plazi/treatments-xml
2
0
Fork 0
Code Issues Pull requests Releases Activity
treatments-xml/data/37/AD/FC/37ADFC8C713C5C8A8645BBC870D0A3D4.xml
maintenance 3103fc73ed added 37
2024-06-21 12:33:32 +02:00

354 lines
41 KiB
XML
Raw Blame History

This file contains ambiguous Unicode characters

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

<document ID-DOI="http://dx.doi.org/10.3897/zookeys.1132.91244" ID-Pensoft-Pub="1313-2970-1132-85" ID-Pensoft-UUID="E57A2873FAAC552282A3E1390FF28D3E" ID-ZooBank="4168C32E37A74912A9094912E69030AA" ModsDocID="1313-2970-1132-85" checkinTime="1669726345720" checkinUser="pensoft" docAuthor="Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne &amp; Parapar, Julio" docDate="2022" docId="37ADFC8C713C5C8A8645BBC870D0A3D4" docLanguage="en" docName="ZooKeys 1132: 85-126" docOrigin="ZooKeys 1132" docPubDate="2022-11-28" docSource="http://dx.doi.org/10.3897/zookeys.1132.91244" docTitle="Terebellides shetlandica Parapar, Moreira &amp; O'Reilly 2016" docType="treatment" docVersion="2" id="E57A2873FAAC552282A3E1390FF28D3E" lastPageNumber="85" masterDocId="E57A2873FAAC552282A3E1390FF28D3E" masterDocTitle="A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species" masterLastPageNumber="126" masterPageNumber="85" pageNumber="85" updateTime="1669726647669" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Barroso, Maria</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-9624-3602</mods:nameIdentifier>
<mods:affiliation>Departamento de Bioloxia, Universidade da Coruna, A Coruna, Spain</mods:affiliation>
<mods:nameIdentifier type="email">maria.p.barroso@udc.es</mods:nameIdentifier>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Moreira, Juan</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-1374-2033</mods:nameIdentifier>
<mods:affiliation>Departamento de Biologia (Zoologia) &amp; Centro de Investigacion en Biodiversidad y Cambio Global (CIBC-UAM), Facultad de Ciencias, Universidad Autonoma de Madrid, Madrid, Spain</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Capa, Maria</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-5063-7961</mods:nameIdentifier>
<mods:affiliation>Departament de Biologia, Universitat de les Illes Balears, Mallorca, Spain</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Nygren, Arne</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-5761-8803</mods:nameIdentifier>
<mods:affiliation>Sjoefartmuseet Akvariet, Goeteborg, Sweden &amp; Institutionen foer marina vetenskaper, Goeteborgs Universitet, Goeteborg, Sweden</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Parapar, Julio</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-7585-6995</mods:nameIdentifier>
<mods:affiliation>Departamento de Bioloxia, Universidade da Coruna, A Coruna, Spain</mods:affiliation>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>ZooKeys</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2022</mods:date>
<mods:detail type="pubDate">
<mods:number>2022-11-28</mods:number>
</mods:detail>
<mods:detail type="volume">
<mods:number>1132</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>85</mods:start>
<mods:end>126</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/zookeys.1132.91244</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.1132.91244</mods:identifier>
<mods:identifier type="Pensoft-Pub">1313-2970-1132-85</mods:identifier>
<mods:identifier type="ZooBank">4168C32E37A74912A9094912E69030AA</mods:identifier>
<mods:identifier type="Pensoft-UUID">E57A2873FAAC552282A3E1390FF28D3E</mods:identifier>
</mods:mods>
<treatment LSID="urn:lsid:plazi:treatment:37ADFC8C713C5C8A8645BBC870D0A3D4" httpUri="http://treatment.plazi.org/id/37ADFC8C713C5C8A8645BBC870D0A3D4" lastPageNumber="85" pageId="0" pageNumber="85">
<subSubSection pageId="0" pageNumber="85" type="nomenclature">
<paragraph pageId="0" pageNumber="85">
<taxonomicName LSID="37ADFC8C-713C-5C8A-8645-BBC870D0A3D4" authority="Parapar, Moreira &amp; O'Reilly, 2016" authorityName="Parapar, Moreira &amp; O'Reilly" authorityYear="2016" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides shetlandica" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
Terebellides shetlandica Parapar, Moreira &amp;
<normalizedToken originalValue="O’Reilly">O'Reilly</normalizedToken>
, 2016
</taxonomicName>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85" type="description">
<paragraph pageId="0" pageNumber="85">
