plazi/treatments-xml
2
0
Fork 0
Code Issues Pull requests Releases Activity
treatments-xml/data/03/FB/87/03FB87BDD87CFFC61AAE8AE2AF2AE7BF.xml
maintenance bc2564723d added 03
2024-06-21 12:22:17 +02:00

381 lines
74 KiB
XML
Raw Blame History

This file contains ambiguous Unicode characters

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

<document id="B0592A3217F5DA5E6C370E44A08DDE63" ID-CLB-Dataset="32551" ID-DOI="10.11646/zootaxa.4300.4.7" ID-GBIF-Dataset="e70b4c69-e5e3-4e04-840e-3734f1ccbebb" ID-ISSN="1175-5326" ID-Zenodo-Dep="839319" ID-ZooBank="0ED749DE-AC2F-466E-87BD-445DA22842AC" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="existingObjects,plazi" IM.taxonomicNames_approvedBy="felipe" checkinTime="1501953762621" checkinUser="plazi" docAuthor="Martínez-Caballero, Ana L., Morales-Gutiérrez, Selene &amp; Elías-Gutiérrez, Manuel" docDate="2017" docId="03FB87BDD87CFFC61AAE8AE2AF2AE7BF" docLanguage="en" docName="zoobank.4300.4.7.pdf" docOrigin="Zootaxa 4300 (4)" docStyle="DocumentStyle:647186512141C8FC8976D5BCC54AEB7D.9:Zootaxa.2013-.journal_article" docStyleId="647186512141C8FC8976D5BCC54AEB7D" docStyleName="Zootaxa.2013-.journal_article" docStyleVersion="9" docTitle="Bunops serricaudata" docType="treatment" docVersion="8" lastPageNumber="597" masterDocId="FFC2FFC5D87EFFCE1A398B4FAD10E11E" masterDocTitle="First record of the genus Bunops Birge, 1893 (Cladocera: Macrothricidae) in the Neotropical highlands of Mexico with a detailed study of morphology and DNA barcodes" masterLastPageNumber="600" masterPageNumber="589" pageNumber="591" updateTime="1698466234505" updateUser="ExternalLinkService">
<mods:mods id="3B2B3275FD8879F078D3069CD9DFA608" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="7073A6704877769C4669F69224824ABD">
<mods:title id="22BEC1831E17EBBD9CBB875EBAE6B91B">First record of the genus Bunops Birge, 1893 (Cladocera: Macrothricidae) in the Neotropical highlands of Mexico with a detailed study of morphology and DNA barcodes</mods:title>
</mods:titleInfo>
<mods:name id="F5096028C26E3F870EEA7ED177EBE032" type="personal">
<mods:role id="A61CF1B7B83C0BDF4DC73FB741DB7077">
<mods:roleTerm id="F2197E6FAE90C91F01C5B19FB45C9578">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="F33B5CC53B4E35CD72AD91A97ABCFD15">Martínez-Caballero, Ana L.</mods:namePart>
</mods:name>
<mods:name id="56EFC844480FFFAE3355F93DD63C5C33" type="personal">
<mods:role id="70BACB8F8528A3CDC005DAE6DE32E62A">
<mods:roleTerm id="309ED6452CD3D4497E3D50A5222FD95D">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="46F4E6DADECCF40BD509DA7B788858C0">Morales-Gutiérrez, Selene</mods:namePart>
</mods:name>
<mods:name id="4BEC67A462CA61B825271709EDDC4742" type="personal">
<mods:role id="9519BDB5AEB25C814093136CFC87BF54">
<mods:roleTerm id="7FD30F41A36B46A1A14B0ACD6D190E0D">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="5B47F69791B2EAB1076151438335CE97">Elías-Gutiérrez, Manuel</mods:namePart>
</mods:name>
<mods:typeOfResource id="C97CAE07BE51321656AD30F2647FDFF1">text</mods:typeOfResource>
<mods:relatedItem id="62ADC02DCB996C3C84A1B39AF9777436" type="host">
<mods:titleInfo id="A2BE6F742403DF692730ADF4E25F65DD">
<mods:title id="ACABD6E0405BDD40BDBAE5907C9A54C0">Zootaxa</mods:title>
</mods:titleInfo>
<mods:part id="3C2A3D57E9D8FE5F1D61D51D5F18C9C9">
<mods:date id="31FC340E66F47996825C663A26BCC59A">2017</mods:date>
<mods:detail id="838CDFC3D808C4B2A807F34FE5D7AB95" type="volume">
<mods:number id="FAE13BF4E6DFCDDBF1D907010C1C7009">4300</mods:number>
</mods:detail>
<mods:detail id="20013E3552D625E91F7E9A3E26B64D7D" type="issue">
<mods:number id="D9517F50D13A65533EBA04FA6A4E0A4F">4</mods:number>
</mods:detail>
<mods:extent id="CC8376EC2FECEE7F8DD0711C93430524" unit="page">
<mods:start id="4E2B65B6A690F19EC99C622C4A50D3E0">589</mods:start>
<mods:end id="BA01C17CC8CA3F66F293CFC3E6683E2A">600</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="626E55969A3E0941EC5363D21687C1A3">journal article</mods:classification>
<mods:identifier id="E1F5518EDB6926D77B8AA945B8B89B61" type="CLB-Dataset">32551</mods:identifier>
<mods:identifier id="7D782EF9C483D9FF0E495A89E59C8750" type="DOI">10.11646/zootaxa.4300.4.7</mods:identifier>
<mods:identifier id="7289AED509F7537A6B118AFE0221038C" type="GBIF-Dataset">e70b4c69-e5e3-4e04-840e-3734f1ccbebb</mods:identifier>
<mods:identifier id="813F2DF434326C0FDB2F19747B42EADA" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="BD31373A0AC01EE2A540B50FA9FEA6BE" type="Zenodo-Dep">839319</mods:identifier>
<mods:identifier id="B59A89C7110B531FB4E0C15A3FDA0EF5" type="ZooBank">0ED749DE-AC2F-466E-87BD-445DA22842AC</mods:identifier>
</mods:mods>
<treatment id="03FB87BDD87CFFC61AAE8AE2AF2AE7BF" ID-DOI="http://doi.org/10.5281/zenodo.6008981" ID-GBIF-Taxon="132630528" ID-Zenodo-Dep="6008981" LSID="urn:lsid:plazi:treatment:03FB87BDD87CFFC61AAE8AE2AF2AE7BF" httpUri="http://treatment.plazi.org/id/03FB87BDD87CFFC61AAE8AE2AF2AE7BF" lastPageId="8" lastPageNumber="597" pageId="2" pageNumber="591">
<subSubSection id="C3486520D87CFFCC1AAE8AE2AC02E0F6" pageId="2" pageNumber="591" type="nomenclature">
<paragraph id="8BED36ABD87CFFCC1AAE8AE2AF7BE0D9" blockId="2.[151,619,429,488]" box="[151,619,429,455]" pageId="2" pageNumber="591">
<heading id="D0A581C7D87CFFCC1AAE8AE2AF7BE0D9" bold="true" box="[151,619,429,455]" fontSize="11" level="1" pageId="2" pageNumber="591" reason="1">
<taxonomicName id="4C524D28D87CFFCC1AAE8AE2AF7BE0D9" ID-CoL="NVFB" authority="(Daday, 1884)" baseAuthorityName="Daday" baseAuthorityYear="1884" box="[151,619,429,455]" class="Branchiopoda" family="Macrothricidae" genus="Bunops" kingdom="Animalia" order="Diplostraca" pageId="2" pageNumber="591" phylum="Arthropoda" rank="species" species="serricaudata">
<emphasis id="B926EAB9D87CFFCC1AAE8AE2AF7BE0D9" bold="true" box="[151,619,429,455]" pageId="2" pageNumber="591">
<emphasis id="B926EAB9D87CFFCC1AAE8AE2ADE4E0D9" bold="true" box="[151,244,429,455]" italics="true" pageId="2" pageNumber="591">Bunops</emphasis>
cf.
