added EB
This commit is contained in:
parent
64cb36270b
commit
14a5337c96
1394 changed files with 302981 additions and 0 deletions
100
data/EB/19/09/EB1909F5D651799AB8554F6683693EA5.xml
Normal file
100
data/EB/19/09/EB1909F5D651799AB8554F6683693EA5.xml
Normal file
|
|
@ -0,0 +1,100 @@
|
|||
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.711.14753" ID-PMC="PMC5674181" ID-Pensoft-Pub="1313-2970-711-1" ID-Pensoft-UUID="FFC4FE3CFFAAFF87F42FFF91FFACFFC3" ID-PubMed="29134026" ID-Zenodo-Dep="1149948" ID-ZooBank="D94E8B43C7A7447386D4FFBFAD6852DC" ModsDocID="1313-2970-711-1" checkinTime="1508771341586" checkinUser="pensoft" docAuthor="Lopes, Daniela A., Gomes, Delir Correa & Knoff, Marcelo" docDate="2017" docId="EB1909F5D651799AB8554F6683693EA5" docLanguage="en" docName="ZooKeys 711: 1-52" docOrigin="ZooKeys 711" docPubDate="2017-10-23" docSource="http://dx.doi.org/10.3897/zookeys.711.14753" docTitle="Diplotriaena zederi Pinto, Vicente & Noronha 1981" docType="treatment" docVersion="6" id="FFC4FE3CFFAAFF87F42FFF91FFACFFC3" lastPageNumber="15" masterDocId="FFC4FE3CFFAAFF87F42FFF91FFACFFC3" masterDocTitle="Type material of Acanthocephala, Nematoda and other non-helminths phyla (Cnidaria, Annelida, and Arthropoda) housed in the Helminthological Collection of the Oswaldo Cruz Institute / FIOCRUZ (CHIOC), Rio de Janeiro, Brazil, from 1979 to 2016" masterLastPageNumber="52" masterPageNumber="1" pageNumber="15" updateTime="1668165017486" updateUser="ExternalLinkService">
|
||||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo>
|
||||
<mods:title>Type material of Acanthocephala, Nematoda and other non-helminths phyla (Cnidaria, Annelida, and Arthropoda) housed in the Helminthological Collection of the Oswaldo Cruz Institute / FIOCRUZ (CHIOC), Rio de Janeiro, Brazil, from 1979 to 2016</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Lopes, Daniela A.</mods:namePart>
|
||||
<mods:affiliation>Laboratorio de Helmintos Parasitos de Vertebrados, Instituto Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365 Rio de Janeiro, RJ, Brazil</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Gomes, Delir Correa</mods:namePart>
|
||||
<mods:affiliation>Laboratorio de Helmintos Parasitos de Vertebrados, Instituto Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365 Rio de Janeiro, RJ, Brazil</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Knoff, Marcelo</mods:namePart>
|
||||
<mods:affiliation>Laboratorio de Helmintos Parasitos de Vertebrados, Instituto Oswaldo Cruz, FIOCRUZ, Av. Brasil, 4365 Rio de Janeiro, RJ, Brazil</mods:affiliation>
|
||||
<mods:nameIdentifier type="email">knoffm@ioc.fiocruz.br</mods:nameIdentifier>
|
||||
</mods:name>
|
||||
<mods:typeOfResource>text</mods:typeOfResource>
|
||||
<mods:relatedItem type="host">
|
||||
<mods:titleInfo>
|
||||
<mods:title>ZooKeys</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:part>
|
||||
<mods:date>2017</mods:date>
|
||||
<mods:detail type="pubDate">
|
||||
<mods:number>2017-10-23</mods:number>
|
||||
</mods:detail>
|
||||
<mods:detail type="volume">
|
||||
<mods:number>711</mods:number>
|
||||
</mods:detail>
|
||||
<mods:extent unit="page">
|
||||
<mods:start>1</mods:start>
|
||||
<mods:end>52</mods:end>
|
||||
</mods:extent>
|
||||
</mods:part>
|
||||
</mods:relatedItem>
|
||||
<mods:location>
|
||||
<mods:url>http://dx.doi.org/10.3897/zookeys.711.14753</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification>journal article</mods:classification>
|
||||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.711.14753</mods:identifier>
|
||||
<mods:identifier type="Pensoft-Pub">1313-2970-711-1</mods:identifier>
|
||||
<mods:identifier type="ZooBank">D94E8B43C7A7447386D4FFBFAD6852DC</mods:identifier>
|
||||
<mods:identifier type="Pensoft-UUID">FFC4FE3CFFAAFF87F42FFF91FFACFFC3</mods:identifier>
|
||||
<mods:identifier type="Zenodo-Dep">1149948</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment ID-GBIF-Taxon="135452797" LSID="urn:lsid:plazi:treatment:EB1909F5D651799AB8554F6683693EA5" httpUri="http://treatment.plazi.org/id/EB1909F5D651799AB8554F6683693EA5" lastPageNumber="15" pageId="14" pageNumber="15">
|
||||
<subSubSection pageId="14" pageNumber="15" type="nomenclature">
|
||||
<paragraph pageId="14" pageNumber="15">
|
||||
<taxonomicName LSID="EB1909F5-D651-799A-B855-4F6683693EA5" authority="Pinto, Vicente & Noronha, 1981" authorityName="Pinto, Vicente & Noronha" authorityYear="1981" class="Chromadorea" family="Diplotriaenidae" genus="Diplotriaena" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Diplotriaena zederi" order="Rhabditida" pageId="14" pageNumber="15" phylum="Nematoda" rank="species" species="zederi">Diplotriaena zederi Pinto, Vicente & Noronha, 1981</taxonomicName>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="14" pageNumber="15" type="type host">
|
||||
<paragraph pageId="14" pageNumber="15">Type host.</paragraph>
|
||||
<paragraph pageId="14" pageNumber="15">
|
||||
<taxonomicName baseAuthorityName="Vieillot" baseAuthorityYear="1818" class="Aves" family="Furnariidae" genus="Xiphocolaptes" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Xiphocolaptes albicollis" order="Passeriformes" pageId="14" pageNumber="15" phylum="Chordata" rank="species" species="albicollis">
|
||||
<emphasis italics="true" pageId="14" pageNumber="15">Xiphocolaptes albicollis</emphasis>
|
||||
</taxonomicName>
|
||||
(Vieillot, 1818) (
|
||||
<taxonomicName authorityName="Lesson" authorityYear="1840" class="Aves" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" lsidName="" pageId="14" pageNumber="15" phylum="Chordata" rank="class">Aves</taxonomicName>
|
||||
:
|
||||
<taxonomicName authorityName="Gray" authorityYear="1840" class="Aves" family="Dendrocolaptidae" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="" order="Passeriformes" pageId="14" pageNumber="15" phylum="Chordata" rank="family">Dendrocolaptidae</taxonomicName>
|
||||
).
