treatments-xml/data/03/A4/87/03A487C6FFC2A656FF65FC75028BEDAD.xml
2024-06-21 12:22:17 +02:00

452 lines
68 KiB
XML
Raw Blame History

This file contains ambiguous Unicode characters

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

<document id="9963E632FE7F832F4906C47E4506844D" ID-DOI="10.5281/zenodo.190439" ID-GBIF-Dataset="03616bb7-53de-42e1-ae7a-87557c1717c3" ID-ISSN="1175-5326" ID-Zenodo-Dep="190439" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.tables_requiresApprovalFor="existingObjects,plazi" IM.taxonomicNames_approvedBy="felipe" checkinTime="1461113101911" checkinUser="plazi" docAuthor="Quiroz-Vázquez, Patricia &amp; Elías-Gutiérrez, Manuel" docDate="2009" docId="03A487C6FFC2A656FF65FC75028BEDAD" docLanguage="en" docName="zt02236p064.pdf" docOrigin="Zootaxa 2236" docStyle="DocumentStyle:890A69B780ED73D6DB8551B71C8AC79E.4:Zootaxa.2009-2012.journal_article" docStyleId="890A69B780ED73D6DB8551B71C8AC79E" docStyleName="Zootaxa.2009-2012.journal_article" docStyleVersion="4" docTitle="Scapholeberis duranguensis Quiroz-Vázquez &amp; Elías-Gutiérrez, 2009, n. sp." docType="treatment" docVersion="9" lastPageNumber="61" masterDocId="FF9DFFBEFFC1A65DFFF2FF99026BED75" masterDocTitle="A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding" masterLastPageNumber="64" masterPageNumber="50" pageNumber="53" updateTime="1698594572336" updateUser="plazi">
<mods:mods id="3E06A906AE8CDAED38CF475666C86A01" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="412127EBA2542101505A656EAF01D2D2">
<mods:title id="254406DBAD6F29E5A0F7C54AB909A98A">A New Species of the Freshwater Cladoceran Genus Scapholeberis Schoedler, 1858 (Cladocera: Anomopoda) from the Semidesert Northern Mexico, Highlighted by DNA Barcoding</mods:title>
</mods:titleInfo>
<mods:name id="5D7BAA7691E3D2CD9805FE5285A968DA" type="personal">
<mods:role id="1515B84476B96A81D367CA822BEF9BDF">
<mods:roleTerm id="675D75370E25A91BD9C492A2BAA9C16A">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="3EBFD68749C28C8DBA91094856AE153D">Quiroz-Vázquez, Patricia</mods:namePart>
</mods:name>
<mods:name id="D5F0BB5A10947C33513D0F214B3C526C" type="personal">
<mods:role id="C1156FC467D069DC45FA294C531BDA90">
<mods:roleTerm id="780F4C14E4A942F2EDFD68BBDA44CD90">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="9648FD870A86E8C8DC33BFF159498615">Elías-Gutiérrez, Manuel</mods:namePart>
</mods:name>
<mods:typeOfResource id="67C0C7C16E7C132A4AB56A8334AF9EF9">text</mods:typeOfResource>
<mods:relatedItem id="E635D8B815E6F4AF8490383EBBFA1E47" type="host">
<mods:titleInfo id="FC969AE58B6D34811E9E43D6FD2FA29E">
<mods:title id="C226CBEE92EBD5781D84DB7622E47805">Zootaxa</mods:title>
</mods:titleInfo>
<mods:part id="6208001639E9EEDC1E1A27A7FC4E4981">
<mods:date id="8F02252A3FB5AF1934C16B521FC9BD09">2009</mods:date>
<mods:detail id="B6C289C37540FD427F868DE7D1CEA79D" type="volume">
<mods:number id="A2F6E7F4C249322455FFFEDE7B63AF99">2236</mods:number>
</mods:detail>
<mods:extent id="D9E7F4E6F28ACE4E9943E81A0460239C" unit="page">
<mods:start id="DB8F00DB4AE1C654E57E12F9D7298481">50</mods:start>
<mods:end id="4B4045992BADFB1F4DEADA03ACAFC156">64</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="314E9B59B2DBB826DB3BFF8280DD6C4E">journal article</mods:classification>
<mods:identifier id="C36E6E8965659DCF3BC1478638BD400B" type="DOI">10.5281/zenodo.190439</mods:identifier>
<mods:identifier id="8DA4FB20652C326AF3D7421994FC24CF" type="GBIF-Dataset">03616bb7-53de-42e1-ae7a-87557c1717c3</mods:identifier>
<mods:identifier id="68FF04519D747069E458C89B049B8568" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="687079C49D780CE22C344F95CCF62BDE" type="Zenodo-Dep">190439</mods:identifier>
</mods:mods>
<treatment id="03A487C6FFC2A656FF65FC75028BEDAD" ID-DOI="http://doi.org/10.5281/zenodo.5625599" ID-GBIF-Taxon="119624324" ID-Zenodo-Dep="5625599" LSID="urn:lsid:plazi:treatment:03A487C6FFC2A656FF65FC75028BEDAD" httpUri="http://treatment.plazi.org/id/03A487C6FFC2A656FF65FC75028BEDAD" lastPageId="11" lastPageNumber="61" pageId="3" pageNumber="53">
<subSubSection id="C317655BFFC2A65EFF65FC75005DE973" box="[151,566,1004,1030]" pageId="3" pageNumber="53" type="nomenclature">
<paragraph id="8BB236D0FFC2A65EFF65FC75005DE973" blockId="3.[151,566,1004,1030]" box="[151,566,1004,1030]" pageId="3" pageNumber="53">
<heading id="D0FA81BCFFC2A65EFF65FC75005DE973" bold="true" box="[151,566,1004,1030]" fontSize="11" level="1" pageId="3" pageNumber="53" reason="1">
<emphasis id="B979EAC2FFC2A65EFF65FC75005DE973" bold="true" box="[151,566,1004,1030]" pageId="3" pageNumber="53">
<taxonomicName id="4C0D4D53FFC2A65EFF65FC750380E973" ID-CoL="6Y73C" box="[151,491,1004,1030]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="3" pageNumber="53" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFC2A65EFF65FC750380E973" bold="true" box="[151,491,1004,1030]" italics="true" pageId="3" pageNumber="53">Scapholeberis duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFC2A65EFE01FC75005DE973" box="[499,566,1004,1030]" pageId="3" pageNumber="53" rank="species">n. sp.</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C317655BFFC2A65EFF65FBAC02B1E9B1" pageId="3" pageNumber="53" type="materials_examined">
<paragraph id="8BB236D0FFC2A65EFF65FBAC02B1E9B1" blockId="3.[151,1437,1077,2032]" pageId="3" pageNumber="53">
<emphasis id="B979EAC2FFC2A65EFF65FBAC0326E93A" bold="true" box="[151,333,1077,1103]" pageId="3" pageNumber="53">
<typeStatus id="54B68872FFC2A65EFF65FBAC02BFE93A" box="[151,212,1077,1103]" pageId="3" pageNumber="53">Type</typeStatus>
Locality:
</emphasis>
El Chupadero is a small and shallow temporal pond located at
<geoCoordinate id="EE395017FFC2A65EFBCFFBAC0697E93A" box="[1085,1276,1077,1103]" direction="north" orientation="latitude" pageId="3" pageNumber="53" precision="1" value="24.13586">24º 08 09.1 N</geoCoordinate>
and
<geoCoordinate id="EE395017FFC2A65EFAC5FBAC036AE903" direction="west" orientation="longitude" pageId="3" pageNumber="53" precision="1" value="-104.712">104º 42 43.2 W</geoCoordinate>
in the south semi-desert region of Durango State,
<collectingCountry id="F31A7640FFC2A65EFCAEFBC501D0E903" box="[860,955,1116,1142]" name="Mexico" pageId="3" pageNumber="53">Mexico</collectingCountry>
. At the time of sampling the pond had a total depth of
<quantity id="4CF59B35FFC2A65EFEB3FB1A03EAE9E8" box="[321,385,1155,1181]" metricMagnitude="-1" metricUnit="m" metricValue="5.0" pageId="3" pageNumber="53" unit="m" value="0.5">0.5m</quantity>
, temperature of 17.8ºC,
<collectingCountry id="F31A7640FFC2A65EFD58FB1A00A4E9E8" box="[682,719,1155,1181]" name="Philippines" pageId="3" pageNumber="53">pH</collectingCountry>
of 7.8, conductivity of 0.264mS/Cm and a Secchi depth of
<quantity id="4CF59B35FFC2A65EFF65FB3302BDE9B1" box="[151,214,1194,1220]" metricMagnitude="-1" metricUnit="m" metricValue="4.0" pageId="3" pageNumber="53" unit="m" value="0.4">0.4m</quantity>
.
</paragraph>
</subSubSection>
<subSubSection id="C317655BFFC2A65EFF34FB49061DE99F" box="[198,1142,1232,1258]" pageId="3" pageNumber="53" type="etymology">
<paragraph id="8BB236D0FFC2A65EFF34FB49061DE99F" blockId="3.[151,1437,1077,2032]" box="[198,1142,1232,1258]" pageId="3" pageNumber="53">
<emphasis id="B979EAC2FFC2A65EFF34FB49033CE99F" bold="true" box="[198,343,1232,1258]" pageId="3" pageNumber="53">Etymology:</emphasis>
This species is named after its
<emphasis id="B979EAC2FFC2A65EFD34FB48013CE99F" box="[710,855,1233,1258]" italics="true" pageId="3" pageNumber="53">terra typica,</emphasis>
Durango State,
<collectingCountry id="F31A7640FFC2A65EFBE7FB490618E99F" box="[1045,1139,1232,1258]" name="Mexico" pageId="3" pageNumber="53">Mexico</collectingCountry>
.
