222 lines
17 KiB
XML
222 lines
17 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.208.3326" ID-GBIF-Dataset="692c4233-dfa9-4ea1-8f8e-0afadbd1f996" ID-PMC="PMC3406448" ID-Pensoft-Pub="1313-2970-208-61" ID-PubMed="22859873" ModsDocAuthor="" ModsDocDate="2012" ModsDocID="1313-2970-208-61" ModsDocOrigin="ZooKeys 208" ModsDocTitle="Mariapanteles (Hymenoptera, Braconidae), a new genus of Neotropical microgastrine parasitoid wasp discovered through biodiversity inventory" checkinTime="1451248886443" checkinUser="pensoft" docAuthor="Whitfield, James B., Fernandez-Triana, Jose L., Janzen, Daniel H., Hallwachs, Winnie, Smith, M. Alex & Cardinal, Sophie" docDate="2012" docId="ED95727767050E8581C815EE1E5E0A8F" docLanguage="en" docName="ZooKeys 208: 61-80" docOrigin="ZooKeys 208" docSource="http://dx.doi.org/10.3897/zookeys.208.3326" docTitle="Mariapanteles dapkeyae Fernandez-Triana, sp. n." docType="treatment" docVersion="4" lastPageNumber="69" masterDocId="FFBCFFF6FF8AFF86FF9BFF86FF80FF8C" masterDocTitle="Mariapanteles (Hymenoptera, Braconidae), a new genus of Neotropical microgastrine parasitoid wasp discovered through biodiversity inventory" masterLastPageNumber="80" masterPageNumber="61" pageNumber="66" updateTime="1668154176021" updateUser="ExternalLinkService">
|
||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||
<mods:titleInfo>
|
||
<mods:title>Mariapanteles (Hymenoptera, Braconidae), a new genus of Neotropical microgastrine parasitoid wasp discovered through biodiversity inventory</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Whitfield, James B.</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Fernandez-Triana, Jose L.</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Janzen, Daniel H.</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Hallwachs, Winnie</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Smith, M. Alex</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Cardinal, Sophie</mods:namePart>
|
||
</mods:name>
|
||
<mods:typeOfResource>text</mods:typeOfResource>
|
||
<mods:relatedItem type="host">
|
||
<mods:titleInfo>
|
||
<mods:title>ZooKeys</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:part>
|
||
<mods:date>2012</mods:date>
|
||
<mods:detail type="volume">
|
||
<mods:number>208</mods:number>
|
||
</mods:detail>
|
||
<mods:extent unit="page">
|
||
<mods:start>61</mods:start>
|
||
<mods:end>80</mods:end>
|
||
</mods:extent>
|
||
</mods:part>
|
||
</mods:relatedItem>
|
||
<mods:location>
|
||
<mods:url>http://dx.doi.org/10.3897/zookeys.208.3326</mods:url>
|
||
</mods:location>
|
||
<mods:classification>journal article</mods:classification>
|
||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.208.3326</mods:identifier>
|
||
<mods:identifier type="Pensoft-Pub">1313-2970-208-61</mods:identifier>
|
||
</mods:mods>
|
||
<treatment ID-GBIF-Taxon="152036389" LSID="urn:lsid:zoobank.org:act:EF2F8657-FEBB-4AEE-8501-06B104771B86" httpUri="http://treatment.plazi.org/id/ED95727767050E8581C815EE1E5E0A8F" lastPageId="8" lastPageNumber="69" pageId="5" pageNumber="66">
|
||
<subSubSection pageId="5" pageNumber="66" type="nomenclature">
|
||
<paragraph pageId="5" pageNumber="66">
|
||
<taxonomicName LSID="urn:lsid:zoobank.org:act:EF2F8657-FEBB-4AEE-8501-06B104771B86" authority="Fernandez-Triana" class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles dapkeyae" order="Hymenoptera" pageId="5" pageNumber="66" phylum="Arthropoda" rank="species" species="dapkeyae">
|
||
Mariapanteles dapkeyae
|
||
<normalizedToken originalValue="Fernández-Triana">Fernandez-Triana</normalizedToken>
|
||
</taxonomicName>
|
||
<taxonomicNameLabel pageId="5" pageNumber="66">sp. n.</taxonomicNameLabel>
|
||
Figs 7-12
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="5" pageNumber="66" type="holotype">
|
||
<paragraph pageId="5" pageNumber="66">Holotype.</paragraph>
|
||
<paragraph pageId="5" pageNumber="66">Female (CNC).BRAZIL: Mato Grosso, Sinop; x-xi.1975, Malaise Trap; M. Alvarenga col.</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="5" pageNumber="66" type="paratype">
|
||
<paragraph pageId="5" pageNumber="66">Paratype.</paragraph>
|
||
<paragraph pageId="5" pageNumber="66">
|
||
5 Females and 4 Males (CNC, with 1 female each deposited in INHS and BMNH). Same data as for holotype, except for collecting date (x.1974 for all specimens but two males with collecting date: x.1975). Two males deposited in the CNC have DNA Voucher codes: CNCHYM 03387 and CNCHYM 07145. 1 Female (CNC). BRAZIL:
|
||
