treatments-xml/data/9B/74/C4/9B74C4BF3DDC5DB098D97D1EDCFDB514.xml
2024-06-21 12:45:21 +02:00

326 lines
36 KiB
XML
Raw Blame History

This file contains ambiguous Unicode characters

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

<document ID-DOI="http://dx.doi.org/10.3897/BDJ.9.e66260" ID-PMC="PMC8102465" ID-Pensoft-Pub="1314-2828-9-e66260" ID-Pensoft-UUID="5366F386BA9058709D3F6067C587B9F9" ID-PubMed="33967582" ID-ZooBank="BBE1D9DCA0B0436EA2ECD82422C45169" ModsDocID="1314-2828-9-e66260" checkinTime="1619703517509" checkinUser="pensoft" docAuthor="Zeng, Zuxian, Wang, Da, Song, Wanjuan, Yu, Hao &amp; Zhong, Yang" docDate="2021" docId="9B74C4BF3DDC5DB098D97D1EDCFDB514" docLanguage="en" docName="BiodivDatJour 9: e66260" docOrigin="Biodiversity Data Journal 9" docPubDate="2021-04-29" docSource="http://dx.doi.org/10.3897/BDJ.9.e66260" docTitle="Clubiona jiugong Yu &amp; Zhong 2021, sp. n." docType="treatment" docUuid="36F4D405-32D2-4119-97B6-9C3758C20F22" docUuidSource="ZooBank" docVersion="3" id="5366F386BA9058709D3F6067C587B9F9" lastPageNumber="66260" masterDocId="5366F386BA9058709D3F6067C587B9F9" masterDocTitle="Clubiona jiugong sp. nov., the fifth species of C. zilla - group from China (Araneae: Clubionidae)" masterLastPageNumber="66260" masterPageNumber="66260" pageNumber="66260" updateTime="1668126058164" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Clubiona jiugong sp. nov., the fifth species of C. zilla - group from China (Araneae: Clubionidae)</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Zeng, Zuxian</mods:namePart>
<mods:affiliation>School of Biological Sciences, Guizhou Education University, Guiyang, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Wang, Da</mods:namePart>
<mods:affiliation>School of Biological Sciences, Guizhou Education University, Guiyang, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Song, Wanjuan</mods:namePart>
<mods:affiliation>School of Biological Sciences, Guizhou Education University, Guiyang, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Yu, Hao</mods:namePart>
<mods:affiliation>School of Biological Sciences, Guizhou Education University, Guiyang, China</mods:affiliation>
<mods:nameIdentifier type="email">insect1986@126.com</mods:nameIdentifier>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Zhong, Yang</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-0517-4582</mods:nameIdentifier>
<mods:affiliation>Hubei Key Laboratory of Radiation Chemistry and Functional Materials, School of Nuclear Technology and Chemistry &amp; Biology, Hubei University of Science and Technology, Xianning, China</mods:affiliation>
<mods:nameIdentifier type="email">hubeispider@aliyun.com</mods:nameIdentifier>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>Biodiversity Data Journal</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2021</mods:date>
<mods:detail type="pubDate">
<mods:number>2021-04-29</mods:number>
</mods:detail>
<mods:detail type="volume">
<mods:number>9</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>66260</mods:start>
<mods:end>66260</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/BDJ.9.e66260</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.9.e66260</mods:identifier>
<mods:identifier type="Pensoft-Pub">1314-2828-9-e66260</mods:identifier>
<mods:identifier type="ZooBank">BBE1D9DCA0B0436EA2ECD82422C45169</mods:identifier>
<mods:identifier type="Pensoft-UUID">5366F386BA9058709D3F6067C587B9F9</mods:identifier>
</mods:mods>
<treatment LSID="urn:lsid:zoobank.org:act:36F4D405-32D2-4119-97B6-9C3758C20F22" httpUri="http://treatment.plazi.org/id/9B74C4BF3DDC5DB098D97D1EDCFDB514" lastPageNumber="66260" pageId="0" pageNumber="66260">
<subSubSection pageId="0" pageNumber="66260" type="nomenclature">
<paragraph pageId="0" pageNumber="66260">
