treatments-xml/data/03/B2/7A/03B27A7EFFD30061FF445FF1FEB4FE57.xml
2024-06-21 12:22:17 +02:00

729 lines
140 KiB
XML
Raw Blame History

This file contains ambiguous Unicode characters

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

<document id="205BF18237B7E0AF43E40037E25571B1" ID-CLB-Dataset="9022" ID-DOI="10.11646/zootaxa.4868.1.2" ID-GBIF-Dataset="a5c421db-9d17-4a25-9431-378a79f940bc" ID-ISSN="1175-5326" ID-Zenodo-Dep="4417203" ID-ZooBank="B869EB5E-073D-471D-A9F3-D390D57B25E6" IM.materialsCitations_approvedBy="felipe" IM.metadata_approvedBy="felipe" IM.taxonomicNames_approvedBy="felipe" checkinTime="1609804682391" checkinUser="plazi" docAuthor="Sankaran, Pradeep M. &amp; Sebastian, Pothalil A." docDate="2020" docId="03B27A7EFFD30061FF445FF1FEB4FE57" docLanguage="en" docName="zootaxa.4868.1.2.pdf" docOrigin="Zootaxa 4868 (1)" docStyle="DocumentStyle:647186512141C8FC8976D5BCC54AEB7D.9:Zootaxa.2013-.journal_article" docStyleId="647186512141C8FC8976D5BCC54AEB7D" docStyleName="Zootaxa.2013-.journal_article" docStyleVersion="9" docTitle="Carlogonus gayathri Sankaran &amp; Sebastian 2020, sp. nov." docType="treatment" docVersion="8" lastPageNumber="38" masterDocId="FF8B0206FFD0006AFFD35E5EFFBBFFA2" masterDocTitle="A new species of Carlogonus Demange, 1961 from southern India (Spirostreptida Harpagophoridae, Harpagophorinae), with phylogenetic analysis and speciesgroup divisions in the genus" masterLastPageNumber="40" masterPageNumber="27" pageNumber="30" updateTime="1698852323459" updateUser="ExternalLinkService" zenodo-license-document="CLOSED">
<mods:mods id="377560D09578BC453DCC4FCAC075F86E" xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo id="34B5E809423219E4C3CAEEE7945EFF64">
<mods:title id="BA057C955A1764D61AFD24BC762BF5A8">A new species of Carlogonus Demange, 1961 from southern India (Spirostreptida Harpagophoridae, Harpagophorinae), with phylogenetic analysis and speciesgroup divisions in the genus</mods:title>
</mods:titleInfo>
<mods:name id="A4510A1E5992CF42416B144186256E4D" type="personal">
<mods:role id="1E298687E4F324C02BA3D679785056D9">
<mods:roleTerm id="C47391E2A126621C32AACEABFA0107FD">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="A06E44F91ACACD822027413F2A770F06">Sankaran, Pradeep M.</mods:namePart>
<mods:affiliation id="19ABDF1D4A3EA2BE59E7E828C4B92AB7">Division of Arachnology, Department of Zoology, Sacred Heart College, Thevara, Cochin, Kerala 682 013, India.</mods:affiliation>
</mods:name>
<mods:name id="09A29A4BBC83874DE93AF9EA6620DA76" type="personal">
<mods:role id="CA110AD4CA0AE2567DB5DAB592630B11">
<mods:roleTerm id="6E4E16298DCEE4ED16647925B2FEE073">Author</mods:roleTerm>
</mods:role>
<mods:namePart id="5735BA7180498718AF7C2A8F554F5814">Sebastian, Pothalil A.</mods:namePart>
<mods:nameIdentifier id="F85E96F2B327FE782E01B50357CB8408" type="ORCID">0000-0002-4936-4310</mods:nameIdentifier>
<mods:affiliation id="F4C263A1ABCF3BACC61217588C0B6AE0">Division of Arachnology, Department of Zoology, Sacred Heart College, Thevara, Cochin, Kerala 682 013, India. &amp; drpothalil @ rediffmail. com; https: // orcid. org / 0000 - 0002 - 4936 - 4310</mods:affiliation>
<mods:nameIdentifier id="AFFF4C3BC41DCBB343B389F490B82CD2" type="email">drpothalil@rediffmail.com</mods:nameIdentifier>
</mods:name>
<mods:typeOfResource id="10D971CBC9DE12E3F14D25214B78EAD9">text</mods:typeOfResource>
<mods:relatedItem id="78B4AB7F4EFA374F524C9423786C10C2" type="host">
<mods:titleInfo id="E31BFE2DBD5038A58B7E3E5C39F10F51">
<mods:title id="B79827EECAB7A3D81E275A38709647F4">Zootaxa</mods:title>
</mods:titleInfo>
<mods:part id="17690BA35A9D092D8DEA6FADE88EE7BC">
<mods:date id="57DDBE613449DB72A4FAEA7E1715B37E">2020</mods:date>
<mods:detail id="E95C770435ABA7844D347EA137745364" type="pubDate">
<mods:number id="2276A670D43EA35A60174B6814B6804A">2020-10-23</mods:number>
</mods:detail>
<mods:detail id="45690D37CE796C4562B8DC4BB23691A6" type="volume">
<mods:number id="9DFEB9B4E9B26C24DE25608252814EEF">4868</mods:number>
</mods:detail>
<mods:detail id="C4BE77D7799BC59EE7DCB4C1115693A9" type="issue">
<mods:number id="EBC8621F3793D7C4794724C262A14994">1</mods:number>
</mods:detail>
<mods:extent id="98D5F18DA18C619868591C7F4DCE78A6" unit="page">
<mods:start id="57312087B13E0E5B2EC45B3929D4B0D0">27</mods:start>
<mods:end id="BBB7F3003DD3BBA9306F9CB0F3B6DDAB">40</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:classification id="8C17FC4BC36B1AC0DD1017311681A895">journal article</mods:classification>
<mods:identifier id="F9F249759CF9667CDC189F58A0F4E9E2" type="CLB-Dataset">9022</mods:identifier>
<mods:identifier id="A9926D1DF674C7D86D5CBCA872504E19" type="DOI">10.11646/zootaxa.4868.1.2</mods:identifier>
<mods:identifier id="AB4A4807DE59AB0E4C257C61DD0C4065" type="GBIF-Dataset">a5c421db-9d17-4a25-9431-378a79f940bc</mods:identifier>
<mods:identifier id="A5D28FF6E6EAB7A8AD8C5A2F9B615FC6" type="ISSN">1175-5326</mods:identifier>
<mods:identifier id="2F14048CB8BE560366542894B6F7408A" type="Zenodo-Dep">4417203</mods:identifier>
<mods:identifier id="B844B82AD17DAD33DFA77D343213002E" type="ZooBank">B869EB5E-073D-471D-A9F3-D390D57B25E6</mods:identifier>
</mods:mods>
<treatment id="03B27A7EFFD30061FF445FF1FEB4FE57" ID-DOI="http://doi.org/10.5281/zenodo.4427141" ID-GBIF-Taxon="176440895" ID-Zenodo-Dep="4427141" LSID="urn:lsid:plazi:treatment:03B27A7EFFD30061FF445FF1FEB4FE57" httpUri="http://treatment.plazi.org/id/03B27A7EFFD30061FF445FF1FEB4FE57" lastPageId="11" lastPageNumber="38" pageId="3" pageNumber="30">
<subSubSection id="C30198E3FFD30069FF445FF1FE4DFE68" box="[151,502,431,458]" pageId="3" pageNumber="30" type="nomenclature">
<paragraph id="8BA4CB68FFD30069FF445FF1FE4DFE68" blockId="3.[151,502,431,494]" box="[151,502,431,458]" pageId="3" pageNumber="30">
<heading id="D0EC7C04FFD30069FF445FF1FE4DFE68" bold="true" box="[151,502,431,458]" fontSize="11" level="1" pageId="3" pageNumber="30" reason="1">
<emphasis id="B96F177AFFD30069FF445FF1FE4DFE68" bold="true" box="[151,502,431,458]" pageId="3" pageNumber="30">
<taxonomicName id="4C1BB0EBFFD30069FF445FF1FE2AFE68" ID-CoL="8476T" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[151,401,431,458]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="3" pageNumber="30" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFD30069FF445FF1FE2AFE68" bold="true" box="[151,401,431,458]" italics="true" pageId="3" pageNumber="30">Carlogonus gayathri</emphasis>
</taxonomicName>
<taxonomicNameLabel id="A25CAA01FFD30069FE4A5FEEFE4DFE68" box="[409,502,432,458]" pageId="3" pageNumber="30" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
</heading>
</paragraph>
</subSubSection>
<subSubSection id="C30198E3FFD30069FF445F8AFEAFFE4C" box="[151,276,468,494]" pageId="3" pageNumber="30" type="description">
<paragraph id="8BA4CB68FFD30069FF445F8AFEAFFE4C" blockId="3.[151,502,431,494]" box="[151,276,468,494]" pageId="3" pageNumber="30">
<figureCitation id="1320D7EDFFD30069FF445F8AFF40FE4C" box="[151,251,468,494]" captionStart-0="FIGURE 1" captionStart-1="FIGURE 2" captionStart-2="FIGURE 3" captionStart-3="FIGURE 4" captionStart-4="FIGURE 5" captionStart-5="FIGURE 6" captionStart-6="FIGURE 7" captionStartId-0="3.[151,250,1648,1672]" captionStartId-1="4.[151,250,547,571]" captionStartId-2="5.[151,250,1740,1764]" captionStartId-3="6.[151,250,1292,1316]" captionStartId-4="7.[151,250,1962,1986]" captionStartId-5="8.[151,250,1788,1812]" captionStartId-6="9.[151,250,1671,1695]" captionTargetBox-0="[216,1374,723,1602]" captionTargetBox-1="[156,1430,279,518]" captionTargetBox-2="[156,1431,187,1702]" captionTargetBox-3="[157,1428,423,1261]" captionTargetBox-4="[164,1423,459,1928]" captionTargetBox-5="[160,1427,564,1753]" captionTargetBox-6="[259,1327,186,1634]" captionTargetId-0="figure-443@3.[187,1400,696,1623]" captionTargetId-1="figure-75@4.[151,1437,273,524]" captionTargetId-2="figure-17@5.[151,1436,181,1716]" captionTargetId-3="figure-126@6.[151,1436,417,1269]" captionTargetId-4="figure-126@7.[151,1436,453,1938]" captionTargetId-5="figure-96@8.[154,1434,558,1762]" captionTargetId-6="figure-17@9.[246,1342,181,1647]" captionTargetPageId-0="3" captionTargetPageId-1="4" captionTargetPageId-2="5" captionTargetPageId-3="6" captionTargetPageId-4="7" captionTargetPageId-5="8" captionTargetPageId-6="9" captionText-0="FIGURE 1. Phylogenetic relationship of Carlogonus Demange, 1961 using maximum likelihood analysis (ML) and Bayesian Inference (BI) showing that Carlogonus is sister-taxon to Thyropygus Pocock, 1894 with strong support (99% for ML bootstrap replicates and a BI posterior probability of 0.99)." captionText-1="FIGURE 2. Field photographs of Carlogonus gayathri sp. nov.. A: Male from Pullodu in Trippalur, Palakkad (MILLI- ADSH0012). B: Female from Pullodu in Trippalur, Palakkad (MILLI-ADSH0013). Photo courtesy Jimmy Paul." captionText-2="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." captionText-3="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." captionText-4="FIGURE 5. Carlogonus gayathri sp. nov.. A: Gonopods, ventral view. B: Same, dorsal view. C: Same, lateral view. D: Left telopodite, ventral view. Scale bars: AD = 1 mm." captionText-5="FIGURE 6. Carlogonus gayathri sp. nov.. A: Female ring 3 showing vulvae, caudal view. B: Vulva, lateral view. C: Same, mesal view. D: Same, ventral view. E: Extended vulva showing external thorn-like processes and ridges on oral valve and internal ventro-lateral ridges on aboral valve, ventral view. F: Enlarged view of thorn-like processes and ridges on oral valve, ventral view. G: Enlarged view of ridges on aboral valve, ventral view. Arrows indicate vulvae in female ring 3 (1, 2), broken femoral spine in vulva (3), thorn-like processes and ridges on oral valve (4) and internal ventro-lateral ridges on aboral valve (5). Scale bars: A = 2 mm; BE = 1 mm; FG = 0.2 mm." captionText-6="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi-0="http://doi.org/10.5281/zenodo.4417205" figureDoi-1="http://doi.org/10.5281/zenodo.4417207" figureDoi-2="http://doi.org/10.5281/zenodo.4417212" figureDoi-3="http://doi.org/10.5281/zenodo.4417214" figureDoi-4="http://doi.org/10.5281/zenodo.4417216" figureDoi-5="http://doi.org/10.5281/zenodo.4417220" figureDoi-6="http://doi.org/10.5281/zenodo.4417222" httpUri-0="https://zenodo.org/record/4417205/files/figure.png" httpUri-1="https://zenodo.org/record/4417207/files/figure.png" httpUri-2="https://zenodo.org/record/4417212/files/figure.png" httpUri-3="https://zenodo.org/record/4417214/files/figure.png" httpUri-4="https://zenodo.org/record/4417216/files/figure.png" httpUri-5="https://zenodo.org/record/4417220/files/figure.png" httpUri-6="https://zenodo.org/record/4417222/files/figure.png" pageId="3" pageNumber="30">Figs 17</figureCitation>
,
<figureCitation id="1320D7EDFFD30069FED55F8AFEAFFE4C" box="[262,276,468,494]" captionStart="FIGURE 9" captionStartId="11.[151,250,1495,1519]" captionTargetBox="[158,1430,531,1464]" captionTargetId="figure-165@11.[151,1436,525,1471]" captionTargetPageId="11" captionText="FIGURE 9. Currently known distribution records of Carlogonus spp.. * Carlogonus acifer Demange, 1977, ♦ Carlogonus auriculus Demange, 1983, é Carlogonus chowdaiahi Demange, 1977, ■ Carlogonus exaratus (Attems, 1936), r Carlogonus gayathri sp. nov., ● Carlogonus palmatus Demange, 1977, □ Carlogonus robustior (Attems, 1936), ○ Carlogonus subvalidus (Carl, 1941), ▲ Carlogonus verhoeffi Demange, 1981 (record of Carlogonus spinicaudus (Gervais, 1847) and subsequent records of other species are omitted from the map due to the lack of locality details)." figureDoi="http://doi.org/10.5281/zenodo.4417228" httpUri="https://zenodo.org/record/4417228/files/figure.png" pageId="3" pageNumber="30">9</figureCitation>