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="14" pageNumber="15" type="infection site">
|
||||
<paragraph pageId="14" pageNumber="15">Infection site.</paragraph>
|
||||
<paragraph pageId="14" pageNumber="15">Body cavity.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="14" pageNumber="15" type="type locality">
|
||||
<paragraph pageId="14" pageNumber="15">Type locality.</paragraph>
|
||||
<paragraph pageId="14" pageNumber="15">Brazil, Rio de Janeiro State, Angra dos Reis.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="14" pageNumber="15" type="holotype">
|
||||
<paragraph pageId="14" pageNumber="15">Holotype.</paragraph>
|
||||
<paragraph pageId="14" pageNumber="15">♂ CHIOC 31826 a.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="14" pageNumber="15" type="paratypes">
|
||||
<paragraph pageId="14" pageNumber="15">Paratypes.</paragraph>
|
||||
<paragraph pageId="14" pageNumber="15">CHIOC 31826 b-d, g (♂♂), e-f, h (♀♀), 31827 a (♂), b-c (♀♀).</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="14" pageNumber="15" type="reference">
|
||||
<paragraph pageId="14" pageNumber="15">Reference.</paragraph>
|
||||
<paragraph pageId="14" pageNumber="15">
|
||||
<bibRefCitation author="Pinto, RM" journalOrPublisher="Atas da Sociedade de Biologia do Rio de Janeiro" pageId="38" pageNumber="39" pagination="37 - 38" refId="B89" refString="Pinto, RM, Vicente, JJ, Noronha, D, 1981. Diplotriaena zederi sp. n. (Diplotriaenidae, Filarioidea) from wood hewer (Xiphocolaptes albicollis albicollis) in Brazil. Atas da Sociedade de Biologia do Rio de Janeiro 22: 37 - 38" title="Diplotriaena zederi sp. n. (Diplotriaenidae, Filarioidea) from wood hewer (Xiphocolaptes albicollis albicollis) in Brazil." volume="22" year="1981">Pinto et al. (1981)</bibRefCitation>
|
||||
.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
208
data/EB/19/58/EB1958F733DB50889DD6AC725E16B769.xml
Normal file
208
data/EB/19/58/EB1958F733DB50889DD6AC725E16B769.xml
Normal file
|
|
@ -0,0 +1,208 @@
|
|||
<document ID-DOI="http://dx.doi.org/10.3897/zitteliana.96.e84187" ID-Pensoft-Pub="2747-8106-96-179" ID-Pensoft-UUID="FE0861D71BB454999EE6637C0D9B2B0C" ID-ZooBank="35B619086E6548B09A177281C2253391" ModsDocID="2747-8106-96-179" checkinTime="1670952513976" checkinUser="pensoft" docAuthor="Gruendel, Joachim, Keupp, Helmut, Lang, Fritz & Nuetzel, Alexander" docDate="2022" docId="EB1958F733DB50889DD6AC725E16B769" docLanguage="en" docName="Zitteliana 96: 179-221" docOrigin="Zitteliana 96" docPubDate="2022-12-12" docSource="http://dx.doi.org/10.3897/zitteliana.96.e84187" docTitle="Nerinea donosa Gründel & Keupp & Lang & Nützel 2022, sp. nov." docType="treatment" docUuid="0351A026-965F-4B49-8FEB-714BAEF2B779" docUuidSource="ZooBank" docVersion="1" id="FE0861D71BB454999EE6637C0D9B2B0C" lastPageNumber="179" masterDocId="FE0861D71BB454999EE6637C0D9B2B0C" masterDocTitle="Late Jurassic (Upper Kimmeridgian) Heterobranchia (Gastropoda) of the coral-facies of Saal near Kelheim and the viciniy of Nattheim (Germany)" masterLastPageNumber="221" masterPageNumber="179" pageNumber="179" updateTime="1670952513976" updateUser="pensoft">
|
||||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo>
|
||||
<mods:title>Late Jurassic (Upper Kimmeridgian) Heterobranchia (Gastropoda) of the coral-facies of Saal near Kelheim and the viciniy of Nattheim (Germany)</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Gruendel, Joachim</mods:namePart>
|
||||
<mods:affiliation>Institut fuer Geowissenschaften, Fachrichtung Palaeontologie, Freie Universitaet Berlin, Malteserstrasse 74 - 100, 12249 Berlin, Germany</mods:affiliation>
|
||||
<mods:nameIdentifier type="email">joachim.gruendel@lingua-pura.de</mods:nameIdentifier>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Keupp, Helmut</mods:namePart>
|
||||
<mods:affiliation>Institut fuer Geowissenschaften, Fachrichtung Palaeontologie, Freie Universitaet Berlin, Malteserstrasse 74 - 100, 12249 Berlin, Germany</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Lang, Fritz</mods:namePart>
|
||||
<mods:affiliation>Drosselweg 16, 96114 Hirschaid, Germany</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Nuetzel, Alexander</mods:namePart>
|
||||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-8852-7688</mods:nameIdentifier>
|
||||
<mods:affiliation>SNSB-Bayerische Staatssammlung fuer Palaeontologie und Geologie, Richard-Wagner-Str. 10, 80333 Muenchen, Germany & Department of Earth and Environmental Sciences, Paleontology and Geobiology, Ludwig-Maximilians-Universitaet Muenchen, Richard-Wagner-Str. 10, 80333 Muenchen, Germany</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:typeOfResource>text</mods:typeOfResource>
|
||||
<mods:relatedItem type="host">
|
||||
<mods:titleInfo>
|
||||
<mods:title>Zitteliana</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:part>
|
||||
<mods:date>2022</mods:date>
|
||||
<mods:detail type="pubDate">
|
||||
<mods:number>2022-12-12</mods:number>
|
||||
</mods:detail>
|
||||
<mods:detail type="volume">
|
||||
<mods:number>96</mods:number>
|
||||
</mods:detail>
|
||||
<mods:extent unit="page">
|
||||
<mods:start>179</mods:start>
|
||||
<mods:end>221</mods:end>
|
||||
</mods:extent>
|
||||
</mods:part>
|
||||
</mods:relatedItem>
|
||||
<mods:location>
|
||||
<mods:url>http://dx.doi.org/10.3897/zitteliana.96.e84187</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification>journal article</mods:classification>
|
||||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zitteliana.96.e84187</mods:identifier>
|
||||
<mods:identifier type="Pensoft-Pub">2747-8106-96-179</mods:identifier>
|
||||
<mods:identifier type="ZooBank">35B619086E6548B09A177281C2253391</mods:identifier>
|
||||
<mods:identifier type="Pensoft-UUID">FE0861D71BB454999EE6637C0D9B2B0C</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment LSID="urn:lsid:zoobank.org:act:0351A026-965F-4B49-8FEB-714BAEF2B779" httpUri="http://treatment.plazi.org/id/EB1958F733DB50889DD6AC725E16B769" lastPageNumber="179" pageId="0" pageNumber="179">
|
||||
<subSubSection pageId="0" pageNumber="179" type="nomenclature">
|
||||
<paragraph pageId="0" pageNumber="179">
|
||||
<taxonomicName LSID="https://zoobank.org/0351A026-965F-4B49-8FEB-714BAEF2B779" authority="Gründel & Keupp & Lang & Nützel, 2022" authorityName="Gründel & Keupp & Lang & Nützel" authorityYear="2022" class="Gastropoda" family="Nerineidae" genus="Nerinea" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nerinea donosa" pageId="0" pageNumber="179" phylum="Mollusca" rank="species" species="donosa" status="sp. nov.">Nerinea donosa</taxonomicName>
|
||||
<taxonomicNameLabel pageId="0" pageNumber="179">sp. nov.</taxonomicNameLabel>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="description">
|
||||
<paragraph pageId="0" pageNumber="179">
|
||||
<figureCitation captionStart="Plate 5" captionStartId="F5" captionText="Plate 5. (1 - 5) Nerinea donosa sp. nov. (1) Paratype, SNSB-BSPG 2021 XV 10, Saal (collection Lang), lateral view, height 18 mm. (2 - 4) Holotype, SNSB-BSPG 2021 XV 11, Saal (collection Lang); (2) lateral view, height 8.8 mm; (3) base, width 4.5 mm; (4) last whorl, height 4.5 mm. (5) Paratype, SNSB-BSPG 2021 XV 11, Saal (collection Keupp), lateral view, height 20 mm." figureDoi="10.3897/zitteliana.96.e84187.plate5" httpUri="https://binary.pensoft.net/fig/780383" pageId="0" pageNumber="179">Plate 5: figs 1-5</figureCitation>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="reference_group">
|
||||
<paragraph pageId="0" pageNumber="179">
|
||||
<taxonomicName authority="Gründel & Keupp & Lang & Nützel, 2022" authorityName="Gründel & Keupp & Lang & Nützel" authorityYear="2022" class="Gastropoda" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="" pageId="0" pageNumber="179" rank="superFamily" status="sp. nov." superFamily="Nerineoidea">2017 - Nerineoidea</taxonomicName>
|
||||
Nr. 7 -
|
||||
<normalizedToken originalValue="Gründel">Gruendel</normalizedToken>
|
||||
: 33, pl. 14D.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="etymology">
|
||||
<paragraph pageId="0" pageNumber="179">Derivatio nominis.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="179">
|
||||
Anagram of Latin
|
||||
<taxonomicName class="Gastropoda" family="Itieriidae" genus="Nerinea" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nerinea nodosa" pageId="0" pageNumber="179" phylum="Mollusca" rank="species" species="nodosa">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Nerinea nodosa</emphasis>
|
||||
</taxonomicName>
|
||||
, referring to the subsutural rows of nodes.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="holotype">
|
||||
<paragraph pageId="0" pageNumber="179">Holotype.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="179">SNSB-BSPG 2021 XV 11, collection Lang.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="locus typicus">
|
||||
<paragraph pageId="0" pageNumber="179">Locus typicus.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="179">Quarry Saal near Kelheim.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="stratum typicum">
|
||||
<paragraph pageId="0" pageNumber="179">Stratum typicum.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="179">Upper Kimmeridgian.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="paratypes">
|
||||
<paragraph pageId="0" pageNumber="179">Paratypes.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="179">Six incomplete or juvenile specimens from Saal: five specimens collection Lang (SNSB-BSPG 2021 XV 10, 13, 168-170), one specimen collection Keupp (SNSB-BSPG 2021 XV 12).</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="materials_examined">
|
||||
<paragraph pageId="0" pageNumber="179">Additional material.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="179">
|
||||
Three specimens without
|
||||
<typeStatus>type</typeStatus>
|
||||
status from Saal (collection Lang).
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="diagnosis">
|
||||
<paragraph pageId="0" pageNumber="179">Diagnosis.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="179">Shell moderately slender; subsutural row of strong nodes forming distinct ramp; spire gradate; transition from whorl face to base at distinct spiral, crest-like cord; base convex, with narrow umbilicus; aperture with two columellar plaits, one strong parietal and partly a palatal plait; with siphonal canal.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="description">
|
||||
<paragraph pageId="0" pageNumber="179">Description.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="179">The largest specimen is 20 mm high. The shell is moderately slender with relatively rapidly increasing whorls. The whorls are more than twice as wide as high. The whorls are ornamented with a subsutural row of strong nodes (8-10 nodes per whorl) occupying 1/2 to 2/3 of whorl height. The nodes demarcate the distinct ramp producing a gradate spire. The suture is accentuated by the ramp. The transition from whorl face to base is marked by a distinct, crest-like spiral cord which is not nodular, and is covered by the following whorls in spire whorls. The incompletely preserved aperture is narrow and has a siphonal canal. It has two columellar plaits, 1-2 parietal plaits and in some specimens a palatal plait. If two columellar plaits are present, the adapical one is weaker as the abapical. The outer lip is not preserved. The base is distinctly convex.</paragraph>
|
||||
<caption doi="10.3897/zitteliana.96.e84187.plate5" httpUri="https://binary.pensoft.net/fig/780383" pageId="0" pageNumber="179" start="Plate 5" startId="F5">
|
||||
<paragraph pageId="0" pageNumber="179">
|
||||
<emphasis bold="true" pageId="0" pageNumber="179">Plate 5.</emphasis>
|
||||
<emphasis bold="true" pageId="0" pageNumber="179">(1-5)</emphasis>
|
||||
<taxonomicName authorityName="Gründel & Keupp & Lang & Nützel" authorityYear="2022" class="Gastropoda" family="Itieriidae" genus="Nerinea" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nerinea donosa" pageId="0" pageNumber="179" phylum="Mollusca" rank="species" species="donosa">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Nerinea donosa</emphasis>
|
||||
</taxonomicName>
|
||||
sp. nov.
