales in midlateral series of body 244–267, none perforated by lateral-line pores, 21 or 22 scale rows between origins of dorsal and pelvic fins. Modally 25 series of scales on caudal peduncle. Pre-dorsal scales 168–193. Vertebrae 64 or 65 (43–45 precaudal and 21–22 caudal). Pleural ribs 41–44. Anterior branchial arch with 11 or 12 gill rakers, 3 or 4 upper and 8 lower (posterior lower one sometimes at limit). + + +Swimbladder subdivided into 11 compartments, positioned in longitudinal series immediately ventral to vertebral column ( +Fig. 4 +). Series arranged in anterior row of three and posterior row of eight, connected by sinuous duct. Individual compartments varying in shape and size. Size of compartments increasing towards anterior and posterior ends, with smallest ones approximately in middle of abdominal cavity. First compartment corresponding in position and shape to anterior chamber of swimbladder in other characiforms. All other compartments represent subdivisions of the posterior chamber. Anterior chamber largest of all in volume, with wide cordiform shape in ventral view. All subsequent chambers narrower than first one. Second chamber cylindrical, longer than first one. Third chamber conical, bottle shaped and markedly smaller in volume than its predecessors, with posterior atrium-like region tapering posteriorly into narrow sinusoid duct expanding slightly into fourth chamber, smallest of all. Constriction separates fourth from slightly larger fifth chamber. Sixth chamber larger still. All subsequent chambers similar in shape, although progressively larger posteriorly, except for last chamber, slightly smaller and more roundish than its predecessor, and abutting against posterior limit of abdominal cavity, dorsally to anterior anal-fin pterygiophores. All swimbladder chambers connected via short ducts, except third and fourth, connected via long sinusoid duct described above. Wall of anterior chamber noticeably thicker than that of subsequent chambers, otherwise uniformly thin and delicate. Ductus pneumaticus opening ventrally from second chamber, close to limit with first one. Swimbladder configuration described is constant in +four specimens +dissected. + + +Pigmentation: +Overall ground colour dark brownish, slightly less dark ventrally. Subtle differences in the density of pigment forming irregular small blotches on the dorsum and flanks, partly merging into irregular vertical or slanted bars on anterior third of trunk, sometimes extending across dorsum. Barred pattern more intense on caudal peduncle, sometimes changing into irregular blotches. Areas of procurrent caudal-fin rays dorsally and ventrally on caudal peduncle darker than rest of peduncle in small specimens, but indistinguishable in larger individuals. Dorsal and ventral edges of caudal peduncle outlined as very dark thin line. Scales with dark exposed portions collectively forming pattern of fine longitudinal stripes covering entire body, visible under close examination. Dark slanted lines on lower half of flanks outlining limits of myomeres. Head as dark as body. Snout and area of opercle darker than rest of the head, with sides of cheeks slightly lighter. Dorsal and lateral sides of head with numerous short thin light lines corresponding to neuromast lines. Central portion of isthmus with same colour as abdomen, with adjacent portion of branchiostegal membrane distinctly darker than rest of ventral aspect of head. Caudal fin with very dark posteriorly convex semilunar mark across base, covering ~15% of length of longest (central) rays at its widest. Heavy dark pigment covering basal third of anal fin, more intense at its ventral limit, forming very dark stripe in some specimens. Rest of fin abruptly hyaline. Dorsal fin with dark field over its basal 10–20%, otherwise hyaline. Pectoral and pelvic fins with dark fields at bases, more pronounced on former, forming dark spot with elongate dark fields radiating alongside fin rays. Remainder of both fins hyaline. Colour of small individuals (up to 6.0-cm SL) very dark and uniform, nearly black. In life, colour pattern obviously mimics dead leaves in habitat, with hyaline portions of fins practically invisible. + + + +Figure 6. +Jaws +of + +Tarumania walkerae + +, paratype, INPA 25747, 151.2-mm SL, lateral view. aa, angulo-articular; den, dentary; mx, maxilla; pmx, premaxilla; ra, retroarticular. + + + +Maximum size: +151.2-mm SL (a specimen from INPA 25747). + + +Geographical distribution: +So far endemic to the Rio Negro basin, from the Rio Tarumã-Mirim, tributary to the Rio Negro near the city of Manaus, and from the Anavilhanas archipelago, on the main Rio Negro ( +Fig. 11 +). The two localities are ~ +60 km +apart in straight line. + + + + \ No newline at end of file diff --git a/data/03/FE/87/03FE8787D952FFEE03F897ECFC16C9AB.xml b/data/03/FE/87/03FE8787D952FFEE03F897ECFC16C9AB.xml new file mode 100644 index 00000000000..2a9513e08c3 --- /dev/null +++ b/data/03/FE/87/03FE8787D952FFEE03F897ECFC16C9AB.xml @@ -0,0 +1,87 @@ + + + +A new family of neotropical freshwater fishes from deep fossorial Amazonian habitat, with a reappraisal of morphological characiform phylogeny (Teleostei: Ostariophysi) + + + +Author + +Pinna, Mário De + + + +Author + +Zuanon, Jansen + + + +Author + +Py-Daniel, Lucia Rapp + + + +Author + +Petry, Paulo + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +76 +106 + + + +journal article +0024-4082 +D3A2334-44D3-4ADA-AAC6-1130F3D7FD22 + + + + + + +TARUMANIA + + + +GEN +. +NOV +. + + + + + + + + +Type +species: +Tarumania walkerae + +sp. nov. + + +Diagnosis: +As for the family. + + +Etymology: +From the river Tarumã-Mirim, tributary of the lower Rio Negro, first known locality of the new taxon. A noun in nominative singular. Gender feminine. + + + + \ No newline at end of file diff --git a/data/4C/54/87/4C548796FFAC1218FE91F968FB1EA8E9.xml b/data/4C/54/87/4C548796FFAC1218FE91F968FB1EA8E9.xml new file mode 100644 index 00000000000..fbe27fa346b --- /dev/null +++ b/data/4C/54/87/4C548796FFAC1218FE91F968FB1EA8E9.xml @@ -0,0 +1,394 @@ + + + +Evolutionary history of Bathygobius (Perciformes: Gobiidae) in the Atlantic biogeographic provinces: a new endemic species and old mitochondrial lineages + + + +Author + +Rodríguez-Rey, Ghennie T. + + + +Author + +Filho, Alfredo Carvalho + + + +Author + +Araújo, Maria Elisabeth De + + + +Author + +Solé-Cava, Antonio M. + +text + + +Zoological Journal of the Linnean Society + + +2018 + +182 + + +360 +384 + + + +journal article +0024-4082 +14B8382-1788-4E8D-AE6A-7771423F5B22 + + + + + +PHYLOGEOGRAPHY +OF + +B +. + +SOPORATOR + +AND +B +. + +GEMINATUS + + + + + + + +The phylogeographic analyses revealed a similar pattern of genetic diversity for both + +B. soporator +and +B +. +geminatus + +. Both species presented deeply differentiated lineages (CAL and EA lineages for + +B +. +soporator +and + +NWA lineage for + +B +. +geminatus + +), separated from other related lineages (WA lineages) by 6–13 and 25–34 mutations for +COI +and cyt +b +, respectively ( +Figs 4 +, +6 +; Supporting Information, Fig. S8). This deep divergence could indicate a relatively old partition corresponding to the major biogeographic provinces. In some reef fishes and sea urchins, for example, the deep genetic divergences observed among Atlantic biogeographic provinces ( +d = +2.3–12.7% for cyt +b +) were attributed to the presence of cryptic species within the Atlantic ( + +Muss +et al. +, 2001 + +; + +Carlin +et al. +, 2003 + +; + +Lessios +et al. +, 2003 + +; +Rocha, 2004 +). The divergence values of the most differentiated lineages of + +B. soporator + +(median +d = +2.7% for +COI +; median +d += 4.1% for cyt +b +) and + +B +. +geminatus + +(median +d = +1.8% for +COI +; median +d += 2.7% for cyt +b +) are similar to those observed between cryptic species of some reef fishes, but are smaller than those found between sister species in the genus + +Bathygobius + +( +Table 1 +). Because of the lack of diagnostic morphological or pigmentation characters ( + +Tornabene +et al. +, 2010 + +), and the monomorphism in the nuclear genes +RAG1 +( +Tornabene & Pezold, 2011 +) and Rhodopsin (data not shown), we conservatively chose not to assign those lineages to distinct species. Genetic divergence without obvious morphological differences has been observed in the wrasse + +Halichoeres bivittatus + +between the tropical and subtropical habitats ( +d = +3.4% for cyt +b +; + +Rocha +et al. +, 2005 + +). + + +The two most closely related lineages (WA1 and WA2) of + +B. soporator +and +B +. +geminatus + +were also observed in sympatry throughout the tropical Western Atlantic and were separated by two +COI +and five to seven cyt +b +mutations, indicating a recent divergence ( +Figs 4 +, +6 +; Supporting Information, Fig. S8). Co-existence of different mitochondrial lineages in sympatry has also been observed in reef fishes such as the surgeonfish + +Naso brevirostris +( + +Horne +et al. +, 2008 + +) + +, the coral trout + +Plectropomus maculatus + +and the snapper + +Lutjanus carponotatus +( + +Evans +et al. +, 2010 + +) + +. In each WA lineage of + +B +. +soporator + +, the Caribbean and Brazilian provinces shared the most common haplotype and four other central haplotypes. The central position of shared haplotypes indicates an old age for the connections between provinces. In + +B +. +geminatus + +, our results suggest that the lineages co-occur in the Brazilian coast and that the WA1 