treatments-xml/data/B0/CC/6F/B0CC6F238DFB5B4ABAD0E8AC5114D687.xml

<document ID-DOI="http://dx.doi.org/10.3897/BDJ.10.e94735" ID-Pensoft-Pub="1314-2828-10-e94735" ID-Pensoft-UUID="0FEAD9146A22540F904BB0F7BAE1583D" ID-ZooBank="BB43C5BEDCEC46949FC1FDC2B499FCA0" ModsDocID="1314-2828-10-e94735" checkinTime="1666647965631" checkinUser="pensoft" docAuthor="Zhong, Yang, Gong, Xusheng &amp; Yu, Hao" docDate="2022" docId="B0CC6F238DFB5B4ABAD0E8AC5114D687" docLanguage="en" docName="BiodivDatJour 10: e94735" docOrigin="Biodiversity Data Journal 10" docPubDate="2022-10-24" docSource="http://dx.doi.org/10.3897/BDJ.10.e94735" docTitle="Clubiona xianning Zhong &amp; Yu 2022, sp. n." docType="treatment" docVersion="1" id="0FEAD9146A22540F904BB0F7BAE1583D" lastPageNumber="94735" masterDocId="0FEAD9146A22540F904BB0F7BAE1583D" masterDocTitle="A new species of the Clubiona corticalis - group (Araneae, Clubionidae) from Jiugong Mountains, Hubei Province, central China" masterLastPageNumber="94735" masterPageNumber="94735" pageNumber="94735" updateTime="1666647965631" updateUser="pensoft">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>A new species of the Clubiona corticalis - group (Araneae, Clubionidae) from Jiugong Mountains, Hubei Province, central China</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Zhong, Yang</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-0517-4582</mods:nameIdentifier>
<mods:affiliation>Administrative Commission of Jiugongshan National Nature Reserve of Hubei Xianning, Xianning, China &amp; School of Nuclear Technology and Chemistry &amp; Biology, Hubei University of Science and Technology, Xianning, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Gong, Xusheng</mods:namePart>
<mods:affiliation>School of Nuclear Technology and Chemistry &amp; Biology, Hubei University of Science and Technology, Xianning, China</mods:affiliation>
<mods:nameIdentifier type="email">gxs5339@stu.hubu.edu.cn</mods:nameIdentifier>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Yu, Hao</mods:namePart>
<mods:affiliation>School of Life Sciences, Guizhou Normal University, Guiyang, China</mods:affiliation>
<mods:nameIdentifier type="email">insect1986@126.com</mods:nameIdentifier>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>Biodiversity Data Journal</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2022</mods:date>
<mods:detail type="pubDate">
<mods:number>2022-10-24</mods:number>
</mods:detail>
<mods:detail type="volume">
<mods:number>10</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>94735</mods:start>
<mods:end>94735</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/BDJ.10.e94735</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.10.e94735</mods:identifier>
<mods:identifier type="Pensoft-Pub">1314-2828-10-e94735</mods:identifier>
<mods:identifier type="ZooBank">BB43C5BEDCEC46949FC1FDC2B499FCA0</mods:identifier>
<mods:identifier type="Pensoft-UUID">0FEAD9146A22540F904BB0F7BAE1583D</mods:identifier>
</mods:mods>
<treatment LSID="urn:lsid:plazi:treatment:B0CC6F238DFB5B4ABAD0E8AC5114D687" httpUri="http://treatment.plazi.org/id/B0CC6F238DFB5B4ABAD0E8AC5114D687" lastPageNumber="94735" pageId="0" pageNumber="94735">
<subSubSection pageId="0" pageNumber="94735" type="nomenclature">
<paragraph pageId="0" pageNumber="94735">
<taxonomicName LSID="B0CC6F23-8DFB-5B4A-BAD0-E8AC5114D687" authority="Zhong &amp; Yu" authorityName="Zhong &amp; Yu" authorityYear="2022" class="Arachnida" family="Clubionidae" genus="Clubiona" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Clubiona xianning" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="xianning" status="sp. n.">Clubiona xianning Zhong &amp; Yu</taxonomicName>
<taxonomicNameLabel pageId="0" pageNumber="94735">sp. n.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="94735" type="materials_examined">
<paragraph pageId="0" pageNumber="94735">Materials</paragraph>
<paragraph pageId="0" pageNumber="94735">
<materialsCitation accessionNumber="OP675437" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="by hand" collectorName="Yang Zhong, Xusheng Gong, Qianle Lu, Zhong, Yu" country="China" determinerName="Hao Yu" latitude="29.39" location="Jiugongshan Nature Reserve" longitude="114.65" pageId="0" pageNumber="94735" specimenCount="1" specimenCount-male="1" stateProvince="Hubei" typeStatus="Holotype">
<emphasis bold="true" pageId="0" pageNumber="94735">Type status:</emphasis>
<materialsCitation accessionNumber="OP675437" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="by hand" collectorName="Yang Zhong, Xusheng Gong, Qianle Lu, Zhong, Yu" country="China" determinerName="Hao Yu" latitude="29.39" location="Jiugongshan Nature Reserve" longitude="114.65" specimenCount="1" specimenCount-male="1" stateProvince="Hubei" typeStatus="Holotype">
<typeStatus pageId="0" pageNumber="94735">Holotype</typeStatus>
. 