<taxonomicName LSID="9B74C4BF-3DDC-5DB0-98D9-7D1EDCFDB514" authority="Yu &amp; Zhong" authorityName="Yu &amp; Zhong" authorityYear="2021" class="Arachnida" family="Clubionidae" genus="Clubiona" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Clubiona jiugong" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="jiugong" status="sp. n.">Clubiona jiugong Yu &amp; Zhong</taxonomicName>
<taxonomicNameLabel pageId="0" pageNumber="66260">sp. n.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="66260" type="materials_examined">
<paragraph pageId="0" pageNumber="66260">Materials</paragraph>
<paragraph pageId="0" pageNumber="66260">
<materialsCitation accessionNumber="MZ020606" collectingDate="2021-01-01" collectingDateMax="2021-12-31" collectingDateMin="2021-01-01" collectingMethod="by hand" collectorName="Qianle Lu, Yu, Zhong" country="China" determinerName="Hao Yu" latitude="29.39" location="Jiugongshan Nature Reserve" longitude="114.65" pageId="0" pageNumber="66260" specimenCount="1" specimenCount-male="1" stateProvince="Hubei" typeStatus="Holotype">
<emphasis bold="true" pageId="0" pageNumber="66260">Type status:</emphasis>
<materialsCitation accessionNumber="MZ020606" collectingDate="2021-01-01" collectingDateMax="2021-12-31" collectingDateMin="2021-01-01" collectingMethod="by hand" collectorName="Qianle Lu, Yu, Zhong" country="China" determinerName="Hao Yu" latitude="29.39" location="Jiugongshan Nature Reserve" longitude="114.65" specimenCount="1" specimenCount-male="1" stateProvince="Hubei" typeStatus="Holotype">
<typeStatus pageId="0" pageNumber="66260">Holotype</typeStatus>
.
<emphasis bold="true" pageId="0" pageNumber="66260">Occurrence:</emphasis>
recordedBy:
<collectorName pageId="0" pageNumber="66260">Qianle Lu</collectorName>
; individualID: YHCLU0274; individualCount:
<specimenCount pageId="0" pageNumber="66260" type="generic">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="66260">male</specimenType>
; lifeStage:
<specimenType pageId="0" pageNumber="66260">adult</specimenType>
; behavior: foraging; preparations: whole animal (EtOH); associatedSequences: GenBank:
<accessionNumber httpUri="http://www.ncbi.nlm.nih.gov/nucleotide/MZ020606">MZ020606</accessionNumber>
;
<emphasis bold="true" pageId="0" pageNumber="66260">Taxon:</emphasis>
order: Araneae; family: Clubionidae; genus: Clubiona; specificEpithet: jiugong; scientificNameAuthorship:
<collectorName>Yu</collectorName>
&amp;
<collectorName>Zhong</collectorName>
;
<emphasis bold="true" pageId="0" pageNumber="66260">Location:</emphasis>
continent: Asian; country:
<collectingCountry name="China" pageId="0" pageNumber="66260">China</collectingCountry>
; countryCode: CHN; stateProvince:
<collectingRegion country="China" name="Hubei">Hubei</collectingRegion>
; county: Tongshan; locality:
<location LSID="urn:lsid:plazi:treatment:9B74C4BF3DDC5DB098D97D1EDCFDB514:2949C150605C9A386BA0D8DC052F5919" country="China" latitude="29.39" longitude="114.65" name="Jiugongshan Nature Reserve" pageId="0" pageNumber="66260" stateProvince="Hubei">Jiugongshan Nature Reserve</location>
; decimalLatitude:
<geoCoordinate orientation="latitude" pageId="0" pageNumber="66260" value="29.39">29.39</geoCoordinate>
; decimalLongitude:
<geoCoordinate orientation="longitude" pageId="0" pageNumber="66260" value="114.65">114.65</geoCoordinate>
;
<emphasis bold="true" pageId="0" pageNumber="66260">Identification:</emphasis>
identifiedBy:
<determinerName pageId="0" pageNumber="66260">Hao Yu</determinerName>
; dateIdentified: 2020-07;
<emphasis bold="true" pageId="0" pageNumber="66260">Event:</emphasis>
samplingProtocol:
<collectingMethod pageId="0" pageNumber="66260">by hand</collectingMethod>
; samplingEffort:
<quantity metricMagnitude="4" metricUnit="m" metricValue="1.0" unit="km" value="10.0">10 km</quantity>
by foot; year: 2020; month: 7; day: 3;
