252 lines
30 KiB
XML
252 lines
30 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.1132.91244" ID-Pensoft-Pub="1313-2970-1132-85" ID-Pensoft-UUID="E57A2873FAAC552282A3E1390FF28D3E" ID-ZooBank="4168C32E37A74912A9094912E69030AA" ModsDocID="1313-2970-1132-85" checkinTime="1669726345720" checkinUser="pensoft" docAuthor="Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio" docDate="2022" docId="A0820D237F6D526D8A6D482AA90CF569" docLanguage="en" docName="ZooKeys 1132: 85-126" docOrigin="ZooKeys 1132" docPubDate="2022-11-28" docSource="http://dx.doi.org/10.3897/zookeys.1132.91244" docTitle="Terebellides irinae Gagaev 2009" docType="treatment" docVersion="2" id="E57A2873FAAC552282A3E1390FF28D3E" lastPageNumber="85" masterDocId="E57A2873FAAC552282A3E1390FF28D3E" masterDocTitle="A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species" masterLastPageNumber="126" masterPageNumber="85" pageNumber="85" updateTime="1669726647669" updateUser="ExternalLinkService">
|
|
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
|
<mods:titleInfo>
|
|
<mods:title>A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species</mods:title>
|
|
</mods:titleInfo>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Barroso, Maria</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-9624-3602</mods:nameIdentifier>
|
|
<mods:affiliation>Departamento de Bioloxia, Universidade da Coruna, A Coruna, Spain</mods:affiliation>
|
|
<mods:nameIdentifier type="email">maria.p.barroso@udc.es</mods:nameIdentifier>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Moreira, Juan</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-1374-2033</mods:nameIdentifier>
|
|
<mods:affiliation>Departamento de Biologia (Zoologia) & Centro de Investigacion en Biodiversidad y Cambio Global (CIBC-UAM), Facultad de Ciencias, Universidad Autonoma de Madrid, Madrid, Spain</mods:affiliation>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Capa, Maria</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-5063-7961</mods:nameIdentifier>
|
|
<mods:affiliation>Departament de Biologia, Universitat de les Illes Balears, Mallorca, Spain</mods:affiliation>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Nygren, Arne</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-5761-8803</mods:nameIdentifier>
|
|
<mods:affiliation>Sjoefartmuseet Akvariet, Goeteborg, Sweden & Institutionen foer marina vetenskaper, Goeteborgs Universitet, Goeteborg, Sweden</mods:affiliation>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Parapar, Julio</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-7585-6995</mods:nameIdentifier>
|
|
<mods:affiliation>Departamento de Bioloxia, Universidade da Coruna, A Coruna, Spain</mods:affiliation>
|
|
</mods:name>
|
|
<mods:typeOfResource>text</mods:typeOfResource>
|
|
<mods:relatedItem type="host">
|
|
<mods:titleInfo>
|
|
<mods:title>ZooKeys</mods:title>
|
|
</mods:titleInfo>
|
|
<mods:part>
|
|
<mods:date>2022</mods:date>
|
|
<mods:detail type="pubDate">
|
|
<mods:number>2022-11-28</mods:number>
|
|
</mods:detail>
|
|
<mods:detail type="volume">
|
|
<mods:number>1132</mods:number>
|
|
</mods:detail>
|
|
<mods:extent unit="page">
|
|
<mods:start>85</mods:start>
|
|
<mods:end>126</mods:end>
|
|
</mods:extent>
|
|
</mods:part>
|
|
</mods:relatedItem>
|
|
<mods:location>
|
|
<mods:url>http://dx.doi.org/10.3897/zookeys.1132.91244</mods:url>
|
|
</mods:location>
|
|
<mods:classification>journal article</mods:classification>
|
|
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.1132.91244</mods:identifier>
|
|
<mods:identifier type="Pensoft-Pub">1313-2970-1132-85</mods:identifier>
|
|
<mods:identifier type="ZooBank">4168C32E37A74912A9094912E69030AA</mods:identifier>
|
|
<mods:identifier type="Pensoft-UUID">E57A2873FAAC552282A3E1390FF28D3E</mods:identifier>
|
|
</mods:mods>
|
|
<treatment LSID="urn:lsid:plazi:treatment:A0820D237F6D526D8A6D482AA90CF569" httpUri="http://treatment.plazi.org/id/A0820D237F6D526D8A6D482AA90CF569" lastPageNumber="85" pageId="0" pageNumber="85">
|
|
<subSubSection pageId="0" pageNumber="85" type="nomenclature">
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<taxonomicName LSID="A0820D23-7F6D-526D-8A6D-482AA90CF569" authority="Gagaev, 2009" authorityName="Gagaev" authorityYear="2009" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides irinae" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">Terebellides irinae Gagaev, 2009</taxonomicName>
