199 lines
18 KiB
XML
199 lines
18 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/BDJ.5.e11760" ID-PMC="PMC5345105" ID-Pensoft-Pub="1314-2828-5-11760" ID-PubMed="28325987" ModsDocAuthor="" ModsDocDate="2017" ModsDocID="1314-2828-5-e11760" ModsDocOrigin="Biodiversity Data Journal 5" ModsDocTitle="New and poorly known Palaearctic fungus gnats (Diptera, Sciaroidea)" checkinTime="1488797779419" checkinUser="pensoft" docAuthor="Salmela, Jukka & Kolcsar, Levente-Peter" docDate="2017" docId="FF75393229C47F6454E44584E18BE295" docLanguage="en" docName="BiodivDatJour 5: e11760" docOrigin="Biodiversity Data Journal 5" docSource="http://dx.doi.org/10.3897/BDJ.5.e11760" docTitle="Phronia reducta Salmela, sp. n." docType="treatment" docVersion="2" lastPageNumber="11760" masterDocId="FFC2737DFF98C73BFFA3FFCCFFF3FFE7" masterDocTitle="New and poorly known Palaearctic fungus gnats (Diptera, Sciaroidea)" masterLastPageNumber="11760" masterPageNumber="11760" pageNumber="11760" updateTime="1668124062406" updateUser="ExternalLinkService">
|
|
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
|
<mods:titleInfo>
|
|
<mods:title>New and poorly known Palaearctic fungus gnats (Diptera, Sciaroidea)</mods:title>
|
|
</mods:titleInfo>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Salmela, Jukka</mods:namePart>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Kolcsar, Levente-Peter</mods:namePart>
|
|
</mods:name>
|
|
<mods:typeOfResource>text</mods:typeOfResource>
|
|
<mods:relatedItem type="host">
|
|
<mods:titleInfo>
|
|
<mods:title>Biodiversity Data Journal</mods:title>
|
|
</mods:titleInfo>
|
|
<mods:part>
|
|
<mods:date>2017</mods:date>
|
|
<mods:detail type="volume">
|
|
<mods:number>5</mods:number>
|
|
</mods:detail>
|
|
<mods:extent unit="page">
|
|
<mods:start>11760</mods:start>
|
|
<mods:end>11760</mods:end>
|
|
</mods:extent>
|
|
</mods:part>
|
|
</mods:relatedItem>
|
|
<mods:location>
|
|
<mods:url>http://dx.doi.org/10.3897/BDJ.5.e11760</mods:url>
|
|
</mods:location>
|
|
<mods:classification>journal article</mods:classification>
|
|
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.5.e11760</mods:identifier>
|
|
<mods:identifier type="Pensoft-Pub">1314-2828-5-11760</mods:identifier>
|
|
</mods:mods>
|
|
<treatment LSID="urn:lsid:plazi:treatment:FF75393229C47F6454E44584E18BE295" httpUri="http://treatment.plazi.org/id/FF75393229C47F6454E44584E18BE295" lastPageNumber="11760" pageId="0" pageNumber="11760">
|
|
<subSubSection pageId="0" pageNumber="11760" type="nomenclature">
|
|
<paragraph pageId="0" pageNumber="11760">
|
|
<taxonomicName LSID="urn:lsid:zoobank.org:act:082AAF64-6B68-438B-991A-9C42736838A3" authority="Salmela" class="Insecta" family="Mycetophilidae" genus="Phronia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Phronia reducta" order="Diptera" pageId="0" pageNumber="11760" phylum="Arthropoda" rank="species" species="reducta">Phronia reducta Salmela</taxonomicName>
|
|
<taxonomicNameLabel pageId="0" pageNumber="11760">sp. n.</taxonomicNameLabel>
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="11760" type="materials_examined">
|
|
<paragraph pageId="0" pageNumber="11760">Materials</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">
|
|
<materialsCitation collectingDate="2013-07-19" collectingMethod="Malaise trap" collectionCode="ZMUT" collectorName="J. Salmela" country="Finland" location="Finland" pageId="0" pageNumber="11760" specimenCode="DIPT-JS- 2015 - 0272" specimenCount="1" specimenCount-male="1" typeStatus="Holotype">
|
|
Type status:
|
|
<typeStatus pageId="0" pageNumber="11760">Holotype</typeStatus>
|
|
. Occurrence: catalogNumber:
|
|
<specimenCode pageId="0" pageNumber="11760">DIPT-JS-2015-0272</specimenCode>
|
|
; recordedBy:
|
|
<collectorName pageId="0" pageNumber="11760">J. Salmela</collectorName>