<normalizedToken originalValue="Goiás">Goias</normalizedToken>
|
||
, Jatai; xi.1972; F. M. Oliveira col.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="6" lastPageNumber="67" pageId="5" pageNumber="66" type="description">
|
||
<paragraph pageId="5" pageNumber="66">Description.</paragraph>
|
||
<paragraph pageId="5" pageNumber="66">
|
||
Female. Antenna about the same length as body; body length 2.4 mm; forewing 2.6 mm. Head. Face with shallow and sparse punctures and sparse, uniformly distributed setae. Face width at antennal base/face width at clypeus edge: 1.1
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
; intertentorial pit distance/face width at clypeus edge: 0.4
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
; compound eye height/head height: 0.8
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
; head height/width: 0.8
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
; face width at antennal base/head maximum width: 0.5
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
; malar space/basal width of mandible 1.4
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
; clypeus width/height: 3.5
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
. Length/width of flagellomeres: 2nd (2.4
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
), 8th (2.5
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
), 14th (1.3
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
). Length of flagellomere 2nd/length of flagellomere 14th: 2.2
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
. Ocello-ocular distance/posterior ocelli diameter: 2.2
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
; distance between posterior ocelli/ocelli diameter: 1.3
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
.
|
||
</paragraph>
|
||
<paragraph pageId="5" pageNumber="66">
|
||
Mesosoma. Pronotum with two lateral grooves present, the lower one excavated. Mesoscutum more or less uniformly sculptured by shallowly impressed punctures (distance between punctures about the same as their diameter). Mesoscutum 1.3
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
wider than long. Mesoscutum and scutellum uniformly covered by dense, pale yellow pilosity. Scutellum mostly smooth, with very shallow and sparse punctures. Scutellum length/width at base 1.1
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
. Scutellar suture broad, with 4-6 costulae. Posterior band of scutellum polished. Scutellar lateral face with polished area less than 20% the face height and less than half the face width. Mesopleuron mostly smooth and glabrous, except for punctures on the anterior margin and setae on all margins; separated from metapleuron by crenulate sulcus. Metapleuron mostly smooth, with some punctures and setae in the apical half; metapleuron with a crenulated, longitudinal sulcus running from lower margin near metacoxa through spiracle. Metapleural carina raised with a short lamella. Propodeum mostly smooth; with a median carina well defined and raised its entire length; and with a clearly complete transverse carina that reaches the spiracles and forks around them (there are also additional, shorter transverse carinae). Transverse carina on propodeum delimiting two areas, the anterior, basal one that is more or less horizontal, and the posterior, apical one is declivous.
|
||
</paragraph>
|
||
<paragraph lastPageId="6" lastPageNumber="67" pageId="5" pageNumber="66">
|
||
Metasoma. Mediotergite 1 mostly smooth and with a deep medial groove over its basal half; slightly widening for the first quarter of its length, then narrowing t
|
||
<pageBreakToken pageId="6" pageNumber="67" start="start">owards</pageBreakToken>
|
||
apex; basal width/apical width 1.5
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
; length/apical width 3.3
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
. Mediotergite 2 mostly smooth, transverse, subtriangular to trapezoidal in shape; basal width/apical width 0.3
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
; length/apical width 0.4
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
. Mediotergite 3 1.5
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
the length of mediotergite 2. Mediotergite 3 and following unsculptured, polished and with sparse setae. Hypopygium mostly inflexible but with a median, translucid fold ventrally where 1-2 weak pleats are sometimes distinguishable. Ovipositor sheaths fully setose, 0.7
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
as long as metatibia length.
