treatments-xml/data/31/76/FD/3176FD4DB936559782E136BBBD5D8A1D.xml
2024-06-21 12:32:55 +02:00

488 lines
38 KiB
XML
Raw Blame History

This file contains ambiguous Unicode characters

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

<document ID-DOI="http://dx.doi.org/10.3897/zookeys.1112.82307" ID-GBIF-Dataset="e3550ced-7c5e-45ca-96bb-0a97dad053bf" ID-Pensoft-Pub="1313-2970-1112-27" ID-Pensoft-UUID="B42162CE96565FF6AD6694DB673F49A9" ID-ZooBank="66B4E8F06AA1445184C78589B97DD840" ModsDocID="1313-2970-1112-27" checkinTime="1657650149184" checkinUser="pensoft" docAuthor="van Noort, Simon, Shaw, Scott Richard &amp; Copeland, Robert S." docDate="2022" docId="3176FD4DB936559782E136BBBD5D8A1D" docLanguage="en" docName="ZooKeys 1112: 27-122" docOrigin="ZooKeys 1112" docPubDate="2022-07-12" docSource="http://dx.doi.org/10.3897/zookeys.1112.82307" docTitle="Dinapsis igneus van Noort &amp; Shaw 2022, sp. nov." docType="treatment" docUuid="742EB1A2-DF10-478F-8DA6-5F25949EF6E0" docUuidSource="ZooBank" docVersion="2" id="B42162CE96565FF6AD6694DB673F49A9" lastPageNumber="27" masterDocId="B42162CE96565FF6AD6694DB673F49A9" masterDocTitle="Revision of the endemic African genus Dinapsis (Dinapsini, Megalyridae, Hymenoptera) with description of seven new species" masterLastPageNumber="122" masterPageNumber="27" pageNumber="27" updateTime="1657651057001" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Revision of the endemic African genus Dinapsis (Dinapsini, Megalyridae, Hymenoptera) with description of seven new species</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>van Noort, Simon</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-6930-9741</mods:nameIdentifier>
<mods:affiliation>Research and Exhibitions Department, South African Museum, Iziko Museums of South Africa, PO Box 61, Cape Town 8000 South Africa &amp; Department of Biological Sciences, University of Cape Town, Private Bag, Rondebosch, 7701, South Africa</mods:affiliation>
<mods:nameIdentifier type="email">svannoort@iziko.org.za</mods:nameIdentifier>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Shaw, Scott Richard</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-5024-4594</mods:nameIdentifier>
<mods:affiliation>U. W. Insect Museum, Department of Ecosystem Science and Management (3354), University of Wyoming, 1000 East University Avenue, Laramie, Wyoming 82071 - 3354, USA</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Copeland, Robert S.</mods:namePart>
<mods:affiliation>International Centre of Insect Physiology and Ecology (ICIPE), P. O. Box 30772 Nairobi, Kenya &amp; Department of Entomology, National Museum of Natural History, Smithsonian Institution, Washington DC, USA</mods:affiliation>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>ZooKeys</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2022</mods:date>
<mods:detail type="pubDate">
<mods:number>2022-07-12</mods:number>
</mods:detail>
<mods:detail type="volume">
<mods:number>1112</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>27</mods:start>
<mods:end>122</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/zookeys.1112.82307</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.1112.82307</mods:identifier>
<mods:identifier type="Pensoft-Pub">1313-2970-1112-27</mods:identifier>
<mods:identifier type="ZooBank">66B4E8F06AA1445184C78589B97DD840</mods:identifier>
<mods:identifier type="Pensoft-UUID">B42162CE96565FF6AD6694DB673F49A9</mods:identifier>
</mods:mods>
<treatment LSID="urn:lsid:zoobank.org:act:742EB1A2-DF10-478F-8DA6-5F25949EF6E0" httpUri="http://treatment.plazi.org/id/3176FD4DB936559782E136BBBD5D8A1D" lastPageNumber="27" pageId="0" pageNumber="27">
<subSubSection pageId="0" pageNumber="27" type="nomenclature">
<paragraph pageId="0" pageNumber="27">
<taxonomicName LSID="https://zoobank.org/742EB1A2-DF10-478F-8DA6-5F25949EF6E0" authority="van Noort &amp; Shaw" authorityName="van Noort &amp; Shaw" authorityYear="2022" class="Insecta" family="Megalyridae" genus="Dinapsis" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Dinapsis igneus" order="Hymenoptera" pageId="0" pageNumber="27" phylum="Arthropoda" rank="species" species="igneus" status="sp. nov.">Dinapsis igneus van Noort &amp; Shaw</taxonomicName>
<taxonomicNameLabel pageId="0" pageNumber="27">sp. nov.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="description">
<paragraph pageId="0" pageNumber="27">