</paragraph>
</subSubSection>
<subSubSection id="C30198E3FFD30069FF445C42FE33FD00" pageId="3" pageNumber="30" type="materials_examined">
<paragraph id="8BA4CB68FFD30069FF445C42FE33FD00" blockId="3.[151,1436,540,674]" pageId="3" pageNumber="30">
<emphasis id="B96F177AFFD30069FF445C42FEE8FD94" bold="true" box="[151,339,540,566]" pageId="3" pageNumber="30">Type material.</emphasis>
<materialsCitation id="3B73C135FFD30069FEBB5C42FAAAFDF8" ID-GBIF-Occurrence="3012569302" collectingDate="2017-10-23" collectorName="M. S. Pradeep" country="India" county="Male" elevation="70" latitude="10.6379385" location="Thrippalur" longLatPrecision="1" longitude="76.56469" municipality="Palakkad" pageId="3" pageNumber="30" specimenCount="1" stateProvince="Kerala" typeStatus="holotype">
<emphasis id="B96F177AFFD30069FEBB5C42FE65FD94" bold="true" box="[360,478,540,566]" pageId="3" pageNumber="30">
<typeStatus id="54A075CAFFD30069FEBB5C42FE62FD94" box="[360,473,540,566]" pageId="3" pageNumber="30" type="holotype">Holotype</typeStatus>
:
</emphasis>
<collectingCounty id="62C5B3E4FFD30069FE205C42FD96FD94" box="[499,557,540,566]" pageId="3" pageNumber="30">Male</collectingCounty>
(MILLI-ADSH0012),
<emphasis id="B96F177AFFD30069FC985C42FBAEFD94" bold="true" box="[843,1045,540,566]" pageId="3" pageNumber="30">
<collectingCountry id="F30C8BF8FFD30069FC985C42FC24FD94" box="[843,927,540,566]" name="India" pageId="3" pageNumber="30">INDIA</collectingCountry>
,
<collectingRegion id="49DF058AFFD30069FC6A5C42FBABFD94" box="[953,1040,540,566]" country="India" name="Kerala" pageId="3" pageNumber="30">Kerala</collectingRegion>
:
</emphasis>
<collectingMunicipality id="6BC05112FFD30069FBF95C42FB2FFD94" box="[1066,1172,540,566]" pageId="3" pageNumber="30">Palakkad</collectingMunicipality>
,
<location id="8EC49DB3FFD30069FB7F5C42FA9DFD94" LSID="urn:lsid:plazi:treatment:03B27A7EFFD30061FF445FF1FEB4FE57:8EC49DB3FFD30069FB7F5C42FA9DFD94" box="[1196,1318,540,566]" country="India" county="Male" latitude="10.6379385" longLatPrecision="1" longitude="76.56469" municipality="Palakkad" name="Thrippalur" pageId="3" pageNumber="30" stateProvince="Kerala">Thrippalur</location>
,
<location id="8EC49DB3FFD30069FAED5C42FA23FD94" LSID="urn:lsid:plazi:treatment:03B27A7EFFD30061FF445FF1FEB4FE57:8EC49DB3FFD30069FAED5C42FA23FD94" box="[1342,1432,540,566]" country="India" county="Male" latitude="10.6379385" longLatPrecision="1" longitude="76.56469" municipality="Palakkad" name="Pullodu" pageId="3" pageNumber="30" stateProvince="Kerala">Pullodu</location>
,
<geoCoordinate id="EE2FADAFFFD30069FF445C1EFEF2FDF9" box="[151,329,576,603]" degrees="10" direction="north" minutes="38" orientation="latitude" pageId="3" pageNumber="30" precision="1" seconds="16.58" value="10.6379385">10°3816.58N</geoCoordinate>
,
<geoCoordinate id="EE2FADAFFFD30069FE865C1EFDBFFDF9" box="[341,516,576,603]" degrees="76" direction="east" minutes="33" orientation="longitude" pageId="3" pageNumber="30" precision="1" seconds="52.87" value="76.56469">76°3352.87E</geoCoordinate>
,
<quantity id="4CE3668DFFD30069FDC35C1EFDF3FDF8" box="[528,584,576,602]" metricMagnitude="1" metricUnit="m" metricValue="7.0" pageId="3" pageNumber="30" unit="m" value="70.0">
<elevation id="00362C5BFFD30069FDC35C1EFDF3FDF8" box="[528,584,576,602]" metricMagnitude="1" metricUnit="m" metricValue="7.0" pageId="3" pageNumber="30" unit="m" value="70.0">70 m</elevation>
</quantity>
alt.,
<date id="FFA5EDA8FFD30069FDAC5C1EFC86FDF8" box="[639,829,576,602]" pageId="3" pageNumber="30" value="2017-10-23">
<collectingDate id="EFE11440FFD30069FDAC5C1EFC86FDF8" box="[639,829,576,602]" pageId="3" pageNumber="30" value="2017-10-23">23 October 2017</collectingDate>
</date>
,
<collectorName id="26EEAEBEFFD30069FC945C1EFC65FDF8" box="[839,990,576,602]" pageId="3" pageNumber="30">M.S. Pradeep</collectorName>
leg., from ground, by hand
</materialsCitation>
.
<typeStatus id="54A075CAFFD30069FAC85C1EFA33FDF8" box="[1307,1416,576,602]" pageId="3" pageNumber="30" type="paratype">Paratypes</typeStatus>
<specimenCount id="9D1D00E1FFD30069FA5D5C1EFF60FDDC" pageId="3" pageNumber="30" type="male">3 males</specimenCount>
,
<specimenCount id="9D1D00E1FFD30069FF345C3AFEEFFDDC" box="[231,340,612,638]" pageId="3" pageNumber="30" type="female">9 females</specimenCount>
(MILLI-ADSH0013),
<materialsCitation id="3B73C135FFD30069FD8B5C3AFB04FDDC" ID-GBIF-Occurrence="3012569301" box="[600,1215,612,638]" collectingDate="2017-10-23" collectorName="M. S. Pradeep" country="India" county="Male" elevation="70" latitude="10.6379385" location="Thrippalur" longLatPrecision="1" longitude="76.56469" municipality="Palakkad" pageId="3" pageNumber="30" specimenCount="1" stateProvince="Kerala" typeStatus="paratype">same data as holotype except for the collecting date of</materialsCitation>
<specimenCount id="9D1D00E1FFD30069FB145C3AFA27FDDC" box="[1223,1436,612,638]" pageId="3" pageNumber="30" type="female" typeStatus="paratype">3 paratype females</specimenCount>
(
<date id="FFA5EDA8FFD30069FF735CD6FEC6FD00" box="[160,381,648,674]" pageId="3" pageNumber="30" value="2019-11-11">11 November 2019</date>
).
</paragraph>
</subSubSection>
<caption id="DF649BE0FFD30069FF44582EFD33F973" ID-DOI="http://doi.org/10.5281/zenodo.4417205" ID-Zenodo-Dep="4417205" httpUri="https://zenodo.org/record/4417205/files/figure.png" pageId="3" pageNumber="30" startId="3.[151,250,1648,1672]" targetBox="[216,1374,723,1602]" targetPageId="3">
<paragraph id="8BA4CB68FFD30069FF44582EFD33F973" blockId="3.[151,1436,1648,1745]" pageId="3" pageNumber="30">
<emphasis id="B96F177AFFD30069FF44582EFEAFF92A" bold="true" box="[151,276,1648,1672]" pageId="3" pageNumber="30">FIGURE 1.</emphasis>
Phylogenetic relationship of
<taxonomicName id="4C1BB0EBFFD30069FDEC582FFCE4F92B" authority="Demange, 1961" authorityName="Demange" authorityYear="1961" box="[575,863,1649,1673]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="3" pageNumber="30" phylum="Arthropoda" rank="genus">
<emphasis id="B96F177AFFD30069FDEC582FFD0CF92B" box="[575,695,1649,1673]" italics="true" pageId="3" pageNumber="30">Carlogonus</emphasis>
<bibRefCitation id="EF8AB699FFD30069FD6D582FFCE4F92B" author="Demange, J. M." box="[702,863,1649,1673]" pageId="3" pageNumber="30" pagination="1 - 274" refId="ref7005" refString="Demange, J. M. (1961) Materiaux pour servir a une revision des Harpagophoridae (Myriapodes-Diplopodes). Memoires du Museum national d'Histoire naturelle, Serie A, Zoologie, 24, 1 - 274." type="journal article" year="1961">Demange, 1961</bibRefCitation>
</taxonomicName>
using maximum likelihood analysis (ML) and Bayesian Inference (BI) showing that
<taxonomicName id="4C1BB0EBFFD30069FE6758CBFD97F90F" authorityName="Demange" authorityYear="1961" box="[436,556,1685,1709]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="3" pageNumber="30" phylum="Arthropoda" rank="genus">
<emphasis id="B96F177AFFD30069FE6758CBFD97F90F" box="[436,556,1685,1709]" italics="true" pageId="3" pageNumber="30">Carlogonus</emphasis>
</taxonomicName>
is sister-taxon to
<taxonomicName id="4C1BB0EBFFD30069FD0E58CBFC5FF90F" authority="Pocock, 1894" authorityName="Pocock" authorityYear="1894" box="[733,996,1685,1709]" class="Diplopoda" family="Harpagophoridae" genus="Thyropygus" kingdom="Animalia" order="Spirostreptida" pageId="3" pageNumber="30" phylum="Arthropoda" rank="genus">
<emphasis id="B96F177AFFD30069FD0E58CBFCEFF90F" box="[733,852,1685,1709]" italics="true" pageId="3" pageNumber="30">Thyropygus</emphasis>
Pocock, 1894
</taxonomicName>
with strong support (99% for ML bootstrap replicates and a BI posterior probability of 0.99).
</paragraph>
</caption>
<subSubSection id="C30198E3FFD30069FF1458A1FEC7F8C3" pageId="3" pageNumber="30" type="etymology">
<paragraph id="8BA4CB68FFD30069FF1458A1FEC7F8C3" blockId="3.[151,1436,1791,2033]" pageId="3" pageNumber="30">
<emphasis id="B96F177AFFD30069FF1458A1FEF5F8BB" bold="true" box="[199,334,1791,1817]" pageId="3" pageNumber="30">Etymology.</emphasis>
The specific epithet refers to the name of the Gayathripuzha River, one of the main tributaries of Bharathapuzha River, flowing through the Palakkad district on the bank of which the
<typeStatus id="54A075CAFFD30069FB8C597DFB34F89F" box="[1119,1167,1827,1853]" pageId="3" pageNumber="30">type</typeStatus>
locality (Thrippalur) of the new species lies.
</paragraph>
</subSubSection>
<subSubSection id="C30198E3FFD3006EFF145935FBD4FF5B" lastPageId="4" lastPageNumber="31" pageId="3" pageNumber="30" type="diagnosis">
<paragraph id="8BA4CB68FFD3006EFF145935FBD4FF5B" blockId="3.[151,1436,1791,2033]" lastBlockId="4.[151,1436,151,249]" lastPageId="4" lastPageNumber="31" pageId="3" pageNumber="30">
<emphasis id="B96F177AFFD30069FF145935FEF9F827" bold="true" box="[199,322,1899,1925]" pageId="3" pageNumber="30">Diagnosis.</emphasis>
Within the
<taxonomicName id="4C1BB0EBFFD30069FE175932FD9FF827" baseAuthorityName="Attems" baseAuthorityYear="1936" box="[452,548,1900,1925]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="3" pageNumber="30" phylum="Arthropoda" rank="species" species="exaratus">
<emphasis id="B96F177AFFD30069FE175932FD9FF827" box="[452,548,1900,1925]" italics="true" pageId="3" pageNumber="30">exaratus</emphasis>
</taxonomicName>
-group,
<taxonomicName id="4C1BB0EBFFD30069FDAF5935FD40F827" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[636,763,1899,1925]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="3" pageNumber="30" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFD30069FDAF5935FD40F827" box="[636,763,1899,1925]" italics="true" pageId="3" pageNumber="30">C. gayathri</emphasis>
</taxonomicName>
<emphasis id="B96F177AFFD30069FCD15935FCE0F827" bold="true" box="[770,859,1899,1925]" pageId="3" pageNumber="30">
<taxonomicNameLabel id="A25CAA01FFD30069FCD15935FCE0F827" box="[770,859,1899,1925]" pageId="3" pageNumber="30" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
is most similar to
<taxonomicName id="4C1BB0EBFFD30069FBFB5935FB7BF827" authorityName="Mauries et al." authorityYear="2001" baseAuthorityName="Carl" baseAuthorityYear="1941" box="[1064,1216,1899,1925]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="3" pageNumber="30" phylum="Arthropoda" rank="species" species="subvalidus">
<emphasis id="B96F177AFFD30069FBFB5935FB80F827" box="[1064,1083,1899,1925]" italics="true" pageId="3" pageNumber="30">C</emphasis>
.
<emphasis id="B96F177AFFD30069FB9B5935FB7BF827" box="[1096,1216,1899,1925]" italics="true" pageId="3" pageNumber="30">subvalidus</emphasis>
</taxonomicName>
as both have an antero-mesal hook-like process of the anterior coxal fold, a sharply curved tibial spine and a distally twisted telopodite, but both can be separated from one another by the following combination of characters: lateral margin of anterior coxal fold without a spine-like outgrowth (lateral margin of anterior coxal fold of
<taxonomicName id="4C1BB0EBFFD30069FBEE5989FB6CF853" authorityName="Mauries et al." authorityYear="2001" baseAuthorityName="Carl" baseAuthorityYear="1941" box="[1085,1239,2007,2033]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="3" pageNumber="30" phylum="Arthropoda" rank="species" species="subvalidus">
<emphasis id="B96F177AFFD30069FBEE5989FBEBF853" box="[1085,1104,2007,2033]" italics="true" pageId="3" pageNumber="30">C</emphasis>
.
