2024-08-09 20:56:59 +02:00
<document id= "807F08025BFEF3D958AC5B1961739D87" ID-DOI= "10.3897/mycokeys.107.125549" ID-publisher-id= "125549" URI-arpha= "3EA0E723-E6FC-58B0-8491-ED4CC2FBAB87" XM.bibliography_approvedBy= "admin" XM.materialsCitations_approvedBy= "admin" XM.taxonomicNames_approvedBy= "admin" XM.treatmentCitations_approvedBy= "admin" XM.treatments_approvedBy= "admin" article-type= "research-article" checkinTime= "1723223129036" checkinUser= "pensoft" docAuthor= "Tedersoo, Leho, Magurno, Franco, Alkahtani, Saad & Mikryukov, Vladimir" docDate= "2024" docId= "EB20E4EE572F53DB849A4606F20139EB" docLanguage= "en" docName= "MycoKeys 107: 249-271" docOrigin= "MycoKeys 107" docSource= "https://mycokeys.pensoft.net/article/125549/download/xml/" docStyle= "DocumentStyle:PensoftTaxPub.0000.journal_article.mycokeys" docStyleName= "PensoftTaxPub.0000.journal_article.mycokeys" docTitle= "Kahvena rebeccae Tedersoo 2024, sp. nov." docType= "treatment" docVersion= "3" dtd-version= "3.0" lastPageNumber= "271" masterDocId= "3EA0E723E6FC58B08491ED4CC2FBAB87" masterDocTitle= "Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes)" masterLastPageNumber= "271" masterPageNumber= "249" pageNumber= "249" updateTime= "1723229325626" updateUser= "admin" >
<mods:mods id= "C86632D5D92704F2413DEC4FE763553E" xmlns:mods= "http://www.loc.gov/mods/v3" >
<mods:titleInfo id= "8998F4180535F1BE26B903FD83334BDF" >
<mods:title id= "9F40C557DDA5CEB0FC09B346EA28BA58" > Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes)</mods:title>
2024-08-09 19:17:04 +02:00
</mods:titleInfo>
2024-08-09 20:56:59 +02:00
<mods:name id= "B1C7B059D967C4B0033BCD84B946D528" type= "personal" >
<mods:role id= "AB6A9D470F713328461D419A39B85D97" >
<mods:roleTerm id= "1C5D55D62367822A27E553F524D21228" > Author</mods:roleTerm>
2024-08-09 19:17:04 +02:00
</mods:role>
2024-08-09 20:56:59 +02:00
<mods:namePart id= "D4DB0DD857474A7021E2FCAB8B4B1BF2" > Tedersoo, Leho</mods:namePart>
<mods:affiliation id= "ACAC39B35432CB04427CE9622A5ECCFF" > Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia</mods:affiliation>
2024-08-09 19:17:04 +02:00
</mods:name>
2024-08-09 20:56:59 +02:00
<mods:name id= "09123B9F97DCFEB4F2EF27064900C1D8" type= "personal" >
<mods:role id= "3325F8B5F72605BFDD7C4367AE4CBECF" >
<mods:roleTerm id= "FA01B72251EF024E8B19CB4761D46FCA" > Author</mods:roleTerm>
2024-08-09 19:17:04 +02:00
</mods:role>
2024-08-09 20:56:59 +02:00
<mods:namePart id= "6D58BF14672FF8AA74C76578AD8A8786" > Magurno, Franco</mods:namePart>
<mods:nameIdentifier id= "B653182CB3D0BE44D21170094851999D" type= "ORCID" > 0000-0002-3117-8149</mods:nameIdentifier>
<mods:affiliation id= "35BE658E69EB84F76372F0ADA78070D0" > Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland</mods:affiliation>
2024-08-09 19:17:04 +02:00
</mods:name>
2024-08-09 20:56:59 +02:00
<mods:name id= "180152DFD95A1A2AD494DDD234EA9155" type= "personal" >
<mods:role id= "80583CBF15BE83A917A442148E210D2A" >
<mods:roleTerm id= "463FBF9541683E65483A80080114CEB1" > Author</mods:roleTerm>