<emphasis id="B926EAB9D87CFFCC1B198AE2ACA7E0D9" bold="true" box="[288,439,429,455]" italics="true" pageId="2" pageNumber="591">serricaudata</emphasis>
(Daday, 1884)
</emphasis>
</taxonomicName>
</heading>
</paragraph>
<paragraph id="8BED36ABD87CFFCC1AAE8A80AC02E0F6" blockId="2.[151,619,429,488]" box="[151,274,463,488]" pageId="2" pageNumber="591">
(
<figureCitation id="13692A2ED87CFFCC1AA68A80AC18E0F6" box="[159,264,463,488]" captionStart-0="FIGURE 1" captionStart-1="FIGURE 2" captionStart-2="FIGURE 4" captionStart-3="FIGURE 5" captionStartId-0="3.[151,250,1625,1647]" captionStartId-1="4.[151,250,1937,1959]" captionStartId-2="6.[151,250,1921,1943]" captionStartId-3="7.[151,250,1867,1889]" captionTargetBox-0="[151,1435,449,1604]" captionTargetBox-1="[167,1419,789,1915]" captionTargetBox-2="[154,1419,205,1877]" captionTargetBox-3="[151,1436,193,1846]" captionTargetId-0="figure@3.[151,1435,449,1604]" captionTargetId-1="figure@4.[167,1419,789,1915]" captionTargetId-2="figure@6.[151,1436,193,1900]" captionTargetId-3="figure@7.[151,1436,193,1846]" captionTargetPageId-0="3" captionTargetPageId-1="4" captionTargetPageId-2="6" captionTargetPageId-3="7" captionText-0="FIGURE 1. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, habitus, parthenogenetic female. B, habitus, ephippial female. C, antennules (scale bar 80 µm). D, tip of antennulae with aesthetascs (scale bar 40 µm)." captionText-1="FIGURE 2. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, antenna (scale bar: 310 µm). B, detail of the distal part of the basipod from A (scale bar: 80 µm). C, postabdomen (scale bar: 200 µm). D, seta natatoria (scale bar 80 µm). E, detail of the armature in the margin of the valves (scale bar 40 µm)." captionText-2="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." captionText-3="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri-0="https://zenodo.org/record/839321/files/figure.png" httpUri-1="https://zenodo.org/record/839323/files/figure.png" httpUri-2="https://zenodo.org/record/839325/files/figure.png" httpUri-3="https://zenodo.org/record/839327/files/figure.png" pageId="2" pageNumber="591">Figs. 1–5</figureCitation>
)
</paragraph>
</subSubSection>
<subSubSection id="C3486520D87CFFC61AAE8958AF2AE7BF" lastPageId="8" lastPageNumber="597" pageId="2" pageNumber="591" type="description">
<paragraph id="8BED36ABD87CFFCC1AAE8958AED5E24E" blockId="2.[151,1437,535,2037]" pageId="2" pageNumber="591">
<emphasis id="B926EAB9D87CFFCC1AAE8958AF42E32E" bold="true" box="[151,594,535,560]" pageId="2" pageNumber="591">Description. Parthenogenetic female.</emphasis>
<emphasis id="B926EAB9D87CFFCC18638958AF8FE32E" box="[602,671,535,560]" italics="true" pageId="2" pageNumber="591">Shape</emphasis>
and
<emphasis id="B926EAB9D87CFFCC18EE8958AE0DE32E" box="[727,797,535,560]" italics="true" pageId="2" pageNumber="591">valves</emphasis>
(
<figureCitation id="13692A2ED87CFFCC19178958AE69E32E" box="[814,889,535,560]" captionStart="FIGURE 1" captionStartId="3.[151,250,1625,1647]" captionTargetBox="[151,1435,449,1604]" captionTargetId="figure@3.[151,1435,449,1604]" captionTargetPageId="3" captionText="FIGURE 1. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, habitus, parthenogenetic female. B, habitus, ephippial female. C, antennules (scale bar 80 µm). D, tip of antennulae with aesthetascs (scale bar 40 µm)." httpUri="https://zenodo.org/record/839321/files/figure.png" pageId="2" pageNumber="591">Figs. 1</figureCitation>
A, 3B–E). Semi-circular in lateral view (length: 0.69±
<quantity id="4CAA9B4ED87CFFCC1AE08973AC20E34A" box="[217,304,572,597]" metricMagnitude="-4" metricUnit="m" metricValue="1.0" pageId="2" pageNumber="591" unit="mm" value="0.1">0.1 mm</quantity>
; height: 0.53±
<quantity id="4CAA9B4ED87CFFCC1BF68973AF26E34A" box="[463,566,572,597]" metricMagnitude="-5" metricUnit="m" metricValue="8.0" pageId="2" pageNumber="591" unit="mm" value="0.08">0.08 mm</quantity>
; N=11), strongly flattened laterally in anterior view. The dorsal margins of the valves are coalesced forming a curved, arched, well-developed keel extending from the head to the posterior dorsal corner, forming a small, rounded projection. Ventral margin armed with 18–21 spines (N=11). From the middle of the ventral side of the valves, the spines are submarginal and increase in length proximally. Between the long spines, there is a row of small spinulae inserted sub-marginally (
<figureCitation id="13692A2ED87CFFCC19558983AEA0E3FA" box="[876,944,716,741]" captionStart="FIGURE 2" captionStartId="4.[151,250,1937,1959]" captionTargetBox="[167,1419,789,1915]" captionTargetId="figure@4.[167,1419,789,1915]" captionTargetPageId="4" captionText="FIGURE 2. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, antenna (scale bar: 310 µm). B, detail of the distal part of the basipod from A (scale bar: 80 µm). C, postabdomen (scale bar: 200 µm). D, seta natatoria (scale bar 80 µm). E, detail of the armature in the margin of the valves (scale bar 40 µm)." httpUri="https://zenodo.org/record/839323/files/figure.png" pageId="2" pageNumber="591">Fig. 2</figureCitation>
E). Internal ventral part of the valves with a row of long setae that goes inside, forming a broad curve that becomes more marginal towards the posterior side (Fig. 3C–D). Hook setae curved towards the dorsal side, followed by a row of small spinulae. The valve ornamentation consists of small spinulae arranged in polygons (Fig. 3E).
</paragraph>
<paragraph id="8BED36ABD87CFFCC1AFE8813AE4BE2FE" blockId="2.[151,1437,535,2037]" pageId="2" pageNumber="591">
<emphasis id="B926EAB9D87CFFCC1AFE8813AC14E26B" box="[199,260,860,885]" italics="true" pageId="2" pageNumber="591">Head</emphasis>
(
<figureCitation id="13692A2ED87CFFCC1B2A8813AC4CE26A" box="[275,348,860,885]" captionStart="FIGURE 1" captionStartId="3.[151,250,1625,1647]" captionTargetBox="[151,1435,449,1604]" captionTargetId="figure@3.[151,1435,449,1604]" captionTargetPageId="3" captionText="FIGURE 1. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, habitus, parthenogenetic female. B, habitus, ephippial female. C, antennules (scale bar 80 µm). D, tip of antennulae with aesthetascs (scale bar 40 µm)." httpUri="https://zenodo.org/record/839321/files/figure.png" pageId="2" pageNumber="591">Figs. 1</figureCitation>
A, 3B). Small in proportion to the size of the animal, triangular, in lateral view with a depression in the rostral region. Compound eye projecting in the dorsal margin. Ocellus smaller than compound eye, near to the tip of rostrum. Head-pore projected and round. Ventral margin of head smooth. Labrum with a widened proximal side, triangular in shape, with a rounded tip (Fig. 3F).