<emphasis id="B96F177AFFD30069FB8C5989FB6CF853" box="[1119,1239,2007,2033]" italics="true" pageId="3" pageNumber="30">subvalidus</emphasis>
</taxonomicName>
with a spine-like outgrowth), narrow lateral flat process of the posterior coxal fold (
<taxonomicName id="4C1BB0EBFFD4006EFC575EC9FBA6FF13" authorityName="Mauries et al." authorityYear="2001" baseAuthorityName="Carl" baseAuthorityYear="1941" box="[900,1053,151,177]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="4" pageNumber="31" phylum="Arthropoda" rank="species" species="subvalidus">
<emphasis id="B96F177AFFD4006EFC575EC9FBA6FF13" box="[900,1053,151,177]" italics="true" pageId="4" pageNumber="31">C. subvalidus</emphasis>
</taxonomicName>
with a wide lateral flat process of the posterior coxal fold) and a femoral spine without basal twists (femoral spine of
<taxonomicName id="4C1BB0EBFFD4006EFB905EE5FB67FF77" authorityName="Mauries et al." authorityYear="2001" baseAuthorityName="Carl" baseAuthorityYear="1941" box="[1091,1244,187,213]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="4" pageNumber="31" phylum="Arthropoda" rank="species" species="subvalidus">
<emphasis id="B96F177AFFD4006EFB905EE5FBEDFF77" box="[1091,1110,187,213]" italics="true" pageId="4" pageNumber="31">C</emphasis>
.
<emphasis id="B96F177AFFD4006EFBB75EE5FB67FF77" box="[1124,1244,187,213]" italics="true" pageId="4" pageNumber="31">subvalidus</emphasis>
</taxonomicName>
has basal twists) (compare
<figureCitation id="1320D7EDFFD4006EFEDB5E81FE1CFF5B" box="[264,423,222,249]" captionStart="FIGURE 5" captionStartId="7.[151,250,1962,1986]" captionTargetBox="[164,1423,459,1928]" captionTargetId="figure-126@7.[151,1436,453,1938]" captionTargetPageId="7" captionText="FIGURE 5. Carlogonus gayathri sp. nov.. A: Gonopods, ventral view. B: Same, dorsal view. C: Same, lateral view. D: Left telopodite, ventral view. Scale bars: AD = 1 mm." figureDoi="http://doi.org/10.5281/zenodo.4417216" httpUri="https://zenodo.org/record/4417216/files/figure.png" pageId="4" pageNumber="31">Figs 5A, B, D</figureCitation>
,
<figureCitation id="1320D7EDFFD4006EFE615E81FE4CFF5B" box="[434,503,223,249]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="4" pageNumber="31">7A, B</figureCitation>
, FH with
<bibRefCitation id="EF8AB699FFD4006EFDA65E81FD53FF5B" author="Carl, J." box="[629,744,223,249]" pageId="4" pageNumber="31" pagination="569 - 714" refId="ref6848" refString="Carl, J. (1941) Diplopoden aus Sudindien und Ceylon. 2. Teil: Nematophora und Juliformia. Revue suisse de Zoologie, 48, 569 - 714. https: // doi. org / 10.5962 / bhl. part. 154483" type="journal article" year="1941">Carl 1941</bibRefCitation>
: figs 144147 and herein
<figureCitation id="1320D7EDFFD4006EFBDA5E81FBD9FF5B" box="[1033,1122,223,249]" captionStart="FIGURE 8" captionStartId="10.[151,250,1872,1896]" captionTargetBox="[318,1271,201,1838]" captionTargetId="figure-18@10.[296,1292,181,1848]" captionTargetPageId="10" captionText="FIGURE 8. Previously known Carlogonus spp.. A: Carlogonus acifer Demange, 1977. B: Carlogonus auriculus Demange, 1983. C: Carlogonus chowdaiahi Demange, 1977. D: Carlogonus exaratus (Attems, 1936). E: Carlogonus palmatus Demange, 1977. F: Carlogonus robustior (Attems, 1936). G: Carlogonus subvalidus (Carl, 1941). H: Carlogonus verhoeffi Demange, 1981 (figures reproduced from Attems (1936), Carl (1941), Demange (1977a, b; 1981; 1983))." figureDoi="http://doi.org/10.5281/zenodo.4417224" httpUri="https://zenodo.org/record/4417224/files/figure.png" pageId="4" pageNumber="31">Fig. 8G</figureCitation>
).
</paragraph>
</subSubSection>
<caption id="DF649BE0FFD4006EFF445C7DFAB3FDFD" ID-DOI="http://doi.org/10.5281/zenodo.4417207" ID-Zenodo-Dep="4417207" httpUri="https://zenodo.org/record/4417207/files/figure.png" pageId="4" pageNumber="31" startId="4.[151,250,547,571]" targetBox="[156,1430,279,518]" targetPageId="4">
<paragraph id="8BA4CB68FFD4006EFF445C7DFAB3FDFD" blockId="4.[151,1436,547,608]" pageId="4" pageNumber="31">
<emphasis id="B96F177AFFD4006EFF445C7DFEA3FD99" bold="true" box="[151,280,547,571]" pageId="4" pageNumber="31">FIGURE 2.</emphasis>
Field photographs of
<taxonomicName id="4C1BB0EBFFD4006EFDD85C7DFD58FD99" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[523,739,547,571]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="4" pageNumber="31" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFD4006EFDD85C7DFD58FD99" box="[523,739,547,571]" italics="true" pageId="4" pageNumber="31">Carlogonus gayathri</emphasis>
</taxonomicName>
<emphasis id="B96F177AFFD4006EFD3D5C7DFCFFFD99" bold="true" box="[750,836,547,571]" pageId="4" pageNumber="31">
<taxonomicNameLabel id="A25CAA01FFD4006EFD3D5C7DFCFFFD99" box="[750,836,547,571]" pageId="4" pageNumber="31" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
.
<emphasis id="B96F177AFFD4006EFC855C7DFCD3FD99" bold="true" box="[854,872,547,571]" pageId="4" pageNumber="31">A</emphasis>
: Male from Pullodu in Trippalur, Palakkad (MILLI- ADSH0012).
<emphasis id="B96F177AFFD4006EFEF75C19FE8EFDFD" bold="true" box="[292,309,583,607]" pageId="4" pageNumber="31">B</emphasis>
: Female from Pullodu in Trippalur, Palakkad (MILLI-ADSH0013). Photo courtesy Jimmy Paul.
</paragraph>
</caption>
<subSubSection id="C30198E3FFD40061FF145CD3FEB4FE57" lastPageId="11" lastPageNumber="38" pageId="4" pageNumber="31" type="description">
<paragraph id="8BA4CB68FFD4006EFF145CD3FB47FD69" blockId="4.[151,1437,653,1939]" pageId="4" pageNumber="31">
<emphasis id="B96F177AFFD4006EFF145CD3FEE2FD05" bold="true" box="[199,345,653,679]" pageId="4" pageNumber="31">Description.</emphasis>
Measurements: male with 65 body rings (64 podous and 1 apodous (telson)), circa
<quantity id="4CE3668DFFD4006EFAD35CD0FAE6FD0A" box="[1280,1373,654,680]" metricMagnitude="-1" metricUnit="m" metricValue="1.27" pageId="4" pageNumber="31" unit="mm" value="127.0">127 mm</quantity>
long,
<quantity id="4CE3668DFFD4006EFF445CEFFF56FD6E" box="[151,237,689,716]" metricMagnitude="-3" metricUnit="m" metricValue="6.4" pageId="4" pageNumber="31" unit="mm" value="6.4">6.4 mm</quantity>
wide. Female with 66 body rings (65 podous, 1 apodous), circa
<quantity id="4CE3668DFFD4006EFC6D5CECFBA0FD6E" box="[958,1051,690,716]" metricMagnitude="-1" metricUnit="m" metricValue="1.33" pageId="4" pageNumber="31" unit="mm" value="133.0">133 mm</quantity>
long,
<quantity id="4CE3668DFFD4006EFBB25CECFB0CFD6E" box="[1121,1207,690,716]" metricMagnitude="-3" metricUnit="m" metricValue="7.9" pageId="4" pageNumber="31" unit="mm" value="7.9">7.9 mm</quantity>
wide.
</paragraph>
<paragraph id="8BA4CB68FFD4006EFF145C8BFE1EFC01" blockId="4.[151,1437,653,1939]" pageId="4" pageNumber="31">
<emphasis id="B96F177AFFD4006EFF145C8BFEADFD4D" box="[199,278,725,751]" italics="true" pageId="4" pageNumber="31">Colour</emphasis>
. Head, collum yellowish with broad coffee-brown patches on both. Antennae, anal valves, legs coffeebrown. Clypeal margin with a coffee-brown, serration-like pattern (
<figureCitation id="1320D7EDFFD4006EFC425CA7FC5CFCB6" box="[913,999,761,788]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="4" pageNumber="31">Fig. 3F</figureCitation>
). Body rings coffee-brown, baso-laterally with yellowish patch. Posterior margin of metazonae light brown. Metazonae up to ring 64 dorso-laterally with olive-green transverse patch. Preanal process (anal spine) yellowish. Colouration of preserved material: overall dull brown with greyish patches and stripes; parts with yellowish colour faded to straw-colour. Metazonae lose dark olive-green colouration.
</paragraph>
<paragraph id="8BA4CB68FFD4006EFF145DF3FEFEFB66" blockId="4.[151,1437,653,1939]" pageId="4" pageNumber="31">
<emphasis id="B96F177AFFD4006EFF145DF3FEBFFC65" box="[199,260,941,967]" italics="true" pageId="4" pageNumber="31">Head</emphasis>
. Head smooth. Each eye patch with circa 5559 ommatidia arranged in 7 or 8 horizontal rows. Axial sulcus prominent, reaching up to frons. Labrum with three smoothly rounded teeth and a single row of 6 or 8 short labral setae (
<figureCitation id="1320D7EDFFD4006EFEF05DABFECCFBB2" box="[291,375,1013,1040]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="4" pageNumber="31">Fig. 3F</figureCitation>
). Clypeus with six setiferous foveolae, three on each side (
<figureCitation id="1320D7EDFFD4006EFC2C5DABFBEBFBB2" box="[1023,1104,1013,1040]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="4" pageNumber="31">Fig. 3F</figureCitation>
, arrows 38). Antennal cavity present, nearly circular in outline. Antennae moderately long (
<figureCitation id="1320D7EDFFD4006EFC855A47FC0BFB96" box="[854,944,1049,1076]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="4" pageNumber="31">Fig. 3G</figureCitation>
), protruding back to ring 4. Relative length of antennomeres: 1&lt;2&gt;3&gt;4&lt;5&gt;6. Terminal antennomere (disc) with four large sensory cones located together inside a membranous area (
<figureCitation id="1320D7EDFFD4006EFE545A3FFE5FFBDE" box="[391,484,1121,1148]" captionStart="FIGURE 4" captionStartId="6.[151,250,1292,1316]" captionTargetBox="[157,1428,423,1261]" captionTargetId="figure-126@6.[151,1436,417,1269]" captionTargetPageId="6" captionText="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="4" pageNumber="31">Fig. 4A</figureCitation>
). Antennomere 6 apico-laterally with field of 9 or 10 rows of narrow, long sensilla basiconica, disc laterally with 1 or 3 rows of irregularly clustered tiny sensilla basiconica (
<figureCitation id="1320D7EDFFD4006EFB575ADBFB71FB02" box="[1156,1226,1157,1184]" captionStart="FIGURE 4" captionStartId="6.[151,250,1292,1316]" captionTargetBox="[157,1428,423,1261]" captionTargetId="figure-126@6.[151,1436,417,1269]" captionTargetPageId="6" captionText="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="4" pageNumber="31">Figs 4</figureCitation>
AC, arrows 1 and 2 respectively).
</paragraph>
<paragraph id="8BA4CB68FFD4006EFF145A93FD8CF9AA" blockId="4.[151,1437,653,1939]" pageId="4" pageNumber="31">
<emphasis id="B96F177AFFD4006EFF145A93FE33FB45" box="[199,392,1229,1255]" italics="true" pageId="4" pageNumber="31">Gnathochilarium</emphasis>
. Usual for spirostreptideans (
<figureCitation id="1320D7EDFFD4006EFD0A5A93FC8EFB4A" box="[729,821,1229,1256]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="4" pageNumber="31">Fig. 3D</figureCitation>
). Mentum smooth with more or less straight posterior margin with less developed prebasilare (
<figureCitation id="1320D7EDFFD4006EFD8A5AAFFD09FAAE" box="[601,690,1265,1292]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="4" pageNumber="31">Fig. 3D</figureCitation>
, arrow 1). Hypostoma flat, medially smooth, laterally with oblique striations. Lamellae linguales each with five spine-like setae, two proximally, three distally. Stipites with a slightly wavy lateral margin, with disto-ventral bulging, medially with oblique excavation, each with a short, thick, thornlike disto-ventral seta placed on a small conical mount, each with four stout apico-lateral setae (
<figureCitation id="1320D7EDFFD4006EFB045B03FA8AFADA" box="[1239,1329,1373,1400]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="4" pageNumber="31">Fig. 3D</figureCitation>
), with 11 or 12 short basal spine-like setae. Only 1st pair of palpi with numerous sensilla (
<figureCitation id="1320D7EDFFD4006EFBE65BDFFB34FA3E" box="[1077,1167,1409,1436]" captionStart="FIGURE 4" captionStartId="6.[151,250,1292,1316]" captionTargetBox="[157,1428,423,1261]" captionTargetId="figure-126@6.[151,1436,417,1269]" captionTargetPageId="6" captionText="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="4" pageNumber="31">Fig. 4E</figureCitation>
). Hypopharyngeal crest with weakly developed field of spine-like structures, distally with a membranous lamina bearing a series of short marginal setae (
<figureCitation id="1320D7EDFFD4006EFE9B5B97FE24FA46" box="[328,415,1481,1508]" captionStart="FIGURE 4" captionStartId="6.[151,250,1292,1316]" captionTargetBox="[157,1428,423,1261]" captionTargetId="figure-126@6.[151,1436,417,1269]" captionTargetPageId="6" captionText="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="4" pageNumber="31">Fig. 4E</figureCitation>
). Central pads of endochilarium divided to a short distance by a groove and a ridge into two separate regions (
<figureCitation id="1320D7EDFFD4006EFE8F5BB3FE09F9AA" box="[348,434,1517,1544]" captionStart="FIGURE 4" captionStartId="6.[151,250,1292,1316]" captionTargetBox="[157,1428,423,1261]" captionTargetId="figure-126@6.[151,1436,417,1269]" captionTargetPageId="6" captionText="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="4" pageNumber="31">Fig. 4E</figureCitation>
; CP, Endo).