2024-08-09 19:17:04 +02:00
</mods:role>
2024-08-09 20:56:59 +02:00
<mods:namePart id= "01259FC0A7D9056D398708863140041B" > Alkahtani, Saad</mods:namePart>
<mods:nameIdentifier id= "C7B70E7ABDB0B1D5D0CC29EA300C6454" type= "ORCID" > 0000-0001-7381-5110</mods:nameIdentifier>
<mods:affiliation id= "996DA7042F3D7656B24D3B005A0F9C8F" > Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia</mods:affiliation>
2024-08-09 19:17:04 +02:00
</mods:name>
2024-08-09 20:56:59 +02:00
<mods:name id= "E2209FEE622173E394384888FA525390" type= "personal" >
<mods:role id= "E8DA948231A4667BC04998830BD6D658" >
<mods:roleTerm id= "4422FAB238ABF3F1EA0FCAC570DEAFDA" > Author</mods:roleTerm>
2024-08-09 19:17:04 +02:00
</mods:role>
2024-08-09 20:56:59 +02:00
<mods:namePart id= "9F6DD216AF70F87A85201A729EDD23D1" > Mikryukov, Vladimir</mods:namePart>
<mods:nameIdentifier id= "369058C9BE7F072F33A5485C0CFCC2E3" type= "ORCID" > 0000-0003-2786-2690</mods:nameIdentifier>
<mods:affiliation id= "6D3E9B362B7C36DFBB08027BAA8C14A9" > Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia</mods:affiliation>
2024-08-09 19:17:04 +02:00
</mods:name>
2024-08-09 20:56:59 +02:00
<mods:typeOfResource id= "D1FC842F6FC43DD529B530E541EFA24D" > text</mods:typeOfResource>
<mods:relatedItem id= "AD1AAADA9BEED1727E206D00F3BD82CA" type= "host" >
<mods:titleInfo id= "F5947C46E6BA38BF2CA50BE0E535E80B" >
<mods:title id= "26EC86B868F6035F56D79100D43E126D" > MycoKeys</mods:title>
2024-08-09 19:17:04 +02:00
</mods:titleInfo>
2024-08-09 20:56:59 +02:00
<mods:part id= "FC5C9D0F535CE06F645912C882897E65" >
<mods:date id= "86FE40B9DE86A351F26B1691D092164E" > 2024</mods:date>
<mods:detail id= "6DB7412650689E70BC9DAE22F09BB09C" type= "pubDate" >
<mods:number id= "6710C7B5B5F79E65367C2CCC50DB2900" > 2024-08-09</mods:number>
2024-08-09 19:17:04 +02:00
</mods:detail>
2024-08-09 20:56:59 +02:00
<mods:detail id= "2647177D5AE8FA230B1A9E9ABB74F133" type= "volume" >
<mods:number id= "064020759CAC5F059CB3484FB1FC0C70" > 107</mods:number>
2024-08-09 19:17:04 +02:00
</mods:detail>
2024-08-09 20:56:59 +02:00
<mods:extent id= "B621A5E0712539E8EBEFDB1A399606E1" unit= "page" >
<mods:start id= "0CC61FF8DC9FE0A80376B33623F4A07E" > 249</mods:start>
<mods:end id= "F151B13E9E16E9B121CD6CEB60C7911E" > 271</mods:end>
2024-08-09 19:17:04 +02:00
</mods:extent>
</mods:part>
</mods:relatedItem>
2024-08-09 20:56:59 +02:00
<mods:classification id= "F8857FF88BE5717560BC579B0A6101C5" > journal article</mods:classification>
<mods:identifier id= "EFB684AF763E67F886B4D2D8AF9B155F" type= "DOI" > 10.3897/mycokeys.107.125549</mods:identifier>
2024-08-09 19:17:04 +02:00
</mods:mods>
2024-08-09 20:56:59 +02:00
<treatment id= "EB20E4EE572F53DB849A4606F20139EB" ID-DOI= "http://doi.org/10.5281/zenodo.13286488" ID-Zenodo-Dep= "13286488" ID-arpha= "EB20E4EE-572F-53DB-849A-4606F20139EB" ID-mycobank= "853575" LSID= "urn:lsid:plazi:treatment:EB20E4EE572F53DB849A4606F20139EB" httpUri= "http://treatment.plazi.org/id/EB20E4EE572F53DB849A4606F20139EB" >
2024-08-09 19:17:04 +02:00