</paragraph>
</subSubSection>
<subSubSection id="C317655BFFC2A65EFF37FB6E0301EB33" pageId="3" pageNumber="53" type="materials_examined">
<paragraph id="8BB236D0FFC2A65EFF37FB6E0102E84D" blockId="3.[151,1437,1077,2032]" pageId="3" pageNumber="53">
<emphasis id="B979EAC2FFC2A65EFF37FB6E0323E864" bold="true" box="[197,328,1271,1297]" pageId="3" pageNumber="53">
<typeStatus id="54B68872FFC2A65EFF37FB6E0329E864" box="[197,322,1271,1297]" pageId="3" pageNumber="53" type="holotype">Holotype</typeStatus>
:
</emphasis>
Adult ephippial female in 96% ethanol with addition of a drop of glycerol. Total length
<quantity id="4CF59B35FFC2A65EFF65FA870290E84D" box="[151,251,1310,1336]" metricMagnitude="-4" metricUnit="m" metricValue="6.4" pageId="3" pageNumber="53" unit="mm" value="0.64">0.64mm</quantity>
, height
<quantity id="4CF59B35FFC2A65EFEA5FA8703D7E84D" box="[343,444,1310,1336]" metricMagnitude="-4" metricUnit="m" metricValue="4.4" pageId="3" pageNumber="53" unit="mm" value="0.44">0.44mm</quantity>
. Access number,
<collectionCode id="ED1CAE15FFC2A65EFD7AFA87017AE84D" box="[648,785,1310,1336]" httpUri="http://grbio.org/cool/rbd5-ct7f" name="El Colegio de la Frontera Sur, Chetumal Unit" pageId="3" pageNumber="53">ECO-CH-Z</collectionCode>
0 3831.
</paragraph>
<paragraph id="8BB236D0FFC2A65EFF37FADD0301EB33" blockId="3.[151,1437,1077,2032]" pageId="3" pageNumber="53">
<emphasis id="B979EAC2FFC2A65EFF37FADD0325E82B" bold="true" box="[197,334,1348,1374]" pageId="3" pageNumber="53">
<typeStatus id="54B68872FFC2A65EFF37FADD0321E82B" box="[197,330,1348,1374]" pageId="3" pageNumber="53" type="paratype">Paratypes</typeStatus>
:
</emphasis>
Two ephippial females (one dissected) mounted in Hoyer´s solution, sealed with Enthellan mounting medium (
<collectionCode id="ED1CAE15FFC2A65EFE8DFAF20061E8F0" box="[383,522,1387,1413]" httpUri="http://grbio.org/cool/rbd5-ct7f" name="El Colegio de la Frontera Sur, Chetumal Unit" pageId="3" pageNumber="53">ECO-CH-Z</collectionCode>
0 3835, 03839). One ephippial female preserved in 96% ethanol and glycerol (
<collectionCode id="ED1CAE15FFC2A65EFF6DFA0B0344E8D9" box="[159,303,1426,1452]" httpUri="http://grbio.org/cool/rbd5-ct7f" name="El Colegio de la Frontera Sur, Chetumal Unit" pageId="3" pageNumber="53">ECO-CH-Z</collectionCode>
03841), one parthenogenetic female in 96% ethanol and glycerol (
<collectionCode id="ED1CAE15FFC2A65EFB95FA0B069CE8D9" box="[1127,1271,1426,1452]" httpUri="http://grbio.org/cool/rbd5-ct7f" name="El Colegio de la Frontera Sur, Chetumal Unit" pageId="3" pageNumber="53">ECO-CH-Z</collectionCode>
03832). Five parthenogenetic females, (one dissected) mounted as above (
<collectionCode id="ED1CAE15FFC2A65EFC88FA210663E8A7" box="[890,1032,1464,1490]" httpUri="http://grbio.org/cool/rbd5-ct7f" name="El Colegio de la Frontera Sur, Chetumal Unit" pageId="3" pageNumber="53">ECO-CH-Z</collectionCode>
0 3833, 0 3834, 03836-03838). In addition, two parthenogenetic females preserved in 96% ethanol and glycerol, and one ephippial female preserved as above (
<collectionCode id="ED1CAE15FFC2A65EFE7FF99F038BEB55" box="[397,480,1542,1568]" pageId="3" pageNumber="53">CNCR</collectionCode>
25880) deposited at Instituto de Biología (Universidad Nacional Autónoma de
<collectingCountry id="F31A7640FFC2A65EFF65F9B5029FEB33" box="[151,244,1580,1606]" name="Mexico" pageId="3" pageNumber="53">México</collectingCountry>
,
<collectionCode id="ED1CAE15FFC2A65EFF0DF9B50335EB33" box="[255,350,1580,1606]" httpUri="http://grbio.org/cool/10ei-x9nj" name="Universidad Nacional Autonoma de Mexico" pageId="3" pageNumber="53">UNAM</collectionCode>
).
</paragraph>
</subSubSection>
<subSubSection id="C317655BFFC2A65EFF37F9CB01E6EA85" pageId="3" pageNumber="53" type="diagnosis">
<paragraph id="8BB236D0FFC2A65EFF37F9CB01E6EA85" blockId="3.[151,1437,1077,2032]" pageId="3" pageNumber="53">
<emphasis id="B979EAC2FFC2A65EFF37F9CB032EEB19" bold="true" box="[197,325,1618,1644]" pageId="3" pageNumber="53">Diagnosis.</emphasis>
Medium-sized daphniids. Parthenogenetic females around 0.6 (0.59 ± 0.09) mm, body ovoid (height /length = 0.55-0-69, n=20). Large and bilaterally ridged head with a pore-like structure at the top (
<figureCitation id="13362A55FFC2A65EFF6DF9390294EBCF" box="[159,255,1696,1722]" captionStart="FIGURE 1" captionStartId="4.[151,259,1801,1825]" captionTargetBox="[214,1384,181,1775]" captionTargetId="figure@4.[212,1388,174,1789]" captionTargetPageId="4" captionText="FIGURE 1. SEM photographs: A, B, D, G and H Scapholeberis duranguensis n. sp., parthenogenetic female. A. Anterior view of the head and rostrum (note the keels on the head, the reticulated rostrum and the pore at the top of the head); B. Head pore; D. Habitus; G and H. Posterior rim of valves (note the thick double membrane of which the upper one is denticulated); C, E, F, I, J, K and L Scapholeberis armata freyi, parthenogenetic female. C. Anterior view of the head and rostrum (note that there is not a pore-like structure at the top of the head); E and F. Lateral view of a cultured and a wild specimen, respectively, both parthenogenetic females; I to L. Posterior rim of the valves with denticulate membrane (note that the membrane is thinner than in S. duranguensis n. sp.)" httpUri="https://zenodo.org/record/190440/files/figure.png" pageId="3" pageNumber="53">Figure 1</figureCitation>
A and B). Well-developed and rounded rostrum (
<figureCitation id="13362A55FFC2A65EFCB7F93901C3EBCF" box="[837,936,1696,1722]" captionStart="FIGURE 3. S" captionStartId="6.[151,255,1954,1978]" captionTargetBox="[182,1397,187,1906]" captionTargetId="figure@6.[151,1436,138,1930]" captionTargetPageId="6" captionText="FIGURE 3. S. duranguensis n. sp. A. Lateral view of ephippial female; B. Mandible; C. Antennule; D. Anterior view of the head; E. Upper view of the head; F. Antenna; G. Postabdomen and postabdominal claw." httpUri="https://zenodo.org/record/190442/files/figure.png" pageId="3" pageNumber="53">Figure 3</figureCitation>
D) with the so-called rostral pore. Ventral rim of valves infolded, supplied with cilia that ramify to form an adhesive sucker-plate (
<figureCitation id="13362A55FFC2A65EFB5DF95E077FEB94" box="[1199,1300,1735,1761]" captionStart="FIGURE 3. S" captionStartId="6.[151,255,1954,1978]" captionTargetBox="[182,1397,187,1906]" captionTargetId="figure@6.[151,1436,138,1930]" captionTargetPageId="6" captionText="FIGURE 3. S. duranguensis n. sp. A. Lateral view of ephippial female; B. Mandible; C. Antennule; D. Anterior view of the head; E. Upper view of the head; F. Antenna; G. Postabdomen and postabdominal claw." httpUri="https://zenodo.org/record/190442/files/figure.png" pageId="3" pageNumber="53">Figure 3</figureCitation>
A). Ventroposterior corner of valves angular, forming a well-defined mucro of medium length (
<figureCitation id="13362A55FFC2A65EFB52F977077BEA7D" box="[1184,1296,1774,1800]" captionStart="FIGURE 1" captionStartId="4.[151,259,1801,1825]" captionTargetBox="[214,1384,181,1775]" captionTargetId="figure@4.[212,1388,174,1789]" captionTargetPageId="4" captionText="FIGURE 1. SEM photographs: A, B, D, G and H Scapholeberis duranguensis n. sp., parthenogenetic female. A. Anterior view of the head and rostrum (note the keels on the head, the reticulated rostrum and the pore at the top of the head); B. Head pore; D. Habitus; G and H. Posterior rim of valves (note the thick double membrane of which the upper one is denticulated); C, E, F, I, J, K and L Scapholeberis armata freyi, parthenogenetic female. C. Anterior view of the head and rostrum (note that there is not a pore-like structure at the top of the head); E and F. Lateral view of a cultured and a wild specimen, respectively, both parthenogenetic females; I to L. Posterior rim of the valves with denticulate membrane (note that the membrane is thinner than in S. duranguensis n. sp.)" httpUri="https://zenodo.org/record/190440/files/figure.png" pageId="3" pageNumber="53">Figures 1</figureCitation>
D and 3A). Posterior rim of valves with a thick double membrane. Upper membrane denticulate (