<emphasis bold="true" pageId="0" pageNumber="66260">Record Level:</emphasis>
institutionCode: MGEU; basisOfRecord: Preserved Specimen
<materialsCitation accessionNumber="MZ020605" collectingDate="2021-01-01" collectingDateMax="2021-12-31" collectingDateMin="2021-01-01" collectingMethod="by hand" collectorName="Qianle Lu, Yu, Zhong" country="China" determinerName="Hao Yu" latitude="29.39" location="Jiugongshan Nature Reserve" longitude="114.65" pageId="0" pageNumber="66260" specimenCount="1" specimenCount-female="1" stateProvince="Hubei" typeStatus="Holotype">
<emphasis bold="true" pageId="0" pageNumber="66260">Type status:</emphasis>
<materialsCitation accessionNumber="MZ020605" collectingDate="2021-01-01" collectingDateMax="2021-12-31" collectingDateMin="2021-01-01" collectingMethod="by hand" collectorName="Qianle Lu, Yu, Zhong" country="China" determinerName="Hao Yu" latitude="29.39" location="Jiugongshan Nature Reserve" longitude="114.65" specimenCount="1" specimenCount-female="1" stateProvince="Hubei" typeStatus="Holotype">
<typeStatus pageId="0" pageNumber="66260">Holotype</typeStatus>
.
<emphasis bold="true" pageId="0" pageNumber="66260">Occurrence:</emphasis>
recordedBy:
<collectorName pageId="0" pageNumber="66260">Qianle Lu</collectorName>
; individualID: YHCLU0275; individualCount:
<specimenCount pageId="0" pageNumber="66260" type="generic">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="66260">female</specimenType>
; lifeStage:
<specimenType pageId="0" pageNumber="66260">adult</specimenType>
; behavior: foraging; preparations: whole animal (EtOH); associatedSequences: GenBank:
<accessionNumber httpUri="http://www.ncbi.nlm.nih.gov/nucleotide/MZ020605">MZ020605</accessionNumber>
;
<emphasis bold="true" pageId="0" pageNumber="66260">Taxon:</emphasis>
order: Araneae; family: Clubionidae; genus: Clubiona; specificEpithet: jiugong; scientificNameAuthorship:
<collectorName>Yu</collectorName>
&amp;
<collectorName>Zhong</collectorName>
;
<emphasis bold="true" pageId="0" pageNumber="66260">Location:</emphasis>
continent: Asian; country:
<collectingCountry name="China" pageId="0" pageNumber="66260">China</collectingCountry>
; countryCode: CHN; stateProvince:
<collectingRegion country="China" name="Hubei">Hubei</collectingRegion>
; county: Tongshan; locality:
<location LSID="urn:lsid:plazi:treatment:9B74C4BF3DDC5DB098D97D1EDCFDB514:7B53F3BDEAB98ACCAC85BB7F18A46282" country="China" latitude="29.39" longitude="114.65" name="Jiugongshan Nature Reserve" pageId="0" pageNumber="66260" stateProvince="Hubei">Jiugongshan Nature Reserve</location>
; decimalLatitude:
<geoCoordinate orientation="latitude" pageId="0" pageNumber="66260" value="29.39">29.39</geoCoordinate>
; decimalLongitude:
<geoCoordinate orientation="longitude" pageId="0" pageNumber="66260" value="114.65">114.65</geoCoordinate>
;
<emphasis bold="true" pageId="0" pageNumber="66260">Identification:</emphasis>
identifiedBy:
<determinerName pageId="0" pageNumber="66260">Hao Yu</determinerName>
; dateIdentified: 2020-07;
<emphasis bold="true" pageId="0" pageNumber="66260">Event:</emphasis>
samplingProtocol:
<collectingMethod pageId="0" pageNumber="66260">by hand</collectingMethod>
; samplingEffort:
<quantity metricMagnitude="4" metricUnit="m" metricValue="1.0" unit="km" value="10.0">10 km</quantity>
by foot; year: 2020; month: 7; day: 4;
<emphasis bold="true" pageId="0" pageNumber="66260">Record Level:</emphasis>
institutionCode: MGEU; basisOfRecord: Preserved Specimen
</materialsCitation>
</materialsCitation>
</materialsCitation>
</materialsCitation>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="66260" type="description">
<paragraph pageId="0" pageNumber="66260">Description</paragraph>
<paragraph pageId="0" pageNumber="66260">
<emphasis bold="true" pageId="0" pageNumber="66260">Male</emphasis>
(Fig.