<subSubSection id= "229076B3C794FD8D1FD58A8E3F2C5FC2" type= "nomenclature" >
<paragraph id= "CCC4F00C3469282213F3430EBD409610" >
<taxonomicName id= "419460B9CF91609436CD4DCDF4D8F290" authority= "Tedersoo" authorityName= "Tedersoo" authorityYear= "2024" class= "Magnoliopsida" family= "Kahvenaceae" genus= "Kahvena" kingdom= "Fungi" order= "Kahvenales" phylum= "Tracheophyta" rank= "species" species= "rebeccae" status= "sp. nov." >
<emphasis id= "1C67F46A51C656D0A50E836ECDCB42C9" italics= "true" > Kahvena rebeccae</emphasis>
Tedersoo
</taxonomicName>
<taxonomicNameLabel id= "46ECDA84C3CFD95B54950132A5301C39" rank= "species" > sp. nov.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection id= "SECID0ENYAI" type= "diagnosis" >
<paragraph id= "0629E8BD7D000970F858108442916C2E" >
<heading id= "422F9EAE2A87EE97A19FBB7586345F19" reason= "title" > Diagnosis.</heading>
</paragraph>
<paragraph id= "F9373E1C4D5BCB44B05B5451533BD2E4" >
Separation from other species of
<taxonomicName id= "2F55617DBC8F6DC52732F9F63E9B7C86" class= "Magnoliopsida" family= "Dipterocarpaceae" genus= "Kahvena" kingdom= "Plantae" order= "Malvales" phylum= "Tracheophyta" rank= "genus" >
<emphasis id= "990ADB701D3C7E21541789AD81CF7279" italics= "true" > Kahvena</emphasis>
</taxonomicName>
based on the
2024-08-09 20:56:59 +02:00
<abbrev id= "ABBRID0E1YAI" xlink_title= "internal transcribed spacer" > ITS</abbrev>
region (ITS 2 positions 200– 218 cattcgcaggaatagccag; one mismatch allowed) and from other species of
2024-08-09 19:17:04 +02:00
<taxonomicName id= "1F7A77CB09614C40AAA08C6688D7E219" class= "Endogonomycetes" higherTaxonomySource= "CoL,GBIF" kingdom= "Fungi" phylum= "Mucoromycota" rank= "class" > Endogonomycetes</taxonomicName>
2024-08-09 20:56:59 +02:00
based on LSU (positions 653– 683 acgcaagctccagatcgaatctccgggctaa; one mismatch allowed) as indicated in Fig.
2024-08-09 19:17:04 +02:00
<figureCitation id= "D5F9737581610B6C07B45816D78957A2" captionStart= "Figure 5" captionStartId= "F5" captionText= "Figure 5. Diagnostic barcodes for Kahvena rebeccae relative to closely-related taxa in ITS 2 and LSU." figureDoi= "10.3897/mycokeys.107.125549.figure5" httpUri= "https://binary.pensoft.net/fig/1111392" > 5</figureCitation>
.
</paragraph>
<caption id= "5674FBE8AB6072B8E906CD4C38FD6CB3" ID-DOI= "10.3897/mycokeys.107.125549.figure5" ID-arpha= "3D790374-2F19-5B7A-B75C-A2C2A8ED8EC2" httpUri= "https://binary.pensoft.net/fig/1111392" startId= "F5" >
<paragraph id= "0CB840370EF5F39520796673B94704A8" >
<label id= "44F771E45D0CB2399B7DE64227D1D6F0" > Figure 5.</label>
</paragraph>
<paragraph id= "446FC4348C929C0B6716B9E738BB5074" >
Diagnostic barcodes for
<taxonomicName id= "6E4392D01B9C3B148C585CAD41461CB0" class= "Magnoliopsida" family= "Dipterocarpaceae" genus= "Kahvena" kingdom= "Plantae" order= "Malvales" phylum= "Tracheophyta" rank= "species" species= "rebeccae" >
<emphasis id= "5B3745B4FA91F054814A0D883F72AEAA" italics= "true" > Kahvena rebeccae</emphasis>
</taxonomicName>
relative to closely-related taxa in ITS 2 and LSU.