<figureCitation captionStart="Figure 14" captionStartId="F14" captionText="Figure 14. Dinapsis igneus van Noort &amp; Shaw, sp. nov. holotype female (DEBU) A habitus, dorsal view B habitus, lateral view C head, mesosoma, lateral view D head, mesosoma, dorsal view E head, dorsal view F antennae, lateral view. Scale bars: 1000 µm (A, B); 200 µm (C, E, F); 500 µm (D)." figureDoi="10.3897/zookeys.1112.82307.figure14" httpUri="https://binary.pensoft.net/fig/714030" pageId="0" pageNumber="27">Figs 14</figureCitation>
<figureCitation captionStart="Figure 15" captionStartId="F15" captionText="Figure 15. Dinapsis igneus van Noort &amp; Shaw, sp. nov. holotype female (DEBU) A head, anterior view B mesoscutum, anterior view C mesosoma, dorsal view D hind leg, anti-axial view E metasoma, lateral view F wings, dorsal view (inset: data labels). Scale bars: 200 µm (A, D, E); 100 µm (B, C); 500 µm (F)." figureDoi="10.3897/zookeys.1112.82307.figure15" httpUri="https://binary.pensoft.net/fig/714031" pageId="0" pageNumber="27">, 15</figureCitation>
<figureCitation captionStart="Figure 16" captionStartId="F16" captionText="Figure 16. Dinapsis igneus van Noort &amp; Shaw, sp. nov. paratype male (DEBU) A habitus, dorsal view B habitus, lateral view C head, mesosoma, dorsal view D head, mesosoma, lateral view E head, dorsoposterior view F metasoma, lateral view. Scale bars: 500 µm (A, B); 200 µm (C, D, E, F)." figureDoi="10.3897/zookeys.1112.82307.figure16" httpUri="https://binary.pensoft.net/fig/714032" pageId="0" pageNumber="27">, 16</figureCitation>
<figureCitation captionStart="Figure 17" captionStartId="F17" captionText="Figure 17. Dinapsis igneus van Noort &amp; Shaw, sp. nov. paratype male (DEBU) A head, anterior view B mesoscutum, anterodorsal view C mesosoma, dorsal view D hind leg, antiaxial view (inset: data labels) E metasoma terminal tergites and pygostyle, dorsal view F wings, dorsal view. Scale bars: 200 µm (A, D); 100 µm (B, C, E); 500 µm (F)." figureDoi="10.3897/zookeys.1112.82307.figure17" httpUri="https://binary.pensoft.net/fig/714033" pageId="0" pageNumber="27">, 17</figureCitation>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="materials_examined">
<paragraph pageId="0" pageNumber="27">Material examined.</paragraph>
<paragraph pageId="0" pageNumber="27">
<materialsCitation collectingDate="2016-12-07" collectorName="Gorges Natl. Pk., S. A. Marshall, WaspWeb" country="Mauritius" elevation="674" latitude="-20.408611" location="Petrin" longLatPrecision="21" longitude="57.469723" specimenCount="♀" stateProvince="Black River" typeStatus="Holotype">
<emphasis bold="true" pageId="0" pageNumber="27">
<emphasis italics="true" pageId="0" pageNumber="27">
<typeStatus>Holotype</typeStatus>
</emphasis>
.
</emphasis>
<collectingCountry name="Mauritius">Mauritius</collectingCountry>
<specimenCount></specimenCount>
;
<collectingRegion country="Mauritius" name="Black River">Black River</collectingRegion>
<collectorName>Gorges Natl. Pk.</collectorName>
,
<normalizedToken originalValue="Pétrin">
<location LSID="urn:lsid:plazi:treatment:3176FD4DB936559782E136BBBD5D8A1D:83259064D060CDF832AB4AFB813CA76D" country="Mauritius" latitude="-20.408611" longLatPrecision="21" longitude="57.469723" name="Petrin" stateProvince="Black River">Petrin</location>
</normalizedToken>
;
<geoCoordinate degrees="20" direction="south" minutes="24" orientation="latitude" precision="15" seconds="31" value="-20.408611">20°24'31&quot;S</geoCoordinate>
,
<geoCoordinate degrees="57" direction="east" minutes="28" orientation="longitude" precision="15" seconds="11" value="57.469723">57°28'11&quot;E</geoCoordinate>
;
<elevation metricMagnitude="2" metricUnit="m" metricValue="6.74" unit="m" value="674.0">
<quantity metricMagnitude="2" metricUnit="m" metricValue="6.74" unit="m" value="674.0">674 m</quantity>
a.s.l.
</elevation>
;
<collectingDate value="2016-12-07">7 Dec. 2016</collectingDate>
;
<collectorName>S.A. Marshall</collectorName>
leg.; debu00396997; BARCODE BOLD:FSA1893-21; IMAGED
<collectorName>WaspWeb</collectorName>
LAS 4.9 SAMC 2019; DEBU
</materialsCitation>
.
<materialsCitation collectingDate="2016-12-07" collectingDateMax="2016-12-09" collectingDateMin="2016-12-07" collectorName="Gorges N. P., S. A. Marshall, WaspWeb" country="Mauritius" determinerName="Det. &amp; S. M. Paiero" elevation="619" latitude="-20.390556" location="Mare Longue" longLatPrecision="21" longitude="57.4525" specimenCount="1" specimenCount-male="1" stateProvince="Black River" typeStatus="Paratypes">
<emphasis bold="true" pageId="0" pageNumber="27">
<emphasis italics="true" pageId="0" pageNumber="27">
<typeStatus>Paratypes</typeStatus>
</emphasis>
.
