140 lines
15 KiB
XML
140 lines
15 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.421.6342" ID-GBIF-Dataset="1e1b1e6b-a12f-4985-a041-cfc4ca1c7511" ID-PMC="PMC4109470" ID-Pensoft-Pub="1313-2970-421-39" ID-PubMed="25061379" ID-ZBK="748B04579F8443E5A165C2CE1A36CE58" ModsDocAuthor="" ModsDocDate="2014" ModsDocID="1313-2970-421-39" ModsDocOrigin="ZooKeys 421" ModsDocTitle="Four new species of Symmerista Hübner, 1816 (Notodontidae, Nystaleinae) from Costa Rica" checkinTime="1451245680270" checkinUser="pensoft" docAuthor="Chacon, Isidro A., Janzen, Daniel H. & Hallwachs, Winnie" docDate="2014" docId="27BEAC60742AA16C132144221793FC94" docLanguage="en" docName="ZooKeys 421: 39-63" docOrigin="ZooKeys 421" docSource="http://dx.doi.org/10.3897/zookeys.421.6342" docTitle="Symmerista minaei Chacon, sp. n." docType="treatment" docUuid="71A2F18E-A8EC-4BF6-9991-ACEC39D20799" docUuidSource="ZooBank" docVersion="4" lastPageNumber="50" masterDocId="8254FF93733E5A70FFF5FFF73375FFBF" masterDocTitle="Four new species of Symmerista Huebner, 1816 (Notodontidae, Nystaleinae) from Costa Rica" masterLastPageNumber="63" masterPageNumber="39" pageNumber="47" updateTime="1668158804465" updateUser="ExternalLinkService">
|
|
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
|
<mods:titleInfo>
|
|
<mods:title>Four new species of Symmerista Huebner, 1816 (Notodontidae, Nystaleinae) from Costa Rica</mods:title>
|
|
</mods:titleInfo>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Chacon, Isidro A.</mods:namePart>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Janzen, Daniel H.</mods:namePart>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Hallwachs, Winnie</mods:namePart>
|
|
</mods:name>
|
|
<mods:typeOfResource>text</mods:typeOfResource>
|
|
<mods:relatedItem type="host">
|
|
<mods:titleInfo>
|
|
<mods:title>ZooKeys</mods:title>
|
|
</mods:titleInfo>
|
|
<mods:part>
|
|
<mods:date>2014</mods:date>
|
|
<mods:detail type="volume">
|
|
<mods:number>421</mods:number>
|
|
</mods:detail>
|
|
<mods:extent unit="page">
|
|
<mods:start>39</mods:start>
|
|
<mods:end>63</mods:end>
|
|
</mods:extent>
|
|
</mods:part>
|
|
</mods:relatedItem>
|
|
<mods:location>
|
|
<mods:url>http://dx.doi.org/10.3897/zookeys.421.6342</mods:url>
|
|
</mods:location>
|
|
<mods:classification>journal article</mods:classification>
|
|
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.421.6342</mods:identifier>
|
|
<mods:identifier type="Pensoft-Pub">1313-2970-421-39</mods:identifier>
|
|
<mods:identifier type="ZBK">748B04579F8443E5A165C2CE1A36CE58</mods:identifier>
|
|
<mods:identifier type="ZooBank">748B04579F8443E5A165C2CE1A36CE58</mods:identifier>
|
|
</mods:mods>
|
|
<treatment ID-GBIF-Taxon="152053903" LSID="urn:lsid:zoobank.org:act:71A2F18E-A8EC-4BF6-9991-ACEC39D20799" httpUri="http://treatment.plazi.org/id/27BEAC60742AA16C132144221793FC94" lastPageId="12" lastPageNumber="50" pageId="8" pageNumber="47">
|
|
<subSubSection pageId="8" pageNumber="47" type="multiple">
|
|
<paragraph pageId="8" pageNumber="47">Taxon classification Animalia Lepidoptera Notodontidae</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="8" pageNumber="47" type="nomenclature">
|
|
<paragraph pageId="8" pageNumber="47">
|
|
<taxonomicName LSID="http://zoobank.org/71A2F18E-A8EC-4BF6-9991-ACEC39D20799" authority="Chacon" class="Insecta" family="Notodontidae" genus="Symmerista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Symmerista minaei" order="Lepidoptera" pageId="8" pageNumber="47" phylum="Arthropoda" rank="species" species="minaei">
|
|
Symmerista minaei
|
|
<normalizedToken originalValue="Chacón">Chacon</normalizedToken>
|
|
</taxonomicName>
|
|
<taxonomicNameLabel pageId="8" pageNumber="47">sp. n.</taxonomicNameLabel>
|
|
Figs 17-25
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="8" pageNumber="47" type="material examined.">
|
|
<paragraph pageId="8" pageNumber="47">Material examined.</paragraph>
|
|
<paragraph pageId="8" pageNumber="47">4 specimens (1 male, 3 females)</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="8" pageNumber="47" type="type material">
|
|
<paragraph pageId="8" pageNumber="47">Type material.</paragraph>