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. STM photographs of live specimens of several Terebellides species (non-type specimens) A, B Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; A ZMBN 116171 B ZMBN 116181) C Terebellides lavesquei sp. nov. (species 5; GNM 15112) D, E Terebellides williamsae Jirkov, 1989 (species 2; D GNM 15108 E GNM 15109) F Terebellides gracilis Malm, 1874 (species 3; GNM 15111). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure2" httpUri="https://binary.pensoft.net/fig/775018" pageId="0" pageNumber="85">Figs 2A, B</figureCitation>
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. STM photographs of several Terebellides species (A, C-F non-type specimens) A Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; ZMBN 116186) B Terebellides lavesquei sp. nov. (species 5; holotype, ZMBN 116322) C Terebellides atlantis Williams, 1984 (species 16; ZMBN 116472) D Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498) E Terebellides williamsae Jirkov, 1989 (species 2; ZMBN 116269) F Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure3" httpUri="https://binary.pensoft.net/fig/775019" pageId="0" pageNumber="85">, 3A</figureCitation>
<figureCitation captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Line drawings of several Terebellides species (A, C, D non-type specimens) A Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; ZMBN 116186), anterior end, right lateral view B Terebellides lavesquei sp. nov. (holotype; ZMBN 116322), anterior end, left lateral view C Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498), anterior end, ventral view D Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283), anterior end, right lateral view. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; tm - tentacular membrane." figureDoi="10.3897/zookeys.1132.91244.figure4" httpUri="https://binary.pensoft.net/fig/775020" pageId="0" pageNumber="85">, 4A</figureCitation>
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; non-type specimens, ZMBN 116181, ZMBN 116204 and ZMBN 116219), SEM micrographs A anterior end, dorsal view B anterior end, left lateral view C TC 6 (TU 1), geniculate chaeta D thoracic uncinus E abdominal neuropodium F abdominal uncini. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; cop - copepod; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; tll - thoracic lateral lobes; tm - tentacular membrane; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure5" httpUri="https://binary.pensoft.net/fig/775021" pageId="0" pageNumber="85">, 5</figureCitation>
<figureCitation captionStart="Figure 9" captionStartId="F9" captionText="Figure 9. Relationship between number of abdominal chaetigers and body length (complete specimens considered except for T. irinae)." figureDoi="10.3897/zookeys.1132.91244.figure9" httpUri="https://binary.pensoft.net/fig/775025" pageId="0" pageNumber="85">, 9</figureCitation>
<figureCitation captionStart="Figure 10" captionStartId="F10" captionText="Figure 10. Geographic distribution of species of Terebellides in Northeast Atlantic Ocean A Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 B Terebellides lavesquei sp. nov. C Terebellides atlantis Williams, 1984 D Terebellides irinae Gagaev, 2009 E Terebellides williamsae Jirkov, 1989 F Terebellides gracilis Malm, 1874. Pink star denotes the type locality of each taxon." figureDoi="10.3897/zookeys.1132.91244.figure10" httpUri="https://binary.pensoft.net/fig/775026" pageId="0" pageNumber="85">, 10A</figureCitation>
<figureCitation captionStart="Figure 11" captionStartId="F11" captionText="Figure 11. Bathymetric distribution of Terebellides species studied in this work." figureDoi="10.3897/zookeys.1132.91244.figure11" httpUri="https://binary.pensoft.net/fig/775027" pageId="0" pageNumber="85">, 11</figureCitation>
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Body MG staining patterns in ventral view of Terebellides species. Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016, Terebellides lavesquei sp. nov., Terebellides atlantis Williams, 1984, Terebellides irinae Gagaev, 2009, Terebellides williamsae Jirkov, 1989 and Terebellides gracilis Malm, 1874. Segments indicated in Arabic numbers." figureDoi="10.3897/zookeys.1132.91244.figure12" httpUri="https://binary.pensoft.net/fig/775028" pageId="0" pageNumber="85">, 12</figureCitation>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85" type="reference_group">
<paragraph pageId="0" pageNumber="85">
<taxonomicName authorityName="Parapar, Moreira &amp; O'Reilly" authorityYear="2016" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides shetlandica" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">Terebellides shetlandica</taxonomicName>
Parapar, Moreira &amp;
<normalizedToken originalValue="O’Reilly">O'Reilly</normalizedToken>
, 2016a: 211-225, figs 1-9, 11.