</paragraph>
<paragraph id="8BED36ABD87CFFCC1AFE88A2AC16E552" blockId="2.[151,1437,535,2037]" pageId="2" pageNumber="591">
<emphasis id="B926EAB9D87CFFCC1AFE88A2AC71E51A" box="[199,353,1005,1028]" italics="true" pageId="2" pageNumber="591">First antenna</emphasis>
(
<figureCitation id="13692A2ED87CFFCC1B4888A3ACABE51A" box="[369,443,1004,1029]" captionStart="FIGURE 1" captionStartId="3.[151,250,1625,1647]" captionTargetBox="[151,1435,449,1604]" captionTargetId="figure@3.[151,1435,449,1604]" captionTargetPageId="3" captionText="FIGURE 1. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, habitus, parthenogenetic female. B, habitus, ephippial female. C, antennules (scale bar 80 µm). D, tip of antennulae with aesthetascs (scale bar 40 µm)." httpUri="https://zenodo.org/record/839321/files/figure.png" pageId="2" pageNumber="591">Figs. 1</figureCitation>
C–D) long, cylindrical, slightly tapering at the distal end (
<figureCitation id="13692A2ED87CFFCC1E6188A3A983E51B" box="[1112,1171,1004,1029]" captionStart="FIGURE 1" captionStartId="3.[151,250,1625,1647]" captionTargetBox="[151,1435,449,1604]" captionTargetId="figure@3.[151,1435,449,1604]" captionTargetPageId="3" captionText="FIGURE 1. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, habitus, parthenogenetic female. B, habitus, ephippial female. C, antennules (scale bar 80 µm). D, tip of antennulae with aesthetascs (scale bar 40 µm)." httpUri="https://zenodo.org/record/839321/files/figure.png" pageId="2" pageNumber="591">Fig.1</figureCitation>
C), with two setules on the last third and two more at a half distance from these to the tip. Nine terminal aesthetascs of different length (
<figureCitation id="13692A2ED87CFFCC1AA68F7BADCFE552" box="[159,223,1076,1101]" captionStart="FIGURE 1" captionStartId="3.[151,250,1625,1647]" captionTargetBox="[151,1435,449,1604]" captionTargetId="figure@3.[151,1435,449,1604]" captionTargetPageId="3" captionText="FIGURE 1. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, habitus, parthenogenetic female. B, habitus, ephippial female. C, antennules (scale bar 80 µm). D, tip of antennulae with aesthetascs (scale bar 40 µm)." httpUri="https://zenodo.org/record/839321/files/figure.png" pageId="2" pageNumber="591">Fig. 1</figureCitation>
D).
</paragraph>
<paragraph id="8BED36ABD87CFFCC1AFE8F18A82EE5C3" blockId="2.[151,1437,535,2037]" pageId="2" pageNumber="591">
<emphasis id="B926EAB9D87CFFCC1AFE8F18AC6BE56E" box="[199,379,1111,1136]" italics="true" pageId="2" pageNumber="591">Second antenna</emphasis>
(
<figureCitation id="13692A2ED87CFFCC1BB48F18ACCCE56E" box="[397,476,1111,1136]" captionStart="FIGURE 2" captionStartId="4.[151,250,1937,1959]" captionTargetBox="[167,1419,789,1915]" captionTargetId="figure@4.[167,1419,789,1915]" captionTargetPageId="4" captionText="FIGURE 2. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, antenna (scale bar: 310 µm). B, detail of the distal part of the basipod from A (scale bar: 80 µm). C, postabdomen (scale bar: 200 µm). D, seta natatoria (scale bar 80 µm). E, detail of the armature in the margin of the valves (scale bar 40 µm)." httpUri="https://zenodo.org/record/839323/files/figure.png" pageId="2" pageNumber="591">Figs. 2</figureCitation>
A–B). Basipod internal with two sensory setae on the proximal part and one on the distal, all of them bi-segmented (Fig 3B). A small spine on the distal external side (
<figureCitation id="13692A2ED87CFFCC1E0B8F33A97EE58A" box="[1074,1134,1148,1173]" captionStart="FIGURE 2" captionStartId="4.[151,250,1937,1959]" captionTargetBox="[167,1419,789,1915]" captionTargetId="figure@4.[167,1419,789,1915]" captionTargetPageId="4" captionText="FIGURE 2. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, antenna (scale bar: 310 µm). B, detail of the distal part of the basipod from A (scale bar: 80 µm). C, postabdomen (scale bar: 200 µm). D, seta natatoria (scale bar 80 µm). E, detail of the armature in the margin of the valves (scale bar 40 µm)." httpUri="https://zenodo.org/record/839323/files/figure.png" pageId="2" pageNumber="591">Fig 2</figureCitation>
B; 3A–B). Swimming seta: 0-0-0-3/1-1-3; spines: 0-1-0-2/0-0-1, very thin and fine. Each segment of both branches with a row of fine spinulae on the distal end. Largest seta thin, bi-segmented, unilaterally setulated with fine spines on both segments.
</paragraph>
<paragraph id="8BED36ABD87CFFCC1AFE8FA8AF0DE48E" blockId="2.[151,1437,535,2037]" pageId="2" pageNumber="591">
<emphasis id="B926EAB9D87CFFCC1AFE8FA8AC70E41E" box="[199,352,1255,1280]" italics="true" pageId="2" pageNumber="591">Postabdomen</emphasis>
(
<figureCitation id="13692A2ED87CFFCC1B568FA8ACADE41E" box="[367,445,1255,1280]" captionStart="FIGURE 2" captionStartId="4.[151,250,1937,1959]" captionTargetBox="[167,1419,789,1915]" captionTargetId="figure@4.[167,1419,789,1915]" captionTargetPageId="4" captionText="FIGURE 2. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, antenna (scale bar: 310 µm). B, detail of the distal part of the basipod from A (scale bar: 80 µm). C, postabdomen (scale bar: 200 µm). D, seta natatoria (scale bar 80 µm). E, detail of the armature in the margin of the valves (scale bar 40 µm)." httpUri="https://zenodo.org/record/839323/files/figure.png" pageId="2" pageNumber="591">Figs. 2</figureCitation>
C–D; 3G–H) oval-acute in lateral view, bilobed. Preanal portion with numerous rows of spines similar in length. Anus surrounded by rows of spinulae. Postabdominal claw curved, with lateral teeth (Fig. 3H). Two postabdominal setae long, slim, biarticulated, with a long distal segment, more than one-third of the total length, covered by thin setulae (
<figureCitation id="13692A2ED87CFFCC18318E1BAF5EE472" box="[520,590,1364,1389]" captionStart="FIGURE 2" captionStartId="4.[151,250,1937,1959]" captionTargetBox="[167,1419,789,1915]" captionTargetId="figure@4.[167,1419,789,1915]" captionTargetPageId="4" captionText="FIGURE 2. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, antenna (scale bar: 310 µm). B, detail of the distal part of the basipod from A (scale bar: 80 µm). C, postabdomen (scale bar: 200 µm). D, seta natatoria (scale bar 80 µm). E, detail of the armature in the margin of the valves (scale bar 40 µm)." httpUri="https://zenodo.org/record/839323/files/figure.png" pageId="2" pageNumber="591">Fig. 2</figureCitation>
D). Before the postabdominal setae, there is a rounded abdominal process with short and stiff hairs (
<figureCitation id="13692A2ED87CFFCC1B8E8E38ACEBE48E" box="[439,507,1399,1424]" captionStart="FIGURE 2" captionStartId="4.[151,250,1937,1959]" captionTargetBox="[167,1419,789,1915]" captionTargetId="figure@4.[167,1419,789,1915]" captionTargetPageId="4" captionText="FIGURE 2. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, antenna (scale bar: 310 µm). B, detail of the distal part of the basipod from A (scale bar: 80 µm). C, postabdomen (scale bar: 200 µm). D, seta natatoria (scale bar 80 µm). E, detail of the armature in the margin of the valves (scale bar 40 µm)." httpUri="https://zenodo.org/record/839323/files/figure.png" pageId="2" pageNumber="591">Fig. 2</figureCitation>
C).