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="description">
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. STM photographs of several Terebellides species (A, C-F non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186) B Terebellides lavesquei sp. nov. (species 5; holotype, ZMBN 116322) C Terebellides atlantis Williams, 1984 (species 16; ZMBN 116472) D Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498) E Terebellides williamsae Jirkov, 1989 (species 2; ZMBN 116269) F Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure3" httpUri="https://binary.pensoft.net/fig/775019" pageId="0" pageNumber="85">Figs 3D</figureCitation>
|
|
<figureCitation captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Line drawings of several Terebellides species (A, C, D non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186), anterior end, right lateral view B Terebellides lavesquei sp. nov. (holotype; ZMBN 116322), anterior end, left lateral view C Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498), anterior end, ventral view D Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283), anterior end, right lateral view. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; tm - tentacular membrane." figureDoi="10.3897/zookeys.1132.91244.figure4" httpUri="https://binary.pensoft.net/fig/775020" pageId="0" pageNumber="85">, 4C</figureCitation>
|
|
<figureCitation captionStart="Figure 9" captionStartId="F9" captionText="Figure 9. Relationship between number of abdominal chaetigers and body length (complete specimens considered except for T. irinae)." figureDoi="10.3897/zookeys.1132.91244.figure9" httpUri="https://binary.pensoft.net/fig/775025" pageId="0" pageNumber="85">, 9</figureCitation>
|
|
<figureCitation captionStart="Figure 10" captionStartId="F10" captionText="Figure 10. Geographic distribution of species of Terebellides in Northeast Atlantic Ocean A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 B Terebellides lavesquei sp. nov. C Terebellides atlantis Williams, 1984 D Terebellides irinae Gagaev, 2009 E Terebellides williamsae Jirkov, 1989 F Terebellides gracilis Malm, 1874. Pink star denotes the type locality of each taxon." figureDoi="10.3897/zookeys.1132.91244.figure10" httpUri="https://binary.pensoft.net/fig/775026" pageId="0" pageNumber="85">, 10D</figureCitation>
|
|
<figureCitation captionStart="Figure 11" captionStartId="F11" captionText="Figure 11. Bathymetric distribution of Terebellides species studied in this work." figureDoi="10.3897/zookeys.1132.91244.figure11" httpUri="https://binary.pensoft.net/fig/775027" pageId="0" pageNumber="85">, 11</figureCitation>
|
|
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Body MG staining patterns in ventral view of Terebellides species. Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016, Terebellides lavesquei sp. nov., Terebellides atlantis Williams, 1984, Terebellides irinae Gagaev, 2009, Terebellides williamsae Jirkov, 1989 and Terebellides gracilis Malm, 1874. Segments indicated in Arabic numbers." figureDoi="10.3897/zookeys.1132.91244.figure12" httpUri="https://binary.pensoft.net/fig/775028" pageId="0" pageNumber="85">, 12</figureCitation>
|
|
<figureCitation captionStart="Figure 13" captionStartId="F13" captionText="Figure 13. Terebellides irinae Gagaev, 2009 (species 24; non-type specimen, ZMBN 116501), SEM micrographs. A anterior end, ventral view B TC 6 (TU 1), geniculate chaetae C row of thoracic uncini D thoracic uncini E abdominal uncini F abdominal uncinus, detail. Abbreviations: tc - thoracic chaetiger; tm - tentacular membrane; tu - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure13" httpUri="https://binary.pensoft.net/fig/775029" pageId="0" pageNumber="85">, 13</figureCitation>
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="reference_group">
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<taxonomicName authorityName="Gagaev" authorityYear="2009" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides irinae" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">Terebellides irinae</taxonomicName>
|
|
Gagaev, 2009: 474-478.