|
|
<paragraph pageId="8" pageNumber="47">Holotype female: INB0003339208 (dissected, COI barcoded), Costa Rica, Prov. Cartago, El Guarco, Macizo de la Muerte, Estacion La Esperanza, 9.68677-83.87775, 2600 m, July 2001, R. Delgado (INBio). Paratypes: Female: INB0003155283 (COI barcoded), Costa Rica, Prov. Limon, Bratsi, Valle del Silencio, 9.107197-82.961749, 2472 m, 11-12 October 2000, R. Delgado (INBio). Female: INB0003352700 (COI barcoded), Costa Rica, Prov. Cartago, Reserva Forestal Rio Macho, El Guarco, Macizo de la Muerte, Sector La Esperanza, 9.686771-83.87775, 2600 m, August 2001, R. Delgado (INBio).</paragraph>
|
|
<paragraph pageId="8" pageNumber="47">Other material examined: 1 Male, INB00033387642 (dissected) Costa Rica, Prov. Cartago, Reserva Forestal Rio Macho, El Guarco, Macizo de la Muerte, 9.68677-83.87775, 2600 m, October 2001. R. Delgado (INBio).</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="8" pageNumber="47" type="etymology">
|
|
<paragraph pageId="8" pageNumber="47">Etymology.</paragraph>
|
|
<paragraph pageId="8" pageNumber="47">
|
|
This species is dedicated to the Ministerio del Ambiente y
|
|
<normalizedToken originalValue="Energía">Energia</normalizedToken>
|
|
(MINAE) of the government of Costa Rica in recognition of its 28 years of continuous and widespread support for the survival and conservation of the wild biodiversity of Costa Rica.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="9" pageNumber="48" type="diagnosis">
|
|
<paragraph pageId="9" pageNumber="48">
|
|
<pageBreakToken pageId="9" pageNumber="48" start="start">Diagnosis</pageBreakToken>
|
|
.
|
|
</paragraph>
|
|
<paragraph pageId="9" pageNumber="48">
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Symmerista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Symmerista minaei" order="Lepidoptera" pageId="9" pageNumber="48" phylum="Arthropoda" rank="species" species="minaei">Symmerista minaei</taxonomicName>
|
|
differs from
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Symmerista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Symmerista luisdiegogomezi" order="Lepidoptera" pageId="9" pageNumber="48" phylum="Arthropoda" rank="species" species="luisdiegogomezi">Symmerista luisdiegogomezi</taxonomicName>
|
|
on: dorsal FW ground color beige and light brown, square mark creamy near the reniform spot; beige mark in the apex; fringe beige yellow; dorsal HW beige. Male genitalia: T8 anterior margin slightly concave, posterior margin finely serrated with a window in the center; St8 lateral margins wide at the base, narrow to posterior margin, anterior margin concave, slightly sclerotized with a short projection in the center, posterior margin with robust projections, highly sclerotized on each side, with blunt apices, a little dome in the middle of the posterior margin; length of the phallus 3.3 mm, proximal part of phallus tube wide at base, distal part of phallus tube robust, sclerotized, with a tubular lateral projection rounded apex with the distal nipple; proximal part of the vesica with a ventral scobinate patch, distal part of the vesica bulbous. Female genitalia: Anterior and posterior apophyses the same size, long an slender; DB sclerotized; CB rounded, membranous and pleated; posterior margin of postvaginal plate sclerotized, slightly irregular, inverted V-shape.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection lastPageId="10" lastPageNumber="49" pageId="9" pageNumber="48" type="description">
|
|
<paragraph pageId="9" pageNumber="48">Description.</paragraph>
|
|
<paragraph pageId="9" pageNumber="48">Male (Figs 17, 18, 21-24). Head - Antenna bipectinate, dark brown, six terminal flagellomeres with very short rami, antennal shaft brown dorsally and light brown ventrally; scape bearing a long tuft of beige scales, sensilla beige; eye smooth, round, black; frons mostly dark brown and black with beige scales; labial palpus porrect, dark brown ventrally, light brown dorsally; vertex beige with black scales; patagium dark brown and light brown.</paragraph>
|
|
<caption pageId="9" pageNumber="48">
|
|
<paragraph pageId="9" pageNumber="48">
|
|
Figures 17-20.