<figureCitation captionStart="Figure 3" captionStartId="F6756711" captionText="Figure 3. Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A-D); 1 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.9.e66260.figure3" httpUri="https://binary.pensoft.net/fig/511635" pageId="0" pageNumber="66260">3</figureCitation>
E and F). Dimensions in mm. Total length 2.60; carapace 1.33 long, 1.02 wide; abdomen 1.27 long, 0.75 wide.
</paragraph>
<paragraph pageId="0" pageNumber="66260">
Colour of the living holotype male was dark brown with red brown abdomen (Fig.
<figureCitation captionStart="Figure 1" captionStartId="F6756700" captionText="Figure 1. Clubiona jiugong sp. nov. A. Distribution record (red circles); B. Male holotype; C. Male left palp of the holotype, ventral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bar: 0.1 mm (C). The photograph of the living spider was provided by Qianle Lu (Shenzhen, Guangdong)." figureDoi="10.3897/BDJ.9.e66260.figure1" httpUri="https://binary.pensoft.net/fig/534389" pageId="0" pageNumber="66260">1</figureCitation>
B).
<emphasis italics="true" pageId="0" pageNumber="66260">Carapace</emphasis>
yellowish-brown in ethanol (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F6756711" captionText="Figure 3. Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A-D); 1 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.9.e66260.figure3" httpUri="https://binary.pensoft.net/fig/511635" pageId="0" pageNumber="66260">3</figureCitation>
E and F), without a distinct pattern. Fovea red. In dorsal view, anterior eye row (AER) slightly recurved, posterior eye row (PER) almost straight, PER wider than AER. Eye sizes and interdistances (mm): anterior median eyes (AME) 0.08, anterior lateral eyes (ALE) 0.09, posterior median eyes (PME) 0.08, posterior lateral eyes (PLE) 0.07; distance between AMEs (AME-AME) 0.03, distance between AME and ALE (AME-ALE) 0.04, distance between PMEs (PME-PME) 0.16, distance between PME and PLE (PME-PLE) 0.06. Length of median ocular quadrangle (MOQ) 0.18, MOQ anterior width 0.18, MOQ posterior width 0.29.
<emphasis italics="true" pageId="0" pageNumber="66260">Chelicerae</emphasis>
coloured as carapace, with 5 teeth on promargin and 3 on retromargin. Labium and endites yellowish-brown. Sternum 0.70 long, 0.42 wide.
</paragraph>
<paragraph pageId="0" pageNumber="66260">
Abdomen red in ethanol (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F6756711" captionText="Figure 3. Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A-D); 1 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.9.e66260.figure3" httpUri="https://binary.pensoft.net/fig/511635" pageId="0" pageNumber="66260">3</figureCitation>
E and F), elongate-oval, dorsum centrally with a lengthwise reticular pattern, reaching 2/5th of abdomen length, posteriorly with a fuzzy pattern represented by numerous horizontal stripes or blotches; ventre reddish-brown; spinnerets light brown.
</paragraph>
<paragraph pageId="0" pageNumber="66260">
Legs uniformly yellowish-brown in ethanol (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F6756711" captionText="Figure 3. Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A-D); 1 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.9.e66260.figure3" httpUri="https://binary.pensoft.net/fig/511635" pageId="0" pageNumber="66260">3</figureCitation>
E and F). Leg length (mm): I 2.62 (0.80, 1.05, 0.52, 0.25), II 2.84 (0.80, 1.30, 0.49, 0.26), III 2.27 (0.75, 0.78, 0.48, 0.25), IV 3.37 (1.11, 1.27, 0.98, 0.30).
</paragraph>
<paragraph pageId="0" pageNumber="66260">
Palp (Fig.