</emphasis>
<collectingCountry name="Mauritius">Mauritius</collectingCountry>
<specimenCount type="male">1 ♂</specimenCount>
;
<collectingRegion country="Mauritius" name="Black River">Black River</collectingRegion>
<collectorName>Gorges N.P.</collectorName>
;
<location LSID="urn:lsid:plazi:treatment:3176FD4DB936559782E136BBBD5D8A1D:528311170491B8A1EF585680C55BD3FC" country="Mauritius" latitude="-20.390556" longLatPrecision="21" longitude="57.4525" name="Mare Longue" stateProvince="Black River">Mare Longue</location>
,
<geoCoordinate degrees="20" direction="south" minutes="23" orientation="latitude" precision="15" seconds="26" value="-20.390556">20°23'26&quot;S</geoCoordinate>
,
<geoCoordinate degrees="57" direction="east" minutes="27" orientation="longitude" precision="15" seconds="9" value="57.4525">57°27'9&quot;E</geoCoordinate>
;
<elevation metricMagnitude="2" metricUnit="m" metricValue="6.1899999999999995" unit="m" value="619.0">
<quantity metricMagnitude="2" metricUnit="m" metricValue="6.1899999999999995" unit="m" value="619.0">619 m</quantity>
a.s.l.
</elevation>
;
<collectingDate value="2016-12-07" valueMax="2016-12-09" valueMin="2016-12-07">7-9 Dec. 2016</collectingDate>
;
<collectorName>S.A. Marshall</collectorName>
leg.;, debu00396799;
<taxonomicName authorityName="Schletterer" authorityYear="1889" class="Insecta" family="Megalyridae" kingdom="Animalia" lsidName="" order="Hymenoptera" pageId="0" pageNumber="27" phylum="Arthropoda" rank="family">Megalyridae</taxonomicName>
<determinerName>Det.</determinerName>
:
<determinerName>S.M. Paiero</determinerName>
2018; BARCODE BOLD:BOLD:FSA1894-21; IMAGED
<collectorName>WaspWeb</collectorName>
LAS 4.9 SAMC 2019; DEBU
</materialsCitation>
<materialsCitation collectingDate="2018-01-24" collectingDateMax="2018-02-02" collectingDateMin="2018-01-24" collectingMethod="Malaise trap" collectorName="Gorges N. P., Kirk-Spriggs, Muller" country="Mauritius" elevation="620" latitude="-20.408611" location="Petrin" longLatPrecision="21" longitude="57.469723" specimenCount="1" specimenCount-female="1" stateProvince="Black River" typeStatus="paratype">
<specimenCount type="female">1 ♀</specimenCount>
;
<collectingRegion country="Mauritius" name="Black River">Black River</collectingRegion>
,
<collectingRegion country="Mauritius" name="Black River">Black River</collectingRegion>
<collectorName>Gorges N.P.</collectorName>
,
<normalizedToken originalValue="Pétrin">
<location LSID="urn:lsid:plazi:treatment:3176FD4DB936559782E136BBBD5D8A1D:4E685D2746CD11B644249096AEBFD1D0" country="Mauritius" latitude="-20.408611" longLatPrecision="21" longitude="57.469723" name="Petrin" stateProvince="Black River">Petrin</location>
</normalizedToken>
;
<geoCoordinate degrees="20" direction="south" minutes="24" orientation="latitude" precision="15" seconds="31" value="-20.408611">20°24'31&quot;S</geoCoordinate>
,
<geoCoordinate degrees="57" direction="east" minutes="28" orientation="longitude" precision="15" seconds="11" value="57.469723">57°28'11&quot;E</geoCoordinate>
;
<collectingDate value="2018-01-24" valueMax="2018-02-02" valueMin="2018-01-24">24 Jan.-2 Feb. 2018</collectingDate>
;
<elevation metricMagnitude="2" metricUnit="m" metricValue="6.2" unit="m" value="620.0">
<quantity metricMagnitude="2" metricUnit="m" metricValue="6.2" unit="m" value="620.0">620 m</quantity>
a.s.l.