<figureCitation id="13362A55FFC2A65EFB8CF88D06B5EA5B" box="[1150,1246,1812,1838]" captionStart="FIGURE 1" captionStartId="4.[151,259,1801,1825]" captionTargetBox="[214,1384,181,1775]" captionTargetId="figure@4.[212,1388,174,1789]" captionTargetPageId="4" captionText="FIGURE 1. SEM photographs: A, B, D, G and H Scapholeberis duranguensis n. sp., parthenogenetic female. A. Anterior view of the head and rostrum (note the keels on the head, the reticulated rostrum and the pore at the top of the head); B. Head pore; D. Habitus; G and H. Posterior rim of valves (note the thick double membrane of which the upper one is denticulated); C, E, F, I, J, K and L Scapholeberis armata freyi, parthenogenetic female. C. Anterior view of the head and rostrum (note that there is not a pore-like structure at the top of the head); E and F. Lateral view of a cultured and a wild specimen, respectively, both parthenogenetic females; I to L. Posterior rim of the valves with denticulate membrane (note that the membrane is thinner than in S. duranguensis n. sp.)" httpUri="https://zenodo.org/record/190440/files/figure.png" pageId="3" pageNumber="53">Figure 1</figureCitation>
G, H). Both, the head and the valves with fine reticulation (
<figureCitation id="13362A55FFC2A65EFD61F8A2009EEA20" box="[659,757,1851,1877]" captionStart="FIGURE 1" captionStartId="4.[151,259,1801,1825]" captionTargetBox="[214,1384,181,1775]" captionTargetId="figure@4.[212,1388,174,1789]" captionTargetPageId="4" captionText="FIGURE 1. SEM photographs: A, B, D, G and H Scapholeberis duranguensis n. sp., parthenogenetic female. A. Anterior view of the head and rostrum (note the keels on the head, the reticulated rostrum and the pore at the top of the head); B. Head pore; D. Habitus; G and H. Posterior rim of valves (note the thick double membrane of which the upper one is denticulated); C, E, F, I, J, K and L Scapholeberis armata freyi, parthenogenetic female. C. Anterior view of the head and rostrum (note that there is not a pore-like structure at the top of the head); E and F. Lateral view of a cultured and a wild specimen, respectively, both parthenogenetic females; I to L. Posterior rim of the valves with denticulate membrane (note that the membrane is thinner than in S. duranguensis n. sp.)" httpUri="https://zenodo.org/record/190440/files/figure.png" pageId="3" pageNumber="53">Figure 1</figureCitation>
A, D). Postabdomen robust, rectangular and with ventral margin slightly curved (
<figureCitation id="13362A55FFC2A65EFE4BF8FB004AEA09" box="[441,545,1890,1916]" captionStart="FIGURE 3. S" captionStartId="6.[151,255,1954,1978]" captionTargetBox="[182,1397,187,1906]" captionTargetId="figure@6.[151,1436,138,1930]" captionTargetPageId="6" captionText="FIGURE 3. S. duranguensis n. sp. A. Lateral view of ephippial female; B. Mandible; C. Antennule; D. Anterior view of the head; E. Upper view of the head; F. Antenna; G. Postabdomen and postabdominal claw." httpUri="https://zenodo.org/record/190442/files/figure.png" pageId="3" pageNumber="53">Figure 3</figureCitation>
G). Postabdomen claw with three successive bilateral pectens of different size. Antennule short, with eight terminal esthetascs and a lateral sensory seta. Antenna short, with a foursegmented exopod and a three-segmented endopod. Five trunk limbs of general daphnid shape. Endopodite of trunk limb I with a brush-like seta. Ephippium with a single egg.
</paragraph>
</subSubSection>
<caption id="DF726658FFC5A659FF65F89001ADEA84" httpUri="https://zenodo.org/record/190440/files/figure.png" pageId="4" pageNumber="54" targetBox="[214,1384,181,1775]" targetPageId="4">
<paragraph id="8BB236D0FFC5A659FF65F89001ADEA84" blockId="4.[151,1437,1801,2033]" pageId="4" pageNumber="54">
<emphasis id="B979EAC2FFC5A659FF65F890034BEA54" bold="true" box="[151,288,1801,1825]" pageId="4" pageNumber="54">FIGURE 1.</emphasis>
SEM photographs: A, B, D, G and H
<taxonomicName id="4C0D4D53FFC5A659FD26F893067FEA54" box="[724,1044,1802,1825]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="4" pageNumber="54" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFC5A659FD26F893067FEA54" box="[724,1044,1802,1825]" italics="true" pageId="4" pageNumber="54">Scapholeberis duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFC5A659FBEEF8930630EA54" box="[1052,1115,1802,1825]" pageId="4" pageNumber="54" rank="species">n. sp.</taxonomicNameLabel>
, parthenogenetic female. A. Anterior view of the head and rostrum (note the keels on the head, the reticulated rostrum and the pore at the top of the head); B. Head pore; D. Habitus; G and H. Posterior rim of valves (note the thick double membrane of which the upper one is denticulated); C, E, F, I, J, K and L
<taxonomicName id="4C0D4D53FFC5A659FD91F8EB01ECEAFC" box="[611,903,1906,1929]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="4" pageNumber="54" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFC5A659FD91F8EB01ECEAFC" box="[611,903,1906,1929]" italics="true" pageId="4" pageNumber="54">Scapholeberis armata freyi</emphasis>
</taxonomicName>
, parthenogenetic female. C. Anterior view of the head and rostrum (note that there is not a pore-like structure at the top of the head); E and F. Lateral view of a cultured and a wild specimen, respectively, both parthenogenetic females; I to L. Posterior rim of the valves with denticulate membrane (note that the membrane is thinner than in
<taxonomicName id="4C0D4D53FFC5A659FD21F8430115EA84" box="[723,894,2010,2033]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="4" pageNumber="54" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFC5A659FD21F8430115EA84" box="[723,894,2010,2033]" italics="true" pageId="4" pageNumber="54">S. duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFC5A659FC76F84301D5EA84" box="[900,958,2010,2033]" pageId="4" pageNumber="54" rank="species">n. sp.</taxonomicNameLabel>
)
</paragraph>
</caption>
<caption id="DF726658FFC4A658FF65F8F101F1EA92" httpUri="https://zenodo.org/record/190441/files/figure.png" pageId="5" pageNumber="55" targetBox="[238,1354,194,1853]" targetPageId="5">
<paragraph id="8BB236D0FFC4A658FF65F8F101F1EA92" blockId="5.[151,1436,1896,2023]" pageId="5" pageNumber="55">
<emphasis id="B979EAC2FFC4A658FF65F8F10372EAF5" bold="true" box="[151,281,1896,1920]" pageId="5" pageNumber="55">FIGURE 2.</emphasis>
SEM photographs: A, C, E and G
<taxonomicName id="4C0D4D53FFC4A658FD61F8F101AAEA0A" box="[659,961,1896,1919]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="5" pageNumber="55" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFC4A658FD61F8F101AAEA0A" box="[659,961,1896,1919]" italics="true" pageId="5" pageNumber="55">Scapholeberis duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFC4A658FC3AF8F10669EA0A" box="[968,1026,1896,1919]" pageId="5" pageNumber="55" rank="species">n. sp.</taxonomicNameLabel>
A. Ephippial female, lateral view; C. Ventral view of trunk limbs; E. Ejector hooks (note the length as compared to those of
<taxonomicName id="4C0D4D53FFC4A658FBCAF81206BCEAD7" box="[1080,1239,1931,1954]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="5" pageNumber="55" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFC4A658FBCAF81206BCEAD7" box="[1080,1239,1931,1954]" italics="true" pageId="5" pageNumber="55">S. armata freyi</emphasis>
</taxonomicName>
); G. Postabdomen and postabdominal claw. B, D, F and H
<taxonomicName id="4C0D4D53FFC4A658FDCEF8340136EAB1" box="[572,861,1965,1988]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="5" pageNumber="55" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFC4A658FDCEF8340136EAB1" box="[572,861,1965,1988]" italics="true" pageId="5" pageNumber="55">Scapholeberis armata freyi</emphasis>
</taxonomicName>
, ephippial female. B. Lateral view; D. Ventral view of trunk limbs; F. Ejector hooks; H. Postabdomen and postabdominal claw.
</paragraph>
</caption>
<caption id="DF726658FFC7A65BFF65F83B060FEAA9" httpUri="https://zenodo.org/record/190442/files/figure.png" pageId="6" pageNumber="56" targetBox="[182,1397,187,1906]" targetPageId="6">
<paragraph id="8BB236D0FFC7A65BFF65F83B060FEAA9" blockId="6.[151,1435,1954,2012]" pageId="6" pageNumber="56">
<emphasis id="B979EAC2FFC7A65BFF65F83B0373EACF" bold="true" box="[151,280,1954,1978]" pageId="6" pageNumber="56">FIGURE 3.</emphasis>
<taxonomicName id="4C0D4D53FFC7A65BFEEDF83B03A2EACC" box="[287,457,1954,1977]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="6" pageNumber="56" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFC7A65BFEEDF83B03A2EACC" box="[287,457,1954,1977]" italics="true" pageId="6" pageNumber="56">S. duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFC7A65BFE3DF83B0063EACC" box="[463,520,1954,1977]" pageId="6" pageNumber="56" rank="species">n. sp.</taxonomicNameLabel>
A. Lateral view of ephippial female; B. Mandible; C. Antennule; D. Anterior view of the head; E. Upper view of the head; F. Antenna; G. Postabdomen and postabdominal claw.