<figureCitation captionStart="Figure 1" captionStartId="F6756700" captionText="Figure 1. Clubiona jiugong sp. nov. A. Distribution record (red circles); B. Male holotype; C. Male left palp of the holotype, ventral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bar: 0.1 mm (C). The photograph of the living spider was provided by Qianle Lu (Shenzhen, Guangdong)." figureDoi="10.3897/BDJ.9.e66260.figure1" httpUri="https://binary.pensoft.net/fig/534389" pageId="0" pageNumber="66260">1</figureCitation>
C and Fig.
<figureCitation captionStart="Figure 2" captionStartId="F6756705" captionText="Figure 2. Male left palp of the holotype of Clubiona jiugong sp. nov. A. Prolateral view; B. Rretrolateral view; C. Bulb, prolateral view; D. Bulb, ventral view; E. Bulb, retrolateral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bars: 0.1 mm (equal for A and B, equal for C-E)." figureDoi="10.3897/BDJ.9.e66260.figure2" httpUri="https://binary.pensoft.net/fig/511634" pageId="0" pageNumber="66260">2</figureCitation>
A-E). Femur and patella unmodified. Tibia short, with single retrolateral apophysis; retrolateral tibial apophysis (RTA) broad, triangular, distally bifurcate in retrolateral view, both tips blunt. Tegulum oval and relativlely flat, ca. twice longer than wide, sperm duct distinct and sinuous; subtegulum (ST) large, located prolaterally. Embolar part (EP) represented by a wide and flat sclerite, situated prolaterally on the tegulum; embolar part apophysis (EPA) strong, slender and long, about as long as tegulum width, shaped like a dagger, originating on the prolateral flank (approximately 11
<normalizedToken originalValue="oclock">o'clock</normalizedToken>
on tegulum), transversally curved to the retrolateral side. Embolus (E) inserted at approximately ten
<normalizedToken originalValue="oclock">o'clock</normalizedToken>
on tegulum, slender and flagelliform, angled across tegular tip, stretched proximally along membranous conductor, tip extending to one-third of tegulum. Conductor (C) area relatively small, approximately two-fifths the length of tegulum.
</paragraph>
<paragraph pageId="0" pageNumber="66260">
<emphasis bold="true" pageId="0" pageNumber="66260">Female</emphasis>
(Fig.
<figureCitation captionStart="Figure 3" captionStartId="F6756711" captionText="Figure 3. Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A-D); 1 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.9.e66260.figure3" httpUri="https://binary.pensoft.net/fig/511635" pageId="0" pageNumber="66260">3</figureCitation>
G and H. Dimensions in mm) Total length 3.64; carapace 1.61 long, 1.14 wide; abdomen 2.03 long, 1.35 wide. Eye sizes and interdistances: AME 0.09, ALE 0.19, PME 0.07, PLE 0.07, AME-AME 0.05, AME-ALE 0.04, PME-PME 0.19, PME-PLE 0.09. MOQL 0.25, MOQA 0.23, MOQP 0.36. Sternum 0.87 long, 0.49 wide. Measurements of legs: I 2.65 (0.77, 1.10, 0.53, 0.25), II 2.79 (0.84, 1.15, 0.58, 0.22), III 2.52 (0.66, 0.98, 0.65, 0.23), IV 3.81 (1.25, 1.26, 0.94, 0.35). General characters as in female, but slightly larger in size and lighter in colour.
</paragraph>
<paragraph pageId="0" pageNumber="66260">
Epigyne (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F6756711" captionText="Figure 3. Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A-D); 1 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.9.e66260.figure3" httpUri="https://binary.pensoft.net/fig/511635" pageId="0" pageNumber="66260">3</figureCitation>
A-D). Epigynal plate distinctly longer than wide, anterior and lateral margin not delimited, posterior margin rebordered, heavily sclerotised and convex; spermathecae (SP) clearly visible through the tegument in ventral view. Two copulatory openings (CO) large, partly fused, situated at medial portion of epigynal plate posterior margin, anteriorly hidden by a hood. Hood (H) wider than 1/2 of epigyne width, heavily sclerotised, V or U-shaped. Hyaline copulatory ducts (CD) thin, ascending in parallel, the proximal half close together, the distal half widely separated and gently curved towards the bursae. Both spermathecae (SP) and bursae (BS) with smooth surfaces, the former anteriad and distinctly larger than the latter. Spermatheca shaped like a chicken egg, inside pigmented and sclerotised, the two spermathecae closely spaced. Bursae globular, separated by ca. 1.2 diameters.