<emphasis bold="true" pageId="0" pageNumber="94735">Occurrence:</emphasis>
recordedBy: 
<collectorName pageId="0" pageNumber="94735">Yang Zhong, Xusheng Gong, Qianle Lu</collectorName>
; individualID: YHCLU0272; individualCount: 
<specimenCount pageId="0" pageNumber="94735" type="generic">1</specimenCount>
; sex: 
<specimenType pageId="0" pageNumber="94735">male</specimenType>
; lifeStage: 
<specimenType pageId="0" pageNumber="94735">adult</specimenType>
; behavior: foraging; preparations: whole animal (ETOH); associatedSequences: GenBank: 
<accessionNumber httpUri="http://www.ncbi.nlm.nih.gov/nucleotide/OP675437">OP675437</accessionNumber>
; occurrenceID: 
<uuid>1312422A-3320-5AE6-9BA9-5DCB3013B14F</uuid>
; 
<emphasis bold="true" pageId="0" pageNumber="94735">Taxon:</emphasis>
order: Araneae; family: Clubionidae; genus: Clubiona; specificEpithet: xianning; scientificNameAuthorship: 
<collectorName>Zhong</collectorName>
&amp; 
<collectorName>Yu</collectorName>
; 
<emphasis bold="true" pageId="0" pageNumber="94735">Location:</emphasis>
continent: Asian; country: 
<collectingCountry name="China" pageId="0" pageNumber="94735">China</collectingCountry>
; countryCode: CHN; stateProvince: 
<collectingRegion country="China" name="Hubei">Hubei</collectingRegion>
; county: Tongshan; municipality: Xianning; locality: 
<location LSID="urn:lsid:plazi:treatment:B0CC6F238DFB5B4ABAD0E8AC5114D687:343CBFA9485AB410A7F2E823AA4A20AD" country="China" latitude="29.39" longitude="114.65" name="Jiugongshan Nature Reserve" pageId="0" pageNumber="94735" stateProvince="Hubei">Jiugongshan Nature Reserve</location>
; decimalLatitude: 
<geoCoordinate orientation="latitude" pageId="0" pageNumber="94735" value="29.39">29.39</geoCoordinate>
; decimalLongitude: 
<geoCoordinate orientation="longitude" pageId="0" pageNumber="94735" value="114.65">114.65</geoCoordinate>
; 
<emphasis bold="true" pageId="0" pageNumber="94735">Identification:</emphasis>
identifiedBy: 
<determinerName pageId="0" pageNumber="94735">Hao Yu</determinerName>
; dateIdentified: 2022-05; 
<emphasis bold="true" pageId="0" pageNumber="94735">Event:</emphasis>
samplingProtocol: 
<collectingMethod pageId="0" pageNumber="94735">by hand</collectingMethod>
; samplingEffort: 
<quantity metricMagnitude="4" metricUnit="m" metricValue="1.0" unit="km" value="10.0">10 km</quantity>
by foot; year: 2020; month: 7; day: 4; 
<emphasis bold="true" pageId="0" pageNumber="94735">Record Level:</emphasis>
basisOfRecord: PreservedSpecimen 
<materialsCitation accessionNumber="OP675436" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="by hand" collectorName="Yang Zhong, Xusheng Gong, Qianle Lu, Zhong, Yu" country="China" determinerName="Hao Yu" latitude="29.39" location="Jiugongshan Nature Reserve" longitude="114.65" pageId="0" pageNumber="94735" specimenCount="1" specimenCount-female="1" stateProvince="Hubei" typeStatus="Holotype">
<emphasis bold="true" pageId="0" pageNumber="94735">Type status:</emphasis>
<materialsCitation accessionNumber="OP675436" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="by hand" collectorName="Yang Zhong, Xusheng Gong, Qianle Lu, Zhong, Yu" country="China" determinerName="Hao Yu" latitude="29.39" location="Jiugongshan Nature Reserve" longitude="114.65" specimenCount="1" specimenCount-female="1" stateProvince="Hubei" typeStatus="Holotype">
<typeStatus pageId="0" pageNumber="94735">Holotype</typeStatus>
. 