</paragraph>
</caption>
<caption id="DF726658FFC6A65AFF65F92003FBEA4D" httpUri="https://zenodo.org/record/190443/files/figure.png" pageId="7" pageNumber="57" targetBox="[206,1394,188,1691]" targetPageId="7">
<paragraph id="8BB236D0FFC6A65AFF65F92003FBEA4D" blockId="7.[151,1437,1721,1848]" pageId="7" pageNumber="57">
<emphasis id="B979EAC2FFC6A65AFF65F9200372EBA4" bold="true" box="[151,281,1721,1745]" pageId="7" pageNumber="57">FIGURE 4.</emphasis>
<taxonomicName id="4C0D4D53FFC6A65AFED3F92003A6EBA5" box="[289,461,1721,1744]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="7" pageNumber="57" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFC6A65AFED3F92003A6EBA5" box="[289,461,1721,1744]" italics="true" pageId="7" pageNumber="57">S. duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFC6A65AFE21F9200066EBA5" box="[467,525,1721,1744]" pageId="7" pageNumber="57" rank="species">n. sp.</taxonomicNameLabel>
A. trunk limb I; B. trunk limb II; C. Gnathobase of trunk limb II; D. Gnathobase of trunk limb II of
<taxonomicName id="4C0D4D53FFC6A65AFEA4F945006EEB86" box="[342,517,1756,1779]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="7" pageNumber="57" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFC6A65AFEA4F945006EEB86" box="[342,517,1756,1779]" italics="true" pageId="7" pageNumber="57">S. armata freyi</emphasis>
</taxonomicName>
for comparison; E. Trunk limb III; F. trunk limb IV. G. Trunk limb V. Initials: AS=Accessory Seta, EH=ejector hooks, EN=endopod, EX=exopod, PS=proximal seta, E=endite, GN=gnathobase, BS=brush-shaped setae
</paragraph>
</caption>
<subSubSection id="C317655BFFC6A654FF37F8FF033CE999" lastPageId="9" lastPageNumber="59" pageId="7" pageNumber="57" type="description">
<paragraph id="8BB236D0FFC6A65AFF37F8FF06EDEA81" blockId="7.[151,1436,1894,2036]" pageId="7" pageNumber="57">
<emphasis id="B979EAC2FFC6A65AFF37F8FF0335EAF5" bold="true" box="[197,350,1894,1920]" pageId="7" pageNumber="57">Description.</emphasis>
<emphasis id="B979EAC2FFC6A65AFE94F8FE03CDEAF5" box="[358,422,1895,1920]" italics="true" pageId="7" pageNumber="57">Head</emphasis>
large, (slightly less than a third of the total length), bilaterally ridged, reticulated and with a pore-like structure at the top (
<figureCitation id="13362A55FFC6A65AFDA7F81400D2EAD2" box="[597,697,1933,1959]" captionStart="FIGURE 1" captionStartId="4.[151,259,1801,1825]" captionTargetBox="[214,1384,181,1775]" captionTargetId="figure@4.[212,1388,174,1789]" captionTargetPageId="4" captionText="FIGURE 1. SEM photographs: A, B, D, G and H Scapholeberis duranguensis n. sp., parthenogenetic female. A. Anterior view of the head and rostrum (note the keels on the head, the reticulated rostrum and the pore at the top of the head); B. Head pore; D. Habitus; G and H. Posterior rim of valves (note the thick double membrane of which the upper one is denticulated); C, E, F, I, J, K and L Scapholeberis armata freyi, parthenogenetic female. C. Anterior view of the head and rostrum (note that there is not a pore-like structure at the top of the head); E and F. Lateral view of a cultured and a wild specimen, respectively, both parthenogenetic females; I to L. Posterior rim of the valves with denticulate membrane (note that the membrane is thinner than in S. duranguensis n. sp.)" httpUri="https://zenodo.org/record/190440/files/figure.png" pageId="7" pageNumber="57">Figure 1</figureCitation>
A), not visible in all studied specimens. Well-developed and rounded rostrum with a pore that opens near its tip (
<figureCitation id="13362A55FFC6A65AFD03F82D013EEABB" box="[753,853,1972,1998]" captionStart="FIGURE 3. S" captionStartId="6.[151,255,1954,1978]" captionTargetBox="[182,1397,187,1906]" captionTargetId="figure@6.[151,1436,138,1930]" captionTargetPageId="6" captionText="FIGURE 3. S. duranguensis n. sp. A. Lateral view of ephippial female; B. Mandible; C. Antennule; D. Anterior view of the head; E. Upper view of the head; F. Antenna; G. Postabdomen and postabdominal claw." httpUri="https://zenodo.org/record/190442/files/figure.png" pageId="7" pageNumber="57">Figure 3</figureCitation>
D). This pore is present in majority of anomopods (
<bibRefCitation id="EF9C4B21FFC6A65AFF6DF8430346EA81" author="Kotov" box="[159,301,2010,2036]" pageId="7" pageNumber="63" refString="Kotov, A. A. (1996) Frontal head pore in primitive representatives of families Chydoridae and Macrothricidae (Anomopoda, Crustacea). Zoologicheskiy Zhurnal, 75, 1603 - 1607." type="journal article" year="1996">Kotov 1996</bibRefCitation>
) and is called rostral or frontal pore. Globular eye and elongated ocellus.
</paragraph>
<paragraph id="8BB236D0FFC9A655FF37FF010667EDAD" blockId="8.[151,1437,152,2034]" pageId="8" pageNumber="58">
<emphasis id="B979EAC2FFC9A655FF37FF010356EDC4" box="[197,317,152,177]" italics="true" pageId="8" pageNumber="58">Antennule</emphasis>
short and rectangular with eight terminal aesthetascs cylindrical and similar in length (
<figureCitation id="13362A55FFC9A655FABFFF0102CDEDAD" captionStart="FIGURE 3. S" captionStartId="6.[151,255,1954,1978]" captionTargetBox="[182,1397,187,1906]" captionTargetId="figure@6.[151,1436,138,1930]" captionTargetPageId="6" captionText="FIGURE 3. S. duranguensis n. sp. A. Lateral view of ephippial female; B. Mandible; C. Antennule; D. Anterior view of the head; E. Upper view of the head; F. Antenna; G. Postabdomen and postabdominal claw." httpUri="https://zenodo.org/record/190442/files/figure.png" pageId="8" pageNumber="58">Figure 3</figureCitation>
C). There is a thinner lateral sensory seta similar in size to the aesthetascs.
</paragraph>
<paragraph id="8BB236D0FFC9A655FF37FF7C002CECEF" blockId="8.[151,1437,152,2034]" pageId="8" pageNumber="58">
<emphasis id="B979EAC2FFC9A655FF37FF7C0343ED8B" box="[197,296,229,254]" italics="true" pageId="8" pageNumber="58">Antenna</emphasis>
with four-segmented exopod and three-segmented endopod (
<figureCitation id="13362A55FFC9A655FBFAFF7C0604ED8A" box="[1032,1135,229,255]" captionStart="FIGURE 3. S" captionStartId="6.[151,255,1954,1978]" captionTargetBox="[182,1397,187,1906]" captionTargetId="figure@6.[151,1436,138,1930]" captionTargetPageId="6" captionText="FIGURE 3. S. duranguensis n. sp. A. Lateral view of ephippial female; B. Mandible; C. Antennule; D. Anterior view of the head; E. Upper view of the head; F. Antenna; G. Postabdomen and postabdominal claw." httpUri="https://zenodo.org/record/190442/files/figure.png" pageId="8" pageNumber="58">Figure 3</figureCitation>
F). First exopod segment relatively short (approx. one third of the second segment). Second segment slightly shorter than the next and with a spine at distal margin. Last two segments of similar size. First endopod segment slightly longer than the other two. First and second endopod segments with a long internal-lateral seta. Three long setae at each apical segment of the endopod and exopod.
</paragraph>
<paragraph id="8BB236D0FFC9A655FF37FE3E03B6EF41" blockId="8.[151,1437,152,2034]" pageId="8" pageNumber="58">
<emphasis id="B979EAC2FFC9A655FF37FE3E0300ECB5" box="[197,363,423,448]" italics="true" pageId="8" pageNumber="58">Postabdomen</emphasis>
robust, rectangular and with ventral margin slightly curved (
<figureCitation id="13362A55FFC9A655FB92FE3F06A1ECB5" box="[1120,1226,422,448]" captionStart="FIGURE 2" captionStartId="5.[151,255,1896,1920]" captionTargetBox="[238,1354,194,1853]" captionTargetId="figure@5.[238,1355,194,1862]" captionTargetPageId="5" captionText="FIGURE 2. SEM photographs: A, C, E and G Scapholeberis duranguensis n. sp. A. Ephippial female, lateral view; C. Ventral view of trunk limbs; E. Ejector hooks (note the length as compared to those of S. armata freyi); G. Postabdomen and postabdominal claw. B, D, F and H Scapholeberis armata freyi, ephippial female. B. Lateral view; D. Ventral view of trunk limbs; F. Ejector hooks; H. Postabdomen and postabdominal claw." httpUri="https://zenodo.org/record/190441/files/figure.png" pageId="8" pageNumber="58">Figure 2</figureCitation>
G, 3G). The total length is approximately three times the height. Preanal portion approximately one third of the total length. Ventral face with two lateral rows of five spines, similar in size. Following the last spine there are two bunches of mid length cilia.