lineage may be restricted to the Brazilian province. However, because of the small sample sizes in the Caribbean, we cannot affirm that the WA1 lineage really does not occur in the Caribbean, as observed for the WA lineages of + +B +. +soporator + +. + + +Two primary hypotheses have been proposed to explain the high biodiversity of regions such as the Greater Caribbean: the centre of origin (CO) hypothesis and the centre of accumulation (CA) hypothesis ( + +Rocha +et al. +, 2008b + +). The CO hypothesis proposes that species originate in the centre and disperse to the periphery, whereas the CA hypothesis proposes that diversity centres accumulate species that originated elsewhere ( + +Rocha +et al. +, 2008b + +; + +Bowen +et al. +, 2013 + +). Therefore, under a CO hypothesis, the ancestral haplotypes should be found at the centre of diversity, and under a CA hypothesis, the ancestral haplotypes should be found in peripheral populations. In + +B. soporator + +, the ancestral haplotype was distributed in the Northwestern Atlantic ( +Fig. 5A +; Supporting Information, Fig. S9A), indicating a Greater Caribbean ancestor for the lineages that dispersed towards the Southern Atlantic, supporting the CO hypothesis. In contrast, the ancestral distribution of + +B +. +geminatus + +was in the Southwestern Atlantic ( +Fig. 7A +; Supporting Information, Fig. S9B), indicating that the lineages probably derived from a Brazilian ancestor that dispersed towards the Northern Atlantic, supporting the CA hypothesis. Genetic patterns that support both or either of the hypotheses for the Greater Caribbean have also been reported in other reef fishes (e.g. + +Rocha +et al. +, 2008b + +; + +Castellanos-Gell +et al. +, 2012 + +), indicating that these two models are not mutually exclusive, but instead may operate in concert. + + +Recent phylogeographic and demographic studies have shown that climatic fluctuations during the Pleistocene ( +c +. 2.6 Mya to 10 ka) influenced the demographic history and distribution of several marine species (e.g. + +Bowen +et al. +, 2006 + +; + +Rodríguez-Rey +et al. +, 2013 + +). During those periods, coral reef habitats experienced massive fluctuations in distribution and quality because of changes in sea level and temperature ( +Daly, 1915 +; + +Kiessling +et al. +, 2012 + +). Reef habitats may have been reduced by 90% in the Caribbean during the glacial periods, when the sea level was at least +100 m +below current levels, decreasing the available habitats for reef fishes and the connectivity among populations ( +Bellwood & Wainwright, 2002 +; + +Bowen +et al. +, 2006 + +). During interglacial periods, the rising sea level increased habitat availability, resulting in population expansions of marine species ( + +Bowen +et al. +, 2006 + +). Our results indicate that the expansions observed in the lineages of both species of + +Bathygobius + +could have occurred during interglacial periods in Late Pleistocene (MIS5 and MIS3; +Figs 5B +and +7B +). Thus, during those interglacial periods, the sea-level rise may have weakened the Amazon barrier (see the discussion below), increasing habitat availability and allowing the dispersal from Caribbean to +Brazil +for + +B +. +soporator +and + +from +Brazil +to the Caribbean for + +B +. +geminatus + +. Demographic expansion events have also been detected during interglacial periods in several reef fishes in the Atlantic [e.g. in the squirrelfishes + +Myripristis jacobus + +and + +Holocentrus ascensionis +( + +Bowen +et al. +, 2006 + +) + +; in the sand goby + +Pomatoschistus minutes + +( + +Gysels +et al. +, 2004 + +; + +Larmuseau +et al. +, 2009 + +)]. + + + + \ No newline at end of file diff --git a/data/73/36/44/733644600C416879FF44FA4CFD943CDB.xml b/data/73/36/44/733644600C416879FF44FA4CFD943CDB.xml new file mode 100644 index 00000000000..6a40f535e76 --- /dev/null +++ b/data/73/36/44/733644600C416879FF44FA4CFD943CDB.xml @@ -0,0 +1,155 @@ + + + +Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family + + + +Author + +White, William T + + + +Author + +Corrigan, Shannon + + + +Author + +Yang, Lei + + + +Author + +Henderson, Aaron C + + + +Author + +Bazinet, Adam L + + + +Author + +Swofford, David L + + + +Author + +Naylor, Gavin J P + +text + + +Zoological Journal of the Linnean Society + + +2018 + +2018-01-31 + + +182 + + +1 + + +50 +75 + + + + +http://academic.oup.com/zoolinnean/article/182/1/50/3886052 + +journal article +10.1093/zoolinnean/zlx018 +0024-4082 +14812581 + + + + + + + +MOBULA +KUHLII + +( + +MÜLLER +& +HENLE +, 1841 + +) + + + + + + + + + +Cephaloptera kuhlii + +Müller & Henle, 1841: 185 + + + +, Pl. 59 (left) ( +India +; +lectotype +MNHN 000-1596) + + + + + + +Dicerobatis eregoodoo + +Cantor, 1849: 