<emphasis bold="true" pageId="0" pageNumber="94735">Occurrence:</emphasis>
recordedBy: 
<collectorName pageId="0" pageNumber="94735">Yang Zhong, Xusheng Gong, Qianle Lu</collectorName>
; individualID: YHCLU0273; individualCount: 
<specimenCount pageId="0" pageNumber="94735" type="generic">1</specimenCount>
; sex: 
<specimenType pageId="0" pageNumber="94735">female</specimenType>
; lifeStage: 
<specimenType pageId="0" pageNumber="94735">adult</specimenType>
; behavior: foraging; preparations: whole animal (ETOH); associatedSequences: GenBank: 
<accessionNumber httpUri="http://www.ncbi.nlm.nih.gov/nucleotide/OP675436">OP675436</accessionNumber>
; occurrenceID: 
<uuid>085B9104-F139-5EC1-9913-5A5DB9C7C9C6</uuid>
; 
<emphasis bold="true" pageId="0" pageNumber="94735">Taxon:</emphasis>
order: Araneae; family: Clubionidae; genus: Clubiona; specificEpithet: xianning; scientificNameAuthorship: 
<collectorName>Zhong</collectorName>
&amp; 
<collectorName>Yu</collectorName>
; 
<emphasis bold="true" pageId="0" pageNumber="94735">Location:</emphasis>
continent: Asian; country: 
<collectingCountry name="China" pageId="0" pageNumber="94735">China</collectingCountry>
; countryCode: CHN; stateProvince: 
<collectingRegion country="China" name="Hubei">Hubei</collectingRegion>
; county: Tongshan; municipality: Xianning; locality: 
<location LSID="urn:lsid:plazi:treatment:B0CC6F238DFB5B4ABAD0E8AC5114D687:93059112293DB6170191B43BDE18B15F" country="China" latitude="29.39" longitude="114.65" name="Jiugongshan Nature Reserve" pageId="0" pageNumber="94735" stateProvince="Hubei">Jiugongshan Nature Reserve</location>
; decimalLatitude: 
<geoCoordinate orientation="latitude" pageId="0" pageNumber="94735" value="29.39">29.39</geoCoordinate>
; decimalLongitude: 
<geoCoordinate orientation="longitude" pageId="0" pageNumber="94735" value="114.65">114.65</geoCoordinate>
; 
<emphasis bold="true" pageId="0" pageNumber="94735">Identification:</emphasis>
identifiedBy: 
<determinerName pageId="0" pageNumber="94735">Hao Yu</determinerName>
; dateIdentified: 2022-05; 
<emphasis bold="true" pageId="0" pageNumber="94735">Event:</emphasis>
samplingProtocol: 
<collectingMethod pageId="0" pageNumber="94735">by hand</collectingMethod>
; samplingEffort: 
<quantity metricMagnitude="4" metricUnit="m" metricValue="1.0" unit="km" value="10.0">10 km</quantity>
by foot; year: 2020; month: 7; day: 4; 
<emphasis bold="true" pageId="0" pageNumber="94735">Record Level:</emphasis>
basisOfRecord: PreservedSpecimen
</materialsCitation>
</materialsCitation>
</materialsCitation>
</materialsCitation>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="94735" type="description">
<paragraph pageId="0" pageNumber="94735">Description</paragraph>
<paragraph pageId="0" pageNumber="94735">
<emphasis bold="true" pageId="0" pageNumber="94735">Male</emphasis>
(Fig. 
<figureCitation captionStart="Figure 4" captionStartId="F8123841" captionText="Figure 4. Clubiona xianning sp. nov., female paratype and male holotype. A Intact epigyne, ventral view; B Cleared epigyne, ventral view; C Cleared vulva, dorsal view; D Vulva, cleared and embedded in Arabic gum, dorsal view; E Male habitus, dorsal view; F Male habitus, lateral view; G Female habitus, dorsal view; H Female habitus, ventral view. Abbreviations: A = atrium; AAM = atrial anterior margin; BS = bursa; CO = copulatory opening; FD = fertilisation duct; SB = spermathecal base; SH = spermathecal head; SP = spermatheca; SS = spermathecal stalk. Scale bars: 0.2 mm (equal for A and B, equal for C and D); 2 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.10.e94735.figure4" httpUri="https://binary.pensoft.net/fig/737479" pageId="0" pageNumber="94735">4</figureCitation>
E and F). Total length 5.31; carapace 2.27 long, 1.73 wide; abdomen 3.04 long, 1.31 wide.
</paragraph>
<paragraph pageId="0" pageNumber="94735">
Colour of the living holotype male was uniformly brown (Fig. 
<figureCitation captionStart="Figure 2" captionStartId="F8123843" captionText="Figure 2. Clubiona xianning sp. nov., male holotype (A, B) and female paratype (C), live specimens. Photographs by Qianle Lu (Shenzhen, Guangdong)." figureDoi="10.3897/BDJ.10.e94735.figure2" httpUri="https://binary.pensoft.net/fig/737480" pageId="0" pageNumber="94735">2</figureCitation>
A and B). Carapace (Fig. 
<figureCitation captionStart="Figure 4" captionStartId="F8123841" captionText="Figure 4. Clubiona xianning sp. nov., female paratype and male holotype. A Intact epigyne, ventral view; B Cleared epigyne, ventral view; C Cleared vulva, dorsal view; D Vulva, cleared and embedded in Arabic gum, dorsal view; E Male habitus, dorsal view; F Male habitus, lateral view; G Female habitus, dorsal view; H Female habitus, ventral view. Abbreviations: A = atrium; AAM = atrial anterior margin; BS = bursa; CO = copulatory opening; FD = fertilisation duct; SB = spermathecal base; SH = spermathecal head; SP = spermatheca; SS = spermathecal stalk. Scale bars: 0.2 mm (equal for A and B, equal for C and D); 2 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.10.e94735.figure4" httpUri="https://binary.pensoft.net/fig/737479" pageId="0" pageNumber="94735">4</figureCitation>
E and F) elongate, oval, light brown in alcohol, uniformly coloured, without pattern, fovea red; pars cephalica distinctly narrowed, cervical groove radial groove indistinct; tegument smooth, with erect, thin, dark setae on front ridge. Eyes: in dorsal view, anterior eye row (AER) slightly recurved, posterior eye row (PER) almost straight, PER wider than AER. Eye sizes and interdistances: anterior median eyes (AME) 0.13, anterior lateral eyes (ALE) 0.12, posterior median eyes (PME) 0.11, posterior lateral eyes (PLE) 0.09, distance between AMEs (AME-AME) 0.07, distance between AME and ALE (AME-ALE) 0.03, distance between PMEs (PME-PME) 0.19, distance between PME and PLE (PME-PLE) 0.09. Length of median ocular quadrangle (MOQL) 0.33, MOQ anterior width (MOQA) 0.29, MOQ posterior width (MOQP) 0.54. Chelicerae robust, light orange, with red fangs, with four promarginal and two retromarginal teeth. Sternum nearly shield-shaped, yellowish-white, 1.21 long, 0.86 wide. Labium and endites coloured as carapace.