</paragraph>
<paragraph id="8BB236D0FFC9A655FF37FDD801E5EFBA" blockId="8.[151,1437,152,2034]" pageId="8" pageNumber="58">
<emphasis id="B979EAC2FFC9A655FF37FDD803D3EF2F" box="[197,440,577,602]" italics="true" pageId="8" pageNumber="58">Postabdominal claw</emphasis>
slightly shorter than the preanal portion (
<figureCitation id="13362A55FFC9A655FC5AFDD80665EF2E" box="[936,1038,577,603]" captionStart="FIGURE 2" captionStartId="5.[151,255,1896,1920]" captionTargetBox="[238,1354,194,1853]" captionTargetId="figure@5.[238,1355,194,1862]" captionTargetPageId="5" captionText="FIGURE 2. SEM photographs: A, C, E and G Scapholeberis duranguensis n. sp. A. Ephippial female, lateral view; C. Ventral view of trunk limbs; E. Ejector hooks (note the length as compared to those of S. armata freyi); G. Postabdomen and postabdominal claw. B, D, F and H Scapholeberis armata freyi, ephippial female. B. Lateral view; D. Ventral view of trunk limbs; F. Ejector hooks; H. Postabdomen and postabdominal claw." httpUri="https://zenodo.org/record/190441/files/figure.png" pageId="8" pageNumber="58">Figure 2</figureCitation>
G, H and 3G). With three pectens (rows of spinules) at each side. The external pecten has only four spines gradually increasing in size. The medium pecten starts at the base of the claw and extends to a bit less than half of it. The internal one starts at the last third of the mid pecten and extends to the tip of the claw.
</paragraph>
<paragraph id="8BB236D0FFC9A655FF37FD45014BEE69" blockId="8.[151,1437,152,2034]" pageId="8" pageNumber="58">
<emphasis id="B979EAC2FFC9A655FF37FD450350EF80" box="[197,315,732,757]" italics="true" pageId="8" pageNumber="58">Mandible</emphasis>
with rectangular distal end (
<figureCitation id="13362A55FFC9A655FD53FD450167EF83" box="[673,780,732,758]" captionStart="FIGURE 3. S" captionStartId="6.[151,255,1954,1978]" captionTargetBox="[182,1397,187,1906]" captionTargetId="figure@6.[151,1436,138,1930]" captionTargetPageId="6" captionText="FIGURE 3. S. duranguensis n. sp. A. Lateral view of ephippial female; B. Mandible; C. Antennule; D. Anterior view of the head; E. Upper view of the head; F. Antenna; G. Postabdomen and postabdominal claw." httpUri="https://zenodo.org/record/190442/files/figure.png" pageId="8" pageNumber="58">Figure 3</figureCitation>
B) and the basal third of body incurved. Masticatory surface with a row of about seven thick and short teeth.
</paragraph>
<paragraph id="8BB236D0FFC9A655FF37FCB00769E9B3" blockId="8.[151,1437,152,2034]" pageId="8" pageNumber="58">
<emphasis id="B979EAC2FFC9A655FF37FCB00332EE37" box="[197,345,809,834]" italics="true" pageId="8" pageNumber="58">Trunk limb I</emphasis>
(P1). Exopod with two not-segmented, apical setae, the first one half as long as the second one (
<figureCitation id="13362A55FFC9A655FF21FCC90355EE1F" box="[211,318,848,874]" captionStart="FIGURE 4. S" captionStartId="7.[151,255,1721,1745]" captionTargetBox="[206,1394,188,1691]" captionTargetId="figure@7.[175,1422,148,1712]" captionTargetPageId="7" captionText="FIGURE 4. S. duranguensis n. sp. A. trunk limb I; B. trunk limb II; C. Gnathobase of trunk limb II; D. Gnathobase of trunk limb II of S. armata freyi for comparison; E. Trunk limb III; F. trunk limb IV. G. Trunk limb V. Initials: AS = Accessory Seta, EH = ejector hooks, EN = endopod, EX = exopod, PS = proximal seta, E = endite, GN = gnathobase, BS = brush-shaped setae" httpUri="https://zenodo.org/record/190443/files/figure.png" pageId="8" pageNumber="58">Figure 4</figureCitation>
A). Distal two thirds of both setae with two rows of long and thick cilia in the ventral face. Transversal row of cilia in the middle of both setae. Endopod with three apical setae. The longest seta with very short cilia bilaterally arranged in more than half of its total length. The second seta two thirds as long as the first one and with an apical tuft of long and thick cilia. The third seta is brush-shaped and slightly shorter than the previous one. Endite 1 with four setae, endites 2 and 3 with two setae each. All setae on endites are similar in length, shape and cilia arrangement. The base of such setae, which represents approximately a third of the total length, is wider than the apical part and has a bilateral arrangement of long and fine cilia. The apical part has two rows of medium-sized thick cilia in the ventral face. All endites with an accessory seta similar in structure to the ejector hooks but slightly shorter. Long ejector hooks with apical arrangement of cilia are just below the base of endite 1. Accessory seta at the external face of base of limb body.
</paragraph>
<paragraph id="8BB236D0FFC9A655FF37FB4A0651EBE3" blockId="8.[151,1437,152,2034]" pageId="8" pageNumber="58">
<emphasis id="B979EAC2FFC9A655FF37FB4A0309E999" box="[197,354,1235,1260]" italics="true" pageId="8" pageNumber="58">Trunk limb II</emphasis>
(P2). Exopod with two apical feather-like setae, the first one is twice as long as the second one (
<figureCitation id="13362A55FFC9A655FF22FB60035EE866" box="[208,309,1273,1299]" captionStart="FIGURE 4. S" captionStartId="7.[151,255,1721,1745]" captionTargetBox="[206,1394,188,1691]" captionTargetId="figure@7.[175,1422,148,1712]" captionTargetPageId="7" captionText="FIGURE 4. S. duranguensis n. sp. A. trunk limb I; B. trunk limb II; C. Gnathobase of trunk limb II; D. Gnathobase of trunk limb II of S. armata freyi for comparison; E. Trunk limb III; F. trunk limb IV. G. Trunk limb V. Initials: AS = Accessory Seta, EH = ejector hooks, EN = endopod, EX = exopod, PS = proximal seta, E = endite, GN = gnathobase, BS = brush-shaped setae" httpUri="https://zenodo.org/record/190443/files/figure.png" pageId="8" pageNumber="58">Figure 4</figureCitation>
B). Endopod with five apical setae similar in size. Setae 2-5 serrated from base to tip and the first one (1) is feather-like with a bilateral arrangement of long and thin cilia from base to tip. Additionally there is a thin and feathered seta that arises from the base of the fifth seta. Near this setae there is also a pair of appendages that arise from the base of the exopod, one of them apical and with ventral short cilia in the distal two thirds, the second one is a naked structure, half as long as the previous one and with a rounded tip. Gnathobase with eight setae (
<figureCitation id="13362A55FFC9A655FE1FFA220047E8A0" box="[493,556,1467,1493]" captionStart="FIGURE 4. S" captionStartId="7.[151,255,1721,1745]" captionTargetBox="[206,1394,188,1691]" captionTargetId="figure@7.[175,1422,148,1712]" captionTargetPageId="7" captionText="FIGURE 4. S. duranguensis n. sp. A. trunk limb I; B. trunk limb II; C. Gnathobase of trunk limb II; D. Gnathobase of trunk limb II of S. armata freyi for comparison; E. Trunk limb III; F. trunk limb IV. G. Trunk limb V. Initials: AS = Accessory Seta, EH = ejector hooks, EN = endopod, EX = exopod, PS = proximal seta, E = endite, GN = gnathobase, BS = brush-shaped setae" httpUri="https://zenodo.org/record/190443/files/figure.png" pageId="8" pageNumber="58">Fig 4</figureCitation>
C). The longest one has two ventral rows of long cilia that extend from base to tip. The second seta is finger-like and it is approximately two thirds as long as the first one. It is a naked seta but it has two ventral rows of thick spine-like structures in the upper half. The third seta is apical, slightly shorter than the previous one and with a transversal row of thick and long cilia in the middle and with two ventral rows of short and thick cilia from the mid part to the tip. The remaining five setae are similar in shape and cilia arrangement to the previous one and with a gradual increase in length.
</paragraph>
<paragraph id="8BB236D0FFC9A655FF37F93A0391EA87" blockId="8.[151,1437,152,2034]" pageId="8" pageNumber="58">
<emphasis id="B979EAC2FFC9A655FF37F93A0300EBC9" box="[197,363,1699,1724]" italics="true" pageId="8" pageNumber="58">Trunk limb III</emphasis>
(P3). Exopod with four apical and two lateral feathered setae (
<figureCitation id="13362A55FFC9A655FBA5F93A06D5EBC8" box="[1111,1214,1699,1725]" captionStart="FIGURE 4. S" captionStartId="7.[151,255,1721,1745]" captionTargetBox="[206,1394,188,1691]" captionTargetId="figure@7.[175,1422,148,1712]" captionTargetPageId="7" captionText="FIGURE 4. S. duranguensis n. sp. A. trunk limb I; B. trunk limb II; C. Gnathobase of trunk limb II; D. Gnathobase of trunk limb II of S. armata freyi for comparison; E. Trunk limb III; F. trunk limb IV. G. Trunk limb V. Initials: AS = Accessory Seta, EH = ejector hooks, EN = endopod, EX = exopod, PS = proximal seta, E = endite, GN = gnathobase, BS = brush-shaped setae" httpUri="https://zenodo.org/record/190443/files/figure.png" pageId="8" pageNumber="58">Figure 4</figureCitation>
E). The two lateral setae are of mid length and bilaterally covered with thin and long cilia from base to tip, the second of such pair of setae is about half as long as the first one. The first two apical setae (1 and 2) are similar in shape and cilia arrangement to the lateral ones but thinner and longer. The second seta slightly shorter than the first one. Setae 3 and 4 with the lower third covered with long and thin cilia and the upper two thirds with very short and fine cilia. Gnathobase with numerous (about 24) long, bisegmented and thin setae similar in shape and size. All setae with a bilateral arrangement of very short and thin cilia from base to tip. Last distal setae are more internally placed than the others. There are four endites, each with at least 2 ciliated setae, between the exopodite and the gnathobase.