</paragraph>
<paragraph id="8BED36ABD87CFFCC1AFE8ED3AE20E6B3" blockId="2.[151,1437,535,2037]" pageId="2" pageNumber="591">
<emphasis id="B926EAB9D87CFFCC1AFE8ED3AC46E4AA" box="[199,342,1436,1461]" italics="true" pageId="2" pageNumber="591">Trunk limb I</emphasis>
(
<figureCitation id="13692A2ED87CFFCC1B5E8ED3ACA8E4AA" box="[359,440,1436,1461]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Figs. 4</figureCitation>
A–C). EX (ODL), bearing a long apical seta, bi-segmented; unilaterally setulated at its distal part and a short lateral seta (
<figureCitation id="13692A2ED87CFFCC182E8EF0AF4CE4C6" box="[535,604,1471,1496]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Fig. 4</figureCitation>
C). EN 4 (IDL) with three setae of different size, the longest bi-segmented and unilaterally setulated at its distal segment; the middle seta is robust hook-shaped, not segmented and unilaterally setulated at its distal segment (
<figureCitation id="13692A2ED87CFFCC184E8D48AFACE73E" box="[631,700,1543,1568]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Fig. 4</figureCitation>
C); the smaller, strong, not segmented, unilaterally setulated at its middle portion (
<figureCitation id="13692A2ED87CFFCC1B688D63AC88E75A" box="[337,408,1580,1605]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Fig. 4</figureCitation>
C). Endite 3 (E3) with four setae; seta 1 long, not segmented, unilaterally setulated, with setulae decreasing in size distally (
<figureCitation id="13692A2ED87CFFCC18228D00AF4EE776" box="[539,606,1615,1640]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Fig. 4</figureCitation>
A); seta 2 shorter and thinner than seta 1, segmented and bi-setulated (
<figureCitation id="13692A2ED87CFFCC1F568D00ADB6E792" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Fig. 4</figureCitation>
A); seta 3, shorter than seta 2, bi-segmented, wider in the first third with long setulae on both sides of it, next twothirds narrower and bilaterally setulated with setulae decreasing in size distally; seta 4 slightly longer and wider than seta 3, bi-segmented, with the same kind of ornamentation. Between E3 and E2 there is a long, thin seta (S in
<figureCitation id="13692A2ED87CFFCC1AAE8D90ADC4E7E6" box="[151,212,1759,1784]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Fig 4</figureCitation>
A). Endite 2 (E2) with three bi-segmented setae, unilaterally setulated at their distal segment and long, thin setulae in the proximal segment (5-7). Endite 1 (E1) with three setae; seta 8 and 9 long, segmented, bilaterally setulated along the last two-thirds; seta 10 long and thin, bi-segmented, bilaterally setulated at distal segment. Next to it, a short seta, with a hairless base and long setulae on both sides of the distal, thinner portion (arrow in
<figureCitation id="13692A2ED87CFFCC1F0F8C03A868E67A" box="[1334,1400,1868,1893]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Fig. 4</figureCitation>
A); E1 has a trident-shaped seta with three teeth, the middle one is wider and with small teeth on both sides (
<figureCitation id="13692A2ED87CFFCC1F0F8C20A86BE696" box="[1334,1403,1903,1928]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Fig. 4</figureCitation>
B). Two ejector hooks, each with small denticles on both sides.
</paragraph>
<paragraph id="8BED36ABD87CFFCD1AFE8CF7A859E0B3" blockId="2.[151,1437,535,2037]" lastBlockId="3.[151,1437,151,429]" lastPageId="3" lastPageNumber="592" pageId="2" pageNumber="591">
<emphasis id="B926EAB9D87CFFCC1AFE8CF7AC4CE6CE" box="[199,348,1976,2001]" italics="true" pageId="2" pageNumber="591">Trunk limb II</emphasis>
(
<figureCitation id="13692A2ED87CFFCC1B528CF7ACABE6CE" box="[363,443,1976,2001]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Figs. 4</figureCitation>
D). EX oval, covered with small and numerous fine hairs with a long, thin bi-segmented seta, inserted towards one side, armed with thin setulae on both sides inserted sub-distally (
<figureCitation id="13692A2ED87CFFCC1EAB8C93A9C6E6EA" box="[1170,1238,2012,2037]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="2" pageNumber="591">Fig. 4</figureCitation>
D). EN with eight stout and bi-segmented scrapers; scraper 1 and scraper 2 of the same size, longer and slender than the others, unilaterally setulated at their distal segment; the other six, decreasing in size proximally, with strong teeth on their distal segment; behind scraper 8, a sensillum strongly setulated at its distal portion (arrow in
<figureCitation id="13692A2ED87DFFCD1EA78B90A9F0E1E6" box="[1182,1248,223,248]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="3" pageNumber="592">Fig. 4</figureCitation>
D). GT with four setae; seta GT1 the shortest, ending pointed; seta GT2, longer, with long setulae on the distal part; seta GT3 with hook-shaped tip; and seta GT4 slightly longer than GT3 and GT1, with two pointed ends. Filter comb with five long setae, not segmented, bilaterally setulated. Besides scraper 2 and 3 there are three hyaline elements, the first one broad, triangular and hairy, the second is very wide, with a bifurcated end, and the third one rounded without setae. Behind scraper 4, one modified seta, possibly sensorial, short, broad, with long setulae on both sides.
</paragraph>
<caption id="DF2D6623D87DFFCD1AAE8D16A9DEE793" httpUri="https://zenodo.org/record/839321/files/figure.png" pageId="3" pageNumber="592" targetBox="[151,1435,449,1604]" targetPageId="3">
<paragraph id="8BED36ABD87DFFCD1AAE8D16A9DEE793" blockId="3.[151,1436,1625,1677]" pageId="3" pageNumber="592">
<emphasis id="B926EAB9D87DFFCD1AAE8D16AC05E770" bold="true" box="[151,277,1625,1647]" pageId="3" pageNumber="592">FIGURE 1.</emphasis>
<taxonomicName id="4C524D28D87DFFCD1B278D15AF07E770" baseAuthorityName="Daday" baseAuthorityYear="1884" box="[286,535,1625,1647]" class="Branchiopoda" family="Macrothricidae" genus="Bunops" kingdom="Animalia" order="Diplostraca" pageId="3" pageNumber="592" phylum="Arthropoda" rank="species" species="serricaudata">
<emphasis id="B926EAB9D87DFFCD1B278D15AC7AE771" box="[286,362,1626,1647]" italics="true" pageId="3" pageNumber="592">Bunops</emphasis>
cf.
<emphasis id="B926EAB9D87DFFCD1BAF8D16AF07E770" box="[406,535,1625,1646]" italics="true" pageId="3" pageNumber="592">serricaudata</emphasis>
</taxonomicName>
from Chipila, Tlaxcala State, Mexico. A, habitus, parthenogenetic female. B, habitus, ephippial female. C, antennules (scale bar 80 µm). D, tip of antennulae with aesthetascs (scale bar 40 µm).