</elevation>
;
<collectorName>Kirk-Spriggs</collectorName>
&amp;
<collectorName>Muller</collectorName>
leg.;
<collectingMethod>Malaise trap</collectingMethod>
; upland heath forest; ICIPE
</materialsCitation>
<materialsCitation collectingDate="2018-01-24" collectingDateMax="2018-02-02" collectingDateMin="2018-01-24" collectingMethod="Malaise trap" collectorName="Gorges N. P., Kirk-Spriggs, Muller, Montane" country="Mauritius" elevation="619" latitude="-20.390556" location="Mare Longue" longLatPrecision="21" longitude="57.4525" specimenCount="1" specimenCount-male="1" stateProvince="Black River" typeStatus="paratype">
<specimenCount type="male">1 ♂</specimenCount>
;
<collectingRegion country="Mauritius" name="Black River">Black River</collectingRegion>
,
<collectingRegion country="Mauritius" name="Black River">Black River</collectingRegion>
<collectorName>Gorges N.P.</collectorName>
,
<location LSID="urn:lsid:plazi:treatment:3176FD4DB936559782E136BBBD5D8A1D:A5129414773D06DFB62E0B3D5B9A8046" country="Mauritius" latitude="-20.390556" longLatPrecision="21" longitude="57.4525" name="Mare Longue" stateProvince="Black River">Mare Longue</location>
;
<geoCoordinate degrees="20" direction="south" minutes="23" orientation="latitude" precision="15" seconds="26" value="-20.390556">20°23'26&quot;S</geoCoordinate>
,
<geoCoordinate degrees="57" direction="east" minutes="27" orientation="longitude" precision="15" seconds="09" value="57.4525">57°27'09&quot;E</geoCoordinate>
;
<collectingDate value="2018-01-24" valueMax="2018-02-02" valueMin="2018-01-24">24 Jan. -2 Feb. 2018</collectingDate>
;
<quantity metricMagnitude="2" metricUnit="m" metricValue="6.1899999999999995" unit="m" value="619.0">
<elevation metricMagnitude="2" metricUnit="m" metricValue="6.1899999999999995" unit="m" value="619.0">619 m</elevation>
</quantity>
a.sl.;
<collectorName>Kirk-Spriggs</collectorName>
&amp;
<collectorName>Muller</collectorName>
leg.;
<collectingMethod>Malaise trap</collectingMethod>
;
<collectorName>Montane</collectorName>
rainforest; ICIPE
</materialsCitation>
.
</paragraph>
<caption doi="10.3897/zookeys.1112.82307.figure14" httpUri="https://binary.pensoft.net/fig/714030" pageId="0" pageNumber="27" start="Figure 14" startId="F14">
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" pageId="0" pageNumber="27">Figure 14.</emphasis>
<taxonomicName authorityName="van Noort &amp; Shaw" authorityYear="2022" class="Insecta" family="Proteaceae" genus="Dinapsis" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Dinapsis igneus" order="Hymenoptera" pageId="0" pageNumber="27" phylum="Arthropoda" rank="species" species="igneus">
<emphasis italics="true" pageId="0" pageNumber="27">Dinapsis igneus</emphasis>
</taxonomicName>
van Noort &amp; Shaw, sp. nov.
<typeStatus>holotype</typeStatus>
female (DEBU)
<emphasis bold="true" pageId="0" pageNumber="27">A</emphasis>
habitus, dorsal view
<emphasis bold="true" pageId="0" pageNumber="27">B</emphasis>
habitus, lateral view
<emphasis bold="true" pageId="0" pageNumber="27">C</emphasis>
head, mesosoma, lateral view
<emphasis bold="true" pageId="0" pageNumber="27">D</emphasis>
head, mesosoma, dorsal view
<emphasis bold="true" pageId="0" pageNumber="27">E</emphasis>
head, dorsal view
<emphasis bold="true" pageId="0" pageNumber="27">F</emphasis>
antennae, lateral view. Scale bars: 1000
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">A, B</emphasis>
); 200
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">C, E, F</emphasis>
); 500
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">D</emphasis>
).
</paragraph>
</caption>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="diagnosis">
<paragraph pageId="0" pageNumber="27">Diagnosis.</paragraph>
<paragraph pageId="0" pageNumber="27">
<taxonomicName authorityName="van Noort &amp; Shaw" authorityYear="2022" class="Insecta" family="Proteaceae" genus="Dinapsis" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Dinapsis igneus" order="Hymenoptera" pageId="0" pageNumber="27" phylum="Arthropoda" rank="species" species="igneus">
<emphasis italics="true" pageId="0" pageNumber="27">Dinapsis igneus</emphasis>
</taxonomicName>
can be assigned to the
<taxonomicName authorityName="Hedqvist" authorityYear="1967" class="Insecta" family="Proteaceae" genus="Dinapsis" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Dinapsis oculohirta" order="Hymenoptera" pageId="0" pageNumber="27" phylum="Arthropoda" rank="species" species="oculohirta">
<emphasis italics="true" pageId="0" pageNumber="27">Dinapsis oculohirta</emphasis>
</taxonomicName>
species group by the presence of dense ocular setae on the eyes. It can be distinguished from
<taxonomicName genus="D." lsidName="D. oculohirta" pageId="0" pageNumber="27" rank="species" species="oculohirta">
<emphasis italics="true" pageId="0" pageNumber="27">D. oculohirta</emphasis>
</taxonomicName>
, and others in that group, by being the only
<taxonomicName authorityName="Waterston" authorityYear="1922" class="Insecta" family="Proteaceae" genus="Dinapsis" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Dinapsis" order="Hymenoptera" pageId="0" pageNumber="27" phylum="Arthropoda" rank="genus">
<emphasis italics="true" pageId="0" pageNumber="27">Dinapsis</emphasis>
</taxonomicName>
species with a slight metallic sheen to the integument (as seen under a microscope with illumination). The mesoscutum has a characteristic strongly raised bilobed crest situated anteriorly (Fig.