</paragraph>
<paragraph id="8BB236D0FFC8A654FF37FF0103B6EC92" blockId="9.[151,1437,152,1531]" pageId="9" pageNumber="59">
<emphasis id="B979EAC2FFC8A654FF37FF010302EDC4" box="[197,361,152,177]" italics="true" pageId="9" pageNumber="59">Trunk limb IV</emphasis>
(P4). Exopod with four apical and two lateral setae. The two lateral setae are of mid length and bilaterally covered with thin and long cilia from base to tip, the second of such pair of setae is longer than the first one (
<figureCitation id="13362A55FFC8A654FEC6FF7C03F0ED8A" box="[308,411,229,255]" captionStart="FIGURE 4. S" captionStartId="7.[151,255,1721,1745]" captionTargetBox="[206,1394,188,1691]" captionTargetId="figure@7.[175,1422,148,1712]" captionTargetPageId="7" captionText="FIGURE 4. S. duranguensis n. sp. A. trunk limb I; B. trunk limb II; C. Gnathobase of trunk limb II; D. Gnathobase of trunk limb II of S. armata freyi for comparison; E. Trunk limb III; F. trunk limb IV. G. Trunk limb V. Initials: AS = Accessory Seta, EH = ejector hooks, EN = endopod, EX = exopod, PS = proximal seta, E = endite, GN = gnathobase, BS = brush-shaped setae" httpUri="https://zenodo.org/record/190443/files/figure.png" pageId="9" pageNumber="59">Figure 4</figureCitation>
F). The first three apical setae (1 to 3) are similar in shape and cilia arrangement to the lateral ones but thinner and longer and show a decrease in length. Seta 4 different in shape from the others. It has a wider and well defined base which is slightly less than half of the total length. Such a base is laterally covered with long cilia and with shorter cilia in the upper ring. The upper portion of the seta is narrower and without cilia. Gnathobase with two rows of setae (one external and one internal), similar in shape to those of P3s gnathobase. The external set has ten setae while the internal one has five. There is an endite between the gnathobase and the exopod.
</paragraph>
<paragraph id="8BB236D0FFC8A654FF37FE6D0168EFF7" blockId="9.[151,1437,152,1531]" pageId="9" pageNumber="59">
<emphasis id="B979EAC2FFC8A654FF37FE6D0335EF78" box="[197,350,500,525]" italics="true" pageId="9" pageNumber="59">Trunk limb V</emphasis>
(P5). Endopod with a long, bisegmented and densely ciliated seta (
<figureCitation id="13362A55FFC8A654FB80FE6D06B3EF7B" box="[1138,1240,500,526]" captionStart="FIGURE 4. S" captionStartId="7.[151,255,1721,1745]" captionTargetBox="[206,1394,188,1691]" captionTargetId="figure@7.[175,1422,148,1712]" captionTargetPageId="7" captionText="FIGURE 4. S. duranguensis n. sp. A. trunk limb I; B. trunk limb II; C. Gnathobase of trunk limb II; D. Gnathobase of trunk limb II of S. armata freyi for comparison; E. Trunk limb III; F. trunk limb IV. G. Trunk limb V. Initials: AS = Accessory Seta, EH = ejector hooks, EN = endopod, EX = exopod, PS = proximal seta, E = endite, GN = gnathobase, BS = brush-shaped setae" httpUri="https://zenodo.org/record/190443/files/figure.png" pageId="9" pageNumber="59">Figure 4</figureCitation>
G). A finger-like structure at the base of this seta is approximately half as long as the base portion of such a seta. Exopod with two shorter ciliated setae. The first one bisegmented and a third longer than the second one. There is a long feather-like proximal setae at the base of the exopod.
</paragraph>
<paragraph id="8BB236D0FFC8A654FF37FD17036CEEAB" blockId="9.[151,1437,152,1531]" pageId="9" pageNumber="59">
<emphasis id="B979EAC2FFC8A654FF37FD1703B1EFDD" bold="true" box="[197,474,654,680]" pageId="9" pageNumber="59">Differential diagnosis:</emphasis>
The main morphological characters that differentiate
<taxonomicName id="4C0D4D53FFC8A654FBA5FD16077FEFDD" box="[1111,1300,655,680]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFC8A654FBA5FD16077FEFDD" box="[1111,1300,655,680]" italics="true" pageId="9" pageNumber="59">S. duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFC8A654FAE9FD170730EFDD" box="[1307,1371,654,680]" pageId="9" pageNumber="59" rank="species">n. sp.</taxonomicNameLabel>
from S.
<taxonomicName id="4C0D4D53FFC8A654FF45FD2C0327EFBB" box="[183,332,693,718]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFC8A654FF45FD2C0327EFBB" box="[183,332,693,718]" italics="true" pageId="9" pageNumber="59">armata freyi</emphasis>
</taxonomicName>
are: (1) a double and thicker membrane at the posterior rim of valves, (2) lower number (8 compared to 9) of setae in the gnathobase of trunk limb II (see
<figureCitation id="13362A55FFC8A654FC5FFD45064AEF83" box="[941,1057,732,758]" captionStart="FIGURE 4. S" captionStartId="7.[151,255,1721,1745]" captionTargetBox="[206,1394,188,1691]" captionTargetId="figure@7.[175,1422,148,1712]" captionTargetPageId="7" captionText="FIGURE 4. S. duranguensis n. sp. A. trunk limb I; B. trunk limb II; C. Gnathobase of trunk limb II; D. Gnathobase of trunk limb II of S. armata freyi for comparison; E. Trunk limb III; F. trunk limb IV. G. Trunk limb V. Initials: AS = Accessory Seta, EH = ejector hooks, EN = endopod, EX = exopod, PS = proximal seta, E = endite, GN = gnathobase, BS = brush-shaped setae" httpUri="https://zenodo.org/record/190443/files/figure.png" pageId="9" pageNumber="59">Figures 4</figureCitation>
C and D), (3) longer and more rectilinear ejector hooks on trunk limb I, and (4) the presence of a pore-like structure at the top of the head (not a definitive character). The average length of the mucro in proportion to the length of the valves in
<taxonomicName id="4C0D4D53FFC8A654FA77FCB0035CEE1C" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="species" species="duranguensis">
<emphasis id="B979EAC2FFC8A654FA77FCB0035CEE1C" italics="true" pageId="9" pageNumber="59">S. duranguensis</emphasis>
</taxonomicName>
(1/5) is significantly higher (p&lt;0.001, n=8) than in
<taxonomicName id="4C0D4D53FFC8A654FC56FCC9063EEE1C" box="[932,1109,848,873]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFC8A654FC56FCC9063EEE1C" box="[932,1109,848,873]" italics="true" pageId="9" pageNumber="59">S. armata freyi</emphasis>
</taxonomicName>
(1/7). The size of the adult specimens (females) is also significantly different (p&lt;0.01, n= 20) between the two species. The average length for 20 individuals of
<taxonomicName id="4C0D4D53FFC8A654FE11FC0400F8EEC3" box="[483,659,925,951]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFC8A654FE11FC040399EEC3" box="[483,498,925,950]" italics="true" pageId="9" pageNumber="59">S</emphasis>
.
<emphasis id="B979EAC2FFC8A654FDF3FC0400F8EEC3" box="[513,659,925,950]" italics="true" pageId="9" pageNumber="59">armata freyi</emphasis>
</taxonomicName>
is
<quantity id="4CF59B35FFC8A654FD45FC04014BEEC2" box="[695,800,925,951]" metricMagnitude="-4" metricUnit="m" metricValue="4.5" pageId="9" pageNumber="59" unit="mm" value="0.45">0.45 mm</quantity>
±
<quantity id="4CF59B35FFC8A654FCB2FC0401C9EEC2" box="[832,930,925,951]" metricMagnitude="-5" metricUnit="m" metricValue="5.0" pageId="9" pageNumber="59" unit="mm" value="0.05">0.05mm</quantity>
whereas in
<taxonomicName id="4C0D4D53FFC8A654FBC3FC040686EEC3" box="[1073,1261,925,950]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="species" species="duranguensis">
<emphasis id="B979EAC2FFC8A654FBC3FC040686EEC3" box="[1073,1261,925,950]" italics="true" pageId="9" pageNumber="59">S. duranguensis</emphasis>
</taxonomicName>
it is
<quantity id="4CF59B35FFC8A654FADBFC0407EFEEC2" box="[1321,1412,925,951]" metricMagnitude="-4" metricUnit="m" metricValue="6.0" pageId="9" pageNumber="59" unit="mm" value="0.6">0.6 mm</quantity>
±
<quantity id="4CF59B35FFC8A654FF65FC5D0368EEAB" box="[151,259,964,990]" metricMagnitude="-5" metricUnit="m" metricValue="9.0" pageId="9" pageNumber="59" unit="mm" value="0.09">0.09 mm</quantity>
.