</paragraph>
</caption>
<paragraph id="8BED36ABD87DFFCA1AFE8DFBAEE0E003" blockId="3.[151,1437,1716,2030]" lastBlockId="4.[151,1437,151,752]" lastPageId="4" lastPageNumber="593" pageId="3" pageNumber="592">
<emphasis id="B926EAB9D87DFFCD1AFE8DFBAC74E7D3" box="[199,356,1716,1741]" italics="true" pageId="3" pageNumber="592">Trunk limb III</emphasis>
(
<figureCitation id="13692A2ED87DFFCD1B4A8DFBACD2E7D3" box="[371,450,1716,1741]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="3" pageNumber="592">Figs. 4</figureCitation>
E). EX with five hyaline setae, well developed; two more vestigial setae, between seta 2 and 3 (arrows in
<figureCitation id="13692A2ED87DFFCD1B6A8D96AC85E7EF" box="[339,405,1753,1778]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="3" pageNumber="592">Fig. 4</figureCitation>
E); seta 1, long, bilaterally setulated from basis to tip; seta 2, short, bilaterally setulated from basis to tip, after this, the first and second vestigial seta (
<date id="FFEC106BD87DFFCD191B8DB2AEB4E60B" box="[802,932,1789,1814]" pageId="3" pageNumber="592">V1 and V2</date>
), setulated; second vestigial seta (
<date id="FFEC106BD87DFFCD1F1F8DB2A85AE60B" box="[1318,1354,1789,1813]" pageId="3" pageNumber="592">V2</date>
) blunt, very short, fully setulated; seta 3 long and robust, fully setulated on both sides; seta 4 longer than 3, both bilaterally setulated from basis to tip; seta 5 shorter than setae 3 and 4, bisegmented, bilaterally setulated from basis to tip. EN with two lobes. First lobe or EE with two rows of setae; anterior row with three setae; seta 1 hook like with small teeth along its distal portion; seta 2 and seta 3, both with long setulae; posterior row with four setae; seta
<date id="FFEC106BD87DFFCD1F1D8CC2A82BE6BB" box="[1316,1339,1933,1957]" pageId="3" pageNumber="592">I1</date>
and seta
<date id="FFEC106BD87DFFCD1AAE8CFEADBEE6D7" box="[151,174,1969,1993]" pageId="3" pageNumber="592">I2</date>
longer, different in length, with broad basis, fully setulated at their distal portion, brush-like appearance; seta
<date id="FFEC106BD87DFFCD1FBC8CFEADCEE6F3" pageId="3" pageNumber="592">I3 and I4</date>
thin, with wide basis, bilaterally setulated. Second lobe or IE also with two rows of setae; anterior row with four setae, bottle-shaped, setulated distal part, seta 4, the longest; posterior row with four setae, long and slim, bilaterally setulated. GT blunt, with rows of thick setulae, near its basis there is a pore and a mamillated receptor similar in shape to a bottle; one angled seta, with setae at their tip, near a hyaline papilla is also found (arrow in
<figureCitation id="13692A2ED87AFFCA1F498B90ADB6E002" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="4" pageNumber="593">Fig. 4</figureCitation>
E); FC composed of six setae, bilaterally setulated from the basis to the tip.
</paragraph>
<paragraph id="8BED36ABD87AFFCA1AFE8A68AEBBE323" blockId="4.[151,1437,151,752]" pageId="4" pageNumber="593">
<emphasis id="B926EAB9D87AFFCA1AFE8A68AC73E05E" box="[199,355,295,320]" italics="true" pageId="4" pageNumber="593">Trunk limb IV</emphasis>
(
<figureCitation id="13692A2ED87AFFCA1B4D8A68ACA8E05E" box="[372,440,295,320]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="4" pageNumber="593">Fig. 4</figureCitation>
F). EX with four hyaline setae; seta 1 and 4, the shortest, bilaterally setulated from basis to tip; seta 3, the second in length, fully setulated from basis to tip; seta 2, the longest, bilaterally setulated along distal side, basis fully setulated on one side. EN with two rows of setae; anterior row with five thin setae with a wide base; in posterior row, seta 1 with a series of small thickened teeth on the distal end, seta 2–4 bi-segmented, with a line of strong and thick setae at its distal portion, seta 5, short, oval with a slender tip, setulated. GT with one long, angled, fully setulated seta at its distal portion (arrow in
<figureCitation id="13692A2ED87AFFCA195F8A93AEBBE0EA" box="[870,939,476,501]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="4" pageNumber="593">Fig. 4</figureCitation>
F), near a short, blunt and naked sensilla; a long, naked seta, between the angled seta and the filter comb (arrow in
<figureCitation id="13692A2ED87AFFCA19FF8AB0A919E306" box="[966,1033,511,536]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="4" pageNumber="593">Fig. 4</figureCitation>
F); the latter composed of five long setae, broad at their basis and bilaterally setulated at the distal portion.
</paragraph>
<paragraph id="8BED36ABD87AFFCA1AFE8908AC26E3EE" blockId="4.[151,1437,151,752]" pageId="4" pageNumber="593">
<emphasis id="B926EAB9D87AFFCA1AFE8908AC4EE37E" box="[199,350,583,608]" italics="true" pageId="4" pageNumber="593">Trunk limb V</emphasis>
(
<figureCitation id="13692A2ED87AFFCA1B498908ACAFE37E" box="[368,447,583,608]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="4" pageNumber="593">Figs. 4</figureCitation>
G–H). EP oval. EX with two long setae; seta 1 the longest, not segmented, bilaterally setulated from the basis to the tip; seta 2 much shorter, not segmented, long and thin in the second half, covered with thin setulae. EN, a lobe with a fully setulated tip (
<figureCitation id="13692A2ED87AFFCA193D89C0AE58E3B6" box="[772,840,655,680]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="4" pageNumber="593">Fig. 4</figureCitation>
G). GT with three setae, 1 longer, seta 3 the shortest, bi-segmented (
<figureCitation id="13692A2ED87AFFCA1B0489FBAC90E3D2" box="[317,384,692,717]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="4" pageNumber="593">Fig. 4</figureCitation>
G). PEP with three blunt sensillae fully covered by thin setae, two of them bigger, with a blunt end (
<figureCitation id="13692A2ED87AFFCA1AF78998AC02E3EE" box="[206,274,727,752]" captionStart="FIGURE 4" captionStartId="6.[151,250,1921,1943]" captionTargetBox="[154,1419,205,1877]" captionTargetId="figure@6.[151,1436,193,1900]" captionTargetPageId="6" captionText="FIGURE 4. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm." httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="4" pageNumber="593">Fig. 4</figureCitation>
H).
</paragraph>
<caption id="DF2D6623D87AFFCA1AAE8CDEAE70E6FA" httpUri="https://zenodo.org/record/839323/files/figure.png" pageId="4" pageNumber="593" targetBox="[167,1419,789,1915]" targetPageId="4">
<paragraph id="8BED36ABD87AFFCA1AAE8CDEAE70E6FA" blockId="4.[151,1436,1937,2020]" pageId="4" pageNumber="593">
<emphasis id="B926EAB9D87AFFCA1AAE8CDEAC04E6B8" bold="true" box="[151,276,1937,1959]" pageId="4" pageNumber="593">FIGURE 2.</emphasis>
<taxonomicName id="4C524D28D87AFFCA1B248CDDAF06E6B8" baseAuthorityName="Daday" baseAuthorityYear="1884" box="[285,534,1937,1959]" class="Branchiopoda" family="Macrothricidae" genus="Bunops" kingdom="Animalia" order="Diplostraca" pageId="4" pageNumber="593" phylum="Arthropoda" rank="species" species="serricaudata">
<emphasis id="B926EAB9D87AFFCA1B248CDDAC79E6B9" box="[285,361,1938,1959]" italics="true" pageId="4" pageNumber="593">Bunops</emphasis>
cf.
<emphasis id="B926EAB9D87AFFCA1BAD8CDEAF06E6B8" box="[404,534,1937,1958]" italics="true" pageId="4" pageNumber="593">serricaudata</emphasis>
</taxonomicName>
from Chipila, Tlaxcala State, Mexico. A, antenna (scale bar: 310 µm). B, detail of the distal part of the basipod from A (scale bar: 80 µm). C, postabdomen (scale bar: 200 µm). D, seta natatoria (scale bar 80 µm). E, detail of the armature in the margin of the valves (scale bar 40 µm).