</paragraph>
<paragraph pageId="0" pageNumber="94735">
Abdomen (Fig. 
<figureCitation captionStart="Figure 4" captionStartId="F8123841" captionText="Figure 4. Clubiona xianning sp. nov., female paratype and male holotype. A Intact epigyne, ventral view; B Cleared epigyne, ventral view; C Cleared vulva, dorsal view; D Vulva, cleared and embedded in Arabic gum, dorsal view; E Male habitus, dorsal view; F Male habitus, lateral view; G Female habitus, dorsal view; H Female habitus, ventral view. Abbreviations: A = atrium; AAM = atrial anterior margin; BS = bursa; CO = copulatory opening; FD = fertilisation duct; SB = spermathecal base; SH = spermathecal head; SP = spermatheca; SS = spermathecal stalk. Scale bars: 0.2 mm (equal for A and B, equal for C and D); 2 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.10.e94735.figure4" httpUri="https://binary.pensoft.net/fig/737479" pageId="0" pageNumber="94735">4</figureCitation>
E and F) oval and light brown, dorsally with a wide and more or less oblong scutum extending ca. 2/3 of abdomen length, with two pairs of inconspicuous muscle depressions on either side; venter white with no distinct pattern; spinnerets yellowish-white.
</paragraph>
<paragraph pageId="0" pageNumber="94735">
Legs uniformly yellowish-white in ethanol (Fig. 
<figureCitation captionStart="Figure 4" captionStartId="F8123841" captionText="Figure 4. Clubiona xianning sp. nov., female paratype and male holotype. A Intact epigyne, ventral view; B Cleared epigyne, ventral view; C Cleared vulva, dorsal view; D Vulva, cleared and embedded in Arabic gum, dorsal view; E Male habitus, dorsal view; F Male habitus, lateral view; G Female habitus, dorsal view; H Female habitus, ventral view. Abbreviations: A = atrium; AAM = atrial anterior margin; BS = bursa; CO = copulatory opening; FD = fertilisation duct; SB = spermathecal base; SH = spermathecal head; SP = spermatheca; SS = spermathecal stalk. Scale bars: 0.2 mm (equal for A and B, equal for C and D); 2 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.10.e94735.figure4" httpUri="https://binary.pensoft.net/fig/737479" pageId="0" pageNumber="94735">4</figureCitation>
E and F). Leg length: I 5.85 (1.73, 2.32, 1.24, 0.57), II 6.29 (1.79, 2.44, 1.33, 0.73), III 5.27 (1.69, 1.60, 1.58, 0.40), IV 7.56 (2.19, 2.54, 2.31, 0.52).
</paragraph>
<paragraph pageId="0" pageNumber="94735">
Palp (Fig. 
<figureCitation captionStart="Figure 3" captionStartId="F8123839" captionText="Figure 3. Male left palp of the holotype of Clubiona xianning sp. nov. A Prolateral view; B Rretrolateral view; C Bulb, prolateral view; D Bulb, ventral view; E Bulb, retrolateral view. Abbreviations: C = conductor; E = embolus; EB = embolic base; RTA = retrolateral tibial apophysis; VTA = ventral tibial apophysis. Scale bars: 0.2 mm (equal for A and B, equal for C-E)." figureDoi="10.3897/BDJ.10.e94735.figure3" httpUri="https://binary.pensoft.net/fig/737476" pageId="0" pageNumber="94735">3</figureCitation>
A-E). Femur and patella unmodified. Tibia relatively short, about 2/5 of cymbium length, with two apophyses: a retrolateral one (RTA) that is heavily sclerotised, ca. 1/2 of palpal tibia length, more or less blade-shaped; a partly membranous, laminar apophysis (VTA), ca. 1/3 of palpal tibia length. Bulb nearly pyriform, slightly excavated on prolatero-apical side to accommodate embolus; tegulum oval and slightly expanded, ca. 1.45 longer than wide, sperm duct indistinct in venter view; subtegulum (ST) large, located prolaterally. Embolus (E) wide and heavily sclerotised, about 2/3 of the tegulum length, dagger-shaped, gradually tapering towards its apex, its tip sharp, slightly curved and extending to apex of cymbium. Conductor long and membranous, irregular-shaped in venter view and triangular in retrolateral view, its tip extending above apex of embolus.