|
||||
<emphasis bold="true" pageId="0" pageNumber="179">(1)</emphasis>
|
||||
Paratype, SNSB-BSPG 2021 XV 10, Saal (collection Lang), lateral view, height 18 mm.
|
||||
<emphasis bold="true" pageId="0" pageNumber="179">(2-4)</emphasis>
|
||||
Holotype, SNSB-BSPG 2021 XV 11, Saal (collection Lang);
|
||||
<emphasis bold="true" pageId="0" pageNumber="179">(2)</emphasis>
|
||||
lateral view, height 8.8 mm;
|
||||
<emphasis bold="true" pageId="0" pageNumber="179">(3)</emphasis>
|
||||
base, width 4.5 mm;
|
||||
<emphasis bold="true" pageId="0" pageNumber="179">(4)</emphasis>
|
||||
last whorl, height 4.5 mm.
|
||||
<emphasis bold="true" pageId="0" pageNumber="179">(5)</emphasis>
|
||||
Paratype, SNSB-BSPG 2021 XV 11, Saal (collection Keupp), lateral view, height 20 mm.
|
||||
</paragraph>
|
||||
</caption>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="179" type="relationships">
|
||||
<paragraph pageId="0" pageNumber="179">Relationships.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="179">
|
||||
<taxonomicName authorityName="Deshayes" authorityYear="1827" class="Gastropoda" family="Itieriidae" genus="Nerinea" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nerinea mosae" pageId="0" pageNumber="179" phylum="Mollusca" rank="species" species="mosae">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Nerinea mosae</emphasis>
|
||||
</taxonomicName>
|
||||
Deshayes, 1827 has weaker subsutural nodes and lacks a strong spiral cord at the transition to the base.
|
||||
<taxonomicName authorityName="Gründel & Keupp & Lang & Nützel" authorityYear="2022" class="Gastropoda" family="Itieriidae" genus="Nerinea" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nerinea" pageId="0" pageNumber="179" phylum="Mollusca" rank="genus">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Nerinea</emphasis>
|
||||
</taxonomicName>
|
||||
(respectively
|
||||
<taxonomicName authorityName="Sharpe" authorityYear="1850" class="Gastropoda" family="Ptygmatididae" genus="Ptygmatis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Ptygmatis" pageId="0" pageNumber="179" phylum="Mollusca" rank="genus">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Ptygmatis</emphasis>
|
||||
</taxonomicName>
|
||||
)
|
||||
<taxonomicName class="Gastropoda" family="Nerineidae" genus="Phaneroptyxis" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Phaneroptyxis nogreti" pageId="0" pageNumber="179" phylum="Mollusca" rank="species" species="nogreti">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Phaneroptyxis nogreti</emphasis>
|
||||
</taxonomicName>
|
||||
Guirand &
|
||||
<normalizedToken originalValue="Ogérien">Ogerien</normalizedToken>
|
||||
, 1865 has, according to these authors and according to Loriol in
|
||||
<bibRefCitation author="Loriol, P de" journalOrPublisher="Der Steinkern" pageId="0" pageNumber="179" refId="B53" refString="Loriol, P de, Bourgeat, AE, 1886-1888. Etudes sur les mollusques des couches coralligenes de Valfin (Jura). Memoires de la Societe Paleontologique Suisse 13-15: 1-369." title="Etudes sur les mollusques des couches coralligenes de Valfin (Jura). Memoires de la Societe Paleontologique Suisse 13 - 15: 1 - 369." year="1886 - 1888">Loriol and Bourgeat (1886-1888)</bibRefCitation>
|
||||
, a similar shape but is larger and lacks a nodular ornament.
|
||||
<taxonomicName class="Gastropoda" family="Cerithiidae" genus="Cerithium" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Cerithium kelheimense" order="Littorinimorpha" pageId="0" pageNumber="179" phylum="Mollusca" rank="species" species="kelheimense">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Cerithium kelheimense</emphasis>
|
||||
</taxonomicName>
|
||||
Schlosser, 1882 lacks plaits and a spiral cord at the transition to the base.
|
||||
<taxonomicName authorityName="Gründel & Keupp & Lang & Nützel" authorityYear="2022" class="Gastropoda" family="Itieriidae" genus="Itieria" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Itieria" pageId="0" pageNumber="179" phylum="Mollusca" rank="genus">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Itieria</emphasis>
|
||||
</taxonomicName>
|
||||
(respectively
|
||||
<taxonomicName authorityName="Gründel & Keupp & Lang & Nützel" authorityYear="2022" class="Gastropoda" family="Itieriidae" genus="Nerinea" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nerinea" pageId="0" pageNumber="179" phylum="Mollusca" rank="genus">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Nerinea</emphasis>
|
||||
</taxonomicName>
|
||||
)
|
||||
<taxonomicName baseAuthorityName="d'Orbigny" baseAuthorityYear="1841" class="Gastropoda" family="Nerineidae" genus="Phaneroptyxis" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Phaneroptyxis moreana" pageId="0" pageNumber="179" phylum="Mollusca" rank="species" species="moreana">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Phaneroptyxis moreana</emphasis>
|
||||
</taxonomicName>
|
||||
<normalizedToken originalValue="d’Orbigny">d'Orbigny</normalizedToken>
|
||||
sensu
|
||||
<bibRefCitation author="Buvignier, A" journalOrPublisher="Paris, Bailliere" pageId="0" pageNumber="179" refId="B7" refString="Buvignier, A, 1852. Statistique geologique, mineralogique, metallurgique et paleontologique du Departement de la Meuse. Paris, Bailliere" title="Statistique geologique, mineralogique, metallurgique et paleontologique du Departement de la Meuse." year="1852">Buvignier (1852)</bibRefCitation>
|
||||
and
|
||||
<bibRefCitation author="Schlosser, M" journalOrPublisher="Palaeontographica" pageId="0" pageNumber="179" pagination="41 - 110" refId="B88" refString="Schlosser, M, 1882. Die Fauna des Kelheimer Diceras-Kalkes. I. Vertebrata, Crustacea, Cephalopoda und Gastropoda. Palaeontographica 28: 41 - 110" title="Die Fauna des Kelheimer Diceras-Kalkes. I. Vertebrata, Crustacea, Cephalopoda und Gastropoda." volume="28" year="1882">Schlosser (1882)</bibRefCitation>
|
||||
has a higher last whorl in relation to the spire height and it lacks a spiral cord at the transition to the base.
|
||||
<taxonomicName class="Gastropoda" family="Itieriidae" genus="Nerinea" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nerinea margaritifera" pageId="0" pageNumber="179" phylum="Mollusca" rank="species" species="margaritifera">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Nerinea margaritifera</emphasis>
|
||||
</taxonomicName>
|
||||
<normalizedToken originalValue="d’Archiac">d'Archiac</normalizedToken>
|
||||
, 1843 and
|
||||
<taxonomicName class="Gastropoda" family="Itieriidae" genus="Itieria" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Itieria multicoronata" pageId="0" pageNumber="179" phylum="Mollusca" rank="species" species="multicoronata">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Itieria multicoronata</emphasis>
|
||||
</taxonomicName>
|
||||
Zittel, 1873) lack a spiral cord at the transition to the base.
|
||||
<taxonomicName class="Gastropoda" family="Itieriidae" genus="Nerinea" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Nerinea catalloi" pageId="0" pageNumber="179" phylum="Mollusca" rank="species" species="catalloi">
|
||||
<emphasis italics="true" pageId="0" pageNumber="179">Nerinea catalloi</emphasis>
|
||||
</taxonomicName>
|
||||
Gemmellaro, 1870 is broader and stouter and has a higher last whorl in relation to the spire.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
67
data/EB/19/AB/EB19AB25BC27250EFDEC6E92977FDCFF.xml
Normal file
67
data/EB/19/AB/EB19AB25BC27250EFDEC6E92977FDCFF.xml
Normal file
|
|
@ -0,0 +1,67 @@
|
|||
<document ENCODING="UTF-8" ID-DOI="https://doi.org/10.5962/bhl.title.542" ID-GBIF-Dataset="57ea6fdb-2533-44e5-b60b-736758a88d19" ID-Zenodo-Dep="3922206" ID-ZooBank="2C6327E1-5560-4DB4-B9CA-76A0FA03D975" checkinTime="1593218702860" checkinUser="admin" docAuthor="Linnaeus, Carolus" docDate="1758" docId="EB19AB25BC27250EFDEC6E92977FDCFF" docLanguage="de" docName="Linnaeus1758Treatments.xml" docOrigin="Stockholm: Laurentius Salvius" docSource="https://archive.org/download/mobot31753000798865/mobot31753000798865.pdf" docTitle="Tipula hortorum Linnaeus, 1758, spec. nov." docType="treatment" docUuid="08966F35-66ED-4F04-B690-79359963FA96" docUuidSource="ZooBank" docVersion="14" lastPageNumber="585" masterDocId="3F896AFC21C459639D0D71D9EDB8875C" masterDocTitle="Systema Naturae per regna tria naturae: secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis" pageNumber="585" updateTime="1643600433100" updateUser="ExternalLinkService">
|
||||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo>
|
||||
<mods:title>Systema Naturae per regna tria naturae: secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Linnaeus, Carolus</mods:namePart>
|
||||
</mods:name>
|
||||
<mods:typeOfResource>text</mods:typeOfResource>
|
||||
<mods:originInfo>
|
||||
<mods:dateIssued>1758</mods:dateIssued>
|
||||
<mods:publisher>Laurentius Salvius</mods:publisher>
|
||||
<mods:place>
|
||||
<mods:placeTerm>Stockholm</mods:placeTerm>
|
||||
</mods:place>
|
||||
</mods:originInfo>
|
||||
<mods:location>
|
||||
<mods:url>https://archive.org/download/mobot31753000798865/mobot31753000798865.pdf</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification>book</mods:classification>
|
||||
<mods:identifier type="ZooBank">2C6327E1-5560-4DB4-B9CA-76A0FA03D975</mods:identifier>
|
||||
<mods:identifier type="DOI">https://doi.org/10.5962/bhl.title.542</mods:identifier>
|
||||
<mods:identifier type="Zenodo-Dep">3922206</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment ID-DOI="http://doi.org/10.5281/zenodo.3922716" ID-GBIF-Taxon="164811093" ID-Zenodo-Dep="3922716" LSID="urn:lsid:zoobank.org:act:08966F35-66ED-4F04-B690-79359963FA96" httpUri="http://treatment.plazi.org/id/EB19AB25BC27250EFDEC6E92977FDCFF" lastPageNumber="585" pageNumber="585" sourcePageUrl="https://www.biodiversitylibrary.org/page/727496">
|
||||
<subSubSection type="nomenclature">
|
||||
<paragraph pageNumber="585">
|
||||
<taxonomicName LSID="urn:lsid:zoobank.org:act:08966F35-66ED-4F04-B690-79359963FA96" authorityName="Linnaeus" authorityYear="1758" class="Insecta" family="Bibionidae" genus="Tipula" kingdom="Animalia" order="Diptera" phylum="Arthropoda" rank="species" species="hortorum" status="spec. nov." zbkClass="Insecta" zbkKingdom="Animalia" zbkOrder="Diptera">Tipula hortorum</taxonomicName>
|
||||
[
|
||||
<taxonomicNameLabel rank="species">spec. nov.</taxonomicNameLabel>
|
||||
]