<figureCitation captionStart="Figure 15" captionStartId="F15" captionText="Figure 15. Dinapsis igneus van Noort &amp; Shaw, sp. nov. holotype female (DEBU) A head, anterior view B mesoscutum, anterior view C mesosoma, dorsal view D hind leg, anti-axial view E metasoma, lateral view F wings, dorsal view (inset: data labels). Scale bars: 200 µm (A, D, E); 100 µm (B, C); 500 µm (F)." figureDoi="10.3897/zookeys.1112.82307.figure15" httpUri="https://binary.pensoft.net/fig/714031" pageId="0" pageNumber="27">15B</figureCitation>
); the head and mesosoma has a characteristic weakly metallic greenish bronze sheen (only observable under sufficient illumination) and is densely rugulose-punctate and covered with dense white setae (Fig.
<figureCitation captionStart="Figure 16" captionStartId="F16" captionText="Figure 16. Dinapsis igneus van Noort &amp; Shaw, sp. nov. paratype male (DEBU) A habitus, dorsal view B habitus, lateral view C head, mesosoma, dorsal view D head, mesosoma, lateral view E head, dorsoposterior view F metasoma, lateral view. Scale bars: 500 µm (A, B); 200 µm (C, D, E, F)." figureDoi="10.3897/zookeys.1112.82307.figure16" httpUri="https://binary.pensoft.net/fig/714032" pageId="0" pageNumber="27">16E</figureCitation>
). The latter character states are also not present in any other species, which are non-metallic, black, or brown, or rarely with orange patches, have a mesosoma which is often smooth, sometimes with scattered foveae, if sculptured then the integument is broadly foveate, and the mesosoma is often semi-glabrous, and only ever sparsely covered with setae.
</paragraph>
<caption doi="10.3897/zookeys.1112.82307.figure15" httpUri="https://binary.pensoft.net/fig/714031" pageId="0" pageNumber="27" start="Figure 15" startId="F15">
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" pageId="0" pageNumber="27">Figure 15.</emphasis>
<taxonomicName authorityName="van Noort &amp; Shaw" authorityYear="2022" class="Insecta" family="Proteaceae" genus="Dinapsis" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Dinapsis igneus" order="Hymenoptera" pageId="0" pageNumber="27" phylum="Arthropoda" rank="species" species="igneus">
<emphasis italics="true" pageId="0" pageNumber="27">Dinapsis igneus</emphasis>
</taxonomicName>
van Noort &amp; Shaw, sp. nov. holotype female (DEBU)
<emphasis bold="true" pageId="0" pageNumber="27">A</emphasis>
head, anterior view
<emphasis bold="true" pageId="0" pageNumber="27">B</emphasis>
mesoscutum, anterior view
<emphasis bold="true" pageId="0" pageNumber="27">C</emphasis>
mesosoma, dorsal view
<emphasis bold="true" pageId="0" pageNumber="27">D</emphasis>
hind leg, anti-axial view
<emphasis bold="true" pageId="0" pageNumber="27">E</emphasis>
metasoma, lateral view
<emphasis bold="true" pageId="0" pageNumber="27">F</emphasis>
wings, dorsal view (inset: data labels). Scale bars: 200
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">A, D, E</emphasis>
); 100
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">B, C</emphasis>
); 500
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">F</emphasis>
).
</paragraph>
</caption>
<caption doi="10.3897/zookeys.1112.82307.figure16" httpUri="https://binary.pensoft.net/fig/714032" pageId="0" pageNumber="27" start="Figure 16" startId="F16">
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" pageId="0" pageNumber="27">Figure 16.</emphasis>
<taxonomicName authorityName="van Noort &amp; Shaw" authorityYear="2022" class="Insecta" family="Proteaceae" genus="Dinapsis" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Dinapsis igneus" order="Hymenoptera" pageId="0" pageNumber="27" phylum="Arthropoda" rank="species" species="igneus">
<emphasis italics="true" pageId="0" pageNumber="27">Dinapsis igneus</emphasis>
</taxonomicName>
van Noort &amp; Shaw, sp. nov. paratype male (DEBU)
<emphasis bold="true" pageId="0" pageNumber="27">A</emphasis>
habitus, dorsal view
<emphasis bold="true" pageId="0" pageNumber="27">B</emphasis>
habitus, lateral view
<emphasis bold="true" pageId="0" pageNumber="27">C</emphasis>
head, mesosoma, dorsal view
<emphasis bold="true" pageId="0" pageNumber="27">D</emphasis>
head, mesosoma, lateral view
<emphasis bold="true" pageId="0" pageNumber="27">E</emphasis>
head, dorsoposterior view
<emphasis bold="true" pageId="0" pageNumber="27">F</emphasis>
metasoma, lateral view. Scale bars: 500
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">A, B</emphasis>
); 200
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">C, D, E, F</emphasis>
).
