treatments-xml/data/22/D8/72/22D872A527DC9E116C14D27D1767D9DF.xml
2024-06-21 12:31:24 +02:00

223 lines
22 KiB
XML
Raw Blame History

This file contains ambiguous Unicode characters

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

<document ID-DOI="http://dx.doi.org/10.3897/BDJ.5.e11760" ID-PMC="PMC5345105" ID-Pensoft-Pub="1314-2828--11760" ID-PubMed="28325987" ModsDocAuthor="" ModsDocDate="2017" ModsDocID="1314-2828--e11760" ModsDocOrigin="Biodiversity Data Journal " ModsDocTitle="New and poorly known Palaearctic fungus gnats (Diptera, Sciaroidea)" checkinTime="1585357168357" checkinUser="pensoft" docAuthor="Salmela, Jukka &amp; Kolcsar, Levente-Peter" docDate="2017" docId="22D872A527DC9E116C14D27D1767D9DF" docLanguage="en" docName="BiodivDatJour 5: e11760" docOrigin="Biodiversity Data Journal 5" docSource="http://dx.doi.org/10.3897/BDJ.5.e11760" docTitle="Orfelia boreoalpina Salmela, sp. n." docType="treatment" docVersion="3" lastPageNumber="11760" masterDocId="FFAAFFE5FFD9FFAEFF9E1D3EFFCDEB40" masterDocTitle="New and poorly known Palaearctic fungus gnats (Diptera, Sciaroidea)" masterLastPageNumber="11760" masterPageNumber="11760" pageNumber="11760" updateTime="1668124059908" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>New and poorly known Palaearctic fungus gnats (Diptera, Sciaroidea)</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Salmela, Jukka</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Kolcsar, Levente-Peter</mods:namePart>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>Biodiversity Data Journal</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2017</mods:date>
<mods:detail type="volume">
<mods:number>5</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>11760</mods:start>
<mods:end>11760</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/BDJ.5.e11760</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.5.e11760</mods:identifier>
<mods:identifier type="Pensoft-Pub">1314-2828--11760</mods:identifier>
</mods:mods>
<treatment LSID="urn:lsid:plazi:treatment:22D872A527DC9E116C14D27D1767D9DF" httpUri="http://treatment.plazi.org/id/22D872A527DC9E116C14D27D1767D9DF" lastPageNumber="11760" pageId="0" pageNumber="11760">
<subSubSection pageId="0" pageNumber="11760" type="nomenclature">
<paragraph pageId="0" pageNumber="11760">
<taxonomicName LSID="urn:lsid:zoobank.org:act:B5A81F63-3F71-4A8F-B23B-ADF5CA4211D3" authority="Salmela" class="Insecta" family="Keroplatidae" genus="Orfelia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Orfelia boreoalpina" order="Diptera" pageId="0" pageNumber="11760" phylum="Arthropoda" rank="species" species="boreoalpina">Orfelia boreoalpina Salmela</taxonomicName>
<taxonomicNameLabel pageId="0" pageNumber="11760">sp. n.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="11760" type="materials_examined">
<paragraph pageId="0" pageNumber="11760">Materials</paragraph>
<paragraph pageId="0" pageNumber="11760">
<materialsCitation collectingDate="2014-07-08" collectionCode="ZMUT" collectorName="M. Maekilae" country="Finland" latitude="67.823" location="Toermaeoja Conservation Area" longitude="29.439" pageId="0" pageNumber="11760" specimenCode="DIPT-JS- 2014 - 0233" specimenCount="1" typeStatus="Holotype">
Type status:
<typeStatus pageId="0" pageNumber="11760">Holotype</typeStatus>
. Occurrence: catalogNumber:
<specimenCode pageId="0" pageNumber="11760">DIPT-JS-2014-0233</specimenCode>
; recordedBy:
<collectorName pageId="0" pageNumber="11760">
M.