</paragraph>
<paragraph id="8BB236D0FFC8A654FF37FC730724E90D" blockId="9.[151,1437,152,1531]" pageId="9" pageNumber="59">
The main differences between
<taxonomicName id="4C0D4D53FFC8A654FDC9FC730096E976" box="[571,765,1002,1027]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFC8A654FDC9FC730096E976" box="[571,765,1002,1027]" italics="true" pageId="9" pageNumber="59">S. duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFC8A654FCF7FC73012CE971" box="[773,839,1002,1028]" pageId="9" pageNumber="59" rank="species">n. sp.</taxonomicNameLabel>
and
<taxonomicName id="4C0D4D53FFC8A654FC71FC730632E976" box="[899,1113,1002,1027]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="armata">
<emphasis id="B979EAC2FFC8A654FC71FC730632E976" box="[899,1113,1002,1027]" italics="true" pageId="9" pageNumber="59">S. armata armata</emphasis>
</taxonomicName>
were the lack of a hyaline membrane and a thinner membrane at the posterior rim of the valves in the latter, as well as the average size of the organisms.
<taxonomicName id="4C0D4D53FFC8A654FEB8FBA10071E924" box="[330,538,1080,1105]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="armata">
<emphasis id="B979EAC2FFC8A654FEB8FBA10071E924" box="[330,538,1080,1105]" italics="true" pageId="9" pageNumber="59">S. armata armata</emphasis>
</taxonomicName>
is noticeably larger (
<quantity id="4CF59B35FFC8A654FCE0FBA10116E927" box="[786,893,1080,1106]" metricMagnitude="-4" metricUnit="m" metricValue="8.2" pageId="9" pageNumber="59" unit="mm" value="0.82">0.82 mm</quantity>
, n=7) than
<taxonomicName id="4C0D4D53FFC8A654FBF6FBA106ABE924" box="[1028,1216,1080,1105]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFC8A654FBF6FBA106ABE924" box="[1028,1216,1080,1105]" italics="true" pageId="9" pageNumber="59">S. duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFC8A654FB35FBA1076DE927" box="[1223,1286,1080,1106]" pageId="9" pageNumber="59" rank="species">n. sp.</taxonomicNameLabel>
The relative length of the mucro in
<taxonomicName id="4C0D4D53FFC8A654FE51FBC6001AE90D" box="[419,625,1119,1144]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="armata">
<emphasis id="B979EAC2FFC8A654FE51FBC6001AE90D" box="[419,625,1119,1144]" italics="true" pageId="9" pageNumber="59">S. armata armata</emphasis>
</taxonomicName>
is significantly lower (1/7) than in
<taxonomicName id="4C0D4D53FFC8A654FBFDFBC606A1E90D" box="[1039,1226,1119,1144]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="species" species="duranguensis">
<emphasis id="B979EAC2FFC8A654FBFDFBC606A1E90D" box="[1039,1226,1119,1144]" italics="true" pageId="9" pageNumber="59">S. duranguensis</emphasis>
</taxonomicName>
n. sp (1/5).
</paragraph>
<paragraph id="8BB236D0FFC8A654FF37FB1C033CE999" blockId="9.[151,1437,152,1531]" pageId="9" pageNumber="59">
Differences of our new species from other species include the arrangement of the denticulate membrane at the posterior rim of the valves, an important feature for taxonomic discrimination according to
<bibRefCitation id="EF9C4B21FFC8A654FAFAFB350338E999" author="Dumont" pageId="9" pageNumber="63" refString="Dumont, H. J. &amp; Pensaert, J. (1983) A revision of the Scapholeberinae (Crustacea, Cladocera). Hydrobiologia, 100, 3 - 45." type="journal article" year="1983">Dumont and Pensaert (1983)</bibRefCitation>
.
</paragraph>
</subSubSection>
<subSubSection id="C317655BFFC8A657FF37FB610657ECDF" lastPageId="10" lastPageNumber="60" pageId="9" pageNumber="59" type="distribution">
<paragraph id="8BB236D0FFC8A654FF37FB610674E866" blockId="9.[151,1437,152,1531]" box="[197,1055,1272,1299]" pageId="9" pageNumber="59">
<emphasis id="B979EAC2FFC8A654FF37FB61030CE867" bold="true" box="[197,359,1272,1298]" pageId="9" pageNumber="59">Distribution:</emphasis>
<taxonomicName id="4C0D4D53FFC8A654FE9DFB600041E867" box="[367,554,1273,1298]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFC8A654FE9DFB600041E867" box="[367,554,1273,1298]" italics="true" pageId="9" pageNumber="59">S. duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFC8A654FDC3FB60001BE866" box="[561,624,1273,1299]" pageId="9" pageNumber="59" rank="species">n. sp.</taxonomicNameLabel>
is known only from its
<typeStatus id="54B68872FFC8A654FC7AFB6001D1E866" box="[904,954,1273,1299]" pageId="9" pageNumber="59">type</typeStatus>
locality.
</paragraph>
<paragraph id="8BB236D0FFC8A654FF37FA860143E8DB" blockId="9.[151,1437,152,1531]" pageId="9" pageNumber="59">
<emphasis id="B979EAC2FFC8A654FF37FA86003AE84C" bold="true" box="[197,593,1311,1337]" pageId="9" pageNumber="59">Molecular Sequences (CO1)</emphasis>
: Sequences of the gene CO1 used for barcoding by the BOLD (www.boldsystems.org) informatics data base were obtained from three topotypes of the new species. All of them are published in the project &quot;
<taxonomicName id="4C0D4D53FFC8A654FDD4FAF400CBE8F2" box="[550,672,1389,1415]" class="Branchiopoda" higherTaxonomySource="GBIF" kingdom="Animalia" order="Cladocera" pageId="9" pageNumber="59" phylum="Arthropoda" rank="order">Cladocera</taxonomicName>
of
<collectingCountry id="F31A7640FFC8A654FD35FAF4014FE8F2" box="[711,804,1389,1415]" name="Mexico" pageId="9" pageNumber="59">Mexico</collectingCountry>
&quot; in BOLD. The average divergence between the three sequences was 0.54±0.03%, with a maximum of 0.61%.
</paragraph>
<paragraph id="8BB236D0FFC8A654FF37FA230059E88E" blockId="9.[151,1437,152,1531]" pageId="9" pageNumber="59">
Average divergence between the three specimens of
<taxonomicName id="4C0D4D53FFC8A654FCBDFA220663E8A1" box="[847,1032,1467,1492]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFC8A654FCBDFA220663E8A1" box="[847,1032,1467,1492]" italics="true" pageId="9" pageNumber="59">S. armata freyi</emphasis>
</taxonomicName>
used for comparison was 0.35 ± 0.06%, with a maximum of 0.62%.
</paragraph>
<caption id="DF726658FFC8A654FF65F81F07E2EAB5" httpUri="https://zenodo.org/record/190444/files/figure.png" pageId="9" pageNumber="59" targetBox="[379,1200,1583,1898]" targetPageId="9">
<paragraph id="8BB236D0FFC8A654FF65F81F07E2EAB5" blockId="9.[151,1436,1926,1984]" pageId="9" pageNumber="59">
<emphasis id="B979EAC2FFC8A654FF65F81F0372EAEB" bold="true" box="[151,281,1926,1950]" pageId="9" pageNumber="59">FIGURE 5.</emphasis>
ID tree based in maximum likelihood analyses in PAUP (lnL=2482.38). Other
<taxonomicName id="4C0D4D53FFC8A654FB8CF81E077EEAEB" box="[1150,1301,1927,1950]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="genus">
<emphasis id="B979EAC2FFC8A654FB8CF81E077EEAEB" box="[1150,1301,1927,1950]" italics="true" pageId="9" pageNumber="59">Scapholeberis</emphasis>
</taxonomicName>
are used for comparison purposes with our material. To identify each
<taxonomicName id="4C0D4D53FFC8A654FD0AF83001E4EAB5" box="[760,911,1961,1984]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="9" pageNumber="59" phylum="Arthropoda" rank="genus">
<emphasis id="B979EAC2FFC8A654FD0AF83001E4EAB5" box="[760,911,1961,1984]" italics="true" pageId="9" pageNumber="59">Scapholeberis</emphasis>
</taxonomicName>
sp., GenBank accession numbers are provided.
</paragraph>
</caption>
<paragraph id="8BB236D0FFCBA657FF34FF010119EDAD" blockId="10.[151,1436,152,216]" pageId="10" pageNumber="60">
Below are the differences in the nucleotide composition of the COI sequence between
<taxonomicName id="4C0D4D53FFCBA657FB15FF0107F7EDC4" box="[1255,1436,152,177]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="10" pageNumber="60" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFCBA657FB15FF0107F7EDC4" box="[1255,1436,152,177]" italics="true" pageId="10" pageNumber="60">S. armata freyi</emphasis>
</taxonomicName>
(ZPLMX096-06) and
<taxonomicName id="4C0D4D53FFCBA657FE6BFF26003FEDAD" box="[409,596,191,216]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="10" pageNumber="60" phylum="Arthropoda" rank="species" species="duranguensis" status="sp. nov.">
<emphasis id="B979EAC2FFCBA657FE6BFF26003FEDAD" box="[409,596,191,216]" italics="true" pageId="10" pageNumber="60">S. duranguensis</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A24A57B9FFCBA657FDA9FF2700F1EDAD" box="[603,666,190,216]" pageId="10" pageNumber="60" rank="species">n. sp.</taxonomicNameLabel>
(ZPLMX144-06).