</paragraph>
</caption>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="distribution">
<paragraph pageId="0" pageNumber="27">Distribution.</paragraph>
<paragraph pageId="0" pageNumber="27">
(Fig.
<figureCitation captionStart="Figure 43" captionStartId="F43" captionText="Figure 43. Distribution maps of Dinapsis species A country occurrences for the genus Dinapsis B specimen point data of described Dinapsis species plotted on a topographical relief map C Dinapsis species occurring in Madagascar and Mauritius, excluding the D. hirtipes species-group (specimen point data plotted on a topographical relief map) D Madagascan records of Dinapsis species in the D. hirtipes species group (specimen point data plotted on a topographical relief map)." figureDoi="10.3897/zookeys.1112.82307.figure43" httpUri="https://binary.pensoft.net/fig/714059" pageId="0" pageNumber="27">43</figureCitation>
) Mauritius.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="comments">
<paragraph pageId="0" pageNumber="27">Comments.</paragraph>
<paragraph pageId="0" pageNumber="27">
Known only from Black River Gorges National Park in both the montane rainforest and upland heath forest habitat. This is the first megalyrid species to be described from an island that is volcanic in origin, and not a more ancient fragment of continental rock. Previous authors have commented on the association of
<taxonomicName authorityName="Schletterer" authorityYear="1889" class="Insecta" family="Megalyridae" kingdom="Animalia" lsidName="" order="Hymenoptera" pageId="0" pageNumber="27" phylum="Arthropoda" rank="family">Megalyridae</taxonomicName>
with ancient continental landmasses (
<bibRefCitation DOI="https://doi.org/10.2307/2845141" author="Shaw, SR" journalOrPublisher="Journal of Biogeography" pageId="0" pageNumber="27" pagination="569 - 581" refId="B57" refString="Shaw, SR, 1990b. Phylogeny and biogeography of the parasitoid wasp family Megalyridae (Hymenoptera). Journal of Biogeography 17 (6): 569 - 581, DOI: https://doi.org/10.2307/2845141" title="Phylogeny and biogeography of the parasitoid wasp family Megalyridae (Hymenoptera)." url="https://doi.org/10.2307/2845141" volume="17" year="1990 b">Shaw 1990b</bibRefCitation>
;
<bibRefCitation DOI="https://doi.org/10.1111/j.1365-3113.2010.00537.x" author="Vilhelmsen, L" journalOrPublisher="Systematic Entomology" pageId="0" pageNumber="27" pagination="658 - 677" refId="B67" refString="Vilhelmsen, L, Perrichot, V, Shaw, SR, 2010. Past and present diversity and distribution in the parasitic wasp family Megalyridae (Hymenoptera). Systematic Entomology 35 (4): 658 - 677, DOI: https://doi.org/10.1111/j.1365-3113.2010.00537.x" title="Past and present diversity and distribution in the parasitic wasp family Megalyridae (Hymenoptera)." url="https://doi.org/10.1111/j.1365-3113.2010.00537.x" volume="35" year="2010">Vilhelmsen et al. 2010</bibRefCitation>
). This raises interesting questions about whether this species is derived from megalyrid ancestors that dispersed naturally to the island in ancient times (perhaps by drifting in wood with infected host insects), or whether the species might have been accidentally transported to the island by human commerce, either from Madagascar or the African mainland, in the last 500 years. We expect it will be found from Africa or Madagascar eventually, unless it is extirpated in those places.
</paragraph>
<caption doi="10.3897/zookeys.1112.82307.figure17" httpUri="https://binary.pensoft.net/fig/714033" pageId="0" pageNumber="27" start="Figure 17" startId="F17">
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" pageId="0" pageNumber="27">Figure 17.</emphasis>
<taxonomicName authorityName="van Noort &amp; Shaw" authorityYear="2022" class="Insecta" family="Proteaceae" genus="Dinapsis" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Dinapsis igneus" order="Hymenoptera" pageId="0" pageNumber="27" phylum="Arthropoda" rank="species" species="igneus">
<emphasis italics="true" pageId="0" pageNumber="27">Dinapsis igneus</emphasis>
</taxonomicName>
van Noort &amp; Shaw, sp. nov. paratype male (DEBU)
<emphasis bold="true" pageId="0" pageNumber="27">A</emphasis>
head, anterior view
<emphasis bold="true" pageId="0" pageNumber="27">B</emphasis>
mesoscutum, anterodorsal view
<emphasis bold="true" pageId="0" pageNumber="27">C</emphasis>
mesosoma, dorsal view
<emphasis bold="true" pageId="0" pageNumber="27">D</emphasis>
hind leg, antiaxial view (inset: data labels)
<emphasis bold="true" pageId="0" pageNumber="27">E</emphasis>
metasoma terminal tergites and pygostyle, dorsal view
<emphasis bold="true" pageId="0" pageNumber="27">F</emphasis>
wings, dorsal view. Scale bars: 200
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">A, D</emphasis>
); 100
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">B, C, E</emphasis>
); 500
<normalizedToken originalValue="µm">µm</normalizedToken>
(
<emphasis bold="true" pageId="0" pageNumber="27">F</emphasis>
).