<normalizedToken originalValue="Mäkilä">Maekilae</normalizedToken>
</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="11760">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="11760">M</specimenType>
; lifeStage:
<specimenType pageId="0" pageNumber="11760">adult</specimenType>
; Taxon: phylum: Arthropoda; class: Insecta; order: Diptera; Location: country:
<collectingCountry pageId="0" pageNumber="11760">Finland</collectingCountry>
; stateProvince: Lapponia kemensis pars orientalis; municipality: Savukoski; locality:
<location LSID="urn:lsid:plazi:treatment:22D872A527DC9E116C14D27D1767D9DF:4A706A18BB9E37367D5573467557A1CF" country="Finland" latitude="67.823" longitude="29.439" name="Toermaeoja Conservation Area" pageId="0" pageNumber="11760">
<normalizedToken originalValue="Törmäoja">Toermaeoja</normalizedToken>
Conservation Area
</location>
; decimalLatitude:
<geoCoordinate orientation="latitude" pageId="0" pageNumber="11760" value="67.823">67.823</geoCoordinate>
; decimalLongitude:
<geoCoordinate orientation="longitude" pageId="0" pageNumber="11760" value="29.439">29.439</geoCoordinate>
; Identification: identifiedBy:
<determinerName pageId="0" pageNumber="11760">Jukka E. Salmela</determinerName>
; Event: eventDate:
<collectingDate pageId="0" pageNumber="11760" value="2014-07-08">2014-08-07</collectingDate>
; Record Level: institutionCode:
<collectionCode pageId="0" pageNumber="11760">ZMUT</collectionCode>
</materialsCitation>
<materialsCitation collectingDate="2012-09-13" collectionCode="ZSM" collectorName="G. Sellmayer" country="Germany" latitude="48.9509" location="Nationalpark Bayerischer Wald, 11.3 km N of Grafenau" longitude="13.422" pageId="0" pageNumber="11760" specimenCode="BIOUG 08366 - D 12" specimenCount="1" specimenCount-female="1" typeStatus="Paratype">
Type status:
<typeStatus pageId="0" pageNumber="11760">Paratype</typeStatus>
. Occurrence: catalogNumber:
<specimenCode pageId="0" pageNumber="11760">BIOUG08366-D12</specimenCode>
; recordNumber: bayw.17; recordedBy:
<collectorName pageId="0" pageNumber="11760">G. Sellmayer</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="11760">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="11760">female</specimenType>
; Location: country:
<collectingCountry pageId="0" pageNumber="11760">Germany</collectingCountry>
; stateProvince: Bavaria; locality:
<location LSID="urn:lsid:plazi:treatment:22D872A527DC9E116C14D27D1767D9DF:773ED1A74F447D1728FE83D2B05D2707" country="Germany" latitude="48.9509" longitude="13.422" name="Nationalpark Bayerischer Wald, 11.3 km N of Grafenau" pageId="0" pageNumber="11760">Nationalpark Bayerischer Wald, 11.3 km N of Grafenau</location>
; decimalLatitude:
<geoCoordinate orientation="latitude" pageId="0" pageNumber="11760" value="48.9509">48.9509</geoCoordinate>
; decimalLongitude:
<geoCoordinate orientation="longitude" pageId="0" pageNumber="11760" value="13.422">13.422</geoCoordinate>
; Event: eventDate:
<collectingDate value="2012-09-13">2012-09-13</collectingDate>
/22; Record Level: institutionCode:
<collectionCode pageId="0" pageNumber="11760">ZSM</collectionCode>
</materialsCitation>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="11760" type="description">
<paragraph pageId="0" pageNumber="11760">Description</paragraph>