|
||
</paragraph>
|
||
<paragraph pageId="6" pageNumber="67">
|
||
Legs. Metacoxa long, surpassing the length of the third metasomal tergum. Metatibial inner spur 1.4
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
the length of outer spur, and 0.5X the length of metatarsomere 1. Metafemur 3.2
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
as long as wide.
|
||
</paragraph>
|
||
<paragraph pageId="6" pageNumber="67">
|
||
Wings. Vein R1a 1.3
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
as long as stigma length. Stigma 3.3
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
as long as wide. Length of R1a about 14
|
||
<normalizedToken originalValue="×">x</normalizedToken>
|
||
as long as the distance between its end and the end of 3RSb. Vein r and 2RS evenly curved to very slightly arched, with no clear limits between the two veins. Vein 2M about the same length of vein (RS+M)b. Edge of vannal lobe of hind wing medially straight to slightly concave and with uniformly distribute setae which are shorter than those at base and apex of the lobe.
|
||
</paragraph>
|
||
<paragraph pageId="6" pageNumber="67">Colour: Mostly yellow, with antennal flagellomere, forewing stigma and most of the wing veins, light brown.</paragraph>
|
||
<paragraph pageId="6" pageNumber="67">Male. Mostly like females, but some specimens with darker interocellar area and mediotergites 3+. We associate these males with these females because of their morphological similarity.</paragraph>
|
||
<caption pageId="6" pageNumber="67">
|
||
<paragraph pageId="6" pageNumber="67">
|
||
Figures 7-12.
|
||
<taxonomicName class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles dapkeyae" order="Hymenoptera" pageId="6" pageNumber="67" phylum="Arthropoda" rank="species" species="dapkeyae">Mariapanteles dapkeyae</taxonomicName>
|
||
Fernandez-Triana. 7 lateral habitus, female 8 dorsal habitus, female 9 fore wing, female 10 head and mesoscutum, dorsal view, female 11 hypopygium and ovipositor, lateral view 12 metanotum, propodeum and anterior metasomal tergites, female, dorsal view.
|
||
</paragraph>
|
||
</caption>
|
||
</subSubSection>
|
||
<subSubSection pageId="6" pageNumber="67" type="distribution">
|
||
<paragraph pageId="6" pageNumber="67">Distribution.</paragraph>
|
||
<paragraph pageId="6" pageNumber="67">The specimens were collected with Malaise traps in two Brazilian localities (less than 1000 km apart) which are presumed to have been rain forests at the time of collecting.</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="6" pageNumber="67" type="molecular data">
|
||
<paragraph pageId="6" pageNumber="67">Molecular data.</paragraph>
|
||
<paragraph pageId="6" pageNumber="67">Two paratype male specimens rendered partial barcodes (361 bp for the one with DNA voucher code CNCHYM 03387, and 164 bp for the one with DNA voucher code CNCHYM 07145). The nucleotide sequence shown below corresponds to the longer sequence in the barcode region of COI:</paragraph>
|
||
<paragraph pageId="6" pageNumber="67">
|
||
>
|
||
<taxonomicName class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles dapkeyae" order="Hymenoptera" pageId="6" pageNumber="67" phylum="Arthropoda" rank="species" species="dapkeyae">Mariapanteles dapkeyae</taxonomicName>
|
||
</paragraph>
|
||
<paragraph pageId="6" pageNumber="67">TAAGATTTTGATTATTAATTCCATCTTTATTTATATTAATTTTTAGAAGATTTATTAATACAGGAGTAGGTACAGGTTGAACAGTATACCCACCATTATCATCAAATTTAAGACATAGGGGCATATCAGTCGATTTAAGAATTTTTTCTTTACATTTAGCAGGAACTTCATCAATTATAGGAGCAATTAATTTTATTACAACAATTAAAAATATACGAGTTAAATTATTTAAAATAAATAAAATTTCTTTATTTAATTGATCAGTTTTAATTACAGCAATTTTATTATTATTATCATTACCAGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACATCATTTTT</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="6" pageNumber="67" type="etymology">