</paragraph>
<paragraph id="8BB236D0FFCBA657FEA5FE91018FEC62" blockId="10.[245,1269,264,338]" box="[343,996,264,279]" pageId="10" pageNumber="60">* 20 * 40 * 60</paragraph>
<paragraph id="8BB236D0FFCBA657FF07FEBC0657ECDF" blockId="10.[245,1269,264,338]" lastBlockId="10.[245,1268,411,485]" pageId="10" pageNumber="60">ZPLMX096-06: GACATTATATTTTATTTTTGGAGTCTGATCTGGTATAGTAGGAACTGCTTTAAGAATGTT: 60 ZPLMX144-06: .....................G..A...................................: 60 * 80 * 100 * 120</paragraph>
</subSubSection>
<subSubSection id="C317655BFFCBA656FF07FE20028BEDAD" lastPageId="11" lastPageNumber="61" pageId="10" pageNumber="60" type="description">
<paragraph id="8BB236D0FFCBA657FF07FE200657EF4B" blockId="10.[245,1268,411,485]" lastBlockId="10.[245,1268,559,633]" pageId="10" pageNumber="60">ZPLMX096-06: AATCCGAGCAGAATTAGGTCAAGCTGGAAGTTTAATTGGGGATGATCAGATTTATAATGT: 120 ZPLMX144-06: ...T........G........G.....G..C........A........A........C..: 120 * 140 * 160 * 180</paragraph>
<paragraph id="8BB236D0FFCBA657FF07FDD50657EFA7" blockId="10.[245,1268,559,633]" lastBlockId="10.[245,1268,707,780]" pageId="10" pageNumber="60">ZPLMX096-06: AGTTGTTACAGCCCACGCGTTTGTCATAATTTTCTTTATAGTTATACCAATCATGATTGG: 180 ZPLMX144-06:.A.C...........T........G.....C..T..........................: 180 * 200 * 220 * 240</paragraph>
<paragraph id="8BB236D0FFCBA657FF07FD790657EE10" blockId="10.[245,1268,707,780]" lastBlockId="10.[245,1268,854,928]" pageId="10" pageNumber="60">ZPLMX096-06: GGGGTTCGGTAATTGATTAGTTCCTCTAATGTTAGGCGCCCCTGACATAGCTTTTCCGCG: 240 ZPLMX144-06: ...C..T.........C....C.........C....T........T...........T..: 240 * 260 * 280 * 300</paragraph>
<paragraph id="8BB236D0FFCBA657FF07FCEA0657EE8D" blockId="10.[245,1268,854,928]" lastBlockId="10.[245,1268,1001,1075]" pageId="10" pageNumber="60">ZPLMX096-06: ATTAAATAACTTAAGTTTTTGGTTTCTTCCCCCCGCTTTAACTTTACTTTTAGTTGGAGG: 300 ZPLMX144-06: ..........C.......C...........T..T....................A..G..: 300 * 320 * 340 * 360</paragraph>
<paragraph id="8BB236D0FFCBA657FF07FB9E0657E9F9" blockId="10.[245,1268,1001,1075]" lastBlockId="10.[245,1268,1149,1223]" pageId="10" pageNumber="60">ZPLMX096-06: GGCGGTAGAAAGTGGGGCTGGAACTGGGTGAACCGTTTACCCGCCCTTGTCAGCAGGAAT: 360 ZPLMX144-06: ...T...........A....................C.....T.....A........G..: 360 * 380 * 400 * 420</paragraph>
<paragraph id="8BB236D0FFCBA657FF07FB030657E86A" blockId="10.[245,1268,1149,1223]" lastBlockId="10.[245,1268,1296,1370]" pageId="10" pageNumber="60">ZPLMX096-06: TGCTCACGCCGGAGCATCAGTTGATCTAAGAATTTTCTCTCTTCACTTAGCAGGGATTTC: 420 ZPLMX144-06: ...C..T..T..............C...........T..C........G...........: 420 * 440 * 460 * 480</paragraph>
<paragraph id="8BB236D0FFCBA657FF07FAB70657E8C6" blockId="10.[245,1268,1296,1370]" lastBlockId="10.[245,1268,1444,1518]" pageId="10" pageNumber="60">ZPLMX096-06: TTCTATTTTAGGGGCTGTTAATTTTATTACTACTATCATTAATATACGATCGGAGGGAAT: 480 ZPLMX144-06: ..........................................C........A..A..G..: 480 * 500 * 520 * 540</paragraph>
<paragraph id="8BB236D0FFCBA657FF07FA580657EB33" blockId="10.[245,1268,1444,1518]" lastBlockId="10.[245,1268,1591,1665]" pageId="10" pageNumber="60">ZPLMX096-06: GTCTTTAGACCGAATTCCGTTATTTGTATGAGCAGTGGGAATTACAGCTCTTCTTTTACT: 540 ZPLMX144-06: ...C.....T...........G........G.....A..G..C........C........: 540 * 560 * 580 * 600</paragraph>
<paragraph id="8BB236D0FFCBA657FF07F9CC01D6EBAC" blockId="10.[245,1268,1591,1665]" lastBlockId="10.[245,1243,1738,1813]" pageId="10" pageNumber="60">ZPLMX096-06: TTTAAGTCTTCCCGTGCTAGCTGGTGCAATCACAATGCTTCTTACAGATCGAAATTTAAA: 600 ZPLMX144-06: ...............A.................G.....CT.A.................: 600 * 620 * 640 *</paragraph>
<paragraph id="8BB236D0FFCBA657FF07F97107F7EA85" blockId="10.[245,1243,1738,1813]" lastBlockId="10.[151,1436,1890,2032]" pageId="10" pageNumber="60">
ZPLMX096-06: TACTTCGTTTTTTGACCCTGCTGGGGGAGGAGATCCTATTCTTTACCAGCATCTTTTC: 658 ZPLMX144-06: ............C.................G..C..A...T....T..A.........: 658
<figureCitation id="13362A55FFCBA657FF34F8FB0341EA09" box="[198,298,1890,1916]" captionStart="FIGURE 5" captionStartId="9.[151,255,1926,1950]" captionTargetBox="[379,1200,1583,1898]" captionTargetId="figure@9.[363,1220,1566,1907]" captionTargetPageId="9" captionText="FIGURE 5. ID tree based in maximum likelihood analyses in PAUP ( lnL = 2482.38). Other Scapholeberis are used for comparison purposes with our material. To identify each Scapholeberis sp., GenBank accession numbers are provided." httpUri="https://zenodo.org/record/190444/files/figure.png" pageId="10" pageNumber="60">Figure 5</figureCitation>
shows the ID tree of the several
<taxonomicName id="4C0D4D53FFCBA657FD45F8FB0136EA0E" box="[695,861,1890,1915]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="10" pageNumber="60" phylum="Arthropoda" rank="genus">
<emphasis id="B979EAC2FFCBA657FD45F8FB0136EA0E" box="[695,861,1890,1915]" italics="true" pageId="10" pageNumber="60">Scapholeberis</emphasis>
</taxonomicName>
used for comparison in this study (see
<tableCitation id="C68F036BFFCBA657FAC1F8FB07E6EA09" box="[1331,1421,1890,1916]" captionStart="TABLE 2" captionStartId="2.[151,242,811,835]" captionTargetBox="[151,1437,1005,1692]" captionTargetPageId="2" captionText="TABLE 2. GenBank, BOLD and collection accession numbers for Scapholeberis COI sequences used to compare Scapholeberis duranguensis n. sp. * Cited as S. rammneri in deWaard et al. (2006). ** Currently recognized as S. duranguensis n. sp. Refers to vouchers from the same sample." httpUri="http://table.plazi.org/id/DF726658FFC3A65FFF65FCB2015FEEF9" pageId="10" pageNumber="60" tableUuid="DF726658FFC3A65FFF65FCB2015FEEF9">Table 2</tableCitation>
). Main variation in the sequences of
<taxonomicName id="4C0D4D53FFCBA657FDC1F8100085EAD7" box="[563,750,1929,1954]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="10" pageNumber="60" phylum="Arthropoda" rank="species" species="duranguensis">
<emphasis id="B979EAC2FFCBA657FDC1F8100085EAD7" box="[563,750,1929,1954]" italics="true" pageId="10" pageNumber="60">S. duranguensis</emphasis>
</taxonomicName>
was in the GC% of the first codon position, in which such a percentage varied from 27.4 to 29.5. In
<taxonomicName id="4C0D4D53FFCBA657FD67F8360120EABD" box="[661,843,1967,1992]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="10" pageNumber="60" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFCBA657FD67F8360120EABD" box="[661,843,1967,1992]" italics="true" pageId="10" pageNumber="60">S. armata freyi</emphasis>
</taxonomicName>
, the main variation was in the GC% of the third codon position, in which it was from 25.5 to 27. The main total variation in both species was given by the C%.
</paragraph>
<paragraph id="8BB236D0FFCAA656FF65FF01028BEDAD" blockId="11.[151,1436,152,216]" pageId="11" pageNumber="61">
In
<taxonomicName id="4C0D4D53FFCAA656FF45FF010319EDC4" box="[183,370,152,177]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="11" pageNumber="61" phylum="Arthropoda" rank="species" species="duranguensis">
<emphasis id="B979EAC2FFCAA656FF45FF010319EDC4" box="[183,370,152,177]" italics="true" pageId="11" pageNumber="61">S. duranguensis</emphasis>
</taxonomicName>
this percentage varied from 18.8 to 20.5 whereas in
<taxonomicName id="4C0D4D53FFCAA656FC2FFF0106E0EDC4" box="[989,1163,152,177]" class="Branchiopoda" genus="Scapholeberis" kingdom="Animalia" order="Diplostraca" pageId="11" pageNumber="61" phylum="Arthropoda" rank="subSpecies" species="armata" subSpecies="freyi">
<emphasis id="B979EAC2FFCAA656FC2FFF0106E0EDC4" box="[989,1163,152,177]" italics="true" pageId="11" pageNumber="61">S. armata freyi</emphasis>
</taxonomicName>
it varied from 18.24 to 19.55.
</paragraph>
</subSubSection>
</treatment>
</document>