<paragraph pageId="0" pageNumber="11760">Male. Head bicolored, vertex with a triangular dark area, laterally yellowish brown (Fig. 1a, b, c). Three ocelli in shallow triangular arrangement, median ocellus smaller than laterals. Vertex covered by short black setae. Clypeus short, yellowish brown. Palpi pale, bearing both light and dark setae. Length ratio of palpal segments 3-5: 3:4=1.2, 4:5=0.67. Penultimate segment 2.25 times as long as wide, last segment 3.86 times as long as wide. Antennae dark brown, flagellomeres bearing dark sensilla that are shorter than width of respective flagellomere. First flagellomere widest apically, its length:width ratio 1.26 (width measured from the apex of the flagellomere). Other flagellomeres quadratic, slightly shorter than wide, except apical one that is elongated and bearing apical papilla; length:width ratios of fourth and last flagellomeres 0.9 and 1.91, respectively (Fig. 1b).</paragraph>
<paragraph pageId="0" pageNumber="11760">Scutum yellowish with three longitudinal brown stripes; median stripe consisting of two stripes that are largely merged, a narrow anterior gap between the stripes is present (Fig. 1b, c). Dark setae on scutum are present. Pleural sclerites of thorax light brown in colour, all bare except scutellum that has a dense row of setae along posterior margin. Halter light brown with dark setae.</paragraph>
<paragraph pageId="0" pageNumber="11760">
Wings yellowish, with a faint subapical dark band extending from C to M2. Veins dark brown except
<normalizedToken originalValue="bmcu">bm-cu</normalizedToken>
and bRs that are lighter. Veins R1 and bCuA with dorsal setae, R5 setose both ventrally and dorsally. Sc ending in C before bRs. R4 very short, about 0.12 times longer than apical portion of R5. Wing length 4.1 mm.
</paragraph>
<paragraph pageId="0" pageNumber="11760">Coxae yellowish brown - brown, bearing short dark setae, legs yellowish. Ratio of femur to tibia for fore, mid and hind legs: 0.79, 0.68, 0.63. Ratio of tibia to basitarsus for fore, mid and hind legs: 1.67, 1.0, 1.0. Anterior spur of mid-tarsus about 0.5 times longer than posterior spur.</paragraph>
<paragraph pageId="0" pageNumber="11760">Abdominal tergites and sternites brown, bearing dark setae. Hypopygium brown. 9th tergite widest medially, apex rounded. Gonocoxites dorsally with an outgrowth, bearing a few long apical setae and having a mesial protrusion (Fig. 2a). Cerci prominent, club-like, apically setose, extending to the level of apices of gonostyli (Fig. 2a). Ventral lobe of gonostylus curved, its apical half mostly bare (Fig. 2a, b). Dorsal lobe of gonostylus elongated, pointed in dorsal view, bearing two black subapical long setae (Fig. 2a, b). Aedeagus curved ventrad in lateral view, apex blunt and medially widest in dorsal view (Fig. 2a, b, d). Parameres rod-like, apically dentate (Fig. 2c).</paragraph>
<paragraph pageId="0" pageNumber="11760">Female.The paratype female is lacking all legs except right fore leg and right hind femur. The specimen is slightly paler than the holotype male. The specimen may be somewhat teneral or it has bleached in the Malaise trap or later in the ethanol. Otherwise the specimen is very similar to the holotype. Antennal flagellomeres, except first and last, are wider than long (length:width ratio of 4th segment is 0.78). Cerci short, apically truncated, gonocoxite 8 short and rounded. Wing length 3.9 mm.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="11760" type="diagnosis">
<paragraph pageId="0" pageNumber="11760">Diagnosis</paragraph>
<paragraph pageId="0" pageNumber="11760">
The new species is characterised by the short and dark antennae, a yellow scutum with contrasting scutellar stripes, brown pleural sclerites of the thorax, brown, unicolorous abdomen and a short R4 vein. The dorsal lobe of gonostylus is strongly curved. The ventral lobe of gonostylus has only two black apical setae, while