</paragraph>
<paragraph pageId="0" pageNumber="85">
<taxonomicName authorityName="Parapar, Moreira &amp; O'Reilly" authorityYear="2016" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides shetlandica" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">Terebellides shetlandica</taxonomicName>
Species 1 -
<bibRefCitation DOI="https://doi.org/10.1371/journal.pone.0198356" author="Nygren, A" journalOrPublisher="Molecular Phylogenetics and Evolution" pageId="0" pageNumber="85" refId="B26" refString="Nygren, A, Parapar, J, Pons, J, Meissner, K, Bakken, T, Kongsrud, JA, Oug, E, Gaeva, D, Sikorski, A, Johansen, RA, Hutchings, PA, Lavesque, N, Capa, M, 2018. A mega-cryptic species complex hidden among one of the most common annelids in the North-East Atlantic. PLoS ONE 13(6): e0198356. https://doi.org/10.1371/journal.pone.0198356" title="A mega-cryptic species complex hidden among one of the most common annelids in the North-East Atlantic. PLoS ONE 13 (6): e 0198356." url="https://doi.org/10.1371/journal.pone.0198356" year="2018">Nygren et al. 2018</bibRefCitation>
: 18-22, figs 6, 10.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
<paragraph pageId="0" pageNumber="85">Material examined.</paragraph>
<paragraph pageId="0" pageNumber="85">
<materialsCitation accessionNumber="GNM14640" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" specimenCount="30">
<specimenCount type="generic">30 specimens</specimenCount>
(Suppl. material 1), Skagerrak (
<accessionNumber httpUri="http://www.ncbi.nlm.nih.gov/protein/GNM14640">GNM14640</accessionNumber>
); Swedish coast (ZMBN116171, ZMBN116181, ZMBN116185, ZMBN116186, ZMBN116187, ZMBN116188, ZMBN116191, ZMBN116192, ZMBN116193, ZMBN116196, ZMBN116198, ZMBN116200, ZMBN116201, ZMBN116202, ZMBN116203, ZMBN116204, ZMBN116206); Norwegian coast (ZMBN116207, ZMBN116208, ZMBN116214, ZMBN116216, ZMBN116219, ZMBN116220, ZMBN116221, ZMBN116226, ZMBN116227, ZMBN116228, ZMBN116235, ZMBN116242)
</materialsCitation>
.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
<paragraph pageId="0" pageNumber="85">GenBank accession numbers of material examined (COI).</paragraph>
<paragraph pageId="0" pageNumber="85">
<materialsCitation accessionNumber="MG024894, MG024895, MG024896, MG024897, MG024898, MG024899, MG024900, MG024901, MG024902, MG024903, MG024904, MG024905, MG024906, MG024907, MG024908, MG024909, MG024910, MG024911, MG024912, MG024913, MG024914, MG024915, MG024916, MG024917, MG024918, MG024919, MG024920, MG024921, MG024922, MG024923, MG024924, MG024925, MG024926, MG024927, MG024928, MG024929, MG024930, MG024931, MG024932, MG024933, MG024934, MG024935, MG024936, MG024937, MG024938, MG024939, MG024940, MG024941, MG024942, MG024943, MG024944, MG024945, MG024946, MG024947, MG024948, MG024949, MG024950, MG024951, MG024952, MG024953, MG024954, MG024955, MG024956" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" specimenCount="1">
<accessionNumber isEnumeration="true">MG024894, MG024895, MG024896, MG024897, MG024898, MG024899, MG024900, MG024901, MG024902, MG024903, MG024904, MG024905, MG024906, MG024907, MG024908, MG024909, MG024910, MG024911, MG024912, MG024913, MG024914, MG024915, MG024916, MG024917, MG024918, MG024919, MG024920, MG024921, MG024922, MG024923, MG024924, MG024925, MG024926, MG024927, MG024928, MG024929, MG024930, MG024931, MG024932, MG024933, MG024934, MG024935, MG024936, MG024937, MG024938, MG024939, MG024940, MG024941, MG024942, MG024943, MG024944, MG024945, MG024946, MG024947, MG024948, MG024949, MG024950, MG024951, MG024952, MG024953, MG024954, MG024955, MG024956</accessionNumber>
</materialsCitation>
.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
<paragraph pageId="0" pageNumber="85">Diagnostic features of studied material.</paragraph>
<paragraph pageId="0" pageNumber="85">
Complete individuals ranging from 5.0-16.0 mm in length (Fig.