</paragraph>
</caption>
<paragraph id="8BED36ABD87BFFCB1AAE8C35AE50E6F0" blockId="5.[151,1437,1914,2030]" pageId="5" pageNumber="594">
<emphasis id="B926EAB9D87BFFCB1AAE8C35AC05E691" bold="true" box="[151,277,1914,1936]" pageId="5" pageNumber="594">FIGURE 3.</emphasis>
<taxonomicName id="4C524D28D87BFFCB1B278C34AF08E691" baseAuthorityName="Daday" baseAuthorityYear="1884" box="[286,536,1914,1936]" class="Branchiopoda" family="Macrothricidae" genus="Bunops" kingdom="Animalia" order="Diplostraca" pageId="5" pageNumber="594" phylum="Arthropoda" rank="species" species="serricaudata">
<emphasis id="B926EAB9D87BFFCB1B278C34AC7AE68E" box="[286,362,1915,1936]" italics="true" pageId="5" pageNumber="594">Bunops</emphasis>
cf.
<emphasis id="B926EAB9D87BFFCB1BAF8C35AF08E691" box="[406,536,1914,1935]" italics="true" pageId="5" pageNumber="594">serricaudata</emphasis>
</taxonomicName>
from Chipila,
<collectingRegion id="4996F849D87BFFCB188D8C35AE1BE68E" box="[692,779,1914,1936]" country="Mexico" name="Tlaxcala" pageId="5" pageNumber="594">Tlaxcala</collectingRegion>
State,
<collectingRegion id="4996F849D87BFFCB196F8C35AEB7E68E" box="[854,935,1914,1936]" country="Mexico" name="Mexico" pageId="5" pageNumber="594">
<collectingCountry id="F345763BD87BFFCB196F8C35AEB7E68E" box="[854,935,1914,1936]" name="Mexico" pageId="5" pageNumber="594">Mexico</collectingCountry>
</collectingRegion>
. SEM photographs. A, ephippial female. A1–A4, close-ups of different regions of the ephippia. B, parthenogenetic female. C, Internal view of the valves, posterior. D, internal view of the valves, middle part. E, ornamentation in the inferior part, parthenogenetic female; lines highlight the part where this detail is found. F, labrum. G, postabdomen. H, postabdominal claw.
</paragraph>
<caption id="DF2D6623D878FFC81AAE8CCEA98DE6CB" httpUri="https://zenodo.org/record/839325/files/figure.png" pageId="6" pageNumber="595" targetBox="[154,1419,205,1877]" targetPageId="6">
<paragraph id="8BED36ABD878FFC81AAE8CCEA98DE6CB" blockId="6.[151,1436,1921,2005]" pageId="6" pageNumber="595">
<emphasis id="B926EAB9D878FFC81AAE8CCEAC04E688" bold="true" box="[151,276,1921,1943]" pageId="6" pageNumber="595">FIGURE 4.</emphasis>
<taxonomicName id="4C524D28D878FFC81B258CCDAF04E689" baseAuthorityName="Daday" baseAuthorityYear="1884" box="[284,532,1921,1943]" class="Branchiopoda" family="Macrothricidae" genus="Bunops" kingdom="Animalia" order="Diplostraca" pageId="6" pageNumber="595" phylum="Arthropoda" rank="species" species="serricaudata">
<emphasis id="B926EAB9D878FFC81B258CCDAC78E689" box="[284,360,1922,1943]" italics="true" pageId="6" pageNumber="595">Bunops</emphasis>
cf.
<emphasis id="B926EAB9D878FFC81BAA8CCDAF04E689" box="[403,532,1922,1943]" italics="true" pageId="6" pageNumber="595">serricaudata</emphasis>
</taxonomicName>
from Chipila, Tlaxcala State, Mexico. A, first thoracic limb. B, detail of trident seta in limb 1. C, ODL and IDL, first thoracic limb. D, second thoracic limb. E, third thoracic limb. F, fourth thoracic limb. G, fifth thoracic limb. H, fifth thoracic limb, pre-epipodite. Scale bar is 100 µm, except in H, which is 40 µm.
</paragraph>
</caption>
<caption id="DF2D6623D879FFC91AAE8C04AE0AE6A3" httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="7" pageNumber="596" targetBox="[151,1436,193,1846]" targetPageId="7">
<paragraph id="8BED36ABD879FFC91AAE8C04AE0AE6A3" blockId="7.[151,1436,1867,1981]" pageId="7" pageNumber="596">
<emphasis id="B926EAB9D879FFC91AAE8C04AC02E67F" bold="true" box="[151,274,1867,1889]" pageId="7" pageNumber="596">FIGURE 5.</emphasis>
<taxonomicName id="4C524D28D879FFC91B218C03AF1BE67E" baseAuthorityName="Daday" baseAuthorityYear="1884" box="[280,523,1867,1889]" class="Branchiopoda" family="Macrothricidae" genus="Bunops" kingdom="Animalia" order="Diplostraca" pageId="7" pageNumber="596" phylum="Arthropoda" rank="species" species="serricaudata">
<emphasis id="B926EAB9D879FFC91B218C03AC74E67F" box="[280,356,1868,1889]" italics="true" pageId="7" pageNumber="596">Bunops</emphasis>
cf.
<emphasis id="B926EAB9D879FFC91BB38C04AF1BE67E" box="[394,523,1867,1888]" italics="true" pageId="7" pageNumber="596">serricaudata</emphasis>
</taxonomicName>
from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A1, external view. C, A1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A1. E, posterior internal part of A1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines.
</paragraph>
</caption>
<paragraph id="8BED36ABD876FFC61AFE8BD8AE10E074" blockId="8.[151,1437,151,1193]" pageId="8" pageNumber="597">
<emphasis id="B926EAB9D876FFC61AFE8BD8AC84E1AE" bold="true" box="[199,404,151,176]" pageId="8" pageNumber="597">Ephippial female</emphasis>
(
<figureCitation id="13692A2ED876FFC61B9A8BD8ACFDE1AE" box="[419,493,151,176]" captionStart="FIGURE 1" captionStartId="3.[151,250,1625,1647]" captionTargetBox="[151,1435,449,1604]" captionTargetId="figure@3.[151,1435,449,1604]" captionTargetPageId="3" captionText="FIGURE 1. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, habitus, parthenogenetic female. B, habitus, ephippial female. C, antennules (scale bar 80 µm). D, tip of antennulae with aesthetascs (scale bar 40 µm)." httpUri="https://zenodo.org/record/839321/files/figure.png" pageId="8" pageNumber="597">Figs. 1</figureCitation>
B, 3A) slightly bigger than parthenogenetic females (length: 0.75±
<quantity id="4CAA9B4ED876FFC61EE28BD8A853E1B1" box="[1243,1347,151,176]" metricMagnitude="-5" metricUnit="m" metricValue="4.0" pageId="8" pageNumber="597" unit="mm" value="0.04">0.04 mm</quantity>
; height: 0.59±
<quantity id="4CAA9B4ED876FFC61AEF8BF3AC53E1CA" box="[214,323,188,213]" metricMagnitude="-5" metricUnit="m" metricValue="2.0" pageId="8" pageNumber="597" unit="mm" value="0.02">0.02 mm</quantity>
; N=6); in general, body similar to that of parthenogenetic female (
<figureCitation id="13692A2ED876FFC61E588BF3A9B5E1CA" box="[1121,1189,188,213]" captionStart="FIGURE 1" captionStartId="3.[151,250,1625,1647]" captionTargetBox="[151,1435,449,1604]" captionTargetId="figure@3.[151,1435,449,1604]" captionTargetPageId="3" captionText="FIGURE 1. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico. A, habitus, parthenogenetic female. B, habitus, ephippial female. C, antennules (scale bar 80 µm). D, tip of antennulae with aesthetascs (scale bar 40 µm)." httpUri="https://zenodo.org/record/839321/files/figure.png" pageId="8" pageNumber="597">Fig. 1</figureCitation>
B, 3A), with a welldeveloped keel. Surface of valves covered by an ornamentation formed by a series of rounded projections (Fig. 3A, 3A2–A3), becoming irregular in shape towards the ventral side, on some occasions with spine-like projections. Inferior margin of valves with a polygonal ornamentation, similar to that of parthenogenetic female (Fig. 3A4). Head pore similar to parthenogenetic female (Fig. 3A1)