<taxonomicName lsidName="O. nigricornis" pageId="0" pageNumber="11760" rank="species" species="nigricornis">O. nigricornis</taxonomicName>
(Fabricius) and
<taxonomicName lsidName="O. subnigricornis" pageId="0" pageNumber="11760" rank="species" species="subnigricornis">O. subnigricornis</taxonomicName>
Zaitzev &amp; Menzel have a bunch of setae.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="11760" type="etymology">
<paragraph pageId="0" pageNumber="11760">Etymology</paragraph>
<paragraph pageId="0" pageNumber="11760">The name of the new species refers to its putative boreo-alpine, disjunct range in Europe. The name is a noun in apposition.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="11760" type="distribution">
<paragraph pageId="0" pageNumber="11760">Distribution</paragraph>
<paragraph pageId="0" pageNumber="11760">
The new species has been observed from eastern Finnish Lapland, the north boreal ecoregion, and from Germany, Bavaria (see
<bibRefCitation author="Geiger, Matthias" journalOrPublisher="Biodiversity Data Journal" pageId="0" pageNumber="11760" pagination=": e 10671" title="Testing the Global Malaise Trap Program - How well does the current barcode reference library identify flying insects in Germany?" volume="4" year="2016">Geiger et al. 2016</bibRefCitation>
). It is likely that
<taxonomicName lsidName="O. boreoalpina" pageId="0" pageNumber="11760" rank="species" species="boreoalpina">O. boreoalpina</taxonomicName>
sp.n. has a disjunct European range, having populations in the northern Fennoscandia and the Central European mountains (Fig. 3).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="11760" type="ecology">
<paragraph pageId="0" pageNumber="11760">Ecology</paragraph>
<paragraph pageId="0" pageNumber="11760">
The Finnish sampling site was a herb-rich meadow, harbouring vascular plants such as
<taxonomicName class="Magnoliopsida" family="Polygonaceae" genus="Bistorta" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Bistorta vivipara" order="Caryophyllales" pageId="0" pageNumber="11760" phylum="Tracheophyta" rank="species" species="vivipara">Bistorta vivipara</taxonomicName>
and
<taxonomicName class="Magnoliopsida" family="Ranunculaceae" genus="Trollius" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Trollius europaeus" order="Ranunculales" pageId="0" pageNumber="11760" phylum="Tracheophyta" rank="species" species="europaeus">Trollius europaeus</taxonomicName>
, and is probably flooded during snowmelt in spring. The meadow is surrounded by pine (
<taxonomicName class="Pinopsida" family="Pinaceae" genus="Pinus" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Pinus sylvestris" order="Pinales" pageId="0" pageNumber="11760" phylum="Tracheophyta" rank="species" species="sylvestris">Pinus sylvestris</taxonomicName>
) dominated boreal forest. Bavarian site is a conifer-dominated mountain forest (
<bibRefCitation author="Geiger, Matthias" journalOrPublisher="Biodiversity Data Journal" pageId="0" pageNumber="11760" pagination=": e 10671" title="Testing the Global Malaise Trap Program - How well does the current barcode reference library identify flying insects in Germany?" volume="4" year="2016">Geiger et al. 2016</bibRefCitation>
)
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="11760" type="taxon discussion">
<paragraph pageId="0" pageNumber="11760">Taxon discussion</paragraph>
<paragraph pageId="0" pageNumber="11760">
The new species is rather distant to all other Holarctic species, but it may be closest to