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Symmerista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Symmerista minaei" order="Lepidoptera" pageId="9" pageNumber="48" phylum="Arthropoda" rank="species" species="minaei">Symmerista minaei</taxonomicName>
|
|
17, 18 Paratype male dorsal and ventral INB0003387642 19, 20 Holotype female dorsal and ventral INB0003339208.
|
|
</paragraph>
|
|
</caption>
|
|
<caption pageId="9" pageNumber="48">
|
|
<paragraph pageId="9" pageNumber="48">
|
|
Figures 21-25.
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Symmerista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Symmerista minaei" order="Lepidoptera" pageId="9" pageNumber="48" phylum="Arthropoda" rank="species" species="minaei">Symmerista minaei</taxonomicName>
|
|
INB0003387642 21, 22 Paratype male genitalia 23 Male St8 24 Phallus 25 Holotype female genitalia INB0003339208,
|
|
</paragraph>
|
|
</caption>
|
|
<paragraph pageId="10" pageNumber="49">
|
|
<pageBreakToken pageId="10" pageNumber="49" start="start">Thorax</pageBreakToken>
|
|
and abdomen - Tegula dark brown at base, a mix of dark brown and light brown scales distally; mesoscutellum beige and dark brown; thoracic pleuron from beige to dark brown; dorsal area of metathorax with black and dark brown hair-like scales; legs mostly dark brown with beige scales between segments; abdominal dorsum dirty beige, venter beige. Wings - dorsal FW ground color beige and light brown, with reniform spot black; basal band light brown; postmedial band light brown; a creamy-white square distal to reniform spot; AD black; fringe dark brown with beige scales where veins touch termen; beige mark in apex; dorsal HW beige; fringe beige-yellow (Figs 17, 18) (WL 17.20-19.21 mm). Male genitalia (Figs 21-24) - T8 wider than long, anterior margin slightly concave, posterior margin finely serrated with a window in center; St8 lateral margins wide at base, narrow to posterior margins, anterior margin convex, slightly sclerotized with a short projection in center, posterior margin concave with a pair of short projections, these sclerotized with blunt apices, a small setose dome in middle of posterior margin (Fig. 23); valva membranous, mildly pubescent, margin of sacculus slightly serrated, costa with straight margin with a distal protuberance close to apex; valva with a triangular spine-like process; tegumen narrowed dorsally; uncus plate slightly concave, somewhat helmet shaped, dorsal surface rough, pubescent, ventral surface smooth with sparse pubescence, socii long, wide, pubescent at bases, narrow and flattened at apex, form s-shaped; vinculum slightly sclerotized (Figs 21, 22); length of phallus 3.3 mm, proximal part of phallus tube wide at base, distal part of phallus tube robust, sclerotized, with a tubular lateral projection rounded apex with distal nipple; proximal part of vesica with a ventral scobinate patch, distal part of vesica bulbous (Fig. 24). Female (Figs 19, 20, 25) Head - Antenna simple, shaft dark brown with cream-colored scales, scape with a tuft of cream-colored scales; eyes naked; frons dark brown, vertex dark brown with groups of beige scales at base and between antennal bases; haustellum vestigial, labial palpus dark brown.