|
|
</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<taxonomicName authorityName="Gagaev" authorityYear="2009" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides irinae" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">Terebellides irinae</taxonomicName>
|
|
Species 24 -
|
|
<bibRefCitation DOI="https://doi.org/10.1371/journal.pone.0198356" author="Nygren, A" journalOrPublisher="Molecular Phylogenetics and Evolution" pageId="0" pageNumber="85" refId="B26" refString="Nygren, A, Parapar, J, Pons, J, Meissner, K, Bakken, T, Kongsrud, JA, Oug, E, Gaeva, D, Sikorski, A, Johansen, RA, Hutchings, PA, Lavesque, N, Capa, M, 2018. A mega-cryptic species complex hidden among one of the most common annelids in the North-East Atlantic. PLoS ONE 13(6): e0198356. https://doi.org/10.1371/journal.pone.0198356" title="A mega-cryptic species complex hidden among one of the most common annelids in the North-East Atlantic. PLoS ONE 13 (6): e 0198356." url="https://doi.org/10.1371/journal.pone.0198356" year="2018">Nygren et al. 2018</bibRefCitation>
|
|
: 18-22, figs 6, 10.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
|
|
<paragraph pageId="0" pageNumber="85">Material examined.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<specimenCount type="generic">6 specimens</specimenCount>
|
|
(Suppl. material 1), Arctic Ocean (ZMBN116496, ZMBN116497, ZMBN116498, ZMBN116499, ZMBN116500, ZMBN116501).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
|
|
<paragraph pageId="0" pageNumber="85">GenBank accession numbers of material examined (COI).</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<materialsCitation accessionNumber="MG025340, MG025341, MG025342, MG025343, MG025344" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" specimenCount="1">
|
|
<accessionNumber isEnumeration="true">MG025340, MG025341, MG025342, MG025343, MG025344</accessionNumber>
|
|
</materialsCitation>
|
|
.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
|
|
<paragraph pageId="0" pageNumber="85">Diagnostic features of studied material.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
Incomplete individuals ranging from 10.0-17.0 mm in length (Fig.
|
|
<figureCitation captionStart="Figure 9" captionStartId="F9" captionText="Figure 9. Relationship between number of abdominal chaetigers and body length (complete specimens considered except for T. irinae)." figureDoi="10.3897/zookeys.1132.91244.figure9" httpUri="https://binary.pensoft.net/fig/775025" pageId="0" pageNumber="85">9</figureCitation>
|
|
). Branchial dorsal lobes provided with filaments, 75.0
|
|
<normalizedToken originalValue="µm">µm</normalizedToken>
|
|
in length (Fig.
|
|
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. STM photographs of several Terebellides species (A, C-F non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186) B Terebellides lavesquei sp. nov. (species 5; holotype, ZMBN 116322) C Terebellides atlantis Williams, 1984 (species 16; ZMBN 116472) D Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498) E Terebellides williamsae Jirkov, 1989 (species 2; ZMBN 116269) F Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure3" httpUri="https://binary.pensoft.net/fig/775019" pageId="0" pageNumber="85">3D</figureCitation>
|
|
) and branchial ventral lobes reduced, distinctly smaller than dorsal ones (Fig.
|
|
<figureCitation captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Line drawings of several Terebellides species (A, C, D non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186), anterior end, right lateral view B Terebellides lavesquei sp. nov. (holotype; ZMBN 116322), anterior end, left lateral view C Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498), anterior end, ventral view D Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283), anterior end, right lateral view. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; tm - tentacular membrane." figureDoi="10.3897/zookeys.1132.91244.figure4" httpUri="https://binary.pensoft.net/fig/775020" pageId="0" pageNumber="85">4C</figureCitation>
|
|
). Dorsal lobes provided with seven lamellae (Fig.
|
|
<figureCitation captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Line drawings of several Terebellides species (A, C, D non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186), anterior end, right lateral view B Terebellides lavesquei sp. nov. (holotype; ZMBN 116322), anterior end, left lateral view C Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498), anterior end, ventral view D Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283), anterior end, right lateral view. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; tm - tentacular membrane." figureDoi="10.3897/zookeys.1132.91244.figure4" httpUri="https://binary.pensoft.net/fig/775020" pageId="0" pageNumber="85">4C</figureCitation>
|
|
). Lateral lappets present on TC 1-4; dorsal projection of thoracic notopodia on TC 2-5 (Fig.