<taxonomicName lsidName="O. nigricornis" pageId="0" pageNumber="11760" rank="species" species="nigricornis">O. nigricornis</taxonomicName>
and
<taxonomicName lsidName="O. subnigricornis" pageId="0" pageNumber="11760" rank="species" species="subnigricornis">O. subnigricornis</taxonomicName>
(see below). If using the key provided by
<bibRefCitation author="Hutson, A. M." journalOrPublisher="Royal Entomological Society of London" pageId="0" pageNumber="11760" title="Mycetophilidae (Bolitophilinae, Ditiomyiinae, Diadocidiinae, Keroplatinae, Sciophilinae and Manotinae). Diptera, Nematocera. Handbooks for Identification of British Insects" year="1980">Hutson et al. 1980</bibRefCitation>
, (species known from Great Britain), the species should either have a largely black or orange thorax, including the pleura, but
<taxonomicName lsidName="O. boreoalpina" pageId="0" pageNumber="11760" rank="species" species="boreoalpina">O. boreoalpina</taxonomicName>
sp.n. has an orange scutum and brown pleura, thus dropping out already in the first couplet. In the key provided by
<bibRefCitation author="Zaitzev, A. I." journalOrPublisher="Nauka, Moscow" pageId="0" pageNumber="11760" title="Fungus gnats of the fauna of Russia and adjacent regions. Part 1" year="1994">Zaitzev 1994</bibRefCitation>
(Russian species), the new species keys in the first couplet (mesonotum yellow with broad longitudinal stripes). In the couplets 2-5 there are three options, and the new species comes closest to
<taxonomicName lsidName="O. nigricornis" pageId="0" pageNumber="11760" rank="species" species="nigricornis">O. nigricornis</taxonomicName>
, that has elongated palpal segments and one pointed outgrowth on the dorsal side of gonocoxites.
<taxonomicName class="Insecta" family="Keroplatidae" genus="Orfelia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Orfelia nigricornis" order="Diptera" pageId="0" pageNumber="11760" phylum="Arthropoda" rank="species" species="nigricornis">Orfelia nigricornis</taxonomicName>
, however, has a tuft of setae on the apex of dorsal lobe of the gonostylus while
<taxonomicName lsidName="O. boreoalpina" pageId="0" pageNumber="11760" rank="species" species="boreoalpina">O. boreoalpina</taxonomicName>
has only two dark setae. Other more or less similar species are 1)
<taxonomicName lsidName="O. subnigricornis" pageId="0" pageNumber="11760" rank="species" species="subnigricornis">O. subnigricornis</taxonomicName>
, that is characterized by the yellow scape and pedicel and median flagellomeres that are 1.4 times longer than wide (
<bibRefCitation author="Zaitzev, A. I." journalOrPublisher="Beitraege zur Entomologie" pageId="0" pageNumber="11760" pagination="159 - 167" title="New data on the fungus gnats from the Russian Far East (Diptera: Sciaroidea)" volume="46" year="1996">Zaitzev and Menzel 1996</bibRefCitation>
) (scape and pedicel dark and median flagellomeres about as long as wide in
<taxonomicName lsidName="O. boreoalpina" pageId="0" pageNumber="11760" rank="species" species="boreoalpina">O. boreoalpina</taxonomicName>
sp.n.; in addition dorsal lobe of the gonostylus in
<taxonomicName lsidName="O. subnigricornis" pageId="0" pageNumber="11760" rank="species" species="subnigricornis">O. subnigricornis</taxonomicName>
has a tuft of setae, only two setae are present in the new species), 2)
<taxonomicName lsidName="O. sachalinensis" pageId="0" pageNumber="11760" rank="species" species="sachalinensis">O. sachalinensis</taxonomicName>
(Matsumura) has a yellow abdomen and indistinct scutal stripes (see