</paragraph>
<paragraph id="8BA4CB68FFD4006EFF14584FFE20F93A" blockId="4.[151,1437,653,1939]" pageId="4" pageNumber="31">
<emphasis id="B96F177AFFD4006EFF14584FFE89F989" box="[199,306,1553,1579]" italics="true" pageId="4" pageNumber="31">Mandible</emphasis>
. Stout and short. External tooth simple, elongately triangular (
<figureCitation id="1320D7EDFFD4006EFBDB584FFBDBF98E" box="[1032,1120,1553,1580]" captionStart="FIGURE 4" captionStartId="6.[151,250,1292,1316]" captionTargetBox="[157,1428,423,1261]" captionTargetId="figure-126@6.[151,1436,417,1269]" captionTargetPageId="6" captionText="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="4" pageNumber="31">Fig. 4F</figureCitation>
; ET); inner tooth with four cusps (
<figureCitation id="1320D7EDFFD4006EFF34586BFEE0F9F2" box="[231,347,1589,1616]" captionStart="FIGURE 4" captionStartId="6.[151,250,1292,1316]" captionTargetBox="[157,1428,423,1261]" captionTargetId="figure-126@6.[151,1436,417,1269]" captionTargetPageId="6" captionText="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="4" pageNumber="31">Fig. 4F; 4</figureCitation>
IT). Nine or 11 rows of pectinate lamellae (
<figureCitation id="1320D7EDFFD4006EFC81586BFC11F9F2" box="[850,938,1589,1616]" captionStart="FIGURE 4" captionStartId="6.[151,250,1292,1316]" captionTargetBox="[157,1428,423,1261]" captionTargetId="figure-126@6.[151,1436,417,1269]" captionTargetPageId="6" captionText="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="4" pageNumber="31">Fig. 4F</figureCitation>
; PL). Medio-basal margin of pectinate area smooth (
<figureCitation id="1320D7EDFFD4006EFF2B5807FEF6F9D6" box="[248,333,1625,1652]" captionStart="FIGURE 4" captionStartId="6.[151,250,1292,1316]" captionTargetBox="[157,1428,423,1261]" captionTargetId="figure-126@6.[151,1436,417,1269]" captionTargetPageId="6" captionText="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="4" pageNumber="31">Fig. 4F</figureCitation>
); basal margin with 3 or 4 transverse rows of small spines. Molar plate long with a distal excavation (
<figureCitation id="1320D7EDFFD4006EFF735823FF49F93A" box="[160,242,1661,1688]" captionStart="FIGURE 4" captionStartId="6.[151,250,1292,1316]" captionTargetBox="[157,1428,423,1261]" captionTargetId="figure-126@6.[151,1436,417,1269]" captionTargetPageId="6" captionText="FIGURE 4. Carlogonus gayathri sp. nov., male. A: Left antenna, antennomere 6 and disc, apical view. B: Enlarged view of sensilla basiconica on antennomere 6, apical view. C: Enlarged view of sensilla basiconica on disc, apical view. D: Gnathochilarium, dorsal view. E: Central pads and palps, detail. F: Left mandible, inner view. Abbreviations: 4IT = 4-combed inner tooth, CP = central pad, Endo = endochilarium, ET = external tooth, MP = molar plate, PL = pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth. Scale bars: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="4" pageNumber="31">Fig. 4F</figureCitation>
, arrow 3; MP).
</paragraph>
<paragraph id="8BA4CB68FFD4006EFF1458FFFA81F91E" blockId="4.[151,1437,653,1939]" box="[199,1338,1697,1724]" pageId="4" pageNumber="31">
<emphasis id="B96F177AFFD4006EFF1458FFFEA2F919" box="[199,281,1697,1723]" italics="true" pageId="4" pageNumber="31">Collum</emphasis>
. Lateral margin rounded, extending beyond the tips of ring 2, surface smooth (
<figureCitation id="1320D7EDFFD4006EFB5E58FFFA95F91E" box="[1165,1326,1697,1724]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="4" pageNumber="31">Fig. 3A, E, M</figureCitation>
).
</paragraph>
<paragraph id="8BA4CB68FFD4006EFF14589BFDDCF831" blockId="4.[151,1437,653,1939]" pageId="4" pageNumber="31">
<emphasis id="B96F177AFFD4006EFF14589BFEF9F97D" box="[199,322,1733,1759]" italics="true" pageId="4" pageNumber="31">Body rings</emphasis>
. Divided by sutures in two transverse zones, pro- and metazonae. Pro- and metazonae dorsally micropunctuated, ventrally with numerous weak longitudinal striations. Ozopore located on metazona, starting with ring 6, located close to, but not touching the suture between pro- and metazonae. Preanal ring/epiproct sharp-edged, extending beyond the anal valves/paraprocts as a long, smooth claw-like preanal process slightly curved downwards (
<figureCitation id="1320D7EDFFD4006EFF73590BFEA1F8D2" box="[160,282,1877,1904]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="4" pageNumber="31">Fig. 3C, N</figureCitation>
). Anal valves with well developed lips, but with neither micropunctuations, grooves, nor setae. Subanal scale/hypoproct, small, widely triangular.
</paragraph>
<caption id="DF649BE0FFD5006FFF445892FAFFF8D6" ID-DOI="http://doi.org/10.5281/zenodo.4417212" ID-Zenodo-Dep="4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="5" pageNumber="32" startId="5.[151,250,1740,1764]" targetBox="[156,1431,187,1702]" targetPageId="5">
<paragraph id="8BA4CB68FFD5006FFF445892FAFFF8D6" blockId="5.[151,1437,1740,1909]" pageId="5" pageNumber="32">
<emphasis id="B96F177AFFD5006FFF445892FEA9F946" bold="true" box="[151,274,1740,1764]" pageId="5" pageNumber="32">FIGURE 3.</emphasis>
<taxonomicName id="4C1BB0EBFFD5006FFECA5892FE57F946" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[281,492,1740,1764]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="5" pageNumber="32" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFD5006FFECA5892FE57F946" box="[281,492,1740,1764]" italics="true" pageId="5" pageNumber="32">Carlogonus gayathri</emphasis>
</taxonomicName>
<emphasis id="B96F177AFFD5006FFE215892FDF9F946" bold="true" box="[498,578,1740,1764]" pageId="5" pageNumber="32">
<taxonomicNameLabel id="A25CAA01FFD5006FFE215892FDF9F946" box="[498,578,1740,1764]" pageId="5" pageNumber="32" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
.
<emphasis id="B96F177AFFD5006FFD9C5892FD3EF946" bold="true" box="[591,645,1740,1764]" pageId="5" pageNumber="32">A, M</emphasis>
: Head and anterior trunk segments, lateral view.
<emphasis id="B96F177AFFD5006FFBA75892FB3EF946" bold="true" box="[1140,1157,1740,1764]" pageId="5" pageNumber="32">B</emphasis>
: Legs 17, ventral view.
<emphasis id="B96F177AFFD5006FFA575892FF12F8AA" bold="true" pageId="5" pageNumber="32">C, N</emphasis>
: Telson, lateral view.
<emphasis id="B96F177AFFD5006FFE5658AEFE2CF8AA" bold="true" box="[389,407,1776,1800]" pageId="5" pageNumber="32">D</emphasis>
: Gnathochilarium, ventral view.
<emphasis id="B96F177AFFD5006FFD3158AEFD48F8AA" bold="true" box="[738,755,1776,1800]" pageId="5" pageNumber="32">E</emphasis>
: Collum, lateral view.
<emphasis id="B96F177AFFD5006FFC0458AEFBB0F8AA" bold="true" box="[983,1035,1776,1800]" pageId="5" pageNumber="32">H, O</emphasis>
: Leg-pair 1, ventral view.
<emphasis id="B96F177AFFD5006FFAC058AEFA83F8AA" bold="true" box="[1299,1336,1776,1800]" pageId="5" pageNumber="32">I, P</emphasis>
: Leg-pair 2, dorsal and ventral views respectively.
<emphasis id="B96F177AFFD5006FFDE0594AFDDBF88E" bold="true" box="[563,608,1812,1836]" pageId="5" pageNumber="32">J, Q</emphasis>
: Leg-pair 3, ventral and dorsal views respectively.
<emphasis id="B96F177AFFD5006FFBB5594AFBCEF88E" bold="true" box="[1126,1141,1812,1836]" pageId="5" pageNumber="32">F</emphasis>
: Head, frontal view showing teeth and setiferous foveolae.
<emphasis id="B96F177AFFD5006FFE105966FE6CF8F2" bold="true" box="[451,471,1848,1872]" pageId="5" pageNumber="32">G</emphasis>
: Left antenna, lateral view.
<emphasis id="B96F177AFFD5006FFD3E5966FCBAF8F2" bold="true" box="[749,769,1848,1872]" pageId="5" pageNumber="32">K</emphasis>
: Left leg of leg-pair 3 showing pads, dorsal view.
<emphasis id="B96F177AFFD5006FFB255966FABCF8F2" bold="true" box="[1270,1287,1848,1872]" pageId="5" pageNumber="32">L</emphasis>
: Penis, ventral view. AL male, MQ female.
<emphasis id="B96F177AFFD5006FFE025902FDFBF8D6" bold="true" box="[465,576,1884,1908]" pageId="5" pageNumber="32">Scale bars</emphasis>
: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm.
</paragraph>
</caption>
<paragraph id="8BA4CB68FFD5006CFF1459FDFB9AFEBF" blockId="5.[151,1436,1954,2017]" lastBlockId="6.[151,1437,151,393]" lastPageId="6" lastPageNumber="33" pageId="5" pageNumber="32">
<emphasis id="B96F177AFFD5006FFF1459FDFF47F81E" box="[199,252,1955,1980]" italics="true" pageId="5" pageNumber="32">Legs</emphasis>
. Coxae 1 short, subcylindrical, coxae 2 rectangular in outline, fused together (
<figureCitation id="1320D7EDFFD5006FFBA959FCFB07F81F" box="[1146,1212,1954,1981]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="5" pageNumber="32">Fig. 3</figureCitation>
HI, OP); coxae 3 and 4 elongately triangular, fused (
<figureCitation id="1320D7EDFFD5006FFDF15998FD2CF843" box="[546,663,1990,2017]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="5" pageNumber="32">Fig. 3J, Q</figureCitation>
); others stout, broadly triangular, unfused. Prefemur 1 and 2 moder- ately long, subcylindrical, unfused (
<figureCitation id="1320D7EDFFD6006CFDFD5EC9FDCBFF13" box="[558,624,151,177]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="6" pageNumber="33">Fig. 3</figureCitation>
HI, OP). Leg-pair 2 longer than 1 (
<figureCitation id="1320D7EDFFD6006CFBCE5EC9FBD7FF13" box="[1053,1132,151,177]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="6" pageNumber="33">Fig. 3I</figureCitation>
); each podomere with apical/ventral/dorsal/mesal/lateral tiny, stout and slender setae; postfemur and tibia from leg-pair 3 onwards bear well developed, complete pads; in anterior leg-pairs, pads with tip curved down (
<figureCitation id="1320D7EDFFD6006CFC325E81FB81FF5B" box="[993,1082,223,249]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="6" pageNumber="33">Fig. 3K</figureCitation>
). Length of mid-body legs circa
<quantity id="4CE3668DFFD6006CFF445F5CFF56FEBF" box="[151,237,258,285]" metricMagnitude="-3" metricUnit="m" metricValue="5.7" pageId="6" pageNumber="33" unit="mm" value="5.7">5.7 mm</quantity>
in males, circa
<quantity id="4CE3668DFFD6006CFE4E5F5CFE48FEBF" box="[413,499,258,285]" metricMagnitude="-3" metricUnit="m" metricValue="5.1" pageId="6" pageNumber="33" unit="mm" value="5.1">5.1 mm</quantity>
in females. Claw large, slightly curved (
<figureCitation id="1320D7EDFFD6006CFC695F5DFBAFFEBF" box="[954,1044,259,285]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="6" pageNumber="33">Fig. 3K</figureCitation>
).
</paragraph>
<paragraph id="8BA4CB68FFD6006CFF145F79FC84FEC7" blockId="6.[151,1437,151,393]" pageId="6" pageNumber="33">
<emphasis id="B96F177AFFD6006CFF145F79FE6BFEE3" box="[199,464,295,321]" italics="true" pageId="6" pageNumber="33">Male sexual characters</emphasis>
. Podomeres lack modifications (
<figureCitation id="1320D7EDFFD6006CFC915F79FC3FFEE3" box="[834,900,295,321]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="6" pageNumber="33">Fig. 3</figureCitation>
HJ). Only body ring 7 conspicuously enlarged (
<figureCitation id="1320D7EDFFD6006CFF735F15FF42FEC7" box="[160,249,331,357]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="6" pageNumber="33">Fig. 3A</figureCitation>
). Tips of gonopods visible in lateral view (
<figureCitation id="1320D7EDFFD6006CFD0B5F15FC89FEC7" box="[728,818,331,357]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="6" pageNumber="33">Fig. 3A</figureCitation>
).
</paragraph>
<paragraph id="8BA4CB68FFD6006CFF145F31FB90FE2B" blockId="6.[151,1437,151,393]" box="[199,1067,367,393]" pageId="6" pageNumber="33">
<emphasis id="B96F177AFFD6006CFF145F31FEBEFE2A" box="[199,261,367,392]" italics="true" pageId="6" pageNumber="33">Penis</emphasis>
. Short, bluntly triangular with thin, flat apical part (
<figureCitation id="1320D7EDFFD6006CFC9F5F31FC03FE2B" box="[844,952,367,393]" captionStart="FIGURE 3" captionStartId="5.[151,250,1740,1764]" captionTargetBox="[156,1431,187,1702]" captionTargetId="figure-17@5.[151,1436,181,1716]" captionTargetPageId="5" captionText="FIGURE 3. Carlogonus gayathri sp. nov.. A, M: Head and anterior trunk segments, lateral view. B: Legs 17, ventral view. C, N: Telson, lateral view. D: Gnathochilarium, ventral view. E: Collum, lateral view. H, O: Leg-pair 1, ventral view. I, P: Leg-pair 2, dorsal and ventral views respectively. J, Q: Leg-pair 3, ventral and dorsal views respectively. F: Head, frontal view showing teeth and setiferous foveolae. G: Left antenna, lateral view. K: Left leg of leg-pair 3 showing pads, dorsal view. L: Penis, ventral view. AL male, MQ female. Scale bars: AC, MN, OQ = 2 mm; D, GJ = 1 mm; EF, K = 0.5 mm; L = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417212" httpUri="https://zenodo.org/record/4417212/files/figure.png" pageId="6" pageNumber="33">Fig. 3I, L</figureCitation>
, arrow 2).