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection type="description">
|
||||
<paragraph pageNumber="585">
|
||||
T. alis hyalinis: maculis sparsis albis obsoletis.
|
||||
<emphasis italics="true">Faun.</emphasis>
|
||||
svec. 1125.
|
||||
</paragraph>
|
||||
<emphasis italics="true">Raj. ins.</emphasis>
|
||||
72.
|
||||
<emphasis italics="true">n.</emphasis>
|
||||
6.
|
||||
<emphasis italics="true">Alb. ins. t.</emphasis>
|
||||
61.
|
||||
</subSubSection>
|
||||
<subSubSection type="distribution">
|
||||
<paragraph pageNumber="585">
|
||||
<emphasis italics="true">Habitat in</emphasis>
|
||||
Europa.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection type="description">
|
||||
<footnote>
|
||||
<paragraph pageNumber="585">
|
||||
Tipulae
|
||||
<emphasis italics="true">Larvae communiter sub radicibus vegetabilium degunt</emphasis>
|
||||
&
|
||||
<emphasis italics="true">radices exedunt.</emphasis>
|
||||
</paragraph>
|
||||
</footnote>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
89
data/EB/19/B9/EB19B9644CD45F2685A5F0F9665A28AE.xml
Normal file
89
data/EB/19/B9/EB19B9644CD45F2685A5F0F9665A28AE.xml
Normal file
|
|
@ -0,0 +1,89 @@
|
|||
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.602.8136" ID-PMC="PMC4978033" ID-Pensoft-Pub="1313-2970-602-1" ID-Pensoft-UUID="FFA86D39FFE2FFF3FF8AFFEBC209FFDE" ID-PubMed="27551193" ID-Zenodo-Dep="126863" ID-ZooBank="65EFA27673454AC69B78DBE7E98D6103" ModsDocID="1313-2970-602-1" checkinTime="1467777339758" checkinUser="pensoft" docAuthor="Neubauer, Thomas A." docDate="2016" docId="EB19B9644CD45F2685A5F0F9665A28AE" docLanguage="en" docName="ZooKeys 602: 1-358" docOrigin="ZooKeys 602" docPubDate="2016-07-05" docSource="http://dx.doi.org/10.3897/zookeys.602.8136" docTitle="Melania (Campylostylus) galloprovincialis subsp. var. var. scalaroides Oppenheim 1892, [invalid]" docType="treatment" docVersion="6" id="FFA86D39FFE2FFF3FF8AFFEBC209FFDE" lastPageNumber="245" masterDocId="FFA86D39FFE2FFF3FF8AFFEBC209FFDE" masterDocTitle="A nomenclator of extant and fossil taxa of the Melanopsidae (Gastropoda, Cerithioidea)" masterLastPageNumber="358" masterPageNumber="1" pageNumber="244" updateTime="1718368541800" updateUser="guilherme">
|
||||
<mods:mods id="DB3B63F85E36040B07CC5E7B2654ACB5" xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo id="B524AD3C8991B04CA394A2A1F9665A5B">
|
||||
<mods:title id="5DB8A25EB239DF94B49708812A23D850">A nomenclator of extant and fossil taxa of the Melanopsidae (Gastropoda, Cerithioidea)</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name id="0E484114064DB91E95FFD33775A3C4DF" type="personal">
|
||||
<mods:role id="D8052527CD0A1C3617D29E0F8A87DE89">
|
||||
<mods:roleTerm id="7ADEE22DD41CB6747BCD04F8DB262809">Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart id="87BB36D3A725DF34F6B91F7FF28479ED">Neubauer, Thomas A.</mods:namePart>
|
||||
<mods:nameIdentifier id="11776F9F623299629CC358FD44D6B874" type="ORCID">https://orcid.org/0000-0002-1398-9941</mods:nameIdentifier>
|
||||
<mods:affiliation id="88176256A1F181BC3B7237B00A905D79">Geological-Paleontological Department, Natural History Museum Vienna, 1010 Vienna, Austria</mods:affiliation>
|
||||
<mods:nameIdentifier id="7A21A664CECF3D09883F53CAD34F6789" type="email">thomas.neubauer@nhm-wien.ac.at</mods:nameIdentifier>
|
||||
</mods:name>
|
||||
<mods:typeOfResource id="E01C120AC2612F0A36F116C5240A0887">text</mods:typeOfResource>
|
||||
<mods:relatedItem id="468E0F1D90B6E014FF3DDA82A25C9F6B" type="host">
|
||||
<mods:titleInfo id="A3020D95117A7C905553A70404E6A203">
|
||||
<mods:title id="E0FF35549F0246DA9D531CC63F061CC1">ZooKeys</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:part id="3BDD7BC063B4A93CEDC910FE246F57FF">
|
||||
<mods:date id="4AF36D32785AD30109BF00540F54034B">2016</mods:date>
|
||||
<mods:detail id="3D8F4D48084C70CB16FDC3DAEA390092" type="pubDate">
|
||||
<mods:number id="249AACA1AA951DC1B972E34C5CA38A51">2016-07-05</mods:number>
|
||||
</mods:detail>
|
||||
<mods:detail id="4FFD3599216DA031A90276E0C02BF910" type="volume">
|
||||
<mods:number id="B6093CEDBBB4E1B98B1ACA37F1AFDDE1">602</mods:number>
|
||||
</mods:detail>
|
||||
<mods:extent id="1387968AA645D81DD5C6D93108B78096" unit="page">
|
||||
<mods:start id="F33649CE954C4157C63C4EB77D3311EA">1</mods:start>
|
||||
<mods:end id="13C704044FFE2A860107E4B84A320AE5">358</mods:end>
|
||||
</mods:extent>
|
||||
</mods:part>
|
||||
</mods:relatedItem>
|
||||
<mods:location id="B3B892F0D350B6D0464AE3F22A37441C">
|
||||
<mods:url id="228D449EF2998051C0CC0948204D489C">http://dx.doi.org/10.3897/zookeys.602.8136</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification id="9748C4E597393AB3DABB45AC1EFC49AD">journal article</mods:classification>
|
||||
<mods:identifier id="B428F43002A9F40D2F61A4F5C4B9E1B6" type="DOI">http://dx.doi.org/10.3897/zookeys.602.8136</mods:identifier>
|
||||
<mods:identifier id="50083E96C0996E0F252F2718D38D85E4" type="Pensoft-Pub">1313-2970-602-1</mods:identifier>
|
||||
<mods:identifier id="15EC2D5548F98EBEF7DD7E9F3FE91F6C" type="ZooBank">65EFA27673454AC69B78DBE7E98D6103</mods:identifier>
|
||||
<mods:identifier id="4B8D481FAC13D5247E8F765D70FAC682" type="Pensoft-UUID">FFA86D39FFE2FFF3FF8AFFEBC209FFDE</mods:identifier>
|
||||
<mods:identifier id="97FFDEEA051513C2C62537AF92F80260" type="Zenodo-Dep">126863</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment id="EB19B9644CD45F2685A5F0F9665A28AE" ID-GBIF-Taxon="182232853" LSID="urn:lsid:plazi:treatment:EB19B9644CD45F2685A5F0F9665A28AE" httpUri="http://treatment.plazi.org/id/EB19B9644CD45F2685A5F0F9665A28AE" lastPageId="244" lastPageNumber="245" pageId="243" pageNumber="244">
|
||||
<subSubSection id="07A584A045B589E76970391C84023867" pageId="243" pageNumber="244" type="nomenclature">
|
||||
<paragraph id="AFCB02B04F6BFDA0B6498CDF24C55850" pageId="243" pageNumber="244">
|
||||
†
|
||||
<taxonomicName id="B6987EF61464689159BFFD8BFEC4928D" ID-CoL="7V865" LSID="EB19B964-4CD4-5F26-85A5-F0F9665A28AE" authority="Oppenheim, 1892" authorityName="Oppenheim" authorityYear="1892" class="Gastropoda" family="Melanopsidae" genus="Melania" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Melania (Campylostylus) galloprovincialis subsp. var. var. scalaroides" order="Sorbeoconcha" pageId="243" pageNumber="244" phylum="Mollusca" rank="variety" species="galloprovincialis" status="[invalid]" subGenus="Campylostylus" subSpecies="var." variety="scalaroides">Melania (Campylostylus) galloprovincialis var. scalaroides Oppenheim, 1892</taxonomicName>
|
||||
<taxonomicNameLabel id="0313154F9EC580D2175709DC819FAD7F" pageId="243" pageNumber="244">[invalid]</taxonomicNameLabel>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="9251D4AB64AE231F1DD8A5A51A847E36" pageId="243" pageNumber="244" type="original source">
|
||||
<paragraph id="CAECEDFA45CEE4CD4A1C5C9A92DC597F" pageId="243" pageNumber="244">Original source.</paragraph>
|
||||
<paragraph id="C5CFF2EF0A9E017BE4BD5B7EA444FD21" pageId="243" pageNumber="244">
|
||||
<bibRefCitation id="0E6AE73EE068F188D4B23280F936C5DD" author="Oppenheim, P" journalOrPublisher="Zeitschrift der Deutschen Geologischen Gesellschaft" pageId="322" pageNumber="323" pagination="697 - 818" publicationUrl="http://www.biodiversitylibrary.org/item/141293page/713/mode/1up" refId="B364" refString="Oppenheim, P, 1892. Ueber einige Brackwasser- und Binnenmollusken aus der Kreide und dem Eocaen Ungarns. Zeitschrift der Deutschen Geologischen Gesellschaft 44: 697 - 818, http://www.biodiversitylibrary.org/item/141293page/713/mode/1up" title="Ueber einige Brackwasser- und Binnenmollusken aus der Kreide und dem Eocaen Ungarns." url="http://www.biodiversitylibrary.org/item/141293page/713/mode/1up" volume="44" year="1892">Oppenheim 1892</bibRefCitation>