</paragraph>
<paragraph id="8BED36ABD876FFC61AFE8A37A952E0C7" blockId="8.[151,1437,151,1193]" pageId="8" pageNumber="597">
<emphasis id="B926EAB9D876FFC61AFE8A37AC14E08F" bold="true" box="[199,260,376,401]" pageId="8" pageNumber="597">Male</emphasis>
(
<figureCitation id="13692A2ED876FFC61B2A8A37AC45E08F" box="[275,341,376,401]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Fig. 5</figureCitation>
A–J)
<emphasis id="B926EAB9D876FFC61BAD8A37ACC8E08F" box="[404,472,376,401]" italics="true" pageId="8" pageNumber="597">Shape</emphasis>
. Smaller than female (length: 0.58±
<quantity id="4CAA9B4ED876FFC619568A37AED7E08E" box="[879,967,376,401]" metricMagnitude="-4" metricUnit="m" metricValue="1.0" pageId="8" pageNumber="597" unit="mm" value="0.1">0.1 mm</quantity>
; height: 0.44±
<quantity id="4CAA9B4ED876FFC61E508A36A9D2E08E" box="[1129,1218,377,401]" metricMagnitude="-4" metricUnit="m" metricValue="2.0" pageId="8" pageNumber="597" unit="mm" value="0.2">0.2 mm</quantity>
; N=10), in general, shape similar to that in female. Semi-oval in lateral view, the posterior region of the dorsal keel more amply curved (
<figureCitation id="13692A2ED876FFC61AA68A8FADF2E0C7" box="[159,226,448,473]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Fig. 5</figureCitation>
A). Internally the valves are similar to the ventral part of the female (
<figureCitation id="13692A2ED876FFC619DE8A8FA938E0C7" box="[999,1064,448,473]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Fig. 5</figureCitation>
F)
</paragraph>
<paragraph id="8BED36ABD876FFC61AFE8AAAAF53E377" blockId="8.[151,1437,151,1193]" pageId="8" pageNumber="597">
<emphasis id="B926EAB9D876FFC61AFE8AAAAC4FE0E2" box="[199,351,485,508]" italics="true" pageId="8" pageNumber="597">First antenna</emphasis>
(
<figureCitation id="13692A2ED876FFC61B498AABACADE0E3" box="[368,445,484,509]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Figs. 5</figureCitation>
B–E) longer than in female, curved forming an open “s” shape (
<figureCitation id="13692A2ED876FFC61EAF8AABA9C9E0E3" box="[1174,1241,484,509]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Fig. 5</figureCitation>
A). Externally, a long sensory seta on the proximal side (
<figureCitation id="13692A2ED876FFC6185F8947AFBCE33F" box="[614,684,520,545]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Fig. 5</figureCitation>
B); internally, a basal internal seta short and robust, with lines of strong and short spines (
<figureCitation id="13692A2ED876FFC61B9E8963ACF9E35B" box="[423,489,556,581]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Fig. 5</figureCitation>
E). Last third with two groups of two external sensory setae. Distal internal part with two leaf-shaped aesthetascs (
<figureCitation id="13692A2ED876FFC61BE5891FAF0EE377" box="[476,542,592,617]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Fig. 5</figureCitation>
D).
</paragraph>
<paragraph id="8BED36ABD876FFC61AFE893BAF23E393" blockId="8.[151,1437,151,1193]" box="[199,563,628,653]" pageId="8" pageNumber="597">
<emphasis id="B926EAB9D876FFC61AFE893BAC69E392" box="[199,377,628,653]" italics="true" pageId="8" pageNumber="597">Second antenna</emphasis>
same as female.
</paragraph>
<paragraph id="8BED36ABD876FFC61AFE89D7AEE0E3CB" blockId="8.[151,1437,151,1193]" pageId="8" pageNumber="597">
<emphasis id="B926EAB9D876FFC61AFE89D7AC46E3AE" box="[199,342,664,689]" italics="true" pageId="8" pageNumber="597">Trunk limb I</emphasis>
(
<figureCitation id="13692A2ED876FFC61B5E89D7ACA6E3AF" box="[359,438,664,689]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">
Figs.
<date id="FFEC106BD876FFC61B9089D7ACA6E3AF" box="[425,438,664,689]" pageId="8" pageNumber="597">5</date>
</figureCitation>
I–J) similar to that of female, but with a hook attached at the distal part of the exopod (EXO-ODL); tip of this hook with three rows of small denticles (
<figureCitation id="13692A2ED876FFC6194989F3AEADE3CB" box="[880,957,700,725]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">
Figs.
<date id="FFEC106BD876FFC6199689F3AEADE3CB" box="[943,957,700,725]" pageId="8" pageNumber="597">5</date>
</figureCitation>
I–J).
</paragraph>
<paragraph id="8BED36ABD876FFC61AFE89AFAFDCE3E7" blockId="8.[151,1437,151,1193]" box="[199,716,736,761]" pageId="8" pageNumber="597">
<emphasis id="B926EAB9D876FFC61AFE89AFACA7E3E6" box="[199,439,736,761]" italics="true" pageId="8" pageNumber="597">Trunk limbs II, III, IV</emphasis>
and
<emphasis id="B926EAB9D876FFC61BD789AEACEFE3E6" box="[494,511,737,760]" italics="true" pageId="8" pageNumber="597">V</emphasis>
similar to female.
</paragraph>
<paragraph id="8BED36ABD876FFC61AFE884BACA1E297" blockId="8.[151,1437,151,1193]" pageId="8" pageNumber="597">
<emphasis id="B926EAB9D876FFC61AFE884BAC70E203" box="[199,352,772,797]" italics="true" pageId="8" pageNumber="597">Postabdomen</emphasis>
(
<figureCitation id="13692A2ED876FFC61B57884BACA9E203" box="[366,441,772,797]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Figs. 5</figureCitation>
G–H) oval in lateral view; bilobed, with numerous rows of spines, similar in length; anus bordered with groups of spines. Postabdominal claw curved, with lateral teeth (
<figureCitation id="13692A2ED876FFC61E358867A95EE25F" box="[1036,1102,808,833]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Fig. 5</figureCitation>
G). Genital pore near the base of the claws on the ventral side (
<figureCitation id="13692A2ED876FFC618188803AF77E27B" box="[545,615,844,869]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Fig. 5</figureCitation>
H). Postabdominal seta with distal segment shorter than the proximal, without setulae (
<figureCitation id="13692A2ED876FFC61B69883FAC9CE297" box="[336,396,880,905]" captionStart="FIGURE 5" captionStartId="7.[151,250,1867,1889]" captionTargetBox="[151,1436,193,1846]" captionTargetId="figure@7.[151,1436,193,1846]" captionTargetPageId="7" captionText="FIGURE 5. Bunops cf. serricaudata from Chipila, Tlaxcala State, Mexico, adult male. A, habitus. B, A 1, external view. C, A 1, internal view. D, detail of the internal anterior part with two leaf-shape aesthetascs, A 1. E, posterior internal part of A 1, with one seta and rows of spines. F, internal part of the valves, middle part. G, postabdomen. H, claws. I, hook in thoracic limb I. J, detail of the tip in the hook of limb I, with three rows of spines." httpUri="https://zenodo.org/record/839327/files/figure.png" pageId="8" pageNumber="597">Fig 5</figureCitation>
A).