|
|
</paragraph>
|
|
<paragraph pageId="10" pageNumber="49">Thorax and abdomen - Generally dark brown, tegula beige, scales of thorax long and forked. Patagium and prothorax with beige and cream scales; mesothorax with scales cream, dark brown and beige; metathorax with a group of black hair-like scales along posterior margin; abdomen light brownish gray, abdominal apex with a thick group of beige scales.</paragraph>
|
|
<paragraph pageId="10" pageNumber="49">Wings - dorsally FW ground color dark brown; antemedial beige band lined at both sides by sinuous dirty dark brown lines; reniform spot black; an irregular thin white to beige line extends from the apex to the reniform spot; postmedial line beige, lined on each side with dark brown; adterminal line black; light beige area between adterminal line and postmedial band from M3 to tornus; fringe dark brown with beige scales where veins touch termen; dorsal HW dirty beige, fringe beige (Figs 19, 20) (WL 19.63-21.18 mm). Female genitalia (Fig. 25) - Papillae anales mambranous with short, scattered setae with longer, inwardly-curved setae arising from base. Anterior and posterior apophyses of same size, long and slender; DB sclerotized; CB rounded, membranous and pleated; posterior margin of postvaginal plate sclerotized, slightly irregular, inverted V-shape.</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="11" pageNumber="50" type="distribution and habitat">
|
|
<paragraph pageId="11" pageNumber="50">
|
|
<pageBreakToken pageId="11" pageNumber="50" start="start">Distribution</pageBreakToken>
|
|
and habitat.
|
|
</paragraph>
|
|
<paragraph pageId="11" pageNumber="50">
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Symmerista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Symmerista minaei" order="Lepidoptera" pageId="11" pageNumber="50" phylum="Arthropoda" rank="species" species="minaei">Symmerista minaei</taxonomicName>
|
|
has only been collected at elevations between 2400 and 2600 m in highland cloud forests of the Cordillera de Talamanca (Talamanca Mountain Range) (Fig. 49).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection lastPageId="12" lastPageNumber="51" pageId="11" pageNumber="50" type="remarks">
|
|
<paragraph pageId="11" pageNumber="50">Remarks.</paragraph>
|
|
<paragraph pageId="11" pageNumber="50">DNA barcode paratype female INB0003155283.</paragraph>
|
|
<paragraph pageId="11" pageNumber="50">
|
|
MHMXP006-08 | INB0003155283 |
|
|
<taxonomicName class="Insecta" family="Notodontidae" genus="Symmerista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Symmerista minaei" order="Lepidoptera" pageId="11" pageNumber="50" phylum="Arthropoda" rank="species" species="minaei">Symmerista minaei</taxonomicName>
|
|
| COI-5P:
|
|
</paragraph>
|
|
<paragraph lastPageId="12" lastPageNumber="51" pageId="11" pageNumber="50">
|
|
AACATTATATTTCATTTTTGGAATTTGAGCAGGTATAGTTGGAACTTCATAAGCCTATTAATTCGAGCTGAATTAGGAAATCCCGGATCCCTTATTGGAGATGATCAAATTTATAACACAATTGTTACAGCCCATGCCTT
|
|
<pageBreakToken pageId="12" pageNumber="51" start="start">TATTATAATTTTTTTTATAGTAATACCTATTATAATTGGGGGATTTGGTAATTGATTAGTCCCCCTTATGCTAGGAGCCCCAGATATAGCATTCCCACGTATAAATAATATAAGTTTTTGACTTTTACCCCCCTCCTTAACCCTTTTAATTTCAAGAAGAATCGTCGAAAATGGGGCAGGAACCGGATGGACAGTGTACCCCCCACTATCCTCCAATATTGCCCACAGTGGAAGTTCTGTAGATTTAGCTATTTTTTCCCTACATTTAGCTGGAATTTCATCAATTTTAGGGGCCATTAATTTTATCACAACAATTATTAATATACGTCTCAATAACATATCTTTTGATCAAATACCCTTATTTGTTTGAGCTGTTGGAATTACAGCATTTTTACTTTTACTTTCTTTACCTGTTCTAGGGAGCTATTACAATACTACTAACGGATCGTAATTTAAATACATCTTTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT</pageBreakToken>
|
|
</paragraph>
|
|
</subSubSection>
|
|
</treatment>
|
|
</document> |