|
||||
: 765, pl. 30, fig. 4.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="B836CF261D51F40BB2878224F0D3853D" pageId="243" pageNumber="244" type="type horizon">
|
||||
<paragraph id="A3F5ADAFC785E22C14BCA3056F24D1A1" pageId="243" pageNumber="244">Type horizon.</paragraph>
|
||||
<paragraph id="8D987DB80EC4B6FC0B643A1C5B2F9354" pageId="243" pageNumber="244">Early Campanian, Cretaceous.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="E8074816CDCCC024B14E7677768B6E9F" pageId="244" pageNumber="245" type="type locality">
|
||||
<paragraph id="4033B84B976FDD07714CA88C4C56F00B" pageId="244" pageNumber="245">
|
||||
<pageBreakToken id="DD2778ADC94A8B2A1E6EFE8A0FA00D5D" pageId="244" pageNumber="245" start="start">Type</pageBreakToken>
|
||||
locality.
|
||||
</paragraph>
|
||||
<paragraph id="970C2DF39C68C00A463E745F63C1A2F6" pageId="244" pageNumber="245">
|
||||
"Plan de Campagne bei
|
||||
<normalizedToken id="F38C79C70C9043BFAEB47F36D1000F40" originalValue="Septême">Septeme</normalizedToken>
|
||||
(B.-
|
||||
<normalizedToken id="609550EF33CA44819C8FDE6F25017F7F" originalValue="du-Rhône)”">du-Rhone)"</normalizedToken>
|
||||
[Plan de Campagne near
|
||||
<normalizedToken id="9EB0B45705CB5DCCD21EF0CBAB31C696" originalValue="Septèmes-les-Vallons">Septemes-les-Vallons</normalizedToken>
|
||||
], France.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection id="6B56218A324DB9A534507155332F1294" pageId="244" pageNumber="245" type="remarks">
|
||||
<paragraph id="287E891E2B2F006CF6BD2068EBBB0DBE" pageId="244" pageNumber="245">Remarks.</paragraph>
|
||||
<paragraph id="A80DE145685ECE5A53564BD3B14FE33A" pageId="244" pageNumber="245">
|
||||
Junior homonym of
|
||||
<taxonomicName id="4FBC5CCC6E650076CDDB80C6556C5427" class="Gastropoda" family="Melanopsidae" genus="Melania" kingdom="Animalia" lsidName="Melania scalaroides" order="Pteropoda" pageId="244" pageNumber="245" phylum="Mollusca" rank="species" species="scalaroides">
|
||||
<emphasis id="71DB002F3C1CF060059B676C5AA25C5C" italics="true" pageId="244" pageNumber="245">Melania scalaroides</emphasis>
|
||||
</taxonomicName>
|
||||
Briart & Cornet, 1882.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
272
data/EB/19/D1/EB19D14BF9BF5E7FAB6DBB26A0112DEA.xml
Normal file
272
data/EB/19/D1/EB19D14BF9BF5E7FAB6DBB26A0112DEA.xml
Normal file
|
|
@ -0,0 +1,272 @@
|
|||
<document ID-DOI="http://dx.doi.org/10.3897/BDJ.10.e96003" ID-Pensoft-Pub="1314-2828-10-e96003" ID-Pensoft-UUID="76077326AB2251039D2C380A594EDA2A" ID-ZooBank="2A9D4A67DC0040DC9745BF531D767F55" ModsDocID="1314-2828-10-e96003" checkinTime="1670952459602" checkinUser="pensoft" docAuthor="Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan" docDate="2022" docId="EB19D14BF9BF5E7FAB6DBB26A0112DEA" docLanguage="en" docName="BiodivDatJour 10: e96003" docOrigin="Biodiversity Data Journal 10" docPubDate="2022-12-12" docSource="http://dx.doi.org/10.3897/BDJ.10.e96003" docTitle="Amauropelma phangnga S. Li & Yao 2022, sp. n." docType="treatment" docVersion="1" id="76077326AB2251039D2C380A594EDA2A" lastPageNumber="96003" masterDocId="76077326AB2251039D2C380A594EDA2A" masterDocTitle="Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia" masterLastPageNumber="96003" masterPageNumber="96003" pageNumber="96003" updateTime="1670952459602" updateUser="pensoft">
|
||||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo>
|
||||
<mods:title>Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Chu, Chang</mods:namePart>
|
||||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0003-3520-5463</mods:nameIdentifier>
|
||||
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Lu, Ying</mods:namePart>
|
||||
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Li, Shuqiang</mods:namePart>
|
||||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-3290-5416</mods:nameIdentifier>
|
||||
<mods:affiliation>Institute of Zoology, Chinese Academy of Sciences, Beijing, China</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Yao, Zhiyuan</mods:namePart>
|
||||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-1631-0949</mods:nameIdentifier>
|
||||
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
|
||||
<mods:nameIdentifier type="email">yaozy@synu.edu.cn</mods:nameIdentifier>
|
||||
</mods:name>
|
||||
<mods:typeOfResource>text</mods:typeOfResource>
|
||||
<mods:relatedItem type="host">
|
||||
<mods:titleInfo>
|
||||
<mods:title>Biodiversity Data Journal</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:part>
|
||||
<mods:date>2022</mods:date>
|
||||
<mods:detail type="pubDate">
|
||||
<mods:number>2022-12-12</mods:number>
|
||||
</mods:detail>
|
||||
<mods:detail type="volume">
|
||||
<mods:number>10</mods:number>
|
||||
</mods:detail>
|
||||
<mods:extent unit="page">
|
||||
<mods:start>96003</mods:start>
|
||||
<mods:end>96003</mods:end>
|
||||
</mods:extent>
|
||||
</mods:part>
|
||||
</mods:relatedItem>
|
||||
<mods:location>
|
||||
<mods:url>http://dx.doi.org/10.3897/BDJ.10.e96003</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification>journal article</mods:classification>
|
||||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.10.e96003</mods:identifier>
|
||||
<mods:identifier type="Pensoft-Pub">1314-2828-10-e96003</mods:identifier>
|
||||
<mods:identifier type="ZooBank">2A9D4A67DC0040DC9745BF531D767F55</mods:identifier>
|
||||
<mods:identifier type="Pensoft-UUID">76077326AB2251039D2C380A594EDA2A</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA" httpUri="http://treatment.plazi.org/id/EB19D14BF9BF5E7FAB6DBB26A0112DEA" lastPageNumber="96003" pageId="0" pageNumber="96003">
|
||||
<subSubSection pageId="0" pageNumber="96003" type="nomenclature">
|
||||
<paragraph pageId="0" pageNumber="96003">
|
||||
<taxonomicName LSID="EB19D14B-F9BF-5E7F-AB6D-BB26A0112DEA" authority="S. Li & Yao" authorityName="S. Li & Yao" authorityYear="2022" class="Arachnida" family="Ctenidae" genus="Amauropelma" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Amauropelma phangnga" order="Araneae" pageId="0" pageNumber="96003" phylum="Arthropoda" rank="species" species="phangnga" status="sp. n.">Amauropelma phangnga S. Li & Yao</taxonomicName>
|
||||
<taxonomicNameLabel pageId="0" pageNumber="96003">sp. n.</taxonomicNameLabel>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="96003" type="materials_examined">
|
||||
<paragraph pageId="0" pageNumber="96003">Materials</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">
|
||||
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectorName="Occurrence, Z. Chen" country="Thailand" county="Taxon" elevation="0" latitude="8.455083" location="Ctenidae" longLatPrecision="1" longitude="98.52817" municipality="Araneae" pageId="0" pageNumber="96003" specimenCount="1" specimenCount-male="1" stateProvince="Phang Nga" typeStatus="Holotype">
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">Type status:</emphasis>
|
||||
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectorName="Occurrence, Z. Chen" country="Thailand" county="Taxon" elevation="0" latitude="8.455083" location="Ctenidae" longLatPrecision="1" longitude="98.52817" municipality="Araneae" specimenCount="43531" stateProvince="Phang Nga" typeStatus="Holotype">
|
||||
<typeStatus pageId="0" pageNumber="96003">Holotype</typeStatus>
|
||||
.