</paragraph>
<paragraph pageId="0" pageNumber="94735">
<emphasis bold="true" pageId="0" pageNumber="94735">Female</emphasis>
(Fig. 
<figureCitation captionStart="Figure 4" captionStartId="F8123841" captionText="Figure 4. Clubiona xianning sp. nov., female paratype and male holotype. A Intact epigyne, ventral view; B Cleared epigyne, ventral view; C Cleared vulva, dorsal view; D Vulva, cleared and embedded in Arabic gum, dorsal view; E Male habitus, dorsal view; F Male habitus, lateral view; G Female habitus, dorsal view; H Female habitus, ventral view. Abbreviations: A = atrium; AAM = atrial anterior margin; BS = bursa; CO = copulatory opening; FD = fertilisation duct; SB = spermathecal base; SH = spermathecal head; SP = spermatheca; SS = spermathecal stalk. Scale bars: 0.2 mm (equal for A and B, equal for C and D); 2 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.10.e94735.figure4" httpUri="https://binary.pensoft.net/fig/737479" pageId="0" pageNumber="94735">4</figureCitation>
G and H). Total length 6.15; carapace 2.64 long, 1.98 wide; abdomen 3.51 long, 1.90 wide. Eye sizes and interdistances: AME 0.16, ALE 0.15, PME 0.14, PLE 0.13; AME-AME 0.07, AME-ALE 0.04, PME-PME 0.22, PME-PLE 0.04. MOQL 0.40, MOQA 0.36, MOQP 0.53. Sternum 1.39 long, 0.96 wide. Measurements of legs: I 5.48 (1.69, 2.12, 1.05, 0.62), II 5.93 (1.90, 2.28, 1.09, 0.66), III 5.29 (1.82, 1.90, 1.14, 0.44), IV 8.07 (2.52, 2.64, 2.32, 0.59). General characters as in female, but slightly larger in size and lighter in colour.
</paragraph>
<paragraph pageId="0" pageNumber="94735">
Epigyne (Fig. 
<figureCitation captionStart="Figure 4" captionStartId="F8123841" captionText="Figure 4. Clubiona xianning sp. nov., female paratype and male holotype. A Intact epigyne, ventral view; B Cleared epigyne, ventral view; C Cleared vulva, dorsal view; D Vulva, cleared and embedded in Arabic gum, dorsal view; E Male habitus, dorsal view; F Male habitus, lateral view; G Female habitus, dorsal view; H Female habitus, ventral view. Abbreviations: A = atrium; AAM = atrial anterior margin; BS = bursa; CO = copulatory opening; FD = fertilisation duct; SB = spermathecal base; SH = spermathecal head; SP = spermatheca; SS = spermathecal stalk. Scale bars: 0.2 mm (equal for A and B, equal for C and D); 2 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.10.e94735.figure4" httpUri="https://binary.pensoft.net/fig/737479" pageId="0" pageNumber="94735">4</figureCitation>
A-D). Epigynal plate slightly wider than long, spermathecae and bursae are indistinctly visible through epigynal plate in ventral view. Atrium (A) large, represented by two symmetrical, spherical, shallow depressions; atrial anterior margin (AAM) distinctly delimited, M-shaped, posterior and lateral anterior margins not rebordered. Two copulatory openings (CO) indistinct, located at medial portion of atrial anterior margin. Spermathecae (SP) with 3 parts: spermathecal head (SH) finger-like and large, ca. 2.7x longer than diameter, the two spermathecal heads separated by 1.58 diameters; spermathecal stalk tubular, running horizontally; (SS) spermathecal base (SB) tubular and convoluted, distinctly thinner than spermathecal head and spermathecal stalk. Fertilisation ducts (FD) short and curved, acicular, located at distal end of spermathecal base.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="94735" type="dnabarcode:">
<paragraph pageId="0" pageNumber="94735">DNAbarcode:</paragraph>
<paragraph pageId="0" pageNumber="94735">5'TTCTGGTCAGCTATAGTTGGTACAGCTATAAGAGTTATAATTCGTATAGAATTAGGTCAATCTGGAGCTTTTTTAGGTGATGATCATTTGTATAATGTAGTAGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGAAATTGATTAGTTCCATTAATATTAGGGGCAGGTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGACTTTTACCACCTTCATTAATATTATTAGTTATATCATCTATGGCTGAGATGGGAGTTGGGGCTGGATGAACAGTTTATCCCCCTCTTGCTTCTTTAGTAGGTCATACGGGAAGAGCAATGGATTTTGCTATTTTTTCATTACATTTAGCTGGGGCTTCTTCTATTATAGGAGCTGTTAATTTTATTACTACTATTATGAATATACGATCTTTTGGAATAATAATGGAAAAGATTTCATTATTTGTTTGGTCTGTTTTAATTACAGCTATTTTATTATTATTATCTTTGCCAGTTTTAGCCGGGGCTATTACTATATTATTAACTGATCGTAATTTTAATACGTCTTTTTTTGACCCTGCTGGGGGAGGTGATCCTATTTTATTTCAACATTTATTTTGATTTTTTGGTCACCC3' (holotype, YHCLU0272; GenBank: OP675437)</paragraph>