|
|
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. STM photographs of several Terebellides species (A, C-F non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186) B Terebellides lavesquei sp. nov. (species 5; holotype, ZMBN 116322) C Terebellides atlantis Williams, 1984 (species 16; ZMBN 116472) D Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498) E Terebellides williamsae Jirkov, 1989 (species 2; ZMBN 116269) F Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure3" httpUri="https://binary.pensoft.net/fig/775019" pageId="0" pageNumber="85">3D</figureCitation>
|
|
). Geniculate chaetae in TC 5, acutely bent and provided with hardly distinguishable capitium (Fig.
|
|
<figureCitation captionStart="Figure 13" captionStartId="F13" captionText="Figure 13. Terebellides irinae Gagaev, 2009 (species 24; non-type specimen, ZMBN 116501), SEM micrographs. A anterior end, ventral view B TC 6 (TU 1), geniculate chaetae C row of thoracic uncini D thoracic uncini E abdominal uncini F abdominal uncinus, detail. Abbreviations: tc - thoracic chaetiger; tm - tentacular membrane; tu - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure13" httpUri="https://binary.pensoft.net/fig/775029" pageId="0" pageNumber="85">13B</figureCitation>
|
|
). Ciliated papilla dorsal to thoracic notopodia not observed. From TC 7, neuropodia with one row of
|
|
<typeStatus>type</typeStatus>
|
|
3 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of four or five medium-sized teeth, followed by several smaller teeth (Fig.
|
|
<figureCitation captionStart="Figure 13" captionStartId="F13" captionText="Figure 13. Terebellides irinae Gagaev, 2009 (species 24; non-type specimen, ZMBN 116501), SEM micrographs. A anterior end, ventral view B TC 6 (TU 1), geniculate chaetae C row of thoracic uncini D thoracic uncini E abdominal uncini F abdominal uncinus, detail. Abbreviations: tc - thoracic chaetiger; tm - tentacular membrane; tu - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure13" httpUri="https://binary.pensoft.net/fig/775029" pageId="0" pageNumber="85">13C, D</figureCitation>
|
|
). Abdomen with at least 20 pairs of neuropodia with
|
|
<typeStatus>type</typeStatus>
|
|
2 uncini (Fig.
|
|
<figureCitation captionStart="Figure 13" captionStartId="F13" captionText="Figure 13. Terebellides irinae Gagaev, 2009 (species 24; non-type specimen, ZMBN 116501), SEM micrographs. A anterior end, ventral view B TC 6 (TU 1), geniculate chaetae C row of thoracic uncini D thoracic uncini E abdominal uncini F abdominal uncinus, detail. Abbreviations: tc - thoracic chaetiger; tm - tentacular membrane; tu - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure13" httpUri="https://binary.pensoft.net/fig/775029" pageId="0" pageNumber="85">13E, F</figureCitation>
|
|
).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="colour pattern">
|
|
<paragraph pageId="0" pageNumber="85">Colour pattern.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
MG staining pattern characterised by compact green colourant in SG 1-4, then turning into striped pattern in SG 5-14 and fading in following segments (Fig.
|
|
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Body MG staining patterns in ventral view of Terebellides species. Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016, Terebellides lavesquei sp. nov., Terebellides atlantis Williams, 1984, Terebellides irinae Gagaev, 2009, Terebellides williamsae Jirkov, 1989 and Terebellides gracilis Malm, 1874. Segments indicated in Arabic numbers." figureDoi="10.3897/zookeys.1132.91244.figure12" httpUri="https://binary.pensoft.net/fig/775028" pageId="0" pageNumber="85">12</figureCitation>
|
|
). Similar to pattern 1.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="nucleotide diagnostic features">
|
|
<paragraph pageId="0" pageNumber="85">Nucleotide diagnostic features.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
All sequences of
|
|
<taxonomicName authorityName="Gagaev" authorityYear="2009" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides irinae" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides irinae</emphasis>
|
|
</taxonomicName>
|
|
share and are distinguished from other available