|
|
; individualCount:
|
|
<specimenCount pageId="0" pageNumber="11760">1</specimenCount>
|
|
; sex:
|
|
<specimenType pageId="0" pageNumber="11760">male</specimenType>
|
|
; Location: country:
|
|
<collectingCountry pageId="0" pageNumber="11760">Finland</collectingCountry>
|
|
; stateProvince: Regio kuusamoensis; verbatimLocality: Salla, Iso
|
|
<normalizedToken originalValue="Pyhätunturi">Pyhaetunturi</normalizedToken>
|
|
; verbatimLatitude: 66.776; verbatimLongitude: 28.810; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy:
|
|
<determinerName pageId="0" pageNumber="11760">J. Salmela</determinerName>
|
|
; Event: samplingProtocol:
|
|
<collectingMethod pageId="0" pageNumber="11760">Malaise trap</collectingMethod>
|
|
; eventDate:
|
|
<collectingDate value="2013-07-19">2013-7-19</collectingDate>
|
|
/8-8; habitat: poor - intermediate rich sloping fen; Record Level: institutionCode:
|
|
<collectionCode pageId="0" pageNumber="11760">ZMUT</collectionCode>
|
|
</materialsCitation>
|
|
<materialsCitation collectingDate="1972-07-26" collectingMethod="sweep net" collectionCode="TSU" collectorName="G. P. Ostroverkhova" country="Russia" location="Russia" pageId="0" pageNumber="11760" specimenCode="1386 (3)" specimenCount="1" specimenCount-male="1" typeStatus="Paratype">
|
|
Type status:
|
|
<typeStatus pageId="0" pageNumber="11760">Paratype</typeStatus>
|
|
. Occurrence: catalogNumber:
|
|
<specimenCode pageId="0" pageNumber="11760">1386 (3)</specimenCode>
|
|
; recordedBy:
|
|
<collectorName pageId="0" pageNumber="11760">G.P. Ostroverkhova</collectorName>
|
|
; individualCount:
|
|
<specimenCount pageId="0" pageNumber="11760">1</specimenCount>
|
|
; sex:
|
|
<specimenType pageId="0" pageNumber="11760">male</specimenType>
|
|
; preparations: slide mounted; Location: country:
|
|
<collectingCountry pageId="0" pageNumber="11760">Russia</collectingCountry>
|
|
; stateProvince: Krasnoyarsk region; verbatimLocality: Tungussko-Chunsky District, village Vanavary; verbatimLatitude: 60.33; verbatimLongitude: 102.30; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Identification: identifiedBy:
|
|
<determinerName pageId="0" pageNumber="11760">J. Salmela</determinerName>
|
|
; Event: samplingProtocol:
|
|
<collectingMethod pageId="0" pageNumber="11760">sweep net</collectingMethod>
|
|
; eventDate:
|
|
<collectingDate pageId="0" pageNumber="11760" value="1972-07-26">1972-7-26</collectingDate>
|
|
; habitat: swampy forest; Record Level: institutionCode:
|
|
<collectionCode pageId="0" pageNumber="11760">TSU</collectionCode>
|
|
</materialsCitation>
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="11760" type="description">
|
|
<paragraph pageId="0" pageNumber="11760">Description</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">Male. Head dark-brown, vertex covered by pale setae, frons glabrous. Ocelli in a line, central ocellus slightly smaller than laterals; lateral ocelli close to eyes, their distance from eye less than their own width. Eyes pubescent. Palpi brown, bearing light setae. Length ratio of palpal segments 3-5: 3:4=0.83, 4:5=0.69. Penultimate segment 3.6 times as long as wide, last segment 5.3 times as long as wide. Third palpomere with a sensory pit in its base. Antennae brown, 16-segmented (scape, pedicel and 14 flagellomeres), base of pedicel and base of first flagellomere yellowish brown. Scape:pedicel length ratio 1.60. Flagellomeres cylindrical, length:width ratio of 1st flagellomere 2.86, 4th flagellomere 1.75 and apical flagellomere 3.0. Flagellomeres covered by dense light setosity, setae slightly curved, their length shorter than width of respective flagellomere.