<figureCitation captionStart="Figure 9" captionStartId="F9" captionText="Figure 9. Relationship between number of abdominal chaetigers and body length (complete specimens considered except for T. irinae)." figureDoi="10.3897/zookeys.1132.91244.figure9" httpUri="https://binary.pensoft.net/fig/775025" pageId="0" pageNumber="85">9</figureCitation>
). Branchial dorsal lobes lamellae provided with well-developed papillary projections and branchial ventral lobes provided with long filaments, ranging from 175.0-225.0
<normalizedToken originalValue="µm">µm</normalizedToken>
in length (Figs
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. STM photographs of live specimens of several Terebellides species (non-type specimens) A, B Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; A ZMBN 116171 B ZMBN 116181) C Terebellides lavesquei sp. nov. (species 5; GNM 15112) D, E Terebellides williamsae Jirkov, 1989 (species 2; D GNM 15108 E GNM 15109) F Terebellides gracilis Malm, 1874 (species 3; GNM 15111). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure2" httpUri="https://binary.pensoft.net/fig/775018" pageId="0" pageNumber="85">2A, B</figureCitation>
,
<figureCitation captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Line drawings of several Terebellides species (A, C, D non-type specimens) A Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; ZMBN 116186), anterior end, right lateral view B Terebellides lavesquei sp. nov. (holotype; ZMBN 116322), anterior end, left lateral view C Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498), anterior end, ventral view D Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283), anterior end, right lateral view. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; tm - tentacular membrane." figureDoi="10.3897/zookeys.1132.91244.figure4" httpUri="https://binary.pensoft.net/fig/775020" pageId="0" pageNumber="85">4A</figureCitation>
,
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; non-type specimens, ZMBN 116181, ZMBN 116204 and ZMBN 116219), SEM micrographs A anterior end, dorsal view B anterior end, left lateral view C TC 6 (TU 1), geniculate chaeta D thoracic uncinus E abdominal neuropodium F abdominal uncini. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; cop - copepod; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; tll - thoracic lateral lobes; tm - tentacular membrane; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure5" httpUri="https://binary.pensoft.net/fig/775021" pageId="0" pageNumber="85">5A, B</figureCitation>
). Between 22-26 lamellae on dorsal lobes (Fig.
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; non-type specimens, ZMBN 116181, ZMBN 116204 and ZMBN 116219), SEM micrographs A anterior end, dorsal view B anterior end, left lateral view C TC 6 (TU 1), geniculate chaeta D thoracic uncinus E abdominal neuropodium F abdominal uncini. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; cop - copepod; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; tll - thoracic lateral lobes; tm - tentacular membrane; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure5" httpUri="https://binary.pensoft.net/fig/775021" pageId="0" pageNumber="85">5A, B</figureCitation>
). Lateral lappets present on TC 1-4; dorsal projections of thoracic notopodia on TC 2 and TC 3 (Fig.
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; non-type specimens, ZMBN 116181, ZMBN 116204 and ZMBN 116219), SEM micrographs A anterior end, dorsal view B anterior end, left lateral view C TC 6 (TU 1), geniculate chaeta D thoracic uncinus E abdominal neuropodium F abdominal uncini. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; cop - copepod; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; tll - thoracic lateral lobes; tm - tentacular membrane; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure5" httpUri="https://binary.pensoft.net/fig/775021" pageId="0" pageNumber="85">5B</figureCitation>
). Geniculate chaetae in TC 5, acutely bent, with poorly marked capitium (Fig.