<paragraph pageId="0" pageNumber="94735">5'TCTGGTCAGCTATAGTTGGTACAGCTATAAGAGTTATAATTCGTATAGAATTAGGTCAATCTGGAGCTTTTTTAGGTGATGATCATTTGTATAATGTAGTAGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGGTTTGGAAATTGATTAGTTCCATTAATATTAGGGGCAGGTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGACTTTTACCACCTTCATTAATATTATTAGTTATATCATCTATGGCTGAGATGGGAGTTGGGGCTGGATGAACAGTTTATCCCCCTCTTGCTTCTTTAGTAGGTCATACGGGAAGAGCAATGGATTTTGCTATTTTTTCATTACATTTAGCTGGGGCTTCTTCTATTATAGGAGCTGTTAATTTTATTACTACTATTATGAATATACGATCTTTTGGAATAATAATGGAAAAGATTTCATTATTTGTTTGGTCTGTTTTAATTACAGCTATTTTATTATTATTATCTTTGCCAGTTTTAGCCGGGGCTATTACTATATTATTAACTGATCGTAATTTTAATACGTCTTTTTTTGACCCTGCTGGGGGAGGTGATCCTATTTTATTTCAACATTTATTTTGATTTTTTGGTCACCC3' (paratype, YHCLU0273; GenBank: OP675436).</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="94735" type="diagnosis">
<paragraph pageId="0" pageNumber="94735">Diagnosis</paragraph>
<paragraph pageId="0" pageNumber="94735">
Male of the new species resembles that of 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. caohai" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="caohai">
<emphasis italics="true" pageId="0" pageNumber="94735">C. caohai</emphasis>
</taxonomicName>
Zhang &amp; Yu, 2020 (
<bibRefCitation author="Zhang, Jianshuang" journalOrPublisher="Turkish Journal of Zoology" pageId="0" pageNumber="94735" pagination="346 - 354" refId="B8124056" refString="Zhang, Jianshuang, Yu, Hao, 2020. Three new species of the Clubiona corticalis -group from southern China (Araneae: Clubionidae). Turkish Journal of Zoology 44 (4): 346 - 354" title="Three new species of the Clubiona corticalis - group from southern China (Araneae: Clubionidae)" volume="44" year="2020">Zhang and Yu 2020</bibRefCitation>
: 347, figs. 2A-E) in having a blade-shaped RTA and a dagger-shaped embolus, but differs in the following: (1) embolus gradually tapering towards its apex (vs. narrowed in the middle) (cf. Fig. 
<figureCitation captionStart="Figure 3" captionStartId="F8123839" captionText="Figure 3. Male left palp of the holotype of Clubiona xianning sp. nov. A Prolateral view; B Rretrolateral view; C Bulb, prolateral view; D Bulb, ventral view; E Bulb, retrolateral view. Abbreviations: C = conductor; E = embolus; EB = embolic base; RTA = retrolateral tibial apophysis; VTA = ventral tibial apophysis. Scale bars: 0.2 mm (equal for A and B, equal for C-E)." figureDoi="10.3897/BDJ.10.e94735.figure3" httpUri="https://binary.pensoft.net/fig/737476" pageId="0" pageNumber="94735">3</figureCitation>
D and 
<bibRefCitation author="Zhang, Jianshuang" journalOrPublisher="Turkish Journal of Zoology" pageId="0" pageNumber="94735" pagination="346 - 354" refId="B8124056" refString="Zhang, Jianshuang, Yu, Hao, 2020. Three new species of the Clubiona corticalis -group from southern China (Araneae: Clubionidae). Turkish Journal of Zoology 44 (4): 346 - 354" title="Three new species of the Clubiona corticalis - group from southern China (Araneae: Clubionidae)" volume="44" year="2020">Zhang and Yu 2020</bibRefCitation>
: fig. 2D); (2) conductor nearly triangular, apex sharp and pointing distally (vs. finger-like, apex blunt and pointing prolaterally) (cf. Fig. 
<figureCitation captionStart="Figure 3" captionStartId="F8123839" captionText="Figure 3. Male left palp of the holotype of Clubiona xianning sp. nov. A Prolateral view; B Rretrolateral view; C Bulb, prolateral view; D Bulb, ventral view; E Bulb, retrolateral view. Abbreviations: C = conductor; E = embolus; EB = embolic base; RTA = retrolateral tibial apophysis; VTA = ventral tibial apophysis. Scale bars: 0.2 mm (equal for A and B, equal for C-E)." figureDoi="10.3897/BDJ.10.e94735.figure3" httpUri="https://binary.pensoft.net/fig/737476" pageId="0" pageNumber="94735">3</figureCitation>
D and E and 
<bibRefCitation author="Zhang, Jianshuang" journalOrPublisher="Turkish Journal of Zoology" pageId="0" pageNumber="94735" pagination="346 - 354" refId="B8124056" refString="Zhang, Jianshuang, Yu, Hao, 2020. Three new species of the Clubiona corticalis -group from southern China (Araneae: Clubionidae). Turkish Journal of Zoology 44 (4): 346 - 354" title="Three new species of the Clubiona corticalis - group from southern China (Araneae: Clubionidae)" volume="44" year="2020">Zhang and Yu 2020</bibRefCitation>
: figs. 2D and E); (3) VTA laminar, relatively large, wider than 1/2 of palpal tibia diameter (vs. papilliform and small, ca. 1/3-1/4 of palpal tibia diameter) (cf. Fig. 