|
||
<paragraph pageId="6" pageNumber="67">Etymology.</paragraph>
|
||
<paragraph pageId="6" pageNumber="67">This species is dedicated to Tanya Heckmann Dapkey of Philadelphia, Pennsylvania, USA, in recognition of her seven years of diligent and highly accurate sorting, processing, databasing, and de-legging ACG microgastrine wasps for DNA barcoding.</paragraph>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="8" lastPageNumber="69" pageId="6" pageNumber="67" type="comments">
|
||
<paragraph pageId="6" pageNumber="67">Comments.</paragraph>
|
||
<paragraph lastPageId="8" lastPageNumber="69" pageId="6" pageNumber="67">
|
||
The biology of this species, collected with Malaise traps, is unknown. In the CNC collection there are two additional specimens of
|
||
<taxonomicName genus="Mariapan" lastPageId="7" lastPageNumber="68" lsidName="Mariapan teles" pageId="6" pageNumber="67" rank="species" species="teles">
|
||
Mariapan
|
||
<pageBreakToken pageId="7" pageNumber="68" start="start">teles</pageBreakToken>
|
||
</taxonomicName>
|
||
from Brazil: one female from Piedra Azul, Minas Gerais; and one male from Rio Javari, Estirar do Equador, Amazonas. Both specimens differ morphologically from
|
||
<taxonomicName class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles dapkeyae" order="Hymenoptera" pageId="7" pageNumber="68" phylum="Arthropoda" rank="species" species="dapkeyae">Mariapanteles dapkeyae</taxonomicName>
|
||
. Additionally, the male specimen (with DNA voucher code CNCHYM 03380) rendered a partial DNA barcode (164bp) which has 7 base pairs
|
||
<pageBreakToken pageId="8" pageNumber="69" start="start">different</pageBreakToken>
|
||
(4.3 %) from the barcoded specimens of
|
||
<taxonomicName class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles dapkeyae" order="Hymenoptera" pageId="8" pageNumber="69" phylum="Arthropoda" rank="species" species="dapkeyae">Mariapanteles dapkeyae</taxonomicName>
|
||
. We believe those two specimens may represent additional species, but because they are singletons we have not described them as new species here.
|
||
</paragraph>
|
||
<caption pageId="8" pageNumber="69">
|
||
<paragraph pageId="8" pageNumber="69">
|
||
Figure 13. Maximum clade credibility tree for
|
||
<taxonomicName class="Insecta" family="Braconidae" genus="Pseudapanteles" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudapanteles" order="Hymenoptera" pageId="8" pageNumber="69" phylum="Arthropoda" rank="genus">Pseudapanteles</taxonomicName>
|
||
and
|
||
<taxonomicName class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles" order="Hymenoptera" pageId="8" pageNumber="69" phylum="Arthropoda" rank="genus">Mariapanteles</taxonomicName>
|
||
based on Bayesian analysis of COI sequences, with 3rd codon positions included (see text for details). Values at nodes are posterior probabilities.
|
||
</paragraph>
|
||
</caption>
|
||
<caption pageId="8" pageNumber="69">
|
||
<paragraph pageId="8" pageNumber="69">
|
||
Figure 14. Maximum clade credibility tree for
|
||
<taxonomicName class="Insecta" family="Braconidae" genus="Pseudapanteles" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Pseudapanteles" order="Hymenoptera" pageId="8" pageNumber="69" phylum="Arthropoda" rank="genus">Pseudapanteles</taxonomicName>
|
||
and
|
||
<taxonomicName class="Insecta" family="Braconidae" genus="Mariapanteles" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Mariapanteles" order="Hymenoptera" pageId="8" pageNumber="69" phylum="Arthropoda" rank="genus">Mariapanteles</taxonomicName>
|
||
based on Bayesian analysis of COI sequences, with 3rd codon positions excluded (see text for details). Values at nodes are posterior probabilities.
|
||
</paragraph>
|
||
</caption>
|
||
</subSubSection>
|
||
</treatment>
|
||
</document> |