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">
|
||||
<collectorName>Occurrence</collectorName>
|
||||
:
|
||||
</emphasis>
|
||||
recordedBy:
|
||||
<collectorName pageId="0" pageNumber="96003">Z. Chen</collectorName>
|
||||
; individualCount:
|
||||
<specimenCount pageId="0" pageNumber="96003" type="generic">1</specimenCount>
|
||||
; sex:
|
||||
<specimenType pageId="0" pageNumber="96003">male</specimenType>
|
||||
; lifeStage:
|
||||
<specimenType pageId="0" pageNumber="96003">adult</specimenType>
|
||||
;
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">
|
||||
<collectingCounty>Taxon</collectingCounty>
|
||||
:
|
||||
</emphasis>
|
||||
order:
|
||||
<collectingMunicipality>Araneae</collectingMunicipality>
|
||||
; family:
|
||||
<location LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA:F8A9BD201975A7C04654F163164E1417" country="Thailand" county="Taxon" latitude="8.455083" longLatPrecision="1" longitude="98.52817" municipality="Araneae" name="Ctenidae" stateProvince="Phang Nga">Ctenidae</location>
|
||||
; genus:
|
||||
<location LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA:BB3B8010BCC2A559C09D1D3C6B25579C" country="Thailand" county="Taxon" latitude="8.455083" longLatPrecision="1" longitude="98.52817" municipality="Araneae" name="Amauropelma" stateProvince="Phang Nga">Amauropelma</location>
|
||||
;
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">
|
||||
<location LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA:E5FFD93541DB96B8768349F4B9E16089" country="Thailand" county="Taxon" latitude="8.455083" longLatPrecision="1" longitude="98.52817" municipality="Araneae" name="Location" stateProvince="Phang Nga">Location</location>
|
||||
:
|
||||
</emphasis>
|
||||
country:
|
||||
<collectingCountry name="Thailand" pageId="0" pageNumber="96003">Thailand</collectingCountry>
|
||||
; stateProvince:
|
||||
<collectingRegion country="Thailand" name="Phangnga">Phang Nga</collectingRegion>
|
||||
; verbatimLocality:
|
||||
<location LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA:6E9A3EE4B238BC57AEC012B6212428AC" country="Thailand" county="Taxon" latitude="8.455083" longLatPrecision="1" longitude="98.52817" municipality="Araneae" name="Mueang District" stateProvince="Phang Nga">Mueang District</location>
|
||||
,
|
||||
<location LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA:03845EB32190F229AEF93D4B3FEA3AAB" country="Thailand" county="Taxon" latitude="8.455083" longLatPrecision="1" longitude="98.52817" municipality="Araneae" name="Tapan Cave" stateProvince="Phang Nga">Tapan Cave</location>
|
||||
; verbatimElevation:
|
||||
<elevation metricMagnitude="1" metricUnit="m" metricValue="3.5" pageId="0" pageNumber="96003" unit="m" value="35.0">
|
||||
<quantity metricMagnitude="1" metricUnit="m" metricValue="3.5" unit="m" value="35.0">35 m</quantity>
|
||||
a.s.l.
|
||||
</elevation>
|
||||
; verbatimLatitude:
|
||||
<geoCoordinate degrees="8" direction="north" minutes="27.305" orientation="latitude" precision="1" value="8.455083">8°27.305'N</geoCoordinate>
|
||||
; verbatimLongitude:
|
||||
<geoCoordinate degrees="98" direction="east" minutes="31.690" orientation="longitude" precision="1" value="98.52817">98°31.690'E</geoCoordinate>
|
||||
;
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">Event:</emphasis>
|
||||
year: 2015; month: 10; day: 10;
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">Record Level:</emphasis>
|
||||
institutionCode: IZCAS-Ar
|
||||
<specimenCount type="generic">
|
||||
43531
|
||||
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectorName="Occurrence, Z. Chen" country="Thailand" county="Taxon" elevation="0" latitude="8.455083" location="Ctenidae" longLatPrecision="1" longitude="98.52817" municipality="Araneae" pageId="0" pageNumber="96003" specimenCount="1" specimenCount-male="1" stateProvince="Phang Nga" typeStatus="Paratype">
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">Type status:</emphasis>
|
||||
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectorName="Occurrence, Z. Chen" country="Thailand" county="Taxon" elevation="0" latitude="8.455083" location="Ctenidae" longLatPrecision="1" longitude="98.52817" municipality="Araneae" specimenCount="1" specimenCount-male="1" stateProvince="Phang Nga" typeStatus="Paratype">
|
||||
<typeStatus pageId="0" pageNumber="96003">Paratype</typeStatus>
|
||||
.
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">
|
||||
<collectorName>Occurrence</collectorName>
|
||||
:
|
||||
</emphasis>
|
||||
recordedBy:
|
||||
<collectorName pageId="0" pageNumber="96003">Z. Chen</collectorName>
|
||||
; individualCount:
|
||||
<specimenCount pageId="0" pageNumber="96003" type="generic">1</specimenCount>
|
||||
; sex:
|
||||
<specimenType pageId="0" pageNumber="96003">male</specimenType>
|
||||
; lifeStage:
|
||||
<specimenType pageId="0" pageNumber="96003">adult</specimenType>
|
||||
;
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">
|
||||
<collectingCounty>Taxon</collectingCounty>
|
||||
:
|
||||
</emphasis>
|
||||
order:
|
||||
<collectingMunicipality>Araneae</collectingMunicipality>
|
||||
; family:
|
||||
<location LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA:970CACE2E026DDFF948E42AA24EE17F2" country="Thailand" county="Taxon" latitude="8.455083" longLatPrecision="1" longitude="98.52817" municipality="Araneae" name="Ctenidae" stateProvince="Phang Nga">Ctenidae</location>
|
||||
; genus:
|
||||
<location LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA:5FAF79B3D78A8136C1C99E0B2F2FC568" country="Thailand" county="Taxon" latitude="8.455083" longLatPrecision="1" longitude="98.52817" municipality="Araneae" name="Amauropelma" stateProvince="Phang Nga">Amauropelma</location>
|
||||
;
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">
|
||||
<location LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA:BDD0F1D099839954A00F07E768F5E104" country="Thailand" county="Taxon" latitude="8.455083" longLatPrecision="1" longitude="98.52817" municipality="Araneae" name="Location" stateProvince="Phang Nga">Location</location>
|
||||
:
|
||||
</emphasis>
|
||||
country:
|
||||
<collectingCountry name="Thailand" pageId="0" pageNumber="96003">Thailand</collectingCountry>
|
||||
; stateProvince:
|
||||
<collectingRegion country="Thailand" name="Phangnga">Phang Nga</collectingRegion>
|
||||
; verbatimLocality:
|
||||
<location LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA:3788DBF3CAC953FC1D2A34D42F8E60FF" country="Thailand" county="Taxon" latitude="8.455083" longLatPrecision="1" longitude="98.52817" municipality="Araneae" name="Mueang District" stateProvince="Phang Nga">Mueang District</location>
|
||||
,
|
||||
<location LSID="urn:lsid:plazi:treatment:EB19D14BF9BF5E7FAB6DBB26A0112DEA:F9D6DB701E257F3896B3C24C0F2BF177" country="Thailand" county="Taxon" latitude="8.455083" longLatPrecision="1" longitude="98.52817" municipality="Araneae" name="Tapan Cave" stateProvince="Phang Nga">Tapan Cave</location>
|
||||
; verbatimElevation:
|
||||
<elevation metricMagnitude="1" metricUnit="m" metricValue="3.5" pageId="0" pageNumber="96003" unit="m" value="35.0">
|
||||
<quantity metricMagnitude="1" metricUnit="m" metricValue="3.5" unit="m" value="35.0">35 m</quantity>
|
||||
a.s.l.
|
||||
</elevation>
|
||||
; verbatimLatitude:
|
||||
<geoCoordinate degrees="8" direction="north" minutes="27.305" orientation="latitude" precision="1" value="8.455083">8°27.305'N</geoCoordinate>
|
||||
; verbatimLongitude:
|
||||
<geoCoordinate degrees="98" direction="east" minutes="31.690" orientation="longitude" precision="1" value="98.52817">98°31.690'E</geoCoordinate>
|
||||
;
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">Event:</emphasis>
|
||||
year: 2015; month: 10; day: 10;
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">Record Level:</emphasis>
|
||||
institutionCode: IZCAS-Ar 43532
|
||||
</materialsCitation>
|
||||
</materialsCitation>
|
||||
</specimenCount>
|
||||
</materialsCitation>
|
||||
</materialsCitation>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="96003" type="description">
|
||||
<paragraph pageId="0" pageNumber="96003">Description</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">Male</emphasis>
|
||||
(IZCAS-Ar 43531): PL 3.3, PW 2.8, AW 1.2, OL 3.0, OW 1.9. Eye diameters and interdistances: AME 0.09, ALE 0.12, PME 0.10, PLE 0.10, AME-AME 0.04, AME-ALE 0.13, PME-PME 0.08, PME-PLE 0.21, AME-PME 0.05, ALE-PLE 0.08, clypeus AME 0.17, clypeus ALE 0.22. Palp and leg measurements: palp 3.8 (0.9, 0.6, 0.8, -, 1.5), I 13.5 (3.3, 1.6, 3.7, 3.2, 1.7), II 11.6 (3.1, 1.6, 3.0, 2.6, 1.3), III 10.9 (2.9, 1.4, 2.7, 2.6, 1.3), IV 14.8 (3.5, 1.5, 3.9, 4.2, 1.7). Leg formula 4123. Spination of palp and legs: palp 131, 100, 1101; femora I p021, d211, r112, II-III p012, d111, r012, IV p102, d111, r012; patellae I-IV 001; tibiae I p010, v22222, II p100, r100, v22222, III p11, d111, r11, v222, IV p11, d11, r11, v222; metatarsi I v222, II p112, r010, v222, III p112, d010, r112, v222, IV p112, r112, v2222. Chelicerae with 3 promarginal, 4 retromarginal teeth, without denticles. Retromargin of chelicerae close to fang base without bristle. Tarsi and metatarsi without scopula. Claw tufts arising separately, but intermingle with each other distally. Leg claws I with 7 and II with 6 secondary teeth. Position of tarsal organ: I 1.37, II 0.92, III 0.85.