</paragraph>
<caption id="DF649BE0FFD6006CFF445B52FBE6FA7A" ID-DOI="http://doi.org/10.5281/zenodo.4417214" ID-Zenodo-Dep="4417214" httpUri="https://zenodo.org/record/4417214/files/figure.png" pageId="6" pageNumber="33" startId="6.[151,250,1292,1316]" targetBox="[157,1428,423,1261]" targetPageId="6">
<paragraph id="8BA4CB68FFD6006CFF445B52FBE6FA7A" blockId="6.[151,1436,1292,1496]" pageId="6" pageNumber="33">
<emphasis id="B96F177AFFD6006CFF445B52FEAFFA86" bold="true" box="[151,276,1292,1316]" pageId="6" pageNumber="33">FIGURE 4.</emphasis>
<taxonomicName id="4C1BB0EBFFD6006CFECF5B52FE4AFA86" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[284,497,1292,1316]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="6" pageNumber="33" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFD6006CFECF5B52FE4AFA86" box="[284,497,1292,1316]" italics="true" pageId="6" pageNumber="33">Carlogonus gayathri</emphasis>
</taxonomicName>
<emphasis id="B96F177AFFD6006CFE2A5B52FDF0FA86" bold="true" box="[505,587,1292,1316]" pageId="6" pageNumber="33">
<taxonomicNameLabel id="A25CAA01FFD6006CFE2A5B52FDF0FA86" box="[505,587,1292,1316]" pageId="6" pageNumber="33" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
, male.
<emphasis id="B96F177AFFD6006CFD4A5B52FD10FA86" bold="true" box="[665,683,1292,1316]" pageId="6" pageNumber="33">A</emphasis>
: Left antenna, antennomere 6 and disc, apical view.
<emphasis id="B96F177AFFD6006CFB1F5B52FB66FA86" bold="true" box="[1228,1245,1292,1316]" pageId="6" pageNumber="33">B</emphasis>
: Enlarged view of sensilla basiconica on antennomere 6, apical view.
<emphasis id="B96F177AFFD6006CFD7A5B6EFD00FAEA" bold="true" box="[681,699,1328,1352]" pageId="6" pageNumber="33">C</emphasis>
: Enlarged view of sensilla basiconica on disc, apical view.
<emphasis id="B96F177AFFD6006CFAFB5B6EFA81FAEA" bold="true" box="[1320,1338,1328,1352]" pageId="6" pageNumber="33">D</emphasis>
: Gnathochilarium, dorsal view.
<emphasis id="B96F177AFFD6006CFE545B0AFE23FACE" bold="true" box="[391,408,1364,1388]" pageId="6" pageNumber="33">E</emphasis>
: Central pads and palps, detail.
<emphasis id="B96F177AFFD6006CFD335B0AFD54FACE" bold="true" box="[736,751,1364,1388]" pageId="6" pageNumber="33">F</emphasis>
: Left mandible, inner view.
<emphasis id="B96F177AFFD6006CFBC15B0AFB10FACE" bold="true" box="[1042,1195,1364,1388]" pageId="6" pageNumber="33">Abbreviations</emphasis>
:
<emphasis id="B96F177AFFD6006CFB6A5B0AFB5BFACE" bold="true" box="[1209,1248,1364,1388]" pageId="6" pageNumber="33">4IT</emphasis>
= 4-combed inner tooth,
<emphasis id="B96F177AFFD6006CFF0B5B26FF41FA32" bold="true" box="[216,250,1400,1424]" pageId="6" pageNumber="33">CP</emphasis>
= central pad,
<emphasis id="B96F177AFFD6006CFE425B26FE70FA32" bold="true" box="[401,459,1400,1424]" pageId="6" pageNumber="33">Endo</emphasis>
= endochilarium,
<emphasis id="B96F177AFFD6006CFD565B26FD1CFA32" bold="true" box="[645,679,1400,1424]" pageId="6" pageNumber="33">ET</emphasis>
= external tooth,
<emphasis id="B96F177AFFD6006CFC895B26FC3AFA32" bold="true" box="[858,897,1400,1424]" pageId="6" pageNumber="33">MP</emphasis>
= molar plate,
<emphasis id="B96F177AFFD6006CFBCF5B26FB87FA32" bold="true" box="[1052,1084,1400,1424]" pageId="6" pageNumber="33">PL</emphasis>
= pectinate lamellae. Arrows indicate sensilla basiconica on antennomere 6 and disc (1, 2) and distal excavation on molar plate (3). Digits 1, 2, 3 and 4 indicate 4 combs of inner tooth.
<emphasis id="B96F177AFFD6006CFE5A5B9EFE43FA7A" bold="true" box="[393,504,1472,1496]" pageId="6" pageNumber="33">Scale bars</emphasis>
: A = 0.1 mm; BC = 0.02 mm; D = 0.5 mm; EF = 0.2 mm.
</paragraph>
</caption>
<paragraph id="8BA4CB68FFD6006CFF145858FEA2F80F" blockId="6.[151,1437,1542,2037]" pageId="6" pageNumber="33">
<emphasis id="B96F177AFFD6006CFF145858FE81F982" box="[199,314,1542,1568]" italics="true" pageId="6" pageNumber="33">Gonopods</emphasis>
(
<figureCitation id="1320D7EDFFD6006CFE9B5858FE36F983" box="[328,397,1542,1569]" captionStart="FIGURE 5" captionStartId="7.[151,250,1962,1986]" captionTargetBox="[164,1423,459,1928]" captionTargetId="figure-126@7.[151,1436,453,1938]" captionTargetPageId="7" captionText="FIGURE 5. Carlogonus gayathri sp. nov.. A: Gonopods, ventral view. B: Same, dorsal view. C: Same, lateral view. D: Left telopodite, ventral view. Scale bars: AD = 1 mm." figureDoi="http://doi.org/10.5281/zenodo.4417216" httpUri="https://zenodo.org/record/4417216/files/figure.png" pageId="6" pageNumber="33">Figs 5</figureCitation>
AD, 7AI). Anterior coxal fold (
<figureCitation id="1320D7EDFFD6006CFCD25858FCE5F983" box="[769,862,1542,1569]" captionStart="FIGURE 5" captionStartId="7.[151,250,1962,1986]" captionTargetBox="[164,1423,459,1928]" captionTargetId="figure-126@7.[151,1436,453,1938]" captionTargetPageId="7" captionText="FIGURE 5. Carlogonus gayathri sp. nov.. A: Gonopods, ventral view. B: Same, dorsal view. C: Same, lateral view. D: Left telopodite, ventral view. Scale bars: AD = 1 mm." figureDoi="http://doi.org/10.5281/zenodo.4417216" httpUri="https://zenodo.org/record/4417216/files/figure.png" pageId="6" pageNumber="33">Figs 5A</figureCitation>
,
<figureCitation id="1320D7EDFFD6006CFCBB5859FC35F983" box="[872,910,1543,1569]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">7A</figureCitation>
; AC): lateral margin less modified, with a weak indentation (
<figureCitation id="1320D7EDFFD6006CFEF55874FE3EF9E7" box="[294,389,1578,1605]" captionStart="FIGURE 5" captionStartId="7.[151,250,1962,1986]" captionTargetBox="[164,1423,459,1928]" captionTargetId="figure-126@7.[151,1436,453,1938]" captionTargetPageId="7" captionText="FIGURE 5. Carlogonus gayathri sp. nov.. A: Gonopods, ventral view. B: Same, dorsal view. C: Same, lateral view. D: Left telopodite, ventral view. Scale bars: AD = 1 mm." figureDoi="http://doi.org/10.5281/zenodo.4417216" httpUri="https://zenodo.org/record/4417216/files/figure.png" pageId="6" pageNumber="33">Figs 5A</figureCitation>
,
<figureCitation id="1320D7EDFFD6006CFE405875FE03F9E7" box="[403,440,1579,1605]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">7A</figureCitation>
, arrow 1); antero-mesally with a thumb-like and a hook-like processes, antero-laterally with a short process (
<figureCitation id="1320D7EDFFD6006CFE585810FE5DF9CB" box="[395,486,1614,1641]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">Fig. 7A</figureCitation>
; amtAC, amhpAC, alpAC). Posterior coxal fold (
<figureCitation id="1320D7EDFFD6006CFBCB5810FBC9F9CB" box="[1048,1138,1614,1641]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">Fig. 7C</figureCitation>
; PC): basally with moderately high lateral paracoxites, distally flat to accommodate telopodite (
<figureCitation id="1320D7EDFFD6006CFC7E582CFC55F92F" box="[941,1006,1650,1677]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">Fig. 7</figureCitation>
AB, D; PX); internal mesal fold with antero-mesal wide process (
<figureCitation id="1320D7EDFFD6006CFE0358C8FD9CF913" box="[464,551,1686,1713]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">Fig. 7E</figureCitation>
; imPC); baso-laterally with a mount-like process lying near to the basal part of telopodite, distally with an anterior roughly globular and a lateral flat processes (
<figureCitation id="1320D7EDFFD6006CFBFE58E4FBCBF977" box="[1069,1136,1722,1749]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">Fig. 7</figureCitation>
BC; blpPC, apPC, lpPC). Telopodite (
<figureCitation id="1320D7EDFFD6006CFECC5880FEC4F95B" box="[287,383,1758,1785]" captionStart="FIGURE 5" captionStartId="7.[151,250,1962,1986]" captionTargetBox="[164,1423,459,1928]" captionTargetId="figure-126@7.[151,1436,453,1938]" captionTargetPageId="7" captionText="FIGURE 5. Carlogonus gayathri sp. nov.. A: Gonopods, ventral view. B: Same, dorsal view. C: Same, lateral view. D: Left telopodite, ventral view. Scale bars: AD = 1 mm." figureDoi="http://doi.org/10.5281/zenodo.4417216" httpUri="https://zenodo.org/record/4417216/files/figure.png" pageId="6" pageNumber="33">Figs 5D</figureCitation>
,
<figureCitation id="1320D7EDFFD6006CFE5E5881FE14F95B" box="[397,431,1759,1785]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">7B</figureCitation>
, FI; T): flat resting on paracoxite, with ventral and lateral twists (
<figureCitation id="1320D7EDFFD6006CFB625880FAAAF95B" box="[1201,1297,1758,1785]" captionStart="FIGURE 5" captionStartId="7.[151,250,1962,1986]" captionTargetBox="[164,1423,459,1928]" captionTargetId="figure-126@7.[151,1436,453,1938]" captionTargetPageId="7" captionText="FIGURE 5. Carlogonus gayathri sp. nov.. A: Gonopods, ventral view. B: Same, dorsal view. C: Same, lateral view. D: Left telopodite, ventral view. Scale bars: AD = 1 mm." figureDoi="http://doi.org/10.5281/zenodo.4417216" httpUri="https://zenodo.org/record/4417216/files/figure.png" pageId="6" pageNumber="33">Figs 5D</figureCitation>
,
<figureCitation id="1320D7EDFFD6006CFACC5881FAF9F95B" box="[1311,1346,1759,1785]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">7B</figureCitation>
); femur with a single strong femoral spine having abrupt basal and smooth distal curvatures (
<figureCitation id="1320D7EDFFD6006CFB82595CFB14F8BF" box="[1105,1199,1794,1821]" captionStart="FIGURE 5" captionStartId="7.[151,250,1962,1986]" captionTargetBox="[164,1423,459,1928]" captionTargetId="figure-126@7.[151,1436,453,1938]" captionTargetPageId="7" captionText="FIGURE 5. Carlogonus gayathri sp. nov.. A: Gonopods, ventral view. B: Same, dorsal view. C: Same, lateral view. D: Left telopodite, ventral view. Scale bars: AD = 1 mm." figureDoi="http://doi.org/10.5281/zenodo.4417216" httpUri="https://zenodo.org/record/4417216/files/figure.png" pageId="6" pageNumber="33">Figs 5D</figureCitation>
,
<figureCitation id="1320D7EDFFD6006CFB68595DFB65F8BF" box="[1211,1246,1795,1821]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">7B</figureCitation>
, FG; FS); tibial spine long, slender, smoothly curved with a basal apically bifurcated seta-like side branch (
<figureCitation id="1320D7EDFFD6006CFB415978FAB7F8E3" box="[1170,1292,1830,1857]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">Fig. 7B, D</figureCitation>
, GH, arrow 2; TS); palette wide, flat, narrowing towards tip, dorsally with a longitudinal crest, with a short lateral thorn-like process, with a single dorsal row of more than 10 pale, brownish apically bifurcated blepharochaetae (
<figureCitation id="1320D7EDFFD6006CFADF5930FAF5F82B" box="[1292,1358,1902,1929]" captionStart="FIGURE 7" captionStartId="9.[151,250,1671,1695]" captionTargetBox="[259,1327,186,1634]" captionTargetId="figure-17@9.[246,1342,181,1647]" captionTargetPageId="9" captionText="FIGURE 7. Carlogonus gayathri sp. nov., male. A: Gonopods, ventral view. B: Same, dorsal view. C: Right gonopod after removing telopodite, dorsal view. D: Left gonopod, lateral view. E: Same, mesal view. F: Left telopodite, ventral view. G: Same, lateral view. H: Enlarged view of distal part of left telopodite, mesal view. I: Enlarged view of blepharochaetae, lateral view. Abbreviations: alpAC = antero-lateral process of anterior coxal fold, amhpAC = antero-mesal hook-like process of anterior coxal fold, amtAC = antero-mesal thumb-like process of anterior coxal fold, AC = anterior coxal fold, B = blepharochaetae, C = distal longitudinal crest, F = femur, FS = femoral spine, dtpP = distal thorne-like process of palette, P = palette, apPC = apical process of posterior coxal fold, blpPC = baso-lateral process of posterior coxal fold, imPC = internal mesal fold of posterior coxal fold, lpPC = lateral process of posterior coxal fold, mpPC = mesal process of posterior coxal fold, PC = posterior coxal fold, PX = paracoxite, ST = sternite, T = telopodite, TS = tibial spine, TT = tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2). Scale bars: AG = 1 mm; HI = 0.5 mm." figureDoi="http://doi.org/10.5281/zenodo.4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="6" pageNumber="33">Fig. 7</figureCitation>
HI; P, C, dtpP, B).