1420 + + + +( +Penang +, +Malaysia +and +Coromandel +, +India +; +syntype +location unknown) + + + + +Dicerobatis draco +Günther, 1872: 422 + +( +Misol +, +Indonesia +; +syntypes +BMNH 1870.8.31.68–69) + + + + \ No newline at end of file diff --git a/data/73/36/44/733644600C4E6876FCDEFE9CFB5838A0.xml b/data/73/36/44/733644600C4E6876FCDEFE9CFB5838A0.xml new file mode 100644 index 00000000000..5373e5e16ff --- /dev/null +++ b/data/73/36/44/733644600C4E6876FCDEFE9CFB5838A0.xml @@ -0,0 +1,164 @@ + + + +Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family + + + +Author + +White, William T + + + +Author + +Corrigan, Shannon + + + +Author + +Yang, Lei + + + +Author + +Henderson, Aaron C + + + +Author + +Bazinet, Adam L + + + +Author + +Swofford, David L + + + +Author + +Naylor, Gavin J P + +text + + +Zoological Journal of the Linnean Society + + +2018 + +2018-01-31 + + +182 + + +1 + + +50 +75 + + + + +http://academic.oup.com/zoolinnean/article/182/1/50/3886052 + +journal article +10.1093/zoolinnean/zlx018 +0024-4082 +14812581 + + + + + + + +MOBULA +HYPOSTOMA + +( +BANCROFT +, 1831) + + + + + + + +Cephalopterus hypostomus +Bancroft, 1831: 134 + +( +Jamaica +; +holotype +not preserved) + + + + + +Cephaloptera olfersii + +Müller, 1836: 311 + + + +( +Brazil +; +syntypes +MNHN A- 9966,? +ZMB 31636 +[ex +ZMB 8923 +],?ZM 31637) + + + + +Cephaloptera massenoidea +Hill, 1862: 176 + +( +Jamaica +; no +types +known) + + + + + +Cephaloptera rochebrunei +Vaillant, 1879: 187 + + +( +Senegal +; MNHN A-9967) + + + + +Ceratobatis robertsii +Boulenger, 1897: 227 + +( +Jamaica +; +holotype +BMNH 1897.7.1.40) + + + + \ No newline at end of file diff --git a/data/73/36/44/733644600C5A6862FEA3F9B2FEDC3CD7.xml b/data/73/36/44/733644600C5A6862FEA3F9B2FEDC3CD7.xml new file mode 100644 index 00000000000..4720c17f06a --- /dev/null +++ b/data/73/36/44/733644600C5A6862FEA3F9B2FEDC3CD7.xml @@ -0,0 +1,110 @@ + + + +Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family + + + +Author + +White, William T + + + +Author + +Corrigan, Shannon + + + +Author + +Yang, Lei + + + +Author + +Henderson, Aaron C + + + +Author + +Bazinet, Adam L + + + +Author + +Swofford, David L + + + +Author + +Naylor, Gavin J P + +text + + +Zoological Journal of the Linnean Society + + +2018 + +2018-01-31 + + +182 + + +1 + + +50 +75 + + + + +http://academic.oup.com/zoolinnean/article/182/1/50/3886052 + +journal article +10.1093/zoolinnean/zlx018 +0024-4082 +14812581 + + + + + + + +MOBULA +ALFREDI + +( +KREFFT +, 1868) + + + + +Not retained, tissue sampled +: Tissue accessions GN15457, GN15458, GN15459 and GN15460, +South Africa +. + + + + +All specimens were nominally identified as + +M. alfredi + +. + + + + \ No newline at end of file diff --git a/data/73/36/44/733644600C5A6862FF4AF8A4FC6739FD.xml b/data/73/36/44/733644600C5A6862FF4AF8A4FC6739FD.xml new file mode 100644 index 00000000000..687880ee7cf --- /dev/null +++ b/data/73/36/44/733644600C5A6862FF4AF8A4FC6739FD.xml @@ -0,0 +1,316 @@ + + + +Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family + + + +Author + +White, William T + + + +Author + +Corrigan, Shannon + + + +Author + +Yang, Lei + + + +Author + +Henderson, Aaron C + + + +Author + +Bazinet, Adam L + + + +Author + +Swofford, David L + + + +Author + +Naylor, Gavin J P + +text + + +Zoological Journal of the Linnean Society + + +2018 + +2018-01-31 + + +182 + + +1 + + +50 +75 + + + + +http://academic.oup.com/zoolinnean/article/182/1/50/3886052 + +journal article +10.1093/zoolinnean/zlx018 +0024-4082 +14812581 + + + + + + + +MOBULA +BIROSTRIS + +( + +WALBAUM +, 1792 + +) + + + + + +CSIRO +H 6446-02 +(one clasper only), adult male +461.4 cm + + +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +18 August 2005 + + +; + +CSIRO +H 7791-01 +(dorsal fin only) + +, + +CSIRO +H 7791-02 +(dorsal fin only), +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +5 October 2009 + + +; + +field code BRU-043, +Philippines +, + +20 April 2007 + + +. + + + + +Photographed (not retained) +: + +male embryo +60.9 cm +DW +, +Pelabuhanratu +landing site, +West Java +, +Indonesia +; female +493 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +25 March 2002 + + +; + +female +412.6 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +25 April 2004 + + +; + +female +337.6 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +26 April 2004 + + +; + +female +377.4 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +13 July 2004 + + +; + +adult male +340.6 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +9 March 2005 + + +; + +male +289.1 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +11 March 2005 + + +; + +adult male +396 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +13 July 2005 + + +; + +male +270 