</paragraph>
</caption>
</subSubSection>
<subSubSection id= "SECID0EA1AI" type= "material" >
<paragraph id= "3C01C8BFA23902828F36A92E7D07EDE5" >
2024-08-09 20:56:59 +02:00
<heading id= "574F6A3F14B350635EAF448166F26A96" reason= "title" > Type.</heading>
2024-08-09 19:17:04 +02:00
</paragraph>
<paragraph id= "7E3C4AB4BC7AFFB57A0EBF93AE51E4F3" >
2024-08-09 20:56:59 +02:00
<materialsCitation id= "CD2A7C5738C7D005D16F20734A886067" collectedFrom= "Populus - Picea - Pinus forest" collectionCode= "TUE, EUK" country= "Estonia" latitude= "58.27991" location= "Kahvena" longLatPrecision= "1" longitude= "25.23165" specimenCode= "TUE 100738, EUK 1634339, TUE 000738" specimenCount= "2" typeStatus= "holotype" >
2024-08-09 19:17:04 +02:00
Soil
<abbrev id= "ABBRID0EG1AI" xlink_title= "environmental DNA" > eDNA</abbrev>
2024-08-09 20:56:59 +02:00
sample
<specimenCode id= "81DE6F8125B2FA24B74859F6AE9D13C4" > TUE 100738</specimenCode>
(
2024-08-09 19:17:04 +02:00
<emphasis id= "024534C3B5EED457DA1DA2AA398E6039" bold= "true" italics= "true" >
<typeStatus id= "3751FEA66383CB83E731C50A4EBAA075" type= "holotype" > holotype</typeStatus>
</emphasis>
);
<abbrev id= "ABBRID0EN1AI" xlink_title= "environmental DNA" > eDNA</abbrev>
2024-08-09 20:56:59 +02:00
sequence
<specimenCode id= "D3F58C6CB17811AB83A2DE74FE8C6B98" > EUK 1634339</specimenCode>
(
2024-08-09 19:17:04 +02:00
<emphasis id= "9DA78F8D16C499A71304E0E28B2B3E6F" bold= "true" italics= "true" >
<typeStatus id= "3E40671318B451DF930A5DBF979E92AF" type= "lectotype" > lectotype</typeStatus>
</emphasis>
);
<abbrev id= "ABBRID0EU1AI" xlink_title= "Global Soil Mycobiome consortium" > GSMc</abbrev>
2024-08-09 20:56:59 +02:00
plot G 4196,
<collectedFrom id= "0307D01EA96BA49520B64EA723206097" >
2024-08-09 19:17:04 +02:00
<emphasis id= "26F63787CBD0EFFE5B697270AE2DB6BC" italics= "true" >
<taxonomicName id= "B3B43B45158680DEA1445DEBEEAF18DA" class= "Magnoliopsida" family= "Salicaceae" genus= "Populus" kingdom= "Plantae" order= "Malpighiales" phylum= "Tracheophyta" rank= "genus" > Populus</taxonomicName>
-
<taxonomicName id= "AEFCE32A063755AE4AAA86D44C4312DA" class= "Pinopsida" family= "Pinaceae" genus= "Picea" kingdom= "Plantae" order= "Pinales" phylum= "Tracheophyta" rank= "genus" > Picea</taxonomicName>
-
<taxonomicName id= "FCBE5FA37EFE08F0F0BBCB668936EADA" authorityName= "Perry" authorityYear= "1811" class= "Pinopsida" family= "Pinaceae" genus= "Pinus" kingdom= "Plantae" order= "Pinales" phylum= "Tracheophyta" rank= "genus" > Pinus</taxonomicName>
</emphasis>
2024-08-09 20:56:59 +02:00
forest
</collectedFrom>
(soil sample
<specimenCode id= "953AD3226390A8D88D62CAB19FC020C2" > TUE 000738</specimenCode>
) in
2024-08-09 19:17:04 +02:00
<taxonomicName id= "61D0F9BDCE3887D0E78E9EA5B1709D55" class= "Magnoliopsida" family= "Dipterocarpaceae" genus= "Kahvena" kingdom= "Plantae" order= "Malvales" phylum= "Tracheophyta" rank= "genus" >
2024-08-09 20:56:59 +02:00
<emphasis id= "614BEEEDEDE79F55B1F0B1CE0E34ABA7" italics= "true" >
<location id= "AF422D182E86C7AA6181A1E86D1F1C22" LSID= "urn:lsid:plazi:treatment:EB20E4EE572F53DB849A4606F20139EB:AF422D182E86C7AA6181A1E86D1F1C22" country= "Estonia" latitude= "58.27991" longLatPrecision= "1" longitude= "25.23165" name= "Kahvena" > Kahvena</location>
</emphasis>
2024-08-09 19:17:04 +02:00
</taxonomicName>
,
<collectingCountry id= "B01B5206A1638C8F2F9DCE25BCC0CE70" name= "Estonia" > Estonia</collectingCountry>
(
<named-content content-type= "dwc:verbatimCoordinates" id= "NCID0EU2AI" specific-use= "{"type":"Point","coordinates":[25.231650,58.279910]}" >
<geoCoordinate id= "7EB944E6F89815DDE2962CD8F919B5EB" degrees= "58.27991" direction= "north" orientation= "latitude" precision= "1" value= "58.27991" > 58.27991 ° N</geoCoordinate>
,
<geoCoordinate id= "2C6CED9FF0B996C3504E12228F314BAD" degrees= "25.23165" direction= "east" orientation= "longitude" precision= "1" value= "25.23165" > 25.23165 ° E</geoCoordinate>
</named-content>
2024-08-09 20:56:59 +02:00
)
</materialsCitation>
.