</paragraph>
<paragraph pageId="0" pageNumber="66260">
<emphasis bold="true" pageId="0" pageNumber="66260">DNA barcode</emphasis>
</paragraph>
<paragraph pageId="0" pageNumber="66260">5'CTTGATCTGCTATAGCAGGAACAGCTATAAGTGTTATAATTCGTATAGAATTAGGACAATCTGGAACATTTTTAGGAGATGATCATTTATATAATGTAGTAGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCTATTTTAATTGGAGGTTTTGGAAATTGAATAATTCCTATGATATTAGGAGCAGCTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTATTACCTCCTTCGTTATTTATATTATTTATATCTTCTATAGCTGAAATAGGTGTGGGAGCAGGGTGAACTATTTATCCTCCTCTTGCATCTAGTATAGGTCATACAGGAAGAGCTATAGATTTTGCTATTTTTTCGTTACATCTAGCTGGAGCTTCTTCTATTATAGGGGCTGTAAATTTTATTACTACTATTATTAATATACGATATATTGGGATGAGAATAGAAAAAGTTCCATTATTTGTTTGGTCTGTTATAATTACTGCAGTACTCTTATTATTATCATTACCTGTATTAGCAGGTGCTATTACTATATTATTGACTGATCGAAATTTTAATACATCTTTTTTTGATCCAGCTGGAGGGGGAGATCCTATTTTATTTCAGCATTTATTTTGATTTTTTGG3' (holotype, YHCLU0274; GenBank: MZ020606)</paragraph>
<paragraph pageId="0" pageNumber="66260">
<emphasis bold="true" pageId="0" pageNumber="66260">DNA barcode</emphasis>
</paragraph>
<paragraph pageId="0" pageNumber="66260">5'TTTGATCTGCTATAGTAGGAACAGCTATAAGTGTTATAATTCGTATAGAATTGGGACAATCTGGAACATTTTTAGGAGATGATCATTTATATAATGTAGTAGTTACAGCTCATGCTTTTGTTATAATTTTTTTTATAGTAATACCAATTTTAATTGGAGGTTTTGGAAATTGAATAATTCCTATGATATTAGGAGCAGCTGATATAGCTTTTCCTCGTATAAATAATTTAAGTTTTTGATTATTACCCCCTTCGTTATTTATATTATTTATATCTTCTATAGCTGAAATAGGTGTGGGAGCAGGGTGAACTATTTATCCTCCTCTTGCATCTAGTATAGGTCATACAGGAAGAGCTATAGATTTTGCTATTTTTTCGTTACATCTAGCTGGAGCTTCTTCTATTATAGGGGCTGTAAATTTTATTACTACTATTATTAATATACGATATATTGGGATGAGAATAGAAAAAGTTCCATTATTTGTTTGGTCTATTATAATTACTGCAGTACTCTTATTATTATCATTACCTGTATTAGCAGGTGCTATTACTATATTATTGACTGATCGAAATTTTAATACATCTTTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATTTCAGCATTTATTTTGATTTTTTGG3' (paratype, YHCLU0275; GenBank: MZ020605)</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="66260" type="diagnosis">
<paragraph pageId="0" pageNumber="66260">Diagnosis</paragraph>
<paragraph pageId="0" pageNumber="66260">
<taxonomicName authorityName="Yu &amp; Zhong" authorityYear="2021" class="Arachnida" family="Clubionidae" genus="Clubiona" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Clubiona jiugong" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="jiugong">
<emphasis italics="true" pageId="0" pageNumber="66260">Clubiona jiugong</emphasis>
</taxonomicName>
sp. nov. resembles the other
<taxonomicName authorityName="Donitz &amp; Strand" authorityYear="1906" class="Arachnida" family="Clubionidae" genus="Clubiona" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Clubiona zilla" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="zilla">
<emphasis italics="true" pageId="0" pageNumber="66260">Clubiona zilla</emphasis>
</taxonomicName>
-group species by the similar habitus (tiny body with length not exceeding 4 mm), but is consistently separable by its genitalia. Male of the new species resembles that of
<taxonomicName class="Arachnida" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" lsidName="C. hooda" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="hooda">
<emphasis italics="true" pageId="0" pageNumber="66260">C. hooda</emphasis>
</taxonomicName>
(
<bibRefCitation author="Dong, X. Y." journalOrPublisher="Acta Arachnologica" pageId="0" pageNumber="66260" pagination="7 - 10" refId="B6756590" refString="Dong, X. Y., Zhang, F., 2016. One new species of the Clubiona trivialis -group (Araneae: Clubionidae) from Hebei Province, China. Acta Arachnologica 65 (1): 7 - 10" title="One new species of the Clubiona trivialis - group (Araneae: Clubionidae) from Hebei Province, China" volume="65" year="2016">Dong and Zhang 2016</bibRefCitation>
: 7, figures 5-7 and 10-12) in having a dagger-shaped EPA and a flagelliform embolus, but can be recognised by the RTA distally bifurcate (Fig.