</paragraph>
</caption>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="etymology">
<paragraph pageId="0" pageNumber="27">Etymology.</paragraph>
<paragraph pageId="0" pageNumber="27">
This species is named after the Latin for fiery (
<emphasis italics="true" pageId="0" pageNumber="27">igneus</emphasis>
) in reference to the provenance of the species from Mauritius, which is a volcanic island formed ca. 8 million years ago. The species epithet is to be treated as an adjective.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="barcode sequence for holotype female">
<paragraph pageId="0" pageNumber="27">Barcode sequence for holotype female.</paragraph>
<paragraph pageId="0" pageNumber="27">38754_A01_Din_ign_fem (sequence code in BOLD: FSA1893-21) BIN URI: None (sequence too short).</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="nucleotide sequence for holotype female">
<paragraph pageId="0" pageNumber="27">Nucleotide sequence for holotype female.</paragraph>
<paragraph pageId="0" pageNumber="27">CTATAAGAATAATTATTCGTATGGAACTTAGAGTTCCGGGTTCATTTATTGGAAATGATCAGATTTATAATTCTATTGTGACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTTTTATAATGGGAGGTTTTGGTAATTGGTTATTGCCCTTAATGTTAGGGGCTCCTGATATGTCTTACCCTCGTCTTAATAATTTAAGGTTTTGATTGTTGGTTCCTTCTTTGTTATTTTTATTAATA.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="barcode sequence for paratype male">
<paragraph pageId="0" pageNumber="27">Barcode sequence for paratype male.</paragraph>
<paragraph pageId="0" pageNumber="27">38754_A02_Din_ign_mal (sequence code in BOLD: FSA1894-21) BIN URI: None (sequence too short).</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="nucleotide sequence for paratype male">
<paragraph pageId="0" pageNumber="27">Nucleotide sequence for paratype male.</paragraph>
<paragraph pageId="0" pageNumber="27">TTGAGCAGGGCTTATTGGATCATCTATAAGAATAATTATTCGTATGGAACTTAGAGTTCCGGGGTCATTTATTGGGAATGATCAGATTTATAATTCTATTGTAACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTTTTATAATGGGAGGGTTTGGTAATTGATTATTGCCTTTGATGTTAGGGGCCCCTGATATGTCTTATCCTCGTCTTAATAATTTAAGGTTTTGATTATTGGTTCCTTCTTTGTTATTTTTACTAATAAGGTTTTATGTGGGCAGAGGTACAGGAA.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="description">
<paragraph pageId="0" pageNumber="27">Description.</paragraph>
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" pageId="0" pageNumber="27">
Holotype female.
<emphasis italics="true" pageId="0" pageNumber="27">Body</emphasis>
</emphasis>
length 4.0 mm excluding ovipositor.
</paragraph>
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" pageId="0" pageNumber="27">
<emphasis italics="true" pageId="0" pageNumber="27">Colour</emphasis>
.
</emphasis>
Head and mesosoma with greenish bronze sheen. Head with a dense covering of white setae on occiput, darker, more widely spaced setae on face and frons; mesoscutal plate with a greenish bronze sheen. Mesoscutal plate with anteriodorsal bilateral peaks. Anteriolateral mesoscutal knobs absent; metasoma brown, lighter yellowish brown along posterior tergal margins. Scape, pedicel, F1, fore coxae and mid coxae, tibiae and tarsi yellowish brown. F2 and F3 light brown; F4 to F12 dark brown with light offset rows of multiporous plate sensilla; trochanters whitish yellow. Hind femur dark brown, except for light yellowish brown apex. Ovipositor orange-brown. Eyes and ocelli silvery. Wing membrane clear without dark bands.
</paragraph>
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" italics="true" pageId="0" pageNumber="27">Head</emphasis>
round, only slightly (1.13
<normalizedToken originalValue="×">x</normalizedToken>
) wider than high; vertex, frons, and face evenly strongly punctate, interstices polished, 1-2
<normalizedToken originalValue="×">x</normalizedToken>
greater than puncture width; ocelli small, OOL 2.0
<normalizedToken originalValue="×">x</normalizedToken>
ocellar diameter; all ocelli bounded by a semi-circular depression on the side facing outer edge of the triangle; ocellar triangle isosceles (POL:LOL - 3:4); eye large and hardly protuberant, not parallel in anterior view, strongly diverging dorsally and ventrally; eye densely and evenly covered with minute white ocular setae; eye margined posteriorly by foveate groove; postocular orbital carina weakly present; antenna with 12 flagellomeres having flagellar length/width ratios as follows: F1 = 5, F2-F4 = 4.0, F5-F9 = 2.5, F10-F11 = 2.2 F12 = 2.75; apical flagellomeres distinctly wider than basal flagellomeres; temple adjacent to ocular orbital carina coarsely rugulose, temple width 0.67
<normalizedToken originalValue="×">x</normalizedToken>
eye width in lateral view; malar length equivalent to mandible width basally; occiput coarsely rugulose; occipital carina wide laterally, narrower dorsally and crenulate.