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; non-type specimens, ZMBN 116181, ZMBN 116204 and ZMBN 116219), SEM micrographs A anterior end, dorsal view B anterior end, left lateral view C TC 6 (TU 1), geniculate chaeta D thoracic uncinus E abdominal neuropodium F abdominal uncini. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; cop - copepod; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; tll - thoracic lateral lobes; tm - tentacular membrane; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure5" httpUri="https://binary.pensoft.net/fig/775021" pageId="0" pageNumber="85">5C</figureCitation>
). Ciliated papilla dorsal to thoracic notopodia not observed. From TC 7, neuropodia with one row of
<typeStatus>type</typeStatus>
4 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of small teeth, followed by several smaller teeth (Fig.
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; non-type specimens, ZMBN 116181, ZMBN 116204 and ZMBN 116219), SEM micrographs A anterior end, dorsal view B anterior end, left lateral view C TC 6 (TU 1), geniculate chaeta D thoracic uncinus E abdominal neuropodium F abdominal uncini. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; cop - copepod; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; tll - thoracic lateral lobes; tm - tentacular membrane; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure5" httpUri="https://binary.pensoft.net/fig/775021" pageId="0" pageNumber="85">5D</figureCitation>
). Abdomen with 25-34 pairs of neuropodia with
<typeStatus>type</typeStatus>
2 uncini (Fig.
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; non-type specimens, ZMBN 116181, ZMBN 116204 and ZMBN 116219), SEM micrographs A anterior end, dorsal view B anterior end, left lateral view C TC 6 (TU 1), geniculate chaeta D thoracic uncinus E abdominal neuropodium F abdominal uncini. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; cop - copepod; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; tll - thoracic lateral lobes; tm - tentacular membrane; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure5" httpUri="https://binary.pensoft.net/fig/775021" pageId="0" pageNumber="85">5E, F</figureCitation>
). Copepods attached to body surface in
<specimenCount type="generic">three specimens</specimenCount>
(Fig.
<figureCitation captionStart="Figure 5" captionStartId="F5" captionText="Figure 5. Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 (species 1; non-type specimens, ZMBN 116181, ZMBN 116204 and ZMBN 116219), SEM micrographs A anterior end, dorsal view B anterior end, left lateral view C TC 6 (TU 1), geniculate chaeta D thoracic uncinus E abdominal neuropodium F abdominal uncini. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; cop - copepod; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; tll - thoracic lateral lobes; tm - tentacular membrane; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure5" httpUri="https://binary.pensoft.net/fig/775021" pageId="0" pageNumber="85">5B</figureCitation>
).
</paragraph>
<caption doi="10.3897/zookeys.1132.91244.figure9" httpUri="https://binary.pensoft.net/fig/775025" pageId="0" pageNumber="85" start="Figure 9" startId="F9">
<paragraph pageId="0" pageNumber="85">
<emphasis bold="true" pageId="0" pageNumber="85">Figure 9.</emphasis>
Relationship between number of abdominal chaetigers and body length (complete specimens considered except for
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. irinae" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">
<emphasis italics="true" pageId="0" pageNumber="85">T. irinae</emphasis>
</taxonomicName>
).
</paragraph>
</caption>
</subSubSection>
<subSubSection pageId="0" pageNumber="85" type="colour pattern">
<paragraph pageId="0" pageNumber="85">Colour pattern.</paragraph>
<paragraph pageId="0" pageNumber="85">
MG staining pattern characterised by compact green colourant in SG 1-6, then turning into striped pattern in SG 7-14 and fading in following segments (Fig.