|
|
<taxonomicName class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="genus">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides</emphasis>
|
|
</taxonomicName>
|
|
sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 177-204: CGGGGGGTTTGGAAACTGGTTAATCCCC, 213-225: TGGGGCCCCAGAC, 249-258: CATAAGGTTC, 273-303: GGCCCTCATCCTACTAGTCAGCTCAGCTGCT, 305-321: GGCTGGT, 327-336: ATGAACTGTA, 342-372: ACCACTTTCAGACAACATCGCTCATGCCGGA, 381-399: AGATCTAGCAATTTTCTCA, 426: CCTAGGTTCTATTAACTTCATCACAACAGTC, 483-499: TCTAGAACGAATCCCAC, 535-573: TTATTACTATCACTACCAGTGCTAGCCGGAGCTATTACC, 594-612: CATTAACACATCATTCTTC, 618-636: AGCCGGTGGTGGTGATCCT.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="type locality">
|
|
<paragraph pageId="0" pageNumber="85">Type locality.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
Arctic Ocean,
|
|
<geoCoordinate degrees="73" direction="north" minutes="04" orientation="latitude" precision="925" value="73.066666">73°04'N</geoCoordinate>
|
|
,
|
|
<geoCoordinate degrees="157" direction="west" minutes="12" orientation="longitude" precision="925" value="-157.2">157°12'W</geoCoordinate>
|
|
(
|
|
<bibRefCitation DOI="https://doi.org/10.1134/S1063074009060042" author="Gagaev, SY" journalOrPublisher="Russian Journal of Marine Biology" pageId="0" pageNumber="85" pagination="474 - 478" refId="B8" refString="Gagaev, SY, 2009. Terebellides irinae sp. n., a new species of Terebellides (Polychaeta: Terebellidae) from the Arctic basin. Russian Journal of Marine Biology 35 (6): 474 - 478, DOI: https://doi.org/10.1134/S1063074009060042" title="Terebellides irinae sp. n., a new species of Terebellides (Polychaeta: Terebellidae) from the Arctic basin." url="https://doi.org/10.1134/S1063074009060042" volume="35" year="2009">Gagaev 2009</bibRefCitation>
|
|
).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="distribution">
|
|
<paragraph pageId="0" pageNumber="85">Distribution and bathymetry.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
Arctic Ocean; 4038-4380 m deep (Figs
|
|
<figureCitation captionStart="Figure 10" captionStartId="F10" captionText="Figure 10. Geographic distribution of species of Terebellides in Northeast Atlantic Ocean A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 B Terebellides lavesquei sp. nov. C Terebellides atlantis Williams, 1984 D Terebellides irinae Gagaev, 2009 E Terebellides williamsae Jirkov, 1989 F Terebellides gracilis Malm, 1874. Pink star denotes the type locality of each taxon." figureDoi="10.3897/zookeys.1132.91244.figure10" httpUri="https://binary.pensoft.net/fig/775026" pageId="0" pageNumber="85">10D</figureCitation>
|
|
,
|
|
<figureCitation captionStart="Figure 11" captionStartId="F11" captionText="Figure 11. Bathymetric distribution of Terebellides species studied in this work." figureDoi="10.3897/zookeys.1132.91244.figure11" httpUri="https://binary.pensoft.net/fig/775027" pageId="0" pageNumber="85">11</figureCitation>
|
|
, Suppl. material 1).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="remarks">
|
|
<paragraph pageId="0" pageNumber="85">Remarks.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<taxonomicName authorityName="Gagaev" authorityYear="2009" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides irinae" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides irinae</emphasis>
|
|
</taxonomicName>
|
|
is a small species, reaching up to 17 mm in length and is characterised by the lack of papillae on margins of branchial lamellae, and by having branchiae of type 4, filaments in ventral branchial lobes, thoracic uncini of type 3 and abdominal uncini of type 2 (Table
|
|
<tableCitation captionStart="Table 1" captionStartId="T1" captionText="Table 1. Comparison of discriminating taxonomic characters of the species studied in this work. Cells in italics show discriminatory characters of each subgroup. (1) sensu Parapar et al. (2016 a); (2) sensu Parapar et al. (2020 b); (3) sensu Parapar et al. (2020 a); (4) dominant trend in bold; (5) Skagerrak." httpUri="http://table.plazi.org/id/D35598DC856676ACF7BB2895D92EA844" pageId="0" pageNumber="85" tableUuid="D35598DC856676ACF7BB2895D92EA844">1</tableCitation>
|
|
).