<figureCitation captionStart="Figure 3" captionStartId="F8123839" captionText="Figure 3. Male left palp of the holotype of Clubiona xianning sp. nov. A Prolateral view; B Rretrolateral view; C Bulb, prolateral view; D Bulb, ventral view; E Bulb, retrolateral view. Abbreviations: C = conductor; E = embolus; EB = embolic base; RTA = retrolateral tibial apophysis; VTA = ventral tibial apophysis. Scale bars: 0.2 mm (equal for A and B, equal for C-E)." figureDoi="10.3897/BDJ.10.e94735.figure3" httpUri="https://binary.pensoft.net/fig/737476" pageId="0" pageNumber="94735">3</figureCitation>
B and 
<bibRefCitation author="Zhang, Jianshuang" journalOrPublisher="Turkish Journal of Zoology" pageId="0" pageNumber="94735" pagination="346 - 354" refId="B8124056" refString="Zhang, Jianshuang, Yu, Hao, 2020. Three new species of the Clubiona corticalis -group from southern China (Araneae: Clubionidae). Turkish Journal of Zoology 44 (4): 346 - 354" title="Three new species of the Clubiona corticalis - group from southern China (Araneae: Clubionidae)" volume="44" year="2020">Zhang and Yu 2020</bibRefCitation>
: fig. 2B). Females of 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. xianning" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="xianning">
<emphasis italics="true" pageId="0" pageNumber="94735">C. xianning</emphasis>
</taxonomicName>
<emphasis bold="true" pageId="0" pageNumber="94735">sp. nov.</emphasis>
can be easily distinguished from other members of the 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. corticalis" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="corticalis">
<emphasis italics="true" pageId="0" pageNumber="94735">C. corticalis</emphasis>
</taxonomicName>
-group, with the exception of 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. altissimus" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="altissimus">
<emphasis italics="true" pageId="0" pageNumber="94735">C. altissimus</emphasis>
</taxonomicName>
Hu, 2001 (
<bibRefCitation author="Hu, JL" journalOrPublisher="Henan Science and Technology Publishing House" pageId="0" pageNumber="94735" refId="B8123974" refString="Hu, JL, 2001. Spiders in Qinghai-Tibet Plateau of China. Henan Science and Technology Publishing House" title="Spiders in Qinghai-Tibet Plateau of China" year="2001">Hu 2001</bibRefCitation>
: 283, fig. 163.1-3) by the atrium represented by two shallow depressions (atrium absent, or present, but represented by one or two deep cavities in all other 
<taxonomicName baseAuthorityName="Walckenaer" baseAuthorityYear="1802" class="Arachnida" family="Clubionidae" genus="Clubiona" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Clubiona corticalis" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="corticalis">
<emphasis italics="true" pageId="0" pageNumber="94735">Clubiona corticalis</emphasis>
</taxonomicName>
-group species), differ from 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. altissimus" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="altissimus">
<emphasis italics="true" pageId="0" pageNumber="94735">C. altissimus</emphasis>
</taxonomicName>
by: (1) atrium large, nearly as wide as epigynal plate (vs. atrium relatively small, ca. 1/3 of epigyne width) (cf. Fig. 
<figureCitation captionStart="Figure 4" captionStartId="F8123841" captionText="Figure 4. Clubiona xianning sp. nov., female paratype and male holotype. A Intact epigyne, ventral view; B Cleared epigyne, ventral view; C Cleared vulva, dorsal view; D Vulva, cleared and embedded in Arabic gum, dorsal view; E Male habitus, dorsal view; F Male habitus, lateral view; G Female habitus, dorsal view; H Female habitus, ventral view. Abbreviations: A = atrium; AAM = atrial anterior margin; BS = bursa; CO = copulatory opening; FD = fertilisation duct; SB = spermathecal base; SH = spermathecal head; SP = spermatheca; SS = spermathecal stalk. Scale bars: 0.2 mm (equal for A and B, equal for C and D); 2 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.10.e94735.figure4" httpUri="https://binary.pensoft.net/fig/737479" pageId="0" pageNumber="94735">4</figureCitation>
A and B and 
<bibRefCitation author="Hu, JL" journalOrPublisher="Henan Science and Technology Publishing House" pageId="0" pageNumber="94735" refId="B8123974" refString="Hu, JL, 2001. Spiders in Qinghai-Tibet Plateau of China. Henan Science and Technology Publishing House" title="Spiders in Qinghai-Tibet Plateau of China" year="2001">Hu 2001</bibRefCitation>
: fig. 163.2); (2) spermathecae consisting of head, tubular stalk and base, the two spermathecal heads finger-like, well separated by 1.58 diameters (vs. spermathecae consisting of head and base, the two spermathecal heads reniform, separated by ca. one diameter) (cf. Fig. 