cm +DW +(tissue accession +GN6791 +), +Cilacap +landing site, +Central Java +, +Indonesia +, + +19 October 2008 + + +. + + +Not retained, tissue sampled +: + +Tissue +accessions GN10559, GN10560, GN10561, GN10568, +Japan +, + +26 September 2012 + + +. + + +All specimens were nominally identified as + +M. birostris + +. + + + + \ No newline at end of file diff --git a/data/73/36/44/733644600C5C6867FC34FA77FD1F3F2B.xml b/data/73/36/44/733644600C5C6867FC34FA77FD1F3F2B.xml new file mode 100644 index 00000000000..dffe38185f0 --- /dev/null +++ b/data/73/36/44/733644600C5C6867FC34FA77FD1F3F2B.xml @@ -0,0 +1,470 @@ + + + +Phylogeny of the manta and devilrays (Chondrichthyes: obulidae), with an updated taxonomic arrangement for the family + + + +Author + +White, William T + + + +Author + +Corrigan, Shannon + + + +Author + +Yang, Lei + + + +Author + +Henderson, Aaron C + + + +Author + +Bazinet, Adam L + + + +Author + +Swofford, David L + + + +Author + +Naylor, Gavin J P + +text + + +Zoological Journal of the Linnean Society + + +2018 + +2018-01-31 + + +182 + + +1 + + +50 +75 + + + + +http://academic.oup.com/zoolinnean/article/182/1/50/3886052 + +journal article +10.1093/zoolinnean/zlx018 +0024-4082 +14812581 + + + + + + + +MOBULA +THURSTONI + +( +LLOYD +, 1908) + + + + + +CSIRO +H 7774-01 +(juvenile male +78.7 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +14 July 2005 + +; +CSIRO +H 7775-01 +(head only), ~ +210 cm +DW +, +CSIRO +H 7775-02 +, ~ +166 cm +DW +, Tanjung Luar landing site, Lombok, +Indonesia +, + +7 October 2009 + +; +HUMZ 114050 +, juvenile male +86 cm +DW +, +119.1 cm +TL, Usujiri, +Japan +, + +24 August 1989 + +; +MZB 15007 +, juvenile female +82.6 cm +DW +, Tanjung Luar landing site, Lombok, +Indonesia +, + +13 July 2004 + +; +MZB 15037 +, female +94 cm +DW +, Tanjung Luar landing site, Lombok, +Indonesia +, + +12 July 2005 + +; +MZB 15444 +(tissue accession +GN11237 +), female +91.5 cm +DW +, Cilacap landing site, Central Java, +Indonesia +, + +11 June 2002 + +; +RMNH +unregistered, male embryo ~ +42 cm +DW +, no collection data; +SMEC +KBU 1 +15397, male embryo +34.7 cm +DW +, +Sabah +, +Malaysia +, + +15 March 1997 + +. + + + + + +Photographed (not retained) +: + +Field code BJ-330 (tissue accession +GN5263 +), male +96 cm +DW +, +Loreto +, +Gulf of California +, +Mexico +, + +29 August 1993 + + +; + +field code BJ-360, male +83 cm +DW +, +Loreto +, +Gulf of California +, +Mexico +, + +1 September 1993 + + +; + +field code BJ-429 (tissue accession +GN5284 +), female +180 cm +DW +, +La Paz +, +Gulf of California +, +Mexico +, + +25 September 1993 + + +; + +field code BJ-434, female +149 cm +DW +, +La Paz +, +Gulf of California +, +Mexico +, + +26 September 1993 + + +; + +field code BJ-705 (tissue accession +GN1560 +), male +172 cm +DW +, BJ-706 (tissue accession +GN1561 +), male +169 cm +DW +, +Santa Rosalia +, +Gulf of California +, +Mexico +, + +13 June 1996 + + +; + +field codes SP-10, female +115.5 cm +TL, SP-11, male +126 cm +TL, +Gulf of California +, +Mexico +, + +18 July 1994 + + +; + +male +145 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +10 September 2004 + + +; + +female +107.1 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +12 October 2004 + + +; + +male +111.5 cm +DW +, +Kedonganan +fish market, +Bali +, +Indonesia +, + +7 July 2005 + + +; + +female +113 cm +DW +, +Tanjung Luar +landing site, +Lombok +, +Indonesia +, + +12 July 2005 + + +. + + +Not retained, tissue sampled +: + +Field code BJ-351 (tissue accession +GN5268 +), male +89 cm +DW +, +Loreto +, +Gulf of California +, +Mexico +, + +1 September 1993 + + +; + +field code BJ-378 (tissue accession +GN5270 +), male +170 cm +DW +, +La Paz +, +Gulf of California +, +Mexico +, + +6 September 1993 + + +; + +field code BJ-411 (tissue accession +GN5277 +), male +171 cm +DW +, +La Paz +, +Gulf of California +, +Mexico +, + +11 September 1993 + + +; + +field code BJ-431 (tissue accession +GN5286 +), male +172 cm +DW +, +La Paz +, +Gulf of California +, +Mexico +, + +25 September 1993 + + +; + +tissue accession GN9725, male, Muttrah, +Oman +, + +3 August 2010 + + +; + +tissue accession GN9728, male, Muttrah, +Oman +, + +17 August 2010 + + +. + + + + \ No newline at end of file diff --git a/data/7C/41/6C/7C416C21FFC8F011FDE6FA85FD69FB26.xml b/data/7C/41/6C/7C416C21FFC8F011FDE6FA85FD69FB26.xml index e5c9fa74192..56a50d91a8d 100644 --- a/data/7C/41/6C/7C416C21FFC8F011FDE6FA85FD69FB26.xml +++ b/data/7C/41/6C/7C416C21FFC8F011FDE6FA85FD69FB26.xml @@ -1,66 +1,66 @@ - - - -A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna + + + +A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna - - -Author + + +Author -Awad, Jessica -0F70AC80-70B4-4AED-BF6E-A191DF4F68BB -State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany. -jessica.awad@smns-bw.de +Awad, Jessica +0F70AC80-70B4-4AED-BF6E-A191DF4F68BB +State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany. +jessica.awad@smns-bw.de - - -Author + + +Author -Zimmermann, Dominique -57F2F5FE-84D9-43DE-AC26-4720B313B0BD -History Museum Vienna, Burgring 7, 1010 Vienna, Austria. -dominique.zimmermann@nhm-wien.ac.at +Zimmermann, Dominique +57F2F5FE-84D9-43DE-AC26-4720B313B0BD +History Museum Vienna, Burgring 7, 1010 Vienna, Austria. +dominique.zimmermann@nhm-wien.ac.at - - -Author + + +Author -Talamas, Elijah -FDE12E40-BFCE-444A-AFAD-9A214A129345 -Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA. -elijah.talamas@fdacs.gov +Talamas, Elijah +FDE12E40-BFCE-444A-AFAD-9A214A129345 +Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA. +elijah.talamas@fdacs.gov -text - - -European Journal of Taxonomy +text + + +European Journal of Taxonomy - -2024 - -2024-06-18 + +2024 + +2024-06-18 - -938 + +938 - -1 -58 + +1 +58 - -https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639 + +https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639 -journal article -298671 -10.5852/ejt.2024.938.2565 -b7c20ad6-4993-48e2-b202-3646dcad0714 -2118-9773 -12106502 -A7C46449-1DA9-4D01-A145-04AA66BBAA63 +journal article +298671 +10.5852/ejt.2024.938.2565 +b7c20ad6-4993-48e2-b202-3646dcad0714 +2118-9773 +12106502 +A7C46449-1DA9-4D01-A145-04AA66BBAA63 - + @@ -259,7 +259,7 @@ Szabó, 1966: 422 , 442. Type species - + Hadronotus lymantriae Masner, 1958 @@ -331,7 +331,7 @@ by original designation. Kieffer 1926: 453 (junior synonym of - + Hadronotus Förster, 1856 diff --git a/data/7C/41/6C/7C416C21FFCDF012FDDDF97FFE72FE2A.xml b/data/7C/41/6C/7C416C21FFCDF012FDDDF97FFE72FE2A.xml index d4c1c5cd013..5a181f2153a 100644 --- a/data/7C/41/6C/7C416C21FFCDF012FDDDF97FFE72FE2A.xml +++ b/data/7C/41/6C/7C416C21FFCDF012FDDDF97FFE72FE2A.xml @@ -1,70 +1,70 @@ - - - -A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna + + + +A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna - - -Author + + +Author -Awad, Jessica -0F70AC80-70B4-4AED-BF6E-A191DF4F68BB -State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany. -jessica.awad@smns-bw.de +Awad, Jessica +0F70AC80-70B4-4AED-BF6E-A191DF4F68BB +State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany. +jessica.awad@smns-bw.de - - -Author + + +Author -Zimmermann, Dominique -57F2F5FE-84D9-43DE-AC26-4720B313B0BD -History Museum Vienna, Burgring 7, 1010 Vienna, Austria. -dominique.zimmermann@nhm-wien.ac.at +Zimmermann, Dominique +57F2F5FE-84D9-43DE-AC26-4720B313B0BD +History Museum Vienna, Burgring 7, 1010 Vienna, Austria. +dominique.zimmermann@nhm-wien.ac.at - - -Author + + +Author -Talamas, Elijah -FDE12E40-BFCE-444A-AFAD-9A214A129345 -Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA. -elijah.talamas@fdacs.gov +Talamas, Elijah +FDE12E40-BFCE-444A-AFAD-9A214A129345 +Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA. +elijah.talamas@fdacs.gov -text - - -European Journal of Taxonomy +text + + +European Journal of Taxonomy - -2024 - -2024-06-18 + +2024 + +2024-06-18 - -938 + +938 - -1 -58 + +1 +58 - -https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639 + +https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639 -journal article -298671 -10.5852/ejt.2024.938.2565 -b7c20ad6-4993-48e2-b202-3646dcad0714 -2118-9773 -12106502 -A7C46449-1DA9-4D01-A145-04AA66BBAA63 +journal article +298671 +10.5852/ejt.2024.938.2565 +b7c20ad6-4993-48e2-b202-3646dcad0714 +2118-9773 +12106502 +A7C46449-1DA9-4D01-A145-04AA66BBAA63 - + - + Hadronotus laticeps Kieffer, 1908 @@ -75,7 +75,7 @@ - + Hadronotus laticeps Kieffer, 1908: 144–145 @@ -101,7 +101,7 @@ locality: - + Hadronotus laticeps – diff --git a/data/7C/41/6C/7C416C21FFCDF013FDABFB38FB97F9BC.xml b/data/7C/41/6C/7C416C21FFCDF013FDABFB38FB97F9BC.xml index 6bdab48f18a..0ead1a718d0 100644 --- a/data/7C/41/6C/7C416C21FFCDF013FDABFB38FB97F9BC.xml +++ b/data/7C/41/6C/7C416C21FFCDF013FDABFB38FB97F9BC.xml @@ -1,70 +1,70 @@ - - - -A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna + + + +A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna - - -Author + + +Author -Awad, Jessica -0F70AC80-70B4-4AED-BF6E-A191DF4F68BB -State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany. -jessica.awad@smns-bw.de +Awad, Jessica +0F70AC80-70B4-4AED-BF6E-A191DF4F68BB +State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany. +jessica.awad@smns-bw.de - - -Author + + +Author -Zimmermann, Dominique -57F2F5FE-84D9-43DE-AC26-4720B313B0BD -History Museum Vienna, Burgring 7, 1010 Vienna, Austria. -dominique.zimmermann@nhm-wien.ac.at +Zimmermann, Dominique +57F2F5FE-84D9-43DE-AC26-4720B313B0BD +History Museum Vienna, Burgring 7, 