2024-08-09 19:17:04 +02:00
</paragraph>
</subSubSection>
<subSubSection id= "SECID0EZ2AI" type= "description" >
<paragraph id= "7F5C0683167181C433D42A097C691AAA" >
<heading id= "6B91F85EE4AD68D6A7D0ED2D304C28B3" reason= "title" > Description.</heading>
</paragraph>
<paragraph id= "7514CD0A96C78C9EE9266A2BE2BEFBA5" >
2024-08-09 20:56:59 +02:00
Other sequences: EUK 1635883 – EUK 1635886 (type locality); EUK 1631811 (
2024-08-09 19:17:04 +02:00
<abbrev id= "ABBRID0E62AI" xlink_title= "Global Soil Mycobiome consortium" > GSMc</abbrev>
2024-08-09 20:56:59 +02:00
plot G 2767, mixed woodland soil at Mäebe,
2024-08-09 19:17:04 +02:00
<collectingCountry id= "034F2AA3FBD8B26ABF0DAD87494F077B" name= "Estonia" > Estonia</collectingCountry>
,
<named-content content-type= "dwc:verbatimCoordinates" id= "NCID0EG3AI" specific-use= "{"type":"Point","coordinates":[22.076180,58.309370]}" >
<geoCoordinate id= "4243B74830BD6B48CF99C1B19D8D2556" degrees= "58.30937" direction= "north" orientation= "latitude" precision= "1" value= "58.30937" > 58.30937 ° N</geoCoordinate>
,
<geoCoordinate id= "A6EE8EAB91ECC36303C00D5FCF91E73C" degrees= "22.07618" direction= "east" orientation= "longitude" precision= "1" value= "22.07618" > 22.07618 ° E</geoCoordinate>
</named-content>
);
<ext-link id= "6164943F332F6C0006213583050C6B1A" ext-link-type= "gen" xlink_href= "KF618358" xlink_type= "simple" > KF 618358</ext-link>
(
<taxonomicName id= "E6290542D5B8EF0872563F69E1516FFD" class= "Pinopsida" family= "Pinaceae" genus= "Picea" kingdom= "Plantae" order= "Pinales" phylum= "Tracheophyta" rank= "species" species= "mariana" >
<emphasis id= "80AB5E0524EED0B8FC0EA1A4D0729AE7" italics= "true" > Picea mariana</emphasis>
</taxonomicName>
2024-08-09 20:56:59 +02:00
forest soil, AK,
2024-08-09 19:17:04 +02:00
<collectingCountry id= "B79B1D54030B74A19523B34D9315D55C" name= "United States of America" > USA</collectingCountry>
);
2024-08-09 20:56:59 +02:00
<ext-link id= "E213EFD1EE4C7D7A7A352C7E776CA91D" ext-link-type= "gen" xlink_href= "MT596306" xlink_type= "simple" > MT 596306</ext-link>
2024-08-09 19:17:04 +02:00
(Tobiotsuka Kofun,
<collectingCountry id= "A0A2AC211161214E196E74802C406DDE" name= "Japan" > Japan</collectingCountry>
,
<named-content content-type= "dwc:verbatimCoordinates" id= "NCID0ED4AI" specific-use= "{"type":"Point","coordinates":[133.681400,34.635500]}" >
<geoCoordinate id= "E1C3F4BBA5FE4D4A30CA0B7C8979F2E9" degrees= "34.6355" direction= "north" orientation= "latitude" precision= "5" value= "34.6355" > 34.6355 ° N</geoCoordinate>
,
<geoCoordinate id= "E0F2CC3800DFCE0E240303AC8F02C4EE" degrees= "133.6814" direction= "east" orientation= "longitude" precision= "5" value= "133.6814" > 133.6814 ° E</geoCoordinate>
</named-content>
);
2024-08-09 20:56:59 +02:00
<ext-link id= "1FBB21077CAE6A0C63BAF4A6E68ED911" ext-link-type= "gen" xlink_href= "KU062529" xlink_type= "simple" > KU 062529</ext-link>
2024-08-09 19:17:04 +02:00
(unknown source); and
<ext-link id= "C3D2A39566A7B3B0223CD6630608BE41" ext-link-type= "gen" xlink_href= "KF565426" xlink_type= "simple" > KF 565426</ext-link>
2024-08-09 20:56:59 +02:00
(Duke Forest, NC,
2024-08-09 19:17:04 +02:00