</paragraph>
<paragraph id="8BA4CB68FFD6006DFF1459E8FE99FEE3" blockId="6.[151,1437,1542,2037]" lastBlockId="7.[151,1437,151,430]" lastPageId="7" lastPageNumber="34" pageId="6" pageNumber="33">
<emphasis id="B96F177AFFD6006CFF1459E8FD81F872" box="[199,570,1974,2000]" italics="true" pageId="6" pageNumber="33">Female copulatory organ (vulva)</emphasis>
(
<figureCitation id="1320D7EDFFD6006CFD9959E8FD37F873" box="[586,652,1974,2001]" captionStart="FIGURE 6" captionStartId="8.[151,250,1788,1812]" captionTargetBox="[160,1427,564,1753]" captionTargetId="figure-96@8.[154,1434,558,1762]" captionTargetPageId="8" captionText="FIGURE 6. Carlogonus gayathri sp. nov.. A: Female ring 3 showing vulvae, caudal view. B: Vulva, lateral view. C: Same, mesal view. D: Same, ventral view. E: Extended vulva showing external thorn-like processes and ridges on oral valve and internal ventro-lateral ridges on aboral valve, ventral view. F: Enlarged view of thorn-like processes and ridges on oral valve, ventral view. G: Enlarged view of ridges on aboral valve, ventral view. Arrows indicate vulvae in female ring 3 (1, 2), broken femoral spine in vulva (3), thorn-like processes and ridges on oral valve (4) and internal ventro-lateral ridges on aboral valve (5). Scale bars: A = 2 mm; BE = 1 mm; FG = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417220" httpUri="https://zenodo.org/record/4417220/files/figure.png" pageId="6" pageNumber="33">Fig. 6</figureCitation>
AG). Located in membranous pouches attached to coxae 2 and 3 and to the inner lateral margin of ring 1 (
<figureCitation id="1320D7EDFFD6006CFDE15984FD37F856" box="[562,652,2010,2036]" captionStart="FIGURE 6" captionStartId="8.[151,250,1788,1812]" captionTargetBox="[160,1427,564,1753]" captionTargetId="figure-96@8.[154,1434,558,1762]" captionTargetPageId="8" captionText="FIGURE 6. Carlogonus gayathri sp. nov.. A: Female ring 3 showing vulvae, caudal view. B: Vulva, lateral view. C: Same, mesal view. D: Same, ventral view. E: Extended vulva showing external thorn-like processes and ridges on oral valve and internal ventro-lateral ridges on aboral valve, ventral view. F: Enlarged view of thorn-like processes and ridges on oral valve, ventral view. G: Enlarged view of ridges on aboral valve, ventral view. Arrows indicate vulvae in female ring 3 (1, 2), broken femoral spine in vulva (3), thorn-like processes and ridges on oral valve (4) and internal ventro-lateral ridges on aboral valve (5). Scale bars: A = 2 mm; BE = 1 mm; FG = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417220" httpUri="https://zenodo.org/record/4417220/files/figure.png" pageId="6" pageNumber="33">Fig. 6A</figureCitation>
, arrows 1 and 2). Simple, looking like a rose flower bud (
<figureCitation id="1320D7EDFFD6006CFAC75984FAECF857" box="[1300,1367,2010,2037]" captionStart="FIGURE 6" captionStartId="8.[151,250,1788,1812]" captionTargetBox="[160,1427,564,1753]" captionTargetId="figure-96@8.[154,1434,558,1762]" captionTargetPageId="8" captionText="FIGURE 6. Carlogonus gayathri sp. nov.. A: Female ring 3 showing vulvae, caudal view. B: Vulva, lateral view. C: Same, mesal view. D: Same, ventral view. E: Extended vulva showing external thorn-like processes and ridges on oral valve and internal ventro-lateral ridges on aboral valve, ventral view. F: Enlarged view of thorn-like processes and ridges on oral valve, ventral view. G: Enlarged view of ridges on aboral valve, ventral view. Arrows indicate vulvae in female ring 3 (1, 2), broken femoral spine in vulva (3), thorn-like processes and ridges on oral valve (4) and internal ventro-lateral ridges on aboral valve (5). Scale bars: A = 2 mm; BE = 1 mm; FG = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417220" httpUri="https://zenodo.org/record/4417220/files/figure.png" pageId="6" pageNumber="33">Fig. 6</figureCitation>
BD), consisting of two simple, subequally-sized, moderately sclerotised valves: a large aboral valve covering the oral valve, with lateral longitudinal invagination, with an antero-lateral membranous extension to attach with the inner margin of ring 1, with ventro-lateral ridges internally (
<figureCitation id="1320D7EDFFD7006DFCE45E81FC0FFF5B" box="[823,948,223,249]" captionStart="FIGURE 6" captionStartId="8.[151,250,1788,1812]" captionTargetBox="[160,1427,564,1753]" captionTargetId="figure-96@8.[154,1434,558,1762]" captionTargetPageId="8" captionText="FIGURE 6. Carlogonus gayathri sp. nov.. A: Female ring 3 showing vulvae, caudal view. B: Vulva, lateral view. C: Same, mesal view. D: Same, ventral view. E: Extended vulva showing external thorn-like processes and ridges on oral valve and internal ventro-lateral ridges on aboral valve, ventral view. F: Enlarged view of thorn-like processes and ridges on oral valve, ventral view. G: Enlarged view of ridges on aboral valve, ventral view. Arrows indicate vulvae in female ring 3 (1, 2), broken femoral spine in vulva (3), thorn-like processes and ridges on oral valve (4) and internal ventro-lateral ridges on aboral valve (5). Scale bars: A = 2 mm; BE = 1 mm; FG = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417220" httpUri="https://zenodo.org/record/4417220/files/figure.png" pageId="7" pageNumber="34">Fig. 6E, G</figureCitation>
, arrow 5). Oral valve short, being covered by meso-lateral part of aboral valve, externally with tiny thorn-like processes and ridges (
<figureCitation id="1320D7EDFFD7006DFB5F5F5DFB75FEBF" box="[1164,1230,259,285]" captionStart="FIGURE 6" captionStartId="8.[151,250,1788,1812]" captionTargetBox="[160,1427,564,1753]" captionTargetId="figure-96@8.[154,1434,558,1762]" captionTargetPageId="8" captionText="FIGURE 6. Carlogonus gayathri sp. nov.. A: Female ring 3 showing vulvae, caudal view. B: Vulva, lateral view. C: Same, mesal view. D: Same, ventral view. E: Extended vulva showing external thorn-like processes and ridges on oral valve and internal ventro-lateral ridges on aboral valve, ventral view. F: Enlarged view of thorn-like processes and ridges on oral valve, ventral view. G: Enlarged view of ridges on aboral valve, ventral view. Arrows indicate vulvae in female ring 3 (1, 2), broken femoral spine in vulva (3), thorn-like processes and ridges on oral valve (4) and internal ventro-lateral ridges on aboral valve (5). Scale bars: A = 2 mm; BE = 1 mm; FG = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417220" httpUri="https://zenodo.org/record/4417220/files/figure.png" pageId="7" pageNumber="34">Fig. 6</figureCitation>
EF, arrow 4). No valval setae.
</paragraph>
<paragraph id="8BA4CB68FFD7006DFF145F15FEA9FE0C" blockId="7.[151,1437,151,430]" pageId="7" pageNumber="34">
<emphasis id="B96F177AFFD7006DFF145F15FE3EFEC6" bold="true" box="[199,389,330,357]" pageId="7" pageNumber="34">Natural history.</emphasis>
<taxonomicName id="4C1BB0EBFFD7006DFE5F5F15FDCDFEC7" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[396,630,331,357]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="7" pageNumber="34" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFD7006DFE5F5F15FDCDFEC7" box="[396,630,331,357]" italics="true" pageId="7" pageNumber="34">Carlogonus gayathri</emphasis>
</taxonomicName>
<emphasis id="B96F177AFFD7006DFDAE5F15FD6CFEC7" bold="true" box="[637,727,331,357]" pageId="7" pageNumber="34">
<taxonomicNameLabel id="A25CAA01FFD7006DFDAE5F15FD6CFEC7" box="[637,727,331,357]" pageId="7" pageNumber="34" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
is living in open grounds covered with dried leaves and debris. It can be seen during the onset of the rainy season. Rarely it could be observed crawling inside buildings (Sankaran, pers. obs.).
</paragraph>
<caption id="DF649BE0FFD7006DFF4459F4FD21F847" ID-DOI="http://doi.org/10.5281/zenodo.4417216" ID-Zenodo-Dep="4417216" httpUri="https://zenodo.org/record/4417216/files/figure.png" pageId="7" pageNumber="34" startId="7.[151,250,1962,1986]" targetBox="[164,1423,459,1928]" targetPageId="7">
<paragraph id="8BA4CB68FFD7006DFF4459F4FD21F847" blockId="7.[151,1436,1962,2022]" pageId="7" pageNumber="34">
<emphasis id="B96F177AFFD7006DFF4459F4FEAFF860" bold="true" box="[151,276,1962,1986]" pageId="7" pageNumber="34">FIGURE 5.</emphasis>
<taxonomicName id="4C1BB0EBFFD7006DFECF59F4FE4AF860" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[284,497,1962,1986]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="7" pageNumber="34" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFD7006DFECF59F4FE4AF860" box="[284,497,1962,1986]" italics="true" pageId="7" pageNumber="34">Carlogonus gayathri</emphasis>
</taxonomicName>
<emphasis id="B96F177AFFD7006DFE2A59F4FDF0F860" bold="true" box="[505,587,1962,1986]" pageId="7" pageNumber="34">
<taxonomicNameLabel id="A25CAA01FFD7006DFE2A59F4FDF0F860" box="[505,587,1962,1986]" pageId="7" pageNumber="34" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
.
<emphasis id="B96F177AFFD7006DFD8A59F4FDD0F860" bold="true" box="[601,619,1962,1986]" pageId="7" pageNumber="34">A</emphasis>
: Gonopods, ventral view.
<emphasis id="B96F177AFFD7006DFCAF59F4FC36F860" bold="true" box="[892,909,1962,1986]" pageId="7" pageNumber="34">B</emphasis>
: Same, dorsal view.
<emphasis id="B96F177AFFD7006DFBB659F4FBCCF860" bold="true" box="[1125,1143,1962,1986]" pageId="7" pageNumber="34">C</emphasis>
: Same, lateral view.
<emphasis id="B96F177AFFD7006DFA8259F4FAD8F860" bold="true" box="[1361,1379,1962,1986]" pageId="7" pageNumber="34">D</emphasis>
: Left telopodite, ventral view.
<emphasis id="B96F177AFFD7006DFE415990FDBAF844" bold="true" box="[402,513,1998,2022]" pageId="7" pageNumber="34">Scale bars</emphasis>
: AD = 1 mm.
</paragraph>
</caption>
<paragraph id="8BA4CB68FFD80062FF145EC9FA27FDBB" blockId="8.[151,1436,151,537]" pageId="8" pageNumber="35">
<emphasis id="B96F177AFFD80062FF145EC9FE8AFF13" bold="true" box="[199,305,151,177]" pageId="8" pageNumber="35">Barcode.</emphasis>
Partial barcode, positions 14902198 of the standard barcode: CAAAAAATCAGAATAAGTGTTGGTATAAAATAGGGTCTCCTCCACCAGCAGGGTCAAAGAAAGAATAT- TAAAATTTCGGTCAGTAAGTAATATTGTGATAGCTCCGGCTAGCACTGGCAAAGATAGTAAAGGAGA- ATGGCTGTAATTTTTACAGCTCATACGAAAAGGGGTATTTGTTCGAATAATATACCTGCTGTTCG- TATATTAATGATGGTTGTAATGAGTTGATTGCACCTAGGATTGATGAAGCACCTGCTAAATGTAAAGAAAAAATAGC- TATATCTACTGATGGGCCGGTATGTGCTAAGGTGGAAGCTAAAGGAGGGTAAACGGTTCAACCT- G TA C C A G C T C C T T T T T C TA C G G C T G A A G A G G C TA G TA ATA G G A ATA A G G C A G G G G G G A G - CAATCAAAAGCTTATATTATTTATTCGAGGGAAGGCTATATCTGGGGCACCTAATATAAGGGGGACTAGT- CAATTTCCGAAACCACCAATTATAATTGGTATTACTATAAAGAAAATTATTACAAAAGCGTGGGCTGT- TACGATTACATTATAAATTTGATCGTCTCCAATTAAGCTGCCAGGTTGGCTTAATTCTAAGCGGATTA- ATATACTTAAAGAGGATCCAACTAATGCTGCTCAAGCACCAAAAATTAAATATATAGTTCCAATATCTTTAT
</paragraph>
<caption id="DF649BE0FFD80062FF4458A2FDC8F86A" ID-DOI="http://doi.org/10.5281/zenodo.4417220" ID-Zenodo-Dep="4417220" httpUri="https://zenodo.org/record/4417220/files/figure.png" pageId="8" pageNumber="35" startId="8.[151,250,1788,1812]" targetBox="[160,1427,564,1753]" targetPageId="8">
<paragraph id="8BA4CB68FFD80062FF4458A2FDC8F86A" blockId="8.[151,1436,1788,1993]" pageId="8" pageNumber="35">
<emphasis id="B96F177AFFD80062FF4458A2FEA9F8B6" bold="true" box="[151,274,1788,1812]" pageId="8" pageNumber="35">FIGURE 6.</emphasis>
<taxonomicName id="4C1BB0EBFFD80062FECB58A2FE50F8B6" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[280,491,1788,1812]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="8" pageNumber="35" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFD80062FECB58A2FE50F8B6" box="[280,491,1788,1812]" italics="true" pageId="8" pageNumber="35">Carlogonus gayathri</emphasis>
</taxonomicName>
<emphasis id="B96F177AFFD80062FE2258A3FDFAF8B7" bold="true" box="[497,577,1789,1813]" pageId="8" pageNumber="35">
<taxonomicNameLabel id="A25CAA01FFD80062FE2258A3FDFAF8B7" box="[497,577,1789,1813]" pageId="8" pageNumber="35" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
.
<emphasis id="B96F177AFFD80062FD9E58A2FDE4F8B6" bold="true" box="[589,607,1788,1812]" pageId="8" pageNumber="35">A</emphasis>
: Female ring 3 showing vulvae, caudal view.
<emphasis id="B96F177AFFD80062FBFF58A3FB86F8B7" bold="true" box="[1068,1085,1789,1813]" pageId="8" pageNumber="35">B</emphasis>
: Vulva, lateral view.