1010 Vienna, Austria. +dominique.zimmermann@nhm-wien.ac.at - - -Author + + +Author -Talamas, Elijah -FDE12E40-BFCE-444A-AFAD-9A214A129345 -Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA. -elijah.talamas@fdacs.gov +Talamas, Elijah +FDE12E40-BFCE-444A-AFAD-9A214A129345 +Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA. +elijah.talamas@fdacs.gov -text - - -European Journal of Taxonomy +text + + +European Journal of Taxonomy - -2024 - -2024-06-18 + +2024 + +2024-06-18 - -938 + +938 - -1 -58 + +1 +58 - -https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639 + +https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639 -journal article -298671 -10.5852/ejt.2024.938.2565 -b7c20ad6-4993-48e2-b202-3646dcad0714 -2118-9773 -12106502 -A7C46449-1DA9-4D01-A145-04AA66BBAA63 +journal article +298671 +10.5852/ejt.2024.938.2565 +b7c20ad6-4993-48e2-b202-3646dcad0714 +2118-9773 +12106502 +A7C46449-1DA9-4D01-A145-04AA66BBAA63 - + - + Hadronotus exsculptus Förstelr, 1861 @@ -75,7 +75,7 @@ Förstelr, 1861 - + Hadronotus exsculptus Förster, 1861: 41 diff --git a/data/7C/41/6C/7C416C21FFCEF013FDC5F8BEFD00FB7D.xml b/data/7C/41/6C/7C416C21FFCEF013FDC5F8BEFD00FB7D.xml index cd068937ff9..4ac5d7bd80e 100644 --- a/data/7C/41/6C/7C416C21FFCEF013FDC5F8BEFD00FB7D.xml +++ b/data/7C/41/6C/7C416C21FFCEF013FDC5F8BEFD00FB7D.xml @@ -1,71 +1,71 @@ - - - -A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna + + + +A photographic type catalogue of Platygastroidea (Insecta, Hymenoptera) in the Natural History Museum Vienna - - -Author + + +Author -Awad, Jessica -0F70AC80-70B4-4AED-BF6E-A191DF4F68BB -State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany. -jessica.awad@smns-bw.de +Awad, Jessica +0F70AC80-70B4-4AED-BF6E-A191DF4F68BB +State Museum of Natural History Stuttgart, Rosenstein 1, 70191 Stuttgart, Germany. +jessica.awad@smns-bw.de - - -Author + + +Author -Zimmermann, Dominique -57F2F5FE-84D9-43DE-AC26-4720B313B0BD -History Museum Vienna, Burgring 7, 1010 Vienna, Austria. -dominique.zimmermann@nhm-wien.ac.at +Zimmermann, Dominique +57F2F5FE-84D9-43DE-AC26-4720B313B0BD +History Museum Vienna, Burgring 7, 1010 Vienna, Austria. +dominique.zimmermann@nhm-wien.ac.at - - -Author + + +Author -Talamas, Elijah -FDE12E40-BFCE-444A-AFAD-9A214A129345 -Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA. -elijah.talamas@fdacs.gov +Talamas, Elijah +FDE12E40-BFCE-444A-AFAD-9A214A129345 +Florida Department of Agriculture and Consumer Services, Division of Plant Industry, 1911 SW 34 St., Gainesville, FL 32601, USA. +elijah.talamas@fdacs.gov -text - - -European Journal of Taxonomy +text + + +European Journal of Taxonomy - -2024 - -2024-06-18 + +2024 + +2024-06-18 - -938 + +938 - -1 -58 + +1 +58 - -https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639 + +https://europeanjournaloftaxonomy.eu/index.php/ejt/article/download/2565/11639 -journal article -298671 -10.5852/ejt.2024.938.2565 -b7c20ad6-4993-48e2-b202-3646dcad0714 -2118-9773 -12106502 -A7C46449-1DA9-4D01-A145-04AA66BBAA63 +journal article +298671 +10.5852/ejt.2024.938.2565 +b7c20ad6-4993-48e2-b202-3646dcad0714 +2118-9773 +12106502 +A7C46449-1DA9-4D01-A145-04AA66BBAA63 - + Genus - + Hadronotus Förster, 1856 @@ -76,7 +76,7 @@ Genus - + Hadronotus Förster, 1856: 101 @@ -84,7 +84,7 @@ Genus , 105. Type species - + Hadronotus exsculptus Förster, 1861 @@ -113,7 +113,7 @@ Dodd, 1913: 171 . Type species - + Hadronotus pentatomus Dodd, 1913 @@ -189,7 +189,7 @@ by monotypy. - + Hadronotus – diff --git a/data/EA/04/87/EA0487FAFFDFFFCBEA912BC92869279E.xml b/data/EA/04/87/EA0487FAFFDFFFCBEA912BC92869279E.xml index cd266114a5e..e81ddc483ca 100644 --- a/data/EA/04/87/EA0487FAFFDFFFCBEA912BC92869279E.xml +++ b/data/EA/04/87/EA0487FAFFDFFFCBEA912BC92869279E.xml @@ -1,58 +1,59 @@ - - - -A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria + + + +A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria - - -Author + + +Author -Martin, Sarah K. +Martin, Sarah K. - - -Author + + +Author -Skidmore, Luke I. +Skidmore, Luke I. - - -Author + + +Author -Stilwell, Jeffrey D. +Stilwell, Jeffrey D. -text - - -Zootaxa +text + + +Zootaxa - -2016 - -4137 + +2016 + +4137 - -1 + +1 - -95 -107 + +95 +107 -journal article -10.11646/zootaxa.4137.1.7 -f88ca779-0496-4982-95e8-826d29bbc163 -1175-5326 -255201 -EA49068A-884D-4B79-AF5F-82910028EE23 +journal article +38613 +10.11646/zootaxa.4137.1.7 +f88ca779-0496-4982-95e8-826d29bbc163 +1175-5326 +255201 +EA49068A-884D-4B79-AF5F-82910028EE23 - + - + Koonwarraphis rotundafrons sp. nov. @@ -61,7 +62,7 @@ ( -Figs 2–4 +Figs 2–4 ) @@ -92,14 +93,14 @@ From the Latin words Description. Body ( -Fig. 2 +Fig. 2 ). 