</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">Thorax generally dark-brown, except scutum that has yellowish anterior corners. Scutum with mainly pale setosity. Mediotergite bare, other sclerites bearing setae. Scutellum with four stout setae. Halteres pale, bearing weak light setae and setulae.</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">Wings hyaline, veins brown. Bases of M1 and M2, M1+2, base of r-m, bM1+2, base of Rs and Sc bare, other veins setose. C exceeds tip of R5 very slightly. Sc ending free. Length ratio of M1+2:r-m = 1.18. Wing length 3.1 mm.</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">Coxae yellow, bearing pale setae, legs yellowish, except femora ventrobasally and apices of hind femora infuscated. Length ratio of femur to tibia for fore, mid and hind legs: 0.95, 0.99, 0.82. Length ratio of tibia to basitarsus for fore, mid and hind legs: 1.03, 1.34, 1.60. Anteroapical depressed area of the fore tibia ovate, having ca. 19 light setae arranged in a slightly curved row. Ratio of apical width of tibia:length of longest tibial spur for fore, mid and hind legs: 0.39, 0.27, 0.24.</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">Abdominal tergites and sternites brown, bearing light setae. 9th tergite and cerci normal for the genus (Fig. 11a). Ventroapical margin of gonocoxites with a median notch (Fig. 11c). Gonostylus is intricate. Dorsal lobe of gonostylus lingulate, with numerous long setae on ventral margin (Fig. 11d, e). Mesial portion with a plate-like, inward projecting rows of combs (1) (Fig. 11d, e). Internal outgrowth of the ventral lobe of gonostylus is curved and apically notched (2) (Fig. 11e). The basal projection of the ventral lobe of gonostylus is relatively narrow and club-like (3) (Fig. 11d); median projection is the largest, bearing long basal setae and short subapical setae (4) (Fig. 11d, e). Aedeagus short and wide, parameres long, having no long apical setae, only small setulae are present (Fig. 11b, f).</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="11760" type="diagnosis">
|
|
<paragraph pageId="0" pageNumber="11760">Diagnosis</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">
|
|
The new species is close of
|
|
<taxonomicName lsidName="P. braueri" pageId="0" pageNumber="11760" rank="species" species="braueri">P. braueri</taxonomicName>
|
|
Dziedzicki but differs in the following features; the apices of the parameres are non-setose (the setae here are long in
|
|
<taxonomicName lsidName="P. braueri" pageId="0" pageNumber="11760" rank="species" species="braueri">P. braueri</taxonomicName>
|
|
), the internal outgrowth of the ventral lobe of the gonostylus is curved and apically notched (not curved or notched in
|
|
<taxonomicName lsidName="P. braueri" pageId="0" pageNumber="11760" rank="species" species="braueri">P. braueri</taxonomicName>
|
|
), and the ventral lobe of the gonostylus also has a narrow club-like basal projection (wedge-shaped and widest basally in
|
|
<taxonomicName lsidName="P. braueri" pageId="0" pageNumber="11760" rank="species" species="braueri">P. braueri</taxonomicName>
|
|
).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="11760" type="etymology">
|
|
<paragraph pageId="0" pageNumber="11760">Etymology</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">
|
|
The name of the new species (Latin
|
|
<taxonomicName class="Insecta" family="Mycetophilidae" genus="Sciaroidea" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Sciaroidea reducta" order="Diptera" pageId="0" pageNumber="11760" phylum="Arthropoda" rank="species" species="reducta">reducta</taxonomicName>
|
|
, reduced, an adjective) is referring to the non-setose apices of the male parameres.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="11760" type="distribution">
|
|