|
|
<bibRefCitation DOI="https://doi.org/10.15298/invertzool.10.2.02" author="Jirkov, IA" journalOrPublisher="Invertebrate Zoology" pageId="0" pageNumber="85" pagination="217 - 243" refId="B17" refString="Jirkov, IA, Leontovich, MK, 2013. Identification keys for Terebellomorpha (Polychaeta) of the eastern Atlantic and the North Polar Basin. Invertebrate Zoology 10 (1): 217 - 243, DOI: https://doi.org/10.15298/invertzool.10.2.02" title="Identification keys for Terebellomorpha (Polychaeta) of the eastern Atlantic and the North Polar Basin." url="https://doi.org/10.15298/invertzool.10.2.02" volume="10" year="2013">Jirkov and Leontovich (2013)</bibRefCitation>
|
|
proposed
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. irinae" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. irinae</emphasis>
|
|
</taxonomicName>
|
|
as synonym of
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. stroemii" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="stroemii">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. stroemii</emphasis>
|
|
</taxonomicName>
|
|
because it fit within the variability of the latter. However,
|
|
<bibRefCitation DOI="https://doi.org/10.1017/S0025315414000903" author="Parapar, J" journalOrPublisher="Journal of the Marine Biological Association of the United Kingdom" pageId="0" pageNumber="85" pagination="323 - 337" refId="B28" refString="Parapar, J, Hutchings, P, 2014. Redescription of Terebellides stroemii (Polychaeta, Trichobranchidae) and designation of a neotype. Journal of the Marine Biological Association of the United Kingdom 95 (2): 323 - 337, DOI: https://doi.org/10.1017/S0025315414000903" title="Redescription of Terebellides stroemii (Polychaeta, Trichobranchidae) and designation of a neotype." url="https://doi.org/10.1017/S0025315414000903" volume="95" year="2014">Parapar and Hutchings (2014)</bibRefCitation>
|
|
redescribed
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. stroemii" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="stroemii">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. stroemii</emphasis>
|
|
</taxonomicName>
|
|
designating a neotype and
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. irinae" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. irinae</emphasis>
|
|
</taxonomicName>
|
|
not fit in this concept. Later,
|
|
<bibRefCitation DOI="https://doi.org/10.1371/journal.pone.0198356" author="Nygren, A" journalOrPublisher="Molecular Phylogenetics and Evolution" pageId="0" pageNumber="85" refId="B26" refString="Nygren, A, Parapar, J, Pons, J, Meissner, K, Bakken, T, Kongsrud, JA, Oug, E, Gaeva, D, Sikorski, A, Johansen, RA, Hutchings, PA, Lavesque, N, Capa, M, 2018. A mega-cryptic species complex hidden among one of the most common annelids in the North-East Atlantic. PLoS ONE 13(6): e0198356. https://doi.org/10.1371/journal.pone.0198356" title="A mega-cryptic species complex hidden among one of the most common annelids in the North-East Atlantic. PLoS ONE 13 (6): e 0198356." url="https://doi.org/10.1371/journal.pone.0198356" year="2018">Nygren et al. (2018)</bibRefCitation>
|
|
recognised
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. irinae" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. irinae</emphasis>
|
|
</taxonomicName>
|
|
as different from
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. stroemii" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="stroemii">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. stroemii</emphasis>
|
|
</taxonomicName>
|
|
after molecular analyses and pointed out that
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. irinae" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. irinae</emphasis>
|
|
</taxonomicName>
|
|
is the only species present in the Arctic Ocean at depths below 4000 m (Fig.
|
|
<figureCitation captionStart="Figure 11" captionStartId="F11" captionText="Figure 11. Bathymetric distribution of Terebellides species studied in this work." figureDoi="10.3897/zookeys.1132.91244.figure11" httpUri="https://binary.pensoft.net/fig/775027" pageId="0" pageNumber="85">11</figureCitation>
|
|
). Furthermore,
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. irinae" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="irinae">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. irinae</emphasis>
|
|
</taxonomicName>
|
|
is the only species in Northeast Atlantic Ocean bearing branchiae of type 4 and therefore is also considered as a valid species in this work. Other taxa from elsewhere such as
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. mira" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="mira">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. mira</emphasis>
|
|
</taxonomicName>
|
|
and
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. rigel" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="rigel">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. rigel</emphasis>
|
|
</taxonomicName>
|
|
also bear the same branchial type, these two species have branchial lobes free from each other with few numbers of not packed lamellae and ventral lobes are also distinctly smaller than the dorsal ones.
|
|
</paragraph>
|
|
</subSubSection>
|
|
</treatment>
|
|
</document> |