<emphasis id="B96F177AFFD80062FAC158A2FA9FF8B6" bold="true" box="[1298,1316,1788,1812]" pageId="8" pageNumber="35">C</emphasis>
: Same, mesal view.
<emphasis id="B96F177AFFD80062FF25597FFEB3F89B" bold="true" box="[246,264,1825,1849]" pageId="8" pageNumber="35">D</emphasis>
: Same, ventral view.
<emphasis id="B96F177AFFD80062FE30597FFE4FF89B" bold="true" box="[483,500,1825,1849]" pageId="8" pageNumber="35">E</emphasis>
: Extended vulva showing external thorn-like processes and ridges on oral valve and internal ventro-lateral ridges on aboral valve, ventral view.
<emphasis id="B96F177AFFD80062FD76591BFD0FF8FF" bold="true" box="[677,692,1861,1885]" pageId="8" pageNumber="35">F</emphasis>
: Enlarged view of thorn-like processes and ridges on oral valve, ventral view.
<emphasis id="B96F177AFFD80062FF075936FF53F822" bold="true" box="[212,232,1896,1920]" pageId="8" pageNumber="35">G</emphasis>
: Enlarged view of ridges on aboral valve, ventral view. Arrows indicate vulvae in female ring 3 (1, 2), broken femoral spine in vulva (3), thorn-like processes and ridges on oral valve (4) and internal ventro-lateral ridges on aboral valve (5).
<emphasis id="B96F177AFFD80062FAB759D2FF7CF86B" bold="true" pageId="8" pageNumber="35">Scale bars</emphasis>
: A = 2 mm; BE = 1 mm; FG = 0.2 mm.
</paragraph>
</caption>
<caption id="DF649BE0FFD90063FF4458D9FAF0F840" ID-DOI="http://doi.org/10.5281/zenodo.4417222" ID-Zenodo-Dep="4417222" httpUri="https://zenodo.org/record/4417222/files/figure.png" pageId="9" pageNumber="36" startId="9.[151,250,1671,1695]" targetBox="[259,1327,186,1634]" targetPageId="9">
<paragraph id="8BA4CB68FFD90063FF4458D9FAF0F840" blockId="9.[151,1437,1671,2019]" pageId="9" pageNumber="36">
<emphasis id="B96F177AFFD90063FF4458D9FEAEF93D" bold="true" box="[151,277,1671,1695]" pageId="9" pageNumber="36">FIGURE 7.</emphasis>
<taxonomicName id="4C1BB0EBFFD90063FECE58D9FE48F93D" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[285,499,1671,1695]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="9" pageNumber="36" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFD90063FECE58D9FE48F93D" box="[285,499,1671,1695]" italics="true" pageId="9" pageNumber="36">Carlogonus gayathri</emphasis>
</taxonomicName>
<emphasis id="B96F177AFFD90063FE2858D9FDF6F93D" bold="true" box="[507,589,1671,1695]" pageId="9" pageNumber="36">
<taxonomicNameLabel id="A25CAA01FFD90063FE2858D9FDF6F93D" box="[507,589,1671,1695]" pageId="9" pageNumber="36" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
, male.
<emphasis id="B96F177AFFD90063FD4F58D9FD15F93D" bold="true" box="[668,686,1671,1695]" pageId="9" pageNumber="36">A</emphasis>
: Gonopods, ventral view.
<emphasis id="B96F177AFFD90063FC1358D9FC6AF93D" bold="true" box="[960,977,1671,1695]" pageId="9" pageNumber="36">B</emphasis>
: Same, dorsal view.
<emphasis id="B96F177AFFD90063FB7858D9FB06F93D" bold="true" box="[1195,1213,1671,1695]" pageId="9" pageNumber="36">C</emphasis>
: Right gonopod after removing telopodite, dorsal view.
<emphasis id="B96F177AFFD90063FE3E58F5FE44F961" bold="true" box="[493,511,1707,1731]" pageId="9" pageNumber="36">D</emphasis>
: Left gonopod, lateral view.
<emphasis id="B96F177AFFD90063FCCD58F5FC94F961" bold="true" box="[798,815,1707,1731]" pageId="9" pageNumber="36">E</emphasis>
: Same, mesal view.
<emphasis id="B96F177AFFD90063FC2858F5FBB1F961" bold="true" box="[1019,1034,1707,1731]" pageId="9" pageNumber="36">F</emphasis>
: Left telopodite, ventral view.
<emphasis id="B96F177AFFD90063FAED58F5FAE9F961" bold="true" box="[1342,1362,1707,1731]" pageId="9" pageNumber="36">G</emphasis>
: Same, lateral view.
<emphasis id="B96F177AFFD90063FECF5891FE8BF945" bold="true" box="[284,304,1743,1767]" pageId="9" pageNumber="36">H</emphasis>
: Enlarged view of distal part of left telopodite, mesal view.
<emphasis id="B96F177AFFD90063FC4E5891FC1CF945" bold="true" box="[925,935,1743,1767]" pageId="9" pageNumber="36">I</emphasis>
: Enlarged view of blepharochaetae, lateral view.
<emphasis id="B96F177AFFD90063FF4458ADFE8BF8A9" bold="true" box="[151,304,1779,1803]" pageId="9" pageNumber="36">Abbreviations</emphasis>
:
<emphasis id="B96F177AFFD90063FEEC58ADFE3EF8A9" bold="true" box="[319,389,1779,1803]" pageId="9" pageNumber="36">alpAC</emphasis>
= antero-lateral process of anterior coxal fold,
<emphasis id="B96F177AFFD90063FCB858ADFC75F8A9" bold="true" box="[875,974,1779,1803]" pageId="9" pageNumber="36">amhpAC</emphasis>
= antero-mesal hook-like process of anterior coxal fold,
<emphasis id="B96F177AFFD90063FEDB5949FEECF88D" bold="true" box="[264,343,1815,1839]" pageId="9" pageNumber="36">amtAC</emphasis>
= antero-mesal thumb-like process of anterior coxal fold,
<emphasis id="B96F177AFFD90063FC485949FC7BF88D" bold="true" box="[923,960,1815,1839]" pageId="9" pageNumber="36">AC</emphasis>
= anterior coxal fold,
<emphasis id="B96F177AFFD90063FB4E5949FB15F88D" bold="true" box="[1181,1198,1815,1839]" pageId="9" pageNumber="36">B</emphasis>
= blepharochaetae,
<emphasis id="B96F177AFFD90063FAA55949FA33F88D" bold="true" box="[1398,1416,1815,1839]" pageId="9" pageNumber="36">C</emphasis>
= distal longitudinal crest,
<emphasis id="B96F177AFFD90063FE425965FE1BF8F1" bold="true" box="[401,416,1851,1875]" pageId="9" pageNumber="36">F</emphasis>
= femur,
<emphasis id="B96F177AFFD90063FDD05965FD9AF8F1" bold="true" box="[515,545,1851,1875]" pageId="9" pageNumber="36">FS</emphasis>
= femoral spine,
<emphasis id="B96F177AFFD90063FD025965FCBEF8F1" bold="true" box="[721,773,1851,1875]" pageId="9" pageNumber="36">dtpP</emphasis>
= distal thorne-like process of palette,
<emphasis id="B96F177AFFD90063FB5C5965FB25F8F1" bold="true" box="[1167,1182,1851,1875]" pageId="9" pageNumber="36">P</emphasis>
= palette,
<emphasis id="B96F177AFFD90063FADA5965FAFDF8F1" bold="true" box="[1289,1350,1851,1875]" pageId="9" pageNumber="36">apPC</emphasis>
= apical process of posterior coxal fold,
<emphasis id="B96F177AFFD90063FE0E5901FD99F8D5" bold="true" box="[477,546,1887,1911]" pageId="9" pageNumber="36">blpPC</emphasis>
= baso-lateral process of posterior coxal fold,
<emphasis id="B96F177AFFD90063FBD05901FBFAF8D5" bold="true" box="[1027,1089,1887,1911]" pageId="9" pageNumber="36">imPC</emphasis>
= internal mesal fold of posterior coxal fold,
<emphasis id="B96F177AFFD90063FED959DDFEFAF839" bold="true" box="[266,321,1923,1947]" pageId="9" pageNumber="36">lpPC</emphasis>
= lateral process of posterior coxal fold,
<emphasis id="B96F177AFFD90063FD3759DDFC92F839" bold="true" box="[740,809,1923,1947]" pageId="9" pageNumber="36">mpPC</emphasis>
= mesal process of posterior coxal fold,
<emphasis id="B96F177AFFD90063FB1B59DDFB51F839" bold="true" box="[1224,1258,1923,1947]" pageId="9" pageNumber="36">PC</emphasis>
= posterior coxal fold,
<emphasis id="B96F177AFFD90063FF1E59F9FF54F81D" bold="true" box="[205,239,1959,1983]" pageId="9" pageNumber="36">PX</emphasis>
= paracoxite,
<emphasis id="B96F177AFFD90063FE5259F9FE1BF81D" bold="true" box="[385,416,1959,1983]" pageId="9" pageNumber="36">ST</emphasis>
= sternite,
<emphasis id="B96F177AFFD90063FDC059F9FD9FF81D" bold="true" box="[531,548,1959,1983]" pageId="9" pageNumber="36">T</emphasis>
= telopodite,
<emphasis id="B96F177AFFD90063FD6259F9FD6BF81D" bold="true" box="[689,720,1959,1983]" pageId="9" pageNumber="36">TS</emphasis>
= tibial spine,
<emphasis id="B96F177AFFD90063FCBA59F9FC30F81D" bold="true" box="[873,907,1959,1983]" pageId="9" pageNumber="36">TT</emphasis>
= tibiotarsus. Arrows indicate indentation on lateral margin of anterior coxal fold (1) and basal bifurcated seta on tibial spine (2).
<emphasis id="B96F177AFFD90063FC755995FBAFF841" bold="true" box="[934,1044,1995,2019]" pageId="9" pageNumber="36">Scale bars</emphasis>
: AG = 1 mm; HI = 0.5 mm.
</paragraph>
</caption>
<caption id="DF649BE0FFDA0060FF44590EFBEEF876" ID-DOI="http://doi.org/10.5281/zenodo.4417224" ID-Zenodo-Dep="4417224" httpUri="https://zenodo.org/record/4417224/files/figure.png" pageId="10" pageNumber="37" startId="10.[151,250,1872,1896]" targetBox="[318,1271,201,1838]" targetPageId="10">
<paragraph id="8BA4CB68FFDA0060FF44590EFBEEF876" blockId="10.[151,1437,1872,2005]" pageId="10" pageNumber="37">
<emphasis id="B96F177AFFDA0060FF44590EFEAEF8CA" bold="true" box="[151,277,1872,1896]" pageId="10" pageNumber="37">FIGURE 8.</emphasis>
Previously known
<taxonomicName id="4C1BB0EBFFDA0060FE0C590EFDECF8CA" authorityName="Demange" authorityYear="1961" box="[479,599,1872,1896]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="10" pageNumber="37" phylum="Arthropoda" rank="genus">
<emphasis id="B96F177AFFDA0060FE0C590EFDECF8CA" box="[479,599,1872,1896]" italics="true" pageId="10" pageNumber="37">Carlogonus</emphasis>
</taxonomicName>
spp..
<emphasis id="B96F177AFFDA0060FD44590EFD12F8CA" bold="true" box="[663,681,1872,1896]" pageId="10" pageNumber="37">A</emphasis>
:
<taxonomicName id="4C1BB0EBFFDA0060FD6A590EFB99F8CA" authority="Demange, 1977" authorityName="Demange" authorityYear="1977" box="[697,1058,1872,1897]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="10" pageNumber="37" phylum="Arthropoda" rank="species" species="acifer">
<emphasis id="B96F177AFFDA0060FD6A590EFCCFF8CA" box="[697,884,1872,1896]" italics="true" pageId="10" pageNumber="37">Carlogonus acifer</emphasis>
Demange, 1977
</taxonomicName>
.
<emphasis id="B96F177AFFDA0060FBFE590EFB85F8CA" bold="true" box="[1069,1086,1872,1896]" pageId="10" pageNumber="37">B</emphasis>
:
<taxonomicName id="4C1BB0EBFFDA0060FB9E590EFF76F82E" authority="Demange, 1983" authorityName="Demange" authorityYear="1983" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="10" pageNumber="37" phylum="Arthropoda" rank="species" species="auriculus">
<emphasis id="B96F177AFFDA0060FB9E590EFA96F8CA" box="[1101,1325,1872,1896]" italics="true" pageId="10" pageNumber="37">Carlogonus auriculus</emphasis>
<bibRefCitation id="EF8AB699FFDA0060FAE6590FFF76F82E" author="Demange, J. - M." pageId="10" pageNumber="37" pagination="561 - 584" refId="ref7169" refString="Demange, J. - M. (1983) Donnees nouvelles sur la famille des Harpagophoridae (Myriapoda, Diplopoda). Bulletin du Museum national d'Histoire naturelle, Serie 4, Section A, 5 (2), 561 - 584." type="journal article" year="1983">Demange, 1983</bibRefCitation>
</taxonomicName>
.
<emphasis id="B96F177AFFDA0060FF05592AFF53F82E" bold="true" box="[214,232,1908,1932]" pageId="10" pageNumber="37">C</emphasis>
:
<taxonomicName id="4C1BB0EBFFDA0060FF26592AFD2AF82E" authority="Demange, 1977" authorityName="Demange" authorityYear="1977" box="[245,657,1908,1933]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="10" pageNumber="37" phylum="Arthropoda" rank="species" species="chowdaiahi">
<emphasis id="B96F177AFFDA0060FF26592AFE53F82E" box="[245,488,1908,1932]" italics="true" pageId="10" pageNumber="37">Carlogonus chowdaiahi</emphasis>
Demange, 1977
</taxonomicName>
.
<emphasis id="B96F177AFFDA0060FD49592AFD17F82E" bold="true" box="[666,684,1908,1932]" pageId="10" pageNumber="37">D</emphasis>
:
<taxonomicName id="4C1BB0EBFFDA0060FD6A592AFB94F82E" authority="(Attems, 1936)" baseAuthorityName="Attems" baseAuthorityYear="1936" box="[697,1071,1908,1932]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="10" pageNumber="37" phylum="Arthropoda" rank="species" species="exaratus">
<emphasis id="B96F177AFFDA0060FD6A592AFC36F82E" box="[697,909,1908,1932]" italics="true" pageId="10" pageNumber="37">Carlogonus exaratus</emphasis>
(
<bibRefCitation id="EF8AB699FFDA0060FC49592AFB9CF82E" author="Attems, C." box="[922,1063,1908,1932]" pageId="10" pageNumber="37" pagination="133 - 323" refId="ref6732" refString="Attems, C. (1936) Diplopoda of India. Memoirs of the Indian Museum, 11, 133 - 323." type="journal article" year="1936">Attems, 1936</bibRefCitation>
)
</taxonomicName>
.