|
||||
</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">
|
||||
Palp (Fig.
|
||||
<figureCitation captionStart="Figure 4" captionStartId="F8184412" captionText="Figure 4. Amauropelma phangnga sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, E = embolus, PCO = prolatero-proximal cymbial outgrowth, RPA = retrolateral patellar apophysis, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure4" httpUri="https://binary.pensoft.net/fig/761680" pageId="0" pageNumber="96003">4</figureCitation>
|
||||
a-c). Patella with distinct retrolateral apophysis. RTA protruding at an almost right angle from tibia in ventral view, with broad base and two short apices, both dorso-distad. Cymbium tip conical, with prolatero-proximal outgrowth. Embolus (Fig.
|
||||
<figureCitation captionStartId="F8220528" pageId="0" pageNumber="96003">9</figureCitation>
|
||||
<figureCitation captionStartId="F8220533" pageId="0" pageNumber="96003">a</figureCitation>
|
||||
) arising at 8
|
||||
<normalizedToken originalValue="o’clock">o'clock</normalizedToken>
|
||||
position, its tip with an extension. Conductor arising at 3
|
||||
<normalizedToken originalValue="o’clock">o'clock</normalizedToken>
|
||||
position, long and laminar, running around tegulum anti-clockwise, its tip situated subdistally. Tegular apophysis arising subcentrally, strongly concave on ventral side and distinctly excavated on prolateral side.
|
||||
</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">
|
||||
Colour (Fig.
|
||||
<figureCitation captionStart="Figure 5" captionStartId="F8184414" captionText="Figure 5. Amauropelma phangnga sp. n., habitus, holotype male. a: Dorsal view; b: Ventral view. Scale bar: 1.0 mm (a, b)." figureDoi="10.3897/BDJ.10.e96003.figure5" httpUri="https://binary.pensoft.net/fig/751861" pageId="0" pageNumber="96003">5</figureCitation>
|
||||
a and b). Yellowish-brown. Dorsal prosoma with eyes marked with black rings, fovea distinct, reddish-brown. Ventral opisthosoma grey.
|
||||
</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">Female</emphasis>
|
||||
</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">Unknown.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">
|
||||
<emphasis bold="true" pageId="0" pageNumber="96003">Variation</emphasis>
|
||||
: Paratype male (IZCAS-Ar 43532): PL 3.4, OL 2.4.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="96003" type="diagnosis">
|
||||
<paragraph pageId="0" pageNumber="96003">Diagnosis</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">
|
||||
Small
|
||||
<taxonomicName class="Arachnida" family="Ctenidae" kingdom="Animalia" lsidName="" order="Araneae" pageId="0" pageNumber="96003" phylum="Arthropoda" rank="family">Ctenidae</taxonomicName>
|
||||
(total length male 5.8-6.3). The new species can be distinguished from all known congeners by the embolus tip with an extension (Fig.
|
||||
<figureCitation captionStart="Figure 4" captionStartId="F8184412" captionText="Figure 4. Amauropelma phangnga sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, E = embolus, PCO = prolatero-proximal cymbial outgrowth, RPA = retrolateral patellar apophysis, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure4" httpUri="https://binary.pensoft.net/fig/761680" pageId="0" pageNumber="96003">4</figureCitation>
|
||||
b and Fig.
|
||||
<figureCitation captionStartId="F8220528" pageId="0" pageNumber="96003">9</figureCitation>
|
||||
<figureCitation captionStartId="F8220533" pageId="0" pageNumber="96003">a</figureCitation>
|
||||
), by the tegular apophysis strongly concave on ventral side and distinctly excavated on prolateral side (Fig.
|
||||
<figureCitation captionStart="Figure 4" captionStartId="F8184412" captionText="Figure 4. Amauropelma phangnga sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, E = embolus, PCO = prolatero-proximal cymbial outgrowth, RPA = retrolateral patellar apophysis, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure4" httpUri="https://binary.pensoft.net/fig/761680" pageId="0" pageNumber="96003">4</figureCitation>
|
||||
a and b), by the conductor arising at 3
|
||||
<normalizedToken originalValue="o’clock">o'clock</normalizedToken>
|
||||
position, long and laminar, running around tegulum anti-clockwise, its tip situated subdistally (Fig.
|
||||
<figureCitation captionStart="Figure 4" captionStartId="F8184412" captionText="Figure 4. Amauropelma phangnga sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, E = embolus, PCO = prolatero-proximal cymbial outgrowth, RPA = retrolateral patellar apophysis, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure4" httpUri="https://binary.pensoft.net/fig/761680" pageId="0" pageNumber="96003">4</figureCitation>
|
||||
b), by the RTA protruding at an almost right angle from tibia in ventral view, with broad base and two short apices, both dorso-distad (Fig.
|
||||
<figureCitation captionStart="Figure 4" captionStartId="F8184412" captionText="Figure 4. Amauropelma phangnga sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, E = embolus, PCO = prolatero-proximal cymbial outgrowth, RPA = retrolateral patellar apophysis, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure4" httpUri="https://binary.pensoft.net/fig/761680" pageId="0" pageNumber="96003">4</figureCitation>
|
||||
b) and by the patella with distinct retrolateral apophysis, pointing anteriorly (Fig.
|
||||
<figureCitation captionStart="Figure 4" captionStartId="F8184412" captionText="Figure 4. Amauropelma phangnga sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, E = embolus, PCO = prolatero-proximal cymbial outgrowth, RPA = retrolateral patellar apophysis, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure4" httpUri="https://binary.pensoft.net/fig/761680" pageId="0" pageNumber="96003">4</figureCitation>
|
||||
b). This species can also be distinguished from
|
||||
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="Am. krabi" order="Araneae" pageId="0" pageNumber="96003" phylum="Arthropoda" rank="species" species="krabi">
|
||||
<emphasis italics="true" pageId="0" pageNumber="96003">Am. krabi</emphasis>
|
||||
</taxonomicName>
|
||||
sp. n. by the COI p-distance 0.134 between them.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="96003" type="etymology">
|
||||
<paragraph pageId="0" pageNumber="96003">Etymology</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">The specific name refers to the type locality and is a noun in apposition.</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="96003" type="distribution">
|
||||
<paragraph pageId="0" pageNumber="96003">Distribution</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">
|
||||
Thailand (Phang Nga, type locality; Fig.
|
||||
<figureCitation captionStart="Figure 1" captionStartId="F8184120" captionText="Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n." figureDoi="10.3897/BDJ.10.e96003.figure1" httpUri="https://binary.pensoft.net/fig/770652" pageId="0" pageNumber="96003">1</figureCitation>
|
||||
).