</paragraph>
<paragraph id="8BED36ABD876FFC61AFE88DBA837E57E" blockId="8.[151,1437,151,1193]" pageId="8" pageNumber="597">
<emphasis id="B926EAB9D876FFC61AFE88DBACA7E2B3" bold="true" box="[199,439,916,941]" pageId="8" pageNumber="597">Molecular analyses.</emphasis>
For the comparison between all macrotricids, we produced a tree where the average intraspecific divergence is 0.91% with a maximum of 2.61%. Between genera, it was 24.57%, with a maximum of 35.55% and a minimum of 18.6%. In particular,
<taxonomicName id="4C524D28D876FFC618FE8892AECAE2EB" baseAuthorityName="Daday" baseAuthorityYear="1884" box="[711,986,988,1013]" class="Branchiopoda" family="Macrothricidae" genus="Bunops" kingdom="Animalia" order="Diplostraca" pageId="8" pageNumber="597" phylum="Arthropoda" rank="species" species="serricaudata">
<emphasis id="B926EAB9D876FFC618FE8892AE0BE2EA" box="[711,795,989,1012]" italics="true" pageId="8" pageNumber="597">Bunops</emphasis>
cf.
<emphasis id="B926EAB9D876FFC619728893AECAE2EB" box="[843,986,988,1013]" italics="true" pageId="8" pageNumber="597">serricaudata</emphasis>
</taxonomicName>
has a maximum divergence of 35.55% with
<taxonomicName id="4C524D28D876FFC61AE88F4FAC5CE507" box="[209,332,1024,1049]" class="Branchiopoda" family="Ophryoxidae" genus="Ophryoxus" kingdom="Animalia" order="Diplostraca" pageId="8" pageNumber="597" phylum="Arthropoda" rank="genus">
<emphasis id="B926EAB9D876FFC61AE88F4FAC5CE507" box="[209,332,1024,1049]" italics="true" pageId="8" pageNumber="597">Ophryoxus</emphasis>
</taxonomicName>
and a minimum of 22.46% with
<taxonomicName id="4C524D28D876FFC618FE8F4FAE56E507" authorityName="Baird" authorityYear="1843" box="[711,838,1024,1049]" class="Branchiopoda" family="Macrothricidae" genus="Macrothrix" kingdom="Animalia" order="Diplostraca" pageId="8" pageNumber="597" phylum="Arthropoda" rank="genus">
<emphasis id="B926EAB9D876FFC618FE8F4FAE56E507" box="[711,838,1024,1049]" italics="true" pageId="8" pageNumber="597">Macrothrix</emphasis>
</taxonomicName>
. Most of the compared material is from Mexico and Canada, except
<taxonomicName id="4C524D28D876FFC61B718F6BAF50E523" authorityName="Brehm" authorityYear="1936" box="[328,576,1060,1085]" class="Branchiopoda" family="Macrothricidae" genus="Macrothrix" kingdom="Animalia" order="Diplostraca" pageId="8" pageNumber="597" phylum="Arthropoda" rank="species" species="atahualpa">
<emphasis id="B926EAB9D876FFC61B718F6BAF50E523" box="[328,576,1060,1085]" italics="true" pageId="8" pageNumber="597">Macrothrix atahualpa</emphasis>
</taxonomicName>
from Bolivia and Peru, and
<taxonomicName id="4C524D28D876FFC619458F6AAEE6E523" authorityName="Sars" authorityYear="1901" box="[892,1014,1060,1085]" class="Branchiopoda" family="Macrothricidae" genus="Macrothrix" kingdom="Animalia" order="Diplostraca" pageId="8" pageNumber="597" phylum="Arthropoda" rank="species" species="elegans">
<emphasis id="B926EAB9D876FFC619458F6AAEE6E523" box="[892,1014,1060,1085]" italics="true" pageId="8" pageNumber="597">M. elegans</emphasis>
</taxonomicName>
represented by some specimens from Guatemala. In general terms,
<taxonomicName id="4C524D28D876FFC61BDB8F06AF26E57E" authorityName="Birge" authorityYear="1893" box="[482,566,1097,1120]" class="Branchiopoda" family="Macrothricidae" genus="Bunops" kingdom="Animalia" order="Diplostraca" pageId="8" pageNumber="597" phylum="Arthropoda" rank="genus">
<emphasis id="B926EAB9D876FFC61BDB8F06AF26E57E" box="[482,566,1097,1120]" italics="true" pageId="8" pageNumber="597">Bunops</emphasis>
</taxonomicName>
conforms a clade that is clearly separate from all others in the tree.
</paragraph>
<paragraph id="8BED36ABD876FFC61AFE8F22AF28E5B6" blockId="8.[151,1437,151,1193]" pageId="8" pageNumber="597">
A consensus sequence of the seven obtained, with lenghts from 613 to 658 bp, is given here as an additional character of
<taxonomicName id="4C524D28D876FFC61B1A8FDEAF20E5B7" baseAuthorityName="Daday" baseAuthorityYear="1884" box="[291,560,1168,1193]" class="Branchiopoda" family="Macrothricidae" genus="Bunops" kingdom="Animalia" order="Diplostraca" pageId="8" pageNumber="597" phylum="Arthropoda" rank="species" species="serricaudata">
<emphasis id="B926EAB9D876FFC61B1A8FDEAC67E5B6" box="[291,375,1169,1192]" italics="true" pageId="8" pageNumber="597">Bunops</emphasis>
cf.
<emphasis id="B926EAB9D876FFC61B988FDFAF20E5B7" box="[417,560,1168,1193]" italics="true" pageId="8" pageNumber="597">serricaudata</emphasis>
</taxonomicName>
:
</paragraph>
<paragraph id="8BED36ABD876FFC61AAE8F96AC00E72B" blockId="8.[151,1433,1241,1589]" box="[151,1433,1241,1589]" pageId="8" pageNumber="597">GACACTTTATTTAATTTTTGGGGCATGGTCCGGAATAGTAGGGACAGCTTTAAGTATACTAATTCGAGC AGAGCTCGGTCAATCTGGAAATTTAATTGGGGACGATCAAATCTACAATGTGATTGTCACTGCTCACG CTTTTATTATAATTTTTTTTATGGTTATACCAATTCTCATTGGAGGATTTGGTAATTGACTTGTGCCTCTA ATATTAGGAGCTCCAGACATAGCGTTCCCCCGACTTAACAATTTAAGTTTTTGGCTTCTACCTCCTTCA CTGACGTTGCTTCTTGTAGGGGGGGCTGTAGAAAGAGGAGCTGGGACCGGTTGGACTGTCTACCCCC CTCTTTCTGCGGGAATTGCTCATGCTGGTGCATCAATTGATTTAAGAATTTTTTCTCTTCATTTAGCAGG GATTTCGTCTATTTTAGGGGCAGTAAATTTCATTACGACTATTATTAATATACGATCACAAGGGATAACT CTAGATCGAATCCCACTATTTGCCTGAGCTGTAGGAATCACAGCCTTGCTTCTTCTTCTGAGTTTGCCA GTACTTGCAGGGGCAATTACGATACTCTTAACTGATCGCAATCTTAATACATCATTTTTTGATCCAGCGG GGGGAG</paragraph>
<paragraph id="8BED36ABD876FFC61AFE8D2BAF2AE7BF" blockId="8.[151,1436,1636,1697]" pageId="8" pageNumber="597">
The average GC composition of
<taxonomicName id="4C524D28D876FFC6180D8D2AAF98E762" authorityName="Birge" authorityYear="1893" box="[564,648,1637,1660]" class="Branchiopoda" family="Macrothricidae" genus="Bunops" kingdom="Animalia" order="Diplostraca" pageId="8" pageNumber="597" phylum="Arthropoda" rank="genus">
<emphasis id="B926EAB9D876FFC6180D8D2AAF98E762" box="[564,648,1637,1660]" italics="true" pageId="8" pageNumber="597">Bunops</emphasis>
</taxonomicName>
sequences is 41.01±0.1, with 53.3% in the first codon position, 45.2% in the second, and 25.7% in the third.
</paragraph>
</subSubSection>
</treatment>
</document>
Reference in a new issue View git blame Copy permalink