<figureCitation captionStart="Figure 4" captionStartId="F8123841" captionText="Figure 4. Clubiona xianning sp. nov., female paratype and male holotype. A Intact epigyne, ventral view; B Cleared epigyne, ventral view; C Cleared vulva, dorsal view; D Vulva, cleared and embedded in Arabic gum, dorsal view; E Male habitus, dorsal view; F Male habitus, lateral view; G Female habitus, dorsal view; H Female habitus, ventral view. Abbreviations: A = atrium; AAM = atrial anterior margin; BS = bursa; CO = copulatory opening; FD = fertilisation duct; SB = spermathecal base; SH = spermathecal head; SP = spermatheca; SS = spermathecal stalk. Scale bars: 0.2 mm (equal for A and B, equal for C and D); 2 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.10.e94735.figure4" httpUri="https://binary.pensoft.net/fig/737479" pageId="0" pageNumber="94735">4</figureCitation>
C and D and 
<bibRefCitation author="Hu, JL" journalOrPublisher="Henan Science and Technology Publishing House" pageId="0" pageNumber="94735" refId="B8123974" refString="Hu, JL, 2001. Spiders in Qinghai-Tibet Plateau of China. Henan Science and Technology Publishing House" title="Spiders in Qinghai-Tibet Plateau of China" year="2001">Hu 2001</bibRefCitation>
: fig. 163.3). In addition, 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. xianning" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="xianning">
<emphasis italics="true" pageId="0" pageNumber="94735">C. xianning</emphasis>
</taxonomicName>
<emphasis bold="true" pageId="0" pageNumber="94735">sp. nov.</emphasis>
also can by separated from 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. caohai" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="caohai">
<emphasis italics="true" pageId="0" pageNumber="94735">C. caohai</emphasis>
</taxonomicName>
and 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. altissimus" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="altissimus">
<emphasis italics="true" pageId="0" pageNumber="94735">C. altissimus</emphasis>
</taxonomicName>
by their habitus: abdomen without distinct colour pattern in 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. xianning" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="xianning">
<emphasis italics="true" pageId="0" pageNumber="94735">C. xianning</emphasis>
</taxonomicName>
<emphasis bold="true" pageId="0" pageNumber="94735">sp. nov.</emphasis>
(Fig. 
<figureCitation captionStart="Figure 4" captionStartId="F8123841" captionText="Figure 4. Clubiona xianning sp. nov., female paratype and male holotype. A Intact epigyne, ventral view; B Cleared epigyne, ventral view; C Cleared vulva, dorsal view; D Vulva, cleared and embedded in Arabic gum, dorsal view; E Male habitus, dorsal view; F Male habitus, lateral view; G Female habitus, dorsal view; H Female habitus, ventral view. Abbreviations: A = atrium; AAM = atrial anterior margin; BS = bursa; CO = copulatory opening; FD = fertilisation duct; SB = spermathecal base; SH = spermathecal head; SP = spermatheca; SS = spermathecal stalk. Scale bars: 0.2 mm (equal for A and B, equal for C and D); 2 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.10.e94735.figure4" httpUri="https://binary.pensoft.net/fig/737479" pageId="0" pageNumber="94735">4</figureCitation>
E-H), but with several chevron-shaped bands in 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. caohai" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="caohai">
<emphasis italics="true" pageId="0" pageNumber="94735">C. caohai</emphasis>
</taxonomicName>
and 
<taxonomicName class="Arachnida" kingdom="Animalia" lsidName="C. altissimus" order="Araneae" pageId="0" pageNumber="94735" phylum="Arthropoda" rank="species" species="altissimus">
<emphasis italics="true" pageId="0" pageNumber="94735">C. altissimus</emphasis>
</taxonomicName>
(
<bibRefCitation author="Zhang, Jianshuang" journalOrPublisher="Turkish Journal of Zoology" pageId="0" pageNumber="94735" pagination="346 - 354" refId="B8124056" refString="Zhang, Jianshuang, Yu, Hao, 2020. Three new species of the Clubiona corticalis -group from southern China (Araneae: Clubionidae). Turkish Journal of Zoology 44 (4): 346 - 354" title="Three new species of the Clubiona corticalis - group from southern China (Araneae: Clubionidae)" volume="44" year="2020">Zhang and Yu 2020</bibRefCitation>
: figs. 2 E-H; 
<bibRefCitation author="Hu, JL" journalOrPublisher="Henan Science and Technology Publishing House" pageId="0" pageNumber="94735" refId="B8123974" refString="Hu, JL, 2001. Spiders in Qinghai-Tibet Plateau of China. Henan Science and Technology Publishing House" title="Spiders in Qinghai-Tibet Plateau of China" year="2001">Hu 2001</bibRefCitation>
: fig. 163.1).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="94735" type="etymology">
<paragraph pageId="0" pageNumber="94735">Etymology</paragraph>
<paragraph pageId="0" pageNumber="94735">The specific name refers to the type locality and is a noun in apposition.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="94735" type="distribution">
<paragraph pageId="0" pageNumber="94735">Distribution</paragraph>
<paragraph pageId="0" pageNumber="94735">
Known from the Mt. Jiugong, Hubei Province, China (Fig. 
<figureCitation captionStart="Figure 1" captionStartId="F8123824" captionText="Figure 1. Distribution record of Clubiona xianning sp. nov. (green circle)." figureDoi="10.3897/BDJ.10.e94735.figure1" httpUri="https://binary.pensoft.net/fig/737473" pageId="0" pageNumber="94735">1</figureCitation>
).
</paragraph>
</subSubSection>
</treatment>
</document>