<paragraph pageId="0" pageNumber="11760">Distribution</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">Apparently a boreal species, hitherto known from NE Finnish Lapland and Siberia, Central Russia (Fig. 3).</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="11760" type="ecology">
|
|
<paragraph pageId="0" pageNumber="11760">Ecology</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">The species occurs in sloping fens and swampy forests. The Finnish collecting site (sloping fen) was close to a pine and spruce dominated pristine boreal forest.</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="11760" type="taxon discussion">
|
|
<paragraph pageId="0" pageNumber="11760">Taxon discussion</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">
|
|
The new species was illustrated for the first time by
|
|
<bibRefCitation author="Ostroverkhova, G. P." journalOrPublisher="Izdatel'stvo Tomskogo Universiteta, Tomsk" pageId="0" pageNumber="11760" title="Fungus-gnats (Diptera, Mycetophiloidea) of Siberia" year="1979">Ostroverkhova 1979</bibRefCitation>
|
|
(the original illustration is reproduced here, Fig. 12), as
|
|
<taxonomicName lsidName="P. annulata" pageId="0" pageNumber="11760" rank="species" species="annulata">P. annulata</taxonomicName>
|
|
, (=
|
|
<taxonomicName lsidName="P. braueri" pageId="0" pageNumber="11760" rank="species" species="braueri">P. braueri</taxonomicName>
|
|
). These two taxa are indeed closely related, but due to differences in the male hypopygia and DNA barcodes are considered as distinct species (see Diagnosis for details; comparative photos of
|
|
<taxonomicName lsidName="P. braueri" pageId="0" pageNumber="11760" rank="species" species="braueri">P. braueri</taxonomicName>
|
|
are provided in Fig. 13). There are a total of 10 slide-mounted "
|
|
<taxonomicName class="Insecta" family="Mycetophilidae" genus="Phronia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Phronia braueri" order="Diptera" pageId="0" pageNumber="11760" phylum="Arthropoda" rank="species" species="braueri">Phronia braueri</taxonomicName>
|
|
" in TSU that were studied by Ostroverkhova, all of them collected from two close-lying localities, between dates 19.-29.7.1972. Unfortunately these slides are in poor condition making it difficult to identify them to species level; however the slide in the best condition was selected as the paratype.
|
|
</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">
|
|
There are two questionable older names of
|
|
<taxonomicName lsidName="P. braueri" pageId="0" pageNumber="11760" rank="species" species="braueri">P. braueri</taxonomicName>
|
|
, namely
|
|
<taxonomicName lsidName="P. annulata" pageId="0" pageNumber="11760" rank="species" species="annulata">P. annulata</taxonomicName>
|
|
Winnertz and
|
|
<taxonomicName lsidName="P. vittata" pageId="0" pageNumber="11760" rank="species" species="vittata">P. vittata</taxonomicName>
|
|
Winnertz (
|
|
<bibRefCitation author="Winnertz, J." journalOrPublisher="Verh. Zool. - Bot. Ges. Wien" pageId="0" pageNumber="11760" pagination="637 - 964" title="Beitrag zu einer Monographie der Pilzmuecken" volume="13" year="1863">Winnertz 1863</bibRefCitation>
|
|
,
|
|
<bibRefCitation author="Hackman, W." editor="Soos, A." journalOrPublisher="Akademiai Kiado, Budapest" pageId="0" pageNumber="11760" title="Catalogue of Palaearctic Diptera. Volume 3. Ceratopogonidae - Mycetophilidae" year="1988">Hackman et al. 1988</bibRefCitation>
|
|
), both are considered here as nomina dubia. These species are known from holotype females only and females of
|
|
<taxonomicName lsidName="P. braueri" pageId="0" pageNumber="11760" rank="species" species="braueri">P. braueri</taxonomicName>
|
|
are difficult to separate from
|
|
<taxonomicName lsidName="P. forcipata" pageId="0" pageNumber="11760" rank="species" species="forcipata">P. forcipata</taxonomicName>
|
|
Winnertz (
|
|