</paragraph>
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" pageId="0" pageNumber="27">
<emphasis italics="true" pageId="0" pageNumber="27">Mesosoma</emphasis>
.
</emphasis>
Pronotum polished, laterally excavated with a row of large quadrate to oblong foveae situated posteriorly on the margin with the mesopleuron; foveae along dorsolateral margin faint and shallow; medially with angled central row of six foveae, dorsal fovea largest, 3
<normalizedToken originalValue="×">x</normalizedToken>
length of others. Mesoscutal anterior plate polished, with a medial suture grading ventrally into a row of approximately five foveae, and lateral carinae bounded by weak foveae; glabrous except for dorsal fifth which is setose as in rest of mesoscutum; mesoscutum 1.1
<normalizedToken originalValue="×">x</normalizedToken>
wider than long, shoulders rounded, mesoscutal lobes absent; medially mesoscutum punctate; medial mesoscutal furrow deep, narrow with weakly jagged edge; transscutal articulation a smooth, narrow furrow, anterior edge weakly jagged, posterior edge straight; scutoscutellar sulci medially comprising a continuous shallow groove with defined foveae; anteriorly meeting before reaching transscutellar articulation; scutellar disc punctate; mesonotum dorsally covered with dense white setae; mesopleuron antero-laterally shallowly foveate, dorsal fovea elongate, extending entire dorsal length of mesopleuron, with short white setae except for medially polished area surrounding large median mid-pit. Metanotum with raised, setose (long white setae as on mesoscutum) medial area flanked laterally by depression with 3-5 foveae. Propodeum medially polished with strong transverse carinae between the submedian longitudinal carinae defining the three central tracks; lateral longitudinal tracks with defined transverse carinae. All five tracks anteriorly with two or three deep foveae.
</paragraph>
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" pageId="0" pageNumber="27">
<emphasis italics="true" pageId="0" pageNumber="27">Legs</emphasis>
.
</emphasis>
All legs with long, white setae, each seated in a darker basal socket, contrasting with surrounding pale integument creating weakly spotted appearance. Apex of fore tibia with comb of stout spines; hind coxa polished, with sparse, shorter, white setae; hind femur stout, polished, 2.3
<normalizedToken originalValue="×">x</normalizedToken>
longer than wide, outer surface of hind femur sparsely covered with short, white setae; inner surface of hind femur polished with very short setae; surface of hind tibia polished, with long, erect white setae dorsally and ventrally, shorter setae laterally; dorsal setae lacking spatulate tips; inner ventral margin of hind tibia with a dense longitudinal patch of shorter white setae; hind basitarsus long, 1.5
<normalizedToken originalValue="×">x</normalizedToken>
length of remaining four tarsomeres combined; basitarsus ventrally with dense preening brush consisting of numerous short, brown setae, inclined posteriorly; basitarsus dorsally with normal long, white setae, lacking spatulate tips; T2 twice as long as wide, T3 1.3
<normalizedToken originalValue="×">x</normalizedToken>
longer than wide, T4 ca. as long as wide, T5 ca. 4
<normalizedToken originalValue="×">x</normalizedToken>
as long as wide; all tarsomeres with normal hair-like setae, but also with scattered elongate, stronger setae projecting from dorsal surface; tarsal claw simple, strongly curved.
</paragraph>
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" pageId="0" pageNumber="27">
<emphasis italics="true" pageId="0" pageNumber="27">Wings</emphasis>
.
</emphasis>
Forewing length 3.1 mm, 3
<normalizedToken originalValue="×">x</normalizedToken>
longer than wide; wing surface evenly covered with small, scattered setae, including basal cells R and 1A; wing clear, without dark vertical bands. Forewing venation with vein Rs apically curving abruptly towards anterior wing margin to form short, truncate marginal cell 2R1; apical segment of vein M abbreviated, not extending beyond apex of marginal cell, vein M with small white bulla situated at a quarter of vein length. Hind wing with apical stub of vein Rs 2/3 of shortest width between the propodeal submedian longitudinal carinae.
</paragraph>
<paragraph pageId="0" pageNumber="27">
<emphasis bold="true" italics="true" pageId="0" pageNumber="27">Metasoma</emphasis>
in lateral view 1.75
<normalizedToken originalValue="×">x</normalizedToken>
as long as wide, with seven dorsally visible terga, all polished; exposed portion of ovipositor relatively short, in lateral view 0.76
<normalizedToken originalValue="×">x</normalizedToken>
metasomal length; dorsal valve with 14 serrations, ventral valve smooth; ovipositor sheaths setose, strongly curled (an artefact of preservation).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="27" type="variation">
<paragraph pageId="0" pageNumber="27">Variation.</paragraph>
<paragraph pageId="0" pageNumber="27">Paratype male has body length 3.75 mm, and forewing length 3.0 mm.</paragraph>
</subSubSection>
</treatment>
</document>