2.5 mm long; forewings displaced and partially crumpled, obscuring some parts of the venation and body features. Head ( -Fig. 3 +Fig. 3 A–D,F). Maximum width 0.5 mm , widest at compound eyes; head wider than long, length 0.5x width. Frons enlarged, bulging apically in a gently rounded curve, with prominent ‘v’ shaped ornament positioned in front of ocelli and extending to posterior margin of head; lateral sutures faint, extending from the lateral margins between the compound eyes and ocelli; epicranial suture short and relatively faint, extending forward from lateral sutures but apparently not reaching front of frons. Antenna @@ -110,10 +111,10 @@ long, 0.1 mm wide, extending 0.6x length of body, just posterior of hind coxae. Distal end of rostrum apparently narrowed, divided. - + FIGURE 2. - + Koonwarraphis rotundafrons gen. & sp. nov. @@ -122,10 +123,10 @@ wide, extending 0.6x length of body, just posterior of hind coxae. Distal end of . A. Photomicrograph of the entire fossil; B. same image under SEM. Scale bar: 1 mm. - + FIGURE 3. - + Koonwarraphis rotundafrons gen. & sp. nov. @@ -134,10 +135,10 @@ wide, extending 0.6x length of body, just posterior of hind coxae. Distal end of . A. Aphid thorax and head; B. same area as C, imaged under SEM, with thoracic sclerites labelled; C. close-up of antenna, showing segments and rhinaria; D. SEM image of antennal segments III and IV, showing rhinaria; E. distal abdomen; F. distal tip of rostrum. Abbreviations: fr = frons; ey = eye, oc = ocelli, an = antennae flagellum, prn = pronotum, prsc = praescutum, sct2 = mesoscutum, scl2 = mesoscutellum, pra = praealare, pn2 = mesopostnotum, m = membrane, rh = secondary rhinaria, hf = hind leg femur, htb = hind leg tibia, ap = anal plates, cd = cauda?, ro = distal rostrum, hc = hind leg coxa, htr = hind leg trochanter. Scale bars: 0.5 mm for parts A and E, and 0.25 mm for parts C and F. - + FIGURE 4. - + Koonwarraphis rotundafrons gen. & sp. nov. @@ -148,7 +149,7 @@ wide, extending 0.6x length of body, just posterior of hind coxae. Distal end of Thorax ( -Fig. 3 +Fig. 3 A–B). Pronotum 0.5 mm long; roughly trapezoidal, anterior width subequal to base of head, widening gently to become subequal to mesoscutum at posterior; central portion of pronotum more strongly sclerotized than laterally. Mesothorax anterior edge broader than head, praealare extended out into ‘shoulders’ slightly wider than the remaining mesothorax; mesoscutum, mesopraescutum, and mesoscutellum strongly domed and clearly defined; mesopraescutum and paired mesoscutum plates large and triangular, mesoscutellum narrow, rectangular, apparently divided centrally; membranous area between paired mesoscutum plates and mesoscutellum large, triangular. Metanotum roughly rectangular in shape, narrow; similar in width to mesoscutellum, divided ventrally; other metathoracic segments difficult to discern individually. Combined thoracic segments ~ @@ -177,7 +178,7 @@ wide; tarsi apparently short, tarsal segments and tarsal claws indistinct. Legs Wings ( -Fig. 4 +Fig. 4 ). Forewing preserved length 2.6 mm ; wing triangular, costal margin gently curved, posterior margin straightened, apical margin incomplete. Both forewings missing apex; right forewing with costal region apparently twisted or crumpled, overprinting itself. Costal area of moderate width, R, M, and Cu stems fused basally (main vein), terminating in large, lozenge-shaped pterostigma @@ -192,7 +193,7 @@ centrally. M diverging from main vein roughly halfway between pterostigma and Cu Abdomen ( -Fig. 3 +Fig. 3 E). Rounded, as wide as or slightly wider than thoracic segments; maximum width 0.9 mm , length diff --git a/data/EA/04/87/EA0487FAFFDFFFCFEA912C3B280D27EF.xml b/data/EA/04/87/EA0487FAFFDFFFCFEA912C3B280D27EF.xml index b6faeb255f5..f1ef44099be 100644 --- a/data/EA/04/87/EA0487FAFFDFFFCFEA912C3B280D27EF.xml +++ b/data/EA/04/87/EA0487FAFFDFFFCFEA912C3B280D27EF.xml @@ -1,59 +1,60 @@ - - - -A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria + + + +A first record of Cretaceous aphids (Hemiptera, Sternorrhyncha, Aphidomorpha) in Australia, from the Lower Cretaceous Koonwarra Fossil Bed, Victoria - - -Author + + +Author -Martin, Sarah K. +Martin, Sarah K. - - -Author + + +Author -Skidmore, Luke I. +Skidmore, Luke I. - - -Author + + +Author -Stilwell, Jeffrey D. +Stilwell, Jeffrey D. -text - - -Zootaxa +text + + +Zootaxa - -2016 - -4137 + +2016 + +4137 - -1 + +1 - -95 -107 + +95 +107 -journal article -10.11646/zootaxa.4137.1.7 -f88ca779-0496-4982-95e8-826d29bbc163 -1175-5326 -255201 -EA49068A-884D-4B79-AF5F-82910028EE23 +journal article +38613 +10.11646/zootaxa.4137.1.7 +f88ca779-0496-4982-95e8-826d29bbc163 +1175-5326 +255201 +EA49068A-884D-4B79-AF5F-82910028EE23 - + Genus - + Koonwarraphis gen. nov. @@ -65,7 +66,7 @@ Genus Type species. - + Koonwarraphis rotundafrons