<bibRefCitation author="Okada, I." journalOrPublisher="Insecta Matsumurana" pageId="0" pageNumber="11760" pagination="17 - 32" title="Beitrag zur Kenntnis der Ceroplatinen-Fauna Japans (Diptera, Fungivoridae)" volume="13" year="1938">Okada 1938</bibRefCitation>
, as
<taxonomicName class="Insecta" family="Keroplatidae" genus="Zelmira" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Zelmira sachalinensis" order="Diptera" pageId="0" pageNumber="11760" phylum="Arthropoda" rank="species" species="sachalinensis">Zelmira sachalinensis</taxonomicName>
) (
<taxonomicName lsidName="O. boreoalpina" pageId="0" pageNumber="11760" rank="species" species="boreoalpina">O. boreoalpina</taxonomicName>
sp.n. has a brown abdomen and strong scutal stripes) and 3)
<taxonomicName lsidName="O. minima" pageId="0" pageNumber="11760" rank="species" species="minima">O. minima</taxonomicName>
(Giglio-Tos) that has a yellowish scape, pedicel and a yellowish abdomen (
<bibRefCitation author="Giglio-Tos, E." journalOrPublisher="Bollettino dei Musei di Zoologia ed Anatomia Comparata della Regia Universita di Torino" pageId="0" pageNumber="11760" pagination="1 - 4" title="Nuove specie di Ditteri del Muzeo Zoologico di Torino" volume="5" year="1890">Giglio-Tos 1890</bibRefCitation>
) (all dark in
<taxonomicName lsidName="O. boreoalpina" pageId="0" pageNumber="11760" rank="species" species="boreoalpina">O. boreoalpina</taxonomicName>
sp.n.).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="11760" type="dna barcoding">
<paragraph pageId="0" pageNumber="11760">DNA barcoding</paragraph>
<paragraph pageId="0" pageNumber="11760">Holotype male: BOLD Sample ID: DIPT-JS-2014-0233. BOLD Process ID: SCFI064-15. GenBank accession number: KY062990.</paragraph>
<paragraph pageId="0" pageNumber="11760">AACATTATATTTTATTTTAGGGACATGGTCAGGAATACTAGGAACATCAATAAGAATTTTAATTCGAGCAGAATTAGGATATCCGGGAGCATTAATTGGAAACGACCAAATTTATAATGTTGTAGTCACAGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTACTATAATTGGAGGTTTCGGAAATTGATTAGTACCTTTAATATTAGGGGCCCCAGATATGGCTTTTCCTCGAATAAATAACATAAGATTTTGACTTCTCCCTCCTTCACTTTCTTTACTATTAATAAGAAGAATAGTAGAAAGTGGTTCTGGAACAGGATGAACTGTATATCCTCCCCTATCTTCTACTTTATCTCATTCTGGTAGATCAGTTGACTTAACTATTTTTTCTCTTCATTTAGCAGGAATTTCTTCAATTCTTGGGGCAGTCAATTTTATTACTACAATTATCAACATACGATCACCTGGGATAAACATAGACATAATACCTTTATTTGTATGATCAGTTTTTATTACAGCCATTCTTCTTCTTTTATCATTACCTGTACTAGCGGGAGCAATTACAATACTTTTAACAGATCGTAATTTAAATACATCATTTTTTGATCCAGCAGGTGGGGGTGACCCAATTCTATATCAACATTTATTT</paragraph>
<paragraph pageId="0" pageNumber="11760">
The DNA barcode of the paratype specimen is almost identical to the holotype, their similarity is 99.54 %. The type specimens belong to the same BIN (BOLD:ACJ7389) shared by no other members. The nearest specimens are rather distant: 97 closest sequences have similarity values between 88.25 and 86.35, being assigned to
<taxonomicName lsidName="O. nemoralis" pageId="0" pageNumber="11760" rank="species" species="nemoralis">O. nemoralis</taxonomicName>
(Meigen) (54 specimens),
<taxonomicName lsidName="O. nigricornis" pageId="0" pageNumber="11760" rank="species" species="nigricornis">O. nigricornis</taxonomicName>
(2),
<taxonomicName family="Keroplatidae" lsidName="" pageId="0" pageNumber="11760" rank="family">Keroplatidae</taxonomicName>
(40) and
<taxonomicName family="Mycetophilidae" lsidName="" pageId="0" pageNumber="11760" rank="family">Mycetophilidae</taxonomicName>
(1). DNA barcode and associated data of the paratype is available from the BOLD Public data portal.
</paragraph>
</subSubSection>
</treatment>
</document>