<emphasis id="B96F177AFFDA0060FBE4592AFBF3F82E" bold="true" box="[1079,1096,1908,1932]" pageId="10" pageNumber="37">E</emphasis>
:
<taxonomicName id="4C1BB0EBFFDA0060FB86592AFF76F812" authority="Demange, 1977" authorityName="Demange" authorityYear="1977" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="10" pageNumber="37" phylum="Arthropoda" rank="species" species="palmatus">
<emphasis id="B96F177AFFDA0060FB86592AFA94F82E" box="[1109,1327,1908,1932]" italics="true" pageId="10" pageNumber="37">Carlogonus palmatus</emphasis>
Demange, 1977
</taxonomicName>
.
<emphasis id="B96F177AFFDA0060FF0A59C6FF53F812" bold="true" box="[217,232,1944,1968]" pageId="10" pageNumber="37">F</emphasis>
:
<taxonomicName id="4C1BB0EBFFDA0060FF2B59C6FDC5F812" authority="(Attems, 1936)" baseAuthorityName="Attems" baseAuthorityYear="1936" box="[248,638,1944,1968]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="10" pageNumber="37" phylum="Arthropoda" rank="species" species="robustior">
<emphasis id="B96F177AFFDA0060FF2B59C6FE6EF812" box="[248,469,1944,1968]" italics="true" pageId="10" pageNumber="37">Carlogonus robustior</emphasis>
(
<bibRefCitation id="EF8AB699FFDA0060FE3659C6FDCDF812" author="Attems, C." box="[485,630,1944,1968]" pageId="10" pageNumber="37" pagination="133 - 323" refId="ref6732" refString="Attems, C. (1936) Diplopoda of India. Memoirs of the Indian Museum, 11, 133 - 323." type="journal article" year="1936">Attems, 1936</bibRefCitation>
)
</taxonomicName>
.
<emphasis id="B96F177AFFDA0060FD5A59C6FD26F812" bold="true" box="[649,669,1944,1968]" pageId="10" pageNumber="37">G</emphasis>
:
<taxonomicName id="4C1BB0EBFFDA0060FD7F59C6FB98F812" authority="(Carl, 1941)" authorityName="Mauries et al." authorityYear="2001" baseAuthorityName="Carl" baseAuthorityYear="1941" box="[684,1059,1944,1968]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="10" pageNumber="37" phylum="Arthropoda" rank="species" species="subvalidus">
<emphasis id="B96F177AFFDA0060FD7F59C6FC22F812" box="[684,921,1944,1968]" italics="true" pageId="10" pageNumber="37">Carlogonus subvalidus</emphasis>
(
<bibRefCitation id="EF8AB699FFDA0060FC7A59C6FBA0F812" author="Carl, J." box="[937,1051,1944,1968]" pageId="10" pageNumber="37" pagination="569 - 714" refId="ref6848" refString="Carl, J. (1941) Diplopoden aus Sudindien und Ceylon. 2. Teil: Nematophora und Juliformia. Revue suisse de Zoologie, 48, 569 - 714. https: // doi. org / 10.5962 / bhl. part. 154483" type="journal article" year="1941">Carl, 1941</bibRefCitation>
)
</taxonomicName>
.
<emphasis id="B96F177AFFDA0060FBFC59C6FBF8F812" bold="true" box="[1071,1091,1944,1968]" pageId="10" pageNumber="37">H</emphasis>
:
<taxonomicName id="4C1BB0EBFFDA0060FB8159C6FF71F876" authority="Demange, 1981" authorityName="Demange" authorityYear="1981" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="10" pageNumber="37" phylum="Arthropoda" rank="species" species="verhoeffi">
<emphasis id="B96F177AFFDA0060FB8159C6FA96F812" box="[1106,1325,1944,1968]" italics="true" pageId="10" pageNumber="37">Carlogonus verhoeffi</emphasis>
<bibRefCitation id="EF8AB699FFDA0060FAE659C7FF71F876" author="Demange, J. - M." pageId="10" pageNumber="37" pagination="63 - 80" refId="ref7139" refString="Demange, J. - M. (1981) Spirostreptida, Harpagophoridae (Myriapoda-Diplopoda) de Sri Lanka. Entomologica Scandinavica, Supplement 11, 63 - 80." type="journal article" year="1981">Demange, 1981</bibRefCitation>
</taxonomicName>
(figures reproduced from
<bibRefCitation id="EF8AB699FFDA0060FE0759E2FDD2F876" author="Attems, C." box="[468,617,1980,2004]" pageId="10" pageNumber="37" pagination="133 - 323" refId="ref6732" refString="Attems, C. (1936) Diplopoda of India. Memoirs of the Indian Museum, 11, 133 - 323." type="journal article" year="1936">Attems (1936)</bibRefCitation>
,
<bibRefCitation id="EF8AB699FFDA0060FDA059E2FD50F876" author="Carl, J." box="[627,747,1980,2004]" pageId="10" pageNumber="37" pagination="569 - 714" refId="ref6848" refString="Carl, J. (1941) Diplopoden aus Sudindien und Ceylon. 2. Teil: Nematophora und Juliformia. Revue suisse de Zoologie, 48, 569 - 714. https: // doi. org / 10.5962 / bhl. part. 154483" type="journal article" year="1941">Carl (1941)</bibRefCitation>
,
<bibRefCitation id="EF8AB699FFDA0060FD2559E3FC1DF876" author="Demange, J. - M." box="[758,934,1980,2005]" pageId="10" pageNumber="37" pagination="231 - 235" refId="ref7044" refString="Demange, J. - M. (1977 a) Harpagophoridae (Myriapodes, Diplopodes) de l'Inde nouveaux ou peu connus. Bulletin du Museum national d'Histoire naturelle, Serie 3, Zoologie, 231, 231 - 235." type="journal article" year="1977">Demange (1977a</bibRefCitation>
, b; 1981; 1983)).
</paragraph>
</caption>
<paragraph id="8BA4CB68FFDB0061FF145EC8FE66FF77" blockId="11.[151,1437,150,501]" pageId="11" pageNumber="38">
<emphasis id="B96F177AFFDB0061FF145EC8FDA0FF13" bold="true" box="[199,539,150,177]" pageId="11" pageNumber="38">GenBank accession number.</emphasis>
The GenBank accession number of the ORF region (positions 292462) of the new sequence is
<accessionNumber id="9448568BFFDB0061FE875EE5FE62FF77" box="[340,473,187,213]" httpUri="https://www.ebi.ac.uk/ena/browser/api/embl/MN887639" pageId="11" pageNumber="38">MN887639</accessionNumber>
.
</paragraph>
<paragraph id="8BA4CB68FFDB0061FF145E81FE7FFEBF" blockId="11.[151,1437,150,501]" pageId="11" pageNumber="38">
<emphasis id="B96F177AFFDB0061FF145E81FEF2FF5B" bold="true" box="[199,329,223,249]" pageId="11" pageNumber="38">Phylogeny.</emphasis>
Phylogenetic analysis shows that
<taxonomicName id="4C1BB0EBFFDB0061FD155E81FCF1FF5B" authorityName="Demange" authorityYear="1961" box="[710,842,223,249]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="11" pageNumber="38" phylum="Arthropoda" rank="genus">
<emphasis id="B96F177AFFDB0061FD155E81FCF1FF5B" box="[710,842,223,249]" italics="true" pageId="11" pageNumber="38">Carlogonus</emphasis>
</taxonomicName>
is the sister-taxon to
<taxonomicName id="4C1BB0EBFFDB0061FBE45E81FB01FF5B" authorityName="Pocock" authorityYear="1894" box="[1079,1210,223,249]" class="Diplopoda" family="Harpagophoridae" genus="Thyropygus" kingdom="Animalia" order="Spirostreptida" pageId="11" pageNumber="38" phylum="Arthropoda" rank="genus">
<emphasis id="B96F177AFFDB0061FBE45E81FB01FF5B" box="[1079,1210,223,249]" italics="true" pageId="11" pageNumber="38">Thyropygus</emphasis>
</taxonomicName>
, with
<taxonomicName id="4C1BB0EBFFDB0061FAD35E81FA26FF5B" authorityName="Attems" authorityYear="1914" box="[1280,1437,223,249]" class="Diplopoda" family="Harpagophoridae" genus="Anurostreptus" kingdom="Animalia" order="Spirostreptida" pageId="11" pageNumber="38" phylum="Arthropoda" rank="genus">
<emphasis id="B96F177AFFDB0061FAD35E81FA26FF5B" box="[1280,1437,223,249]" italics="true" pageId="11" pageNumber="38">Anurostreptus</emphasis>
</taxonomicName>
in a basal position (
<figureCitation id="1320D7EDFFDB0061FEA15F5DFE08FEBF" box="[370,435,259,285]" captionStart="FIGURE 1" captionStartId="3.[151,250,1648,1672]" captionTargetBox="[216,1374,723,1602]" captionTargetId="figure-443@3.[187,1400,696,1623]" captionTargetPageId="3" captionText="FIGURE 1. Phylogenetic relationship of Carlogonus Demange, 1961 using maximum likelihood analysis (ML) and Bayesian Inference (BI) showing that Carlogonus is sister-taxon to Thyropygus Pocock, 1894 with strong support (99% for ML bootstrap replicates and a BI posterior probability of 0.99)." figureDoi="http://doi.org/10.5281/zenodo.4417205" httpUri="https://zenodo.org/record/4417205/files/figure.png" pageId="11" pageNumber="38">Fig. 1</figureCitation>
).
</paragraph>
<paragraph id="8BA4CB68FFDB0061FF145F79FEB4FE57" blockId="11.[151,1437,150,501]" pageId="11" pageNumber="38">
<emphasis id="B96F177AFFDB0061FF145F79FEBDFEE3" bold="true" box="[199,262,295,321]" pageId="11" pageNumber="38">Note.</emphasis>
A broken femoral spine was found in the left vulva of one of the female specimens of
<taxonomicName id="4C1BB0EBFFDB0061FB225F79FAC9FEE3" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[1265,1394,295,321]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="11" pageNumber="38" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFDB0061FB225F79FABFFEE3" box="[1265,1284,295,321]" italics="true" pageId="11" pageNumber="38">C</emphasis>
.
<emphasis id="B96F177AFFDB0061FAC05F79FAC9FEE3" box="[1299,1394,295,321]" italics="true" pageId="11" pageNumber="38">gayathri</emphasis>
</taxonomicName>
<emphasis id="B96F177AFFDB0061FAA85F79FF73FEC7" bold="true" pageId="11" pageNumber="38">
<taxonomicNameLabel id="A25CAA01FFDB0061FAA85F79FF73FEC7" pageId="11" pageNumber="38" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
(
<figureCitation id="1320D7EDFFDB0061FF0A5F15FE89FEC7" box="[217,306,331,357]" captionStart="FIGURE 6" captionStartId="8.[151,250,1788,1812]" captionTargetBox="[160,1427,564,1753]" captionTargetId="figure-96@8.[154,1434,558,1762]" captionTargetPageId="8" captionText="FIGURE 6. Carlogonus gayathri sp. nov.. A: Female ring 3 showing vulvae, caudal view. B: Vulva, lateral view. C: Same, mesal view. D: Same, ventral view. E: Extended vulva showing external thorn-like processes and ridges on oral valve and internal ventro-lateral ridges on aboral valve, ventral view. F: Enlarged view of thorn-like processes and ridges on oral valve, ventral view. G: Enlarged view of ridges on aboral valve, ventral view. Arrows indicate vulvae in female ring 3 (1, 2), broken femoral spine in vulva (3), thorn-like processes and ridges on oral valve (4) and internal ventro-lateral ridges on aboral valve (5). Scale bars: A = 2 mm; BE = 1 mm; FG = 0.2 mm." figureDoi="http://doi.org/10.5281/zenodo.4417220" httpUri="https://zenodo.org/record/4417220/files/figure.png" pageId="11" pageNumber="38">Fig. 6B</figureCitation>
, arrow 3). One male with a broken-off femoral spine on the left telopodite was also found. The occurrence of a broken femoral spine in the vulva may indicate its use as an accessory copulatory structure. It can be hypothesised that during copulation, the male
<taxonomicName id="4C1BB0EBFFDB0061FD445FCDFCADFE0F" authority="Sankaran &amp; Sebastian, 2020" authorityName="Sankaran &amp; Sebastian" authorityYear="2020" box="[663,790,403,429]" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="11" pageNumber="38" phylum="Arthropoda" rank="species" species="gayathri" status="sp. nov.">
<emphasis id="B96F177AFFDB0061FD445FCDFD11FE0F" box="[663,682,403,429]" italics="true" pageId="11" pageNumber="38">C</emphasis>
.
<emphasis id="B96F177AFFDB0061FD645FCDFCADFE0F" box="[695,790,403,429]" italics="true" pageId="11" pageNumber="38">gayathri</emphasis>
</taxonomicName>
<emphasis id="B96F177AFFDB0061FCCF5FCDFCCEFE0F" bold="true" box="[796,885,403,429]" pageId="11" pageNumber="38">
<taxonomicNameLabel id="A25CAA01FFDB0061FCCF5FCDFCCEFE0F" box="[796,885,403,429]" pageId="11" pageNumber="38" rank="species">sp. nov.</taxonomicNameLabel>
</emphasis>
(and possibly the males of other known
<taxonomicName id="4C1BB0EBFFDB0061FAE55FCDFF05FE72" authorityName="Demange" authorityYear="1961" class="Diplopoda" family="Harpagophoridae" genus="Carlogonus" kingdom="Animalia" order="Spirostreptida" pageId="11" pageNumber="38" phylum="Arthropoda" rank="genus">
<emphasis id="B96F177AFFDB0061FAE55FCDFF05FE72" italics="true" pageId="11" pageNumber="38">Carlogonus</emphasis>
</taxonomicName>
species) may use the femoral spine to keep the valves of the vulva open in order to support the insertion of the telopodite.
</paragraph>
</subSubSection>
</treatment>
</document>