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Body MG staining patterns in ventral view of Terebellides species. Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016, Terebellides lavesquei sp. nov., Terebellides atlantis Williams, 1984, Terebellides irinae Gagaev, 2009, Terebellides williamsae Jirkov, 1989 and Terebellides gracilis Malm, 1874. Segments indicated in Arabic numbers." figureDoi="10.3897/zookeys.1132.91244.figure12" httpUri="https://binary.pensoft.net/fig/775028" pageId="0" pageNumber="85">12</figureCitation>
). Similar to pattern 1.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85" type="nucleotide diagnostic features">
<paragraph pageId="0" pageNumber="85">Nucleotide diagnostic features.</paragraph>
<paragraph pageId="0" pageNumber="85">
All sequences of
<taxonomicName authorityName="Parapar, Moreira &amp; O'Reilly" authorityYear="2016" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides shetlandica" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides shetlandica</emphasis>
</taxonomicName>
share and are distinguished from other available
<taxonomicName class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="genus">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides</emphasis>
</taxonomicName>
sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 78-98: CCAACCCGGAGCCTATTTAGGT, 186-192: CGGAAAC, 210-219: GCTAGGCGCC, 228-234: GGCATTC, 264-276: TCTCCCGCCTGCC, 288- 292: CGTT, 306: C, 333-342: CGTCTACCCT, 351-369: AGACAATATGGCACACGCC, 381-402: AGATCTGGCTATTTTCTCCCTA, 453-459: AGTAATA, 511-522: TCAGCTATAATC, 535-558: TTACTTCTTTCTCTGCCAGTTCTG.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85" type="type locality">
<paragraph pageId="0" pageNumber="85">Type locality.</paragraph>
<paragraph pageId="0" pageNumber="85">
NW Hutton Oilfield, between Shetland Islands and Norway,
<geoCoordinate degrees="61" direction="north" minutes="10" orientation="latitude" precision="925" value="61.166668">61°10'N</geoCoordinate>
,
<geoCoordinate degrees="01" direction="east" minutes="12" orientation="longitude" precision="925" value="1.2">01°12'E</geoCoordinate>
(
<bibRefCitation DOI="https://doi.org/10.1007/s12526-015-0353-5" author="Parapar, J" journalOrPublisher="Marine Biodiversity" pageId="0" pageNumber="85" pagination="211 - 225" refId="B30" refString="Parapar, J, Moreira, J, O'Reilly, M, 2016a. A new species of Terebellides (Polychaeta: Trichobranchidae) from Scottish waters with an insight into branchial morphology. Marine Biodiversity 46 (1): 211 - 225, DOI: https://doi.org/10.1007/s12526-015-0353-5" title="A new species of Terebellides (Polychaeta: Trichobranchidae) from Scottish waters with an insight into branchial morphology." url="https://doi.org/10.1007/s12526-015-0353-5" volume="46" year="2016 a">Parapar et al. 2016a</bibRefCitation>
).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="85" type="distribution">
<paragraph pageId="0" pageNumber="85">Distribution and bathymetry.</paragraph>
<paragraph pageId="0" pageNumber="85">
Norwegian coast and shelf, North Sea, Skagerrak, Kattegat; 25-375 m deep; 92.7% of specimens present at depths below 200 m (Figs
<figureCitation captionStart="Figure 10" captionStartId="F10" captionText="Figure 10. Geographic distribution of species of Terebellides in Northeast Atlantic Ocean A Terebellides shetlandica Parapar, Moreira &amp; O'Reilly, 2016 B Terebellides lavesquei sp. nov. C Terebellides atlantis Williams, 1984 D Terebellides irinae Gagaev, 2009 E Terebellides williamsae Jirkov, 1989 F Terebellides gracilis Malm, 1874. Pink star denotes the type locality of each taxon." figureDoi="10.3897/zookeys.1132.91244.figure10" httpUri="https://binary.pensoft.net/fig/775026" pageId="0" pageNumber="85">10A</figureCitation>
,
<figureCitation captionStart="Figure 11" captionStartId="F11" captionText="Figure 11. Bathymetric distribution of Terebellides species studied in this work." figureDoi="10.3897/zookeys.1132.91244.figure11" httpUri="https://binary.pensoft.net/fig/775027" pageId="0" pageNumber="85">11</figureCitation>
, Suppl. material 1).