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="96003" type="dna barcode">
|
||||
<paragraph pageId="0" pageNumber="96003">DNA Barcode</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">Male (IZCAS-Ar 43532):</paragraph>
|
||||
<paragraph pageId="0" pageNumber="96003">GGTGGGTTCGGAAATTGATTGGTTCCTTTGATGTTAGGAGCTCCTGATATATCATTTCCTCGTATAAATAATTTGTCTTTTTGGTTACTTCCTCCTTCTTTATTTTTGTTATTAATATCTTCTATGGTGGAAATAGGAGTGGGAGCAGGATGAACTGTCTATCCTCCTTTAGCTTCTAGAATAGGGCATGTGGGAAGATCAATAGATTTTGCGATTTTTTCTCTTCATTTAGCTGGAGTTTCTTCTATTATGGGAGCGGTTAATTTTATTTCTACTATTATTAATATGCGATTATATGGAATAACTATAGAAAAGGTTCCTTTATTCGTTTGATCAGTTTTTATTACTGCAGTTTTGTTGTTGTTATCATTACCTGTGTTAGCAGGTGCTATTACTATATTATTGACAGATCGAAATTTTAATACTTCTTTTTTTGATCCTGCAGGGGGTGGAGATCCAATTTTATTTCAACATTTATTCTGATTTTTTGGTCACCCTGGAAAGTTTAA (GenBank accession number OP718556).</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
161
data/EB/19/E3/EB19E3894578546AA414F64D0FE4E59D.xml
Normal file
161
data/EB/19/E3/EB19E3894578546AA414F64D0FE4E59D.xml
Normal file
|
|
@ -0,0 +1,161 @@
|
|||
<document ID-DOI="http://dx.doi.org/10.3897/jhr.87.72842" ID-GBIF-Dataset="3e3ca27b-44ad-4ea2-af6b-516245293ccf" ID-Pensoft-Pub="1314-2607-87-323" ID-Pensoft-UUID="D03A96052A8550F9918BB08ACA344FB9" ID-Zenodo-Dep="5811493" ID-ZooBank="E343379ED04447ABA1ED47B3F01F3E59" ModsDocID="1314-2607-87-323" checkinTime="1640348264987" checkinUser="pensoft" docAuthor="Talamas, Elijah J., Bremer, Jonathan S., Moore, Matthew R., Bon, Marie-Claude, Lahey, Zachary, Roberts, Cheryl G., Combee, Lynn A., McGathey, Natalie, van Noort, Simon, Timokhov, Alexander V., Hougardy, Evelyne & Hogg, Brian" docDate="2021" docId="EB19E3894578546AA414F64D0FE4E59D" docLanguage="en" docName="JourHymenoptRes 87: 323-480" docOrigin="Journal of Hymenoptera Research 87" docPubDate="2021-12-23" docSource="http://dx.doi.org/10.3897/jhr.87.72842" docTitle="Gryon amplum" docType="treatment" docVersion="4" id="D03A96052A8550F9918BB08ACA344FB9" lastPageNumber="323" masterDocId="D03A96052A8550F9918BB08ACA344FB9" masterDocTitle="A maximalist approach to the systematics of a biological control agent: Gryon aetherium Talamas, sp. nov. (Hymenoptera, Scelionidae)" masterLastPageNumber="480" masterPageNumber="323" pageNumber="323" updateTime="1678757109313" updateUser="pensoft">
|
||||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||||
<mods:titleInfo>
|
||||
<mods:title>A maximalist approach to the systematics of a biological control agent: Gryon aetherium Talamas, sp. nov. (Hymenoptera, Scelionidae)</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Talamas, Elijah J.</mods:namePart>
|
||||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-1048-6345</mods:nameIdentifier>
|
||||
<mods:affiliation>Florida Department of Agriculture and Consumer Services, Gainesville, FL, USA</mods:affiliation>
|
||||
<mods:nameIdentifier type="email">elijah.talamas@fdacs.gov</mods:nameIdentifier>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Bremer, Jonathan S.</mods:namePart>
|
||||
<mods:affiliation>Florida Department of Agriculture and Consumer Services, Gainesville, FL, USA</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Moore, Matthew R.</mods:namePart>
|
||||
<mods:affiliation>Florida Department of Agriculture and Consumer Services, Gainesville, FL, USA</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Bon, Marie-Claude</mods:namePart>
|
||||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-5914-1682</mods:nameIdentifier>
|
||||
<mods:affiliation>USDA-ARS-EBCL, Montpellier, France</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Lahey, Zachary</mods:namePart>
|
||||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-9402-9570</mods:nameIdentifier>
|
||||
<mods:affiliation>Department of Evolution, Ecology, and Organismal Biology, The Ohio State University, Columbus, OH, USA</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Roberts, Cheryl G.</mods:namePart>
|
||||
<mods:affiliation>Florida Department of Agriculture and Consumer Services, Gainesville, FL, USA</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Combee, Lynn A.</mods:namePart>
|
||||
<mods:affiliation>Florida Department of Agriculture and Consumer Services, Gainesville, FL, USA</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>McGathey, Natalie</mods:namePart>
|
||||
<mods:affiliation>Florida Department of Agriculture and Consumer Services, Gainesville, FL, USA</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>van Noort, Simon</mods:namePart>
|
||||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-6930-9741</mods:nameIdentifier>
|
||||
<mods:affiliation>Iziko South African Museum, Cape Town, South Africa</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Timokhov, Alexander V.</mods:namePart>
|
||||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-7040-6290</mods:nameIdentifier>
|
||||
<mods:affiliation>Lomonosov Moscow State University, Moscow, Russia</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Hougardy, Evelyne</mods:namePart>
|
||||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-7537-470X</mods:nameIdentifier>
|
||||
<mods:affiliation>USDA-ARS-ISPH, Albany, CA, USA</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:name type="personal">
|
||||
<mods:role>
|
||||
<mods:roleTerm>Author</mods:roleTerm>
|
||||
</mods:role>
|
||||
<mods:namePart>Hogg, Brian</mods:namePart>
|
||||
<mods:affiliation>USDA-ARS-ISPH, Albany, CA, USA</mods:affiliation>
|
||||
</mods:name>
|
||||
<mods:typeOfResource>text</mods:typeOfResource>
|
||||
<mods:relatedItem type="host">
|
||||
<mods:titleInfo>
|
||||
<mods:title>Journal of Hymenoptera Research</mods:title>
|
||||
</mods:titleInfo>
|
||||
<mods:part>
|
||||
<mods:date>2021</mods:date>
|
||||
<mods:detail type="pubDate">
|
||||
<mods:number>2021-12-23</mods:number>
|
||||
</mods:detail>
|
||||
<mods:detail type="volume">
|
||||
<mods:number>87</mods:number>
|
||||
</mods:detail>
|
||||
<mods:extent unit="page">
|
||||
<mods:start>323</mods:start>
|
||||
<mods:end>480</mods:end>
|
||||
</mods:extent>
|
||||
</mods:part>
|
||||
</mods:relatedItem>
|
||||
<mods:location>
|
||||
<mods:url>http://dx.doi.org/10.3897/jhr.87.72842</mods:url>
|
||||
</mods:location>
|
||||
<mods:classification>journal article</mods:classification>
|
||||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/jhr.87.72842</mods:identifier>
|
||||
<mods:identifier type="Pensoft-Pub">1314-2607-87-323</mods:identifier>
|
||||
<mods:identifier type="ZooBank">E343379ED04447ABA1ED47B3F01F3E59</mods:identifier>
|
||||
<mods:identifier type="Pensoft-UUID">D03A96052A8550F9918BB08ACA344FB9</mods:identifier>
|
||||
<mods:identifier type="Zenodo-Dep">5811493</mods:identifier>
|
||||
</mods:mods>
|
||||
<treatment ID-GBIF-Taxon="191737385" LSID="urn:lsid:plazi:treatment:EB19E3894578546AA414F64D0FE4E59D" httpUri="http://treatment.plazi.org/id/EB19E3894578546AA414F64D0FE4E59D" lastPageNumber="323" pageId="0" pageNumber="323">
|
||||
<subSubSection pageId="0" pageNumber="323" type="nomenclature">
|
||||
<paragraph pageId="0" pageNumber="323">
|
||||
<taxonomicName ID-CoL="3HHC5" LSID="EB19E389-4578-546A-A414-F64D0FE4E59D" authority="(Dodd)" baseAuthorityName="Dodd" baseAuthorityYear="1914" class="Insecta" family="Scelionidae" genus="Gryon" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Gryon amplum" order="Hymenoptera" pageId="0" pageNumber="323" phylum="Arthropoda" rank="species" species="amplum">Gryon amplum (Dodd)</taxonomicName>
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="323" type="reference_group">
|
||||
<paragraph pageId="0" pageNumber="323">
|
||||
<taxonomicName authorityName="Dodd" authorityYear="1914" class="Insecta" family="Scelionidae" genus="Hadronotus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hadronotus amplus" order="Hymenoptera" pageId="0" pageNumber="323" phylum="Arthropoda" rank="species" species="amplus">Hadronotus amplus</taxonomicName>
|
||||
Dodd, 1914b: 81 (original description); Dodd, 1915: 20 (keyed); Kieffer, 1926: 455, 471 (description, keyed).
|
||||
</paragraph>
|
||||
<paragraph pageId="0" pageNumber="323">
|
||||
<taxonomicName baseAuthorityName="Dodd" baseAuthorityYear="1914" class="Insecta" family="Scelionidae" genus="Mirotelenomus" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mirotelenomus amplus" order="Hymenoptera" pageId="0" pageNumber="323" phylum="Arthropoda" rank="species" species="amplus">Mirotelenomus amplus</taxonomicName>
|
||||
(Dodd): Dodd, 1926: 313 (generic transfer); Galloway, 1976: 96 (type information); Johnson, 1992: 439 (cataloged, type information).
|
||||
</paragraph>
|
||||
<paragraph pageId="0" pageNumber="323">
|
||||
<taxonomicName baseAuthorityName="Dodd" baseAuthorityYear="1914" class="Insecta" family="Scelionidae" genus="Gryon" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Gryon amplum" order="Hymenoptera" pageId="0" pageNumber="323" phylum="Arthropoda" rank="species" species="amplum">Gryon amplum</taxonomicName>
|
||||
(Dodd): Caleca & Mineo, 1995: 19 (generic transfer).
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
<subSubSection pageId="0" pageNumber="323" type="comments">
|
||||
<paragraph pageId="0" pageNumber="323">Comments.</paragraph>
|
||||
<paragraph pageId="0" pageNumber="323">
|
||||
The original description states "Head and thorax very finely reticulate rugulose" which is consistent with placement in
|
||||
<taxonomicName authorityName="Haliday" authorityYear="1833" class="Insecta" family="Scelionidae" genus="Gryon" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Gryon" order="Hymenoptera" pageId="0" pageNumber="323" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="0" pageNumber="323">Gryon</emphasis>
|
||||
</taxonomicName>
|
||||
if it is referring to microsculpture. However, it also states "club 6-jointed", which suggests
|
||||
<taxonomicName authorityName="Foerster" authorityYear="1856" class="Insecta" family="Scelionidae" genus="Hadronotus" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hadronotus" order="Hymenoptera" pageId="0" pageNumber="323" phylum="Arthropoda" rank="genus">
|
||||
<emphasis italics="true" pageId="0" pageNumber="323">Hadronotus</emphasis>
|
||||
</taxonomicName>
|
||||
. Because it is presently unclear where this species belongs, we leave it in its current placement.
|
||||
</paragraph>
|
||||
</subSubSection>
|
||||
</treatment>
|
||||
</document>
|
||||
Loading…
Add table
Add a link
Reference in a new issue