<collectingCountry id= "DD6EDD66BBC8FA5423FFBF7AB8172778" name= "United States of America" > USA</collectingCountry>
,
<named-content content-type= "dwc:verbatimCoordinates" id= "NCID0EV4AI" specific-use= "{"type":"Point","coordinates":[79.090000,35.970000]}" >
<geoCoordinate id= "504427E5E3E80C62D698899D8B83591B" degrees= "35.97" direction= "north" orientation= "latitude" precision= "555" value= "35.97" > 35.97 ° N</geoCoordinate>
, -
<geoCoordinate id= "624DD8F6749FF6D1A9A90CAC64B18BD8" degrees= "79.09" direction= "east" orientation= "longitude" precision= "555" value= "79.09" > 79.09 ° E</geoCoordinate>
</named-content>
), isolated by Rebecca C. Mueller (
<bibRefCitation id= "A48427A1E0724D23A89EF70AC431C0C7" DOI= "10.1111/mec.12858" author= "Mueller" etAl= "et al." firstAuthor= "Mueller" issue= "17" journalOrPublisher= "Molecular Ecology" pagination= "4406-4417" refId= "B55" refString= "Mueller RC, Balasch MM, Kuske CL (2014) Contrasting soil fungal community responses to experimental nitrogen addition using the large subunit rRNA taxonomic marker and cellobiohydrolase I functional marker. Molecular Ecology 23 (17): 4406– 4417. https://doi.org/10.1111/mec.12858" title= "Contrasting soil fungal community responses to experimental nitrogen addition using the large subunit rRNA taxonomic marker and cellobiohydrolase I functional marker." volume= "23" year= "2014" > Mueller et al. 2014</bibRefCitation>
).
</paragraph>
</subSubSection>
<subSubSection id= "SECID0EE5AI" type= "etymology" >
<paragraph id= "3FCFA9C1F1CF31A81506BDCE112FD8B9" >
<heading id= "088CF3DCAD6CCB5A389928E457CC089B" reason= "title" > Etymology.</heading>
</paragraph>
<paragraph id= "4E5A0EB0BE68EFDB67FBF469D322C513" >
<emphasis id= "DD2F57A25496C3CB31AA358595EDC235" italics= "true" > Kahvena</emphasis>
2024-08-09 20:56:59 +02:00
(Estonian) refers to type locality; and
2024-08-09 19:17:04 +02:00
<emphasis id= "487B37E842DDB70581600C97419291DA" italics= "true" > Rebecca</emphasis>
2024-08-09 20:56:59 +02:00
(English) refers to the first name of Rebecca C. Mueller, who collected the first materials belonging to this genus and the type species.
2024-08-09 19:17:04 +02:00
</paragraph>
</subSubSection>
<subSubSection id= "SECID0E55AI" type= "notes" >
<paragraph id= "7F281CD27F3551AD6CBD6340B71EAA7D" >
<heading id= "04371DD51B7E0655A612DE2008745855" reason= "title" > Notes.</heading>
</paragraph>
<paragraph id= "ECDE75F7E864B0D016E5193F5156EFC9" >
Found from temperate and subarctic forests in Europe, Asia and North America, with
2024-08-09 20:56:59 +02:00
<abbrev id= "ABBRID0EE6AI" xlink_title= "internal transcribed spacer" > ITS</abbrev>
and LSU sequences differing up to 4 % (excluding a 29 - base deletion in EUK 1631811 and
<ext-link id= "F7FEC4555F452DC51B003226E5E7926A" ext-link-type= "gen" xlink_href= "KU062529" xlink_type= "simple" > KU 062529</ext-link>
) and 1.5 %, respectively. Considered as a single species because of high intraspecific variation amongst common sequence variants in the type locality (2 % in
<abbrev id= "ABBRID0EN6AI" xlink_title= "internal transcribed spacer" > ITS</abbrev>
and 1 % in LSU, representing both indels and substitutions).
2024-08-09 19:17:04 +02:00
</paragraph>
</subSubSection>
</treatment>
</document>