</paragraph>
<caption doi="10.3897/zookeys.1132.91244.figure10" httpUri="https://binary.pensoft.net/fig/775026" pageId="0" pageNumber="85" start="Figure 10" startId="F10">
<paragraph pageId="0" pageNumber="85">
<emphasis bold="true" pageId="0" pageNumber="85">Figure 10.</emphasis>
Geographic distribution of species of
<taxonomicName class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="genus">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides</emphasis>
</taxonomicName>
in Northeast Atlantic Ocean
<emphasis bold="true" pageId="0" pageNumber="85">A</emphasis>
<taxonomicName authorityName="Parapar, Moreira &amp; O'Reilly" authorityYear="2016" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides shetlandica" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides shetlandica</emphasis>
</taxonomicName>
Parapar, Moreira &amp;
<normalizedToken originalValue="O’Reilly">O'Reilly</normalizedToken>
, 2016
<emphasis bold="true" pageId="0" pageNumber="85">B</emphasis>
<taxonomicName authorityName="Barroso &amp; Moreira &amp; Capa &amp; Nygren &amp; Parapar" authorityYear="2022" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides lavesquei" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides lavesquei</emphasis>
</taxonomicName>
sp. nov.
<emphasis bold="true" pageId="0" pageNumber="85">C</emphasis>
<taxonomicName authorityName="Williams" authorityYear="1984" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides atlantis" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides atlantis</emphasis>
</taxonomicName>
Williams, 1984
<emphasis bold="true" pageId="0" pageNumber="85">D</emphasis>
<taxonomicName authorityName="Gagaev" authorityYear="2009" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides irinae" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides irinae</emphasis>
</taxonomicName>
Gagaev, 2009
<emphasis bold="true" pageId="0" pageNumber="85">E</emphasis>
<taxonomicName authorityName="Jirkov" authorityYear="1989" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides williamsae" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="williamsae">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides williamsae</emphasis>
</taxonomicName>
Jirkov, 1989
<emphasis bold="true" pageId="0" pageNumber="85">F</emphasis>
<taxonomicName authorityName="Malm" authorityYear="1874" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides gracilis" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="gracilis">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides gracilis</emphasis>
</taxonomicName>
Malm, 1874. Pink star denotes the type locality of each taxon.
</paragraph>
</caption>
<caption doi="10.3897/zookeys.1132.91244.figure11" httpUri="https://binary.pensoft.net/fig/775027" pageId="0" pageNumber="85" start="Figure 11" startId="F11">
<paragraph pageId="0" pageNumber="85">
<emphasis bold="true" pageId="0" pageNumber="85">Figure 11.</emphasis>
Bathymetric distribution of
<taxonomicName class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="genus">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides</emphasis>
</taxonomicName>
species studied in this work.
</paragraph>
</caption>
<caption doi="10.3897/zookeys.1132.91244.figure12" httpUri="https://binary.pensoft.net/fig/775028" pageId="0" pageNumber="85" start="Figure 12" startId="F12">
<paragraph pageId="0" pageNumber="85">
<emphasis bold="true" pageId="0" pageNumber="85">Figure 12.</emphasis>
Body MG staining patterns in ventral view of
<taxonomicName class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="genus">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides</emphasis>
</taxonomicName>
species.
<taxonomicName authorityName="Parapar, Moreira &amp; O'Reilly" authorityYear="2016" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides shetlandica" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides shetlandica</emphasis>
</taxonomicName>
Parapar, Moreira &amp;
<normalizedToken originalValue="O’Reilly">O'Reilly</normalizedToken>
, 2016,
<taxonomicName authorityName="Barroso &amp; Moreira &amp; Capa &amp; Nygren &amp; Parapar" authorityYear="2022" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides lavesquei" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides lavesquei</emphasis>
</taxonomicName>
sp. nov.,
<taxonomicName authorityName="Williams" authorityYear="1984" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides atlantis" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides atlantis</emphasis>
</taxonomicName>
Williams, 1984,
<taxonomicName authorityName="Gagaev" authorityYear="2009" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides irinae" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides irinae</emphasis>
</taxonomicName>
Gagaev, 2009,
<taxonomicName authorityName="Jirkov" authorityYear="1989" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides williamsae" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="williamsae">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides williamsae</emphasis>
</taxonomicName>
Jirkov, 1989 and
<taxonomicName authorityName="Malm" authorityYear="1874" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides gracilis" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="gracilis">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides gracilis</emphasis>
</taxonomicName>
Malm, 1874. Segments indicated in Arabic numbers.