<bibRefCitation author="Hackman, W." journalOrPublisher="Notulae entomologicae" pageId="0" pageNumber="11760" pagination="41 - 60" title="New species of the genus Phronia Winnertz (Diptera, Mycetophilidae) from Eastern Fennoscandia and notes on the synonymies in this genus" volume="50" year="1970">Hackman 1970</bibRefCitation>
|
|
). It is also likely that the type specimens were destroyed during WWII (
|
|
<bibRefCitation author="Kurina, O." journalOrPublisher="Entomologica Fennica" pageId="0" pageNumber="11760" pagination="193 - 197" title="Redescription of Sciophila nitens Winnertz (Diptera: Mycetophilidae) with a new synonymization" volume="15" year="2004">Kurina 2004</bibRefCitation>
|
|
, citing
|
|
<bibRefCitation author="Evenhuis, N." journalOrPublisher="Backhuys Publishers, Leiden" pageId="0" pageNumber="11760" title="Literatura Taxonomica Dipterorum (1758 - 1930)" year="1997">Evenhuis 1997</bibRefCitation>
|
|
). Furthermore, most likely the type specimens of both
|
|
<taxonomicName lsidName="P. annulata" pageId="0" pageNumber="11760" rank="species" species="annulata">P. annulata</taxonomicName>
|
|
and
|
|
<taxonomicName lsidName="P. vittata" pageId="0" pageNumber="11760" rank="species" species="vittata">P. vittata</taxonomicName>
|
|
were collected from Krefeld, Germany, that is a nemoral lowland area. We consider
|
|
<taxonomicName lsidName="P. reducta" pageId="0" pageNumber="11760" rank="species" species="reducta">P. reducta</taxonomicName>
|
|
sp.n. having a boreal range, being absent from Central Europe. Thus, we find it very unlikely that these nomina dubia would be conspecific with the new species.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="11760" type="dna barcoding">
|
|
<paragraph pageId="0" pageNumber="11760">DNA barcoding</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">Holotype male: BOLD Sample ID: DIPT-JS-2015-0272. BOLD Process ID: SCFI741-16. GenBank accession number: KY062992.</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">AATTTTATATTTTATTTTTGGAGCTTGATCTGGAATAGTGGGAACTTCTCTTAGAATTATTATTCGGACTGAATTAGGACATCCAGGAGCATTAATTGGTAATGACCAAATTTATAATGTTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCACTAATACTAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGATTTTGGTTATTACCTCCTTCTCTTACATTATTACTTTCTAGAAGTTTAGTAGAAGCAGGGGCTGGAACTGGTTGAACAGTTTACCCTCCCCTTTCTTCAACTATTGCTCATGCTGGCGCATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGGGCAGTTAATTTTATTACTACCATTATTAATATACGAGCTCCTGGAATCACTTTTGATCGTTTACCTTTATTTGTTTGATCTGTTCTTATTACAGCAGTATTACTATTATTATCTTTACCCGTATTAGCAGGAGCTATTACTATACTATTAACAGACCGAAATCTTAATACTTCATTTTTTGACCCTGCAGGGGGAGGAGATCCTATTTTATACCAACATTTATTT</paragraph>
|
|
<paragraph pageId="0" pageNumber="11760">
|
|
The holotype male is the only member of the BIN BOLD:ADD3565. This specimen has no very close matches in BOLD database. The closest matches are 44
|
|
<taxonomicName class="Insecta" family="Mycetophilidae" genus="Phronia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Phronia" order="Diptera" pageId="0" pageNumber="11760" phylum="Arthropoda" rank="genus">Phronia</taxonomicName>
|
|
specimens, whose similarities to the new species range between 96,74 - 96,01. One of these specimens is assigned to
|
|
<taxonomicName lsidName="P. braueri" pageId="0" pageNumber="11760" rank="species" species="braueri">P. braueri</taxonomicName>
|
|
, the sister species of
|
|
<taxonomicName lsidName="P. reducta" pageId="0" pageNumber="11760" rank="species" species="reducta">P. reducta</taxonomicName>
|
|
sp.n. That
|
|
<taxonomicName lsidName="P. braueri" pageId="0" pageNumber="11760" rank="species" species="braueri">P. braueri</taxonomicName>
|
|
specimen is collected from Norway and was identified by J. Kjaerandsen (unpublished record).
|
|
</paragraph>
|
|
</subSubSection>
|
|
</treatment>
|
|
</document> |