</paragraph>
</caption>
</subSubSection>
<subSubSection pageId="0" pageNumber="85" type="remarks">
<paragraph pageId="0" pageNumber="85">Remarks.</paragraph>
<paragraph pageId="0" pageNumber="85">
<taxonomicName authorityName="Parapar, Moreira &amp; O'Reilly" authorityYear="2016" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides shetlandica" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides shetlandica</emphasis>
</taxonomicName>
is a small species, reaching up to 16 mm length and is characterised by having branchiae of type 3 and long filaments in ventral branchial lobes, thoracic uncini of type 4, abdominal uncini of type 2 and lacking papillae on margins of branchial lamellae (Table
<tableCitation captionStart="Table 1" captionStartId="T1" captionText="Table 1. Comparison of discriminating taxonomic characters of the species studied in this work. Cells in italics show discriminatory characters of each subgroup. (1) sensu Parapar et al. (2016 a); (2) sensu Parapar et al. (2020 b); (3) sensu Parapar et al. (2020 a); (4) dominant trend in bold; (5) Skagerrak." httpUri="http://table.plazi.org/id/D35598DC856676ACF7BB2895D92EA844" pageId="0" pageNumber="85" tableUuid="D35598DC856676ACF7BB2895D92EA844">1</tableCitation>
).
<bibRefCitation DOI="https://doi.org/10.1007/s12526-015-0353-5" author="Parapar, J" journalOrPublisher="Marine Biodiversity" pageId="0" pageNumber="85" pagination="211 - 225" refId="B30" refString="Parapar, J, Moreira, J, O'Reilly, M, 2016a. A new species of Terebellides (Polychaeta: Trichobranchidae) from Scottish waters with an insight into branchial morphology. Marine Biodiversity 46 (1): 211 - 225, DOI: https://doi.org/10.1007/s12526-015-0353-5" title="A new species of Terebellides (Polychaeta: Trichobranchidae) from Scottish waters with an insight into branchial morphology." url="https://doi.org/10.1007/s12526-015-0353-5" volume="46" year="2016 a">Parapar et al. (2016a)</bibRefCitation>
pointed out that
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. atlantis" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
<emphasis italics="true" pageId="0" pageNumber="85">T. atlantis</emphasis>
</taxonomicName>
is the most similar species to
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. shetlandica" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
<emphasis italics="true" pageId="0" pageNumber="85">T. shetlandica</emphasis>
</taxonomicName>
; this is confirmed here according to molecular analyses and morphological examination. Both species are small sized (length:
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. shetlandica" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
<emphasis italics="true" pageId="0" pageNumber="85">T. shetlandica</emphasis>
</taxonomicName>
, 5-16 mm;
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. atlantis" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
<emphasis italics="true" pageId="0" pageNumber="85">T. atlantis</emphasis>
</taxonomicName>
, 10-16 mm) and have branchiae of type 3, with free branchial lobes. However, the branchiae of
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. shetlandica" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
<emphasis italics="true" pageId="0" pageNumber="85">T. shetlandica</emphasis>
</taxonomicName>
have a high number (22-26) of tightly packed branchial lamellae, all lobes are similar in shape and length and ventral ones bear long filaments whereas
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. atlantis" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
<emphasis italics="true" pageId="0" pageNumber="85">T. atlantis</emphasis>
</taxonomicName>
has a fewer number of branchiae (10-11), lamellae are not packed, lobes differ in shape and size and ventral lobes bear shorter filaments. Furthermore, the range of abdominal chaetigers number is higher in
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. shetlandica" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
<emphasis italics="true" pageId="0" pageNumber="85">T. shetlandica</emphasis>
</taxonomicName>
than in
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. atlantis" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
<emphasis italics="true" pageId="0" pageNumber="85">T. atlantis</emphasis>
</taxonomicName>
(25-34 vs. 23-28 respectively).
</paragraph>
</subSubSection>
</treatment>
</document>
Reference in a new issue View git blame Copy permalink