<figureCitation captionStart="Figure 1" captionStartId="F6756700" captionText="Figure 1. Clubiona jiugong sp. nov. A. Distribution record (red circles); B. Male holotype; C. Male left palp of the holotype, ventral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bar: 0.1 mm (C). The photograph of the living spider was provided by Qianle Lu (Shenzhen, Guangdong)." figureDoi="10.3897/BDJ.9.e66260.figure1" httpUri="https://binary.pensoft.net/fig/534389" pageId="0" pageNumber="66260">1</figureCitation>
C) (vs. RTA not branched in
<taxonomicName class="Arachnida" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" lsidName="C. hooda" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="hooda">
<emphasis italics="true" pageId="0" pageNumber="66260">C. hooda</emphasis>
</taxonomicName>
) and by the EPA originating from the prolateral portion of the tegulum, pointed to the retrolateral side (Fig.
<figureCitation captionStart="Figure 1" captionStartId="F6756700" captionText="Figure 1. Clubiona jiugong sp. nov. A. Distribution record (red circles); B. Male holotype; C. Male left palp of the holotype, ventral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bar: 0.1 mm (C). The photograph of the living spider was provided by Qianle Lu (Shenzhen, Guangdong)." figureDoi="10.3897/BDJ.9.e66260.figure1" httpUri="https://binary.pensoft.net/fig/534389" pageId="0" pageNumber="66260">1</figureCitation>
C, Fig.
<figureCitation captionStart="Figure 2" captionStartId="F6756705" captionText="Figure 2. Male left palp of the holotype of Clubiona jiugong sp. nov. A. Prolateral view; B. Rretrolateral view; C. Bulb, prolateral view; D. Bulb, ventral view; E. Bulb, retrolateral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bars: 0.1 mm (equal for A and B, equal for C-E)." figureDoi="10.3897/BDJ.9.e66260.figure2" httpUri="https://binary.pensoft.net/fig/511634" pageId="0" pageNumber="66260">2</figureCitation>
A and C-E) (vs. EPA originating retrolaterally and curved to the prolateral side). Females of
<taxonomicName class="Arachnida" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" lsidName="C. jiugong" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="jiugong">
<emphasis italics="true" pageId="0" pageNumber="66260">C. jiugong</emphasis>
</taxonomicName>
sp. nov. can be easily distinguished from other members of the
<taxonomicName class="Arachnida" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" lsidName="C. zilla" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="zilla">
<emphasis italics="true" pageId="0" pageNumber="66260">C. zilla</emphasis>
</taxonomicName>
-group, with the exception of
<taxonomicName class="Arachnida" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" lsidName="C. zilla" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="zilla">
<emphasis italics="true" pageId="0" pageNumber="66260">C. zilla</emphasis>
</taxonomicName>
(
<bibRefCitation author="Ono, H." journalOrPublisher="Bulletin of the National Museum of Nature and Science Tokyo" pageId="0" pageNumber="66260" pagination="117 - 121" refId="B6756646" refString="Ono, H., 1986. Little-known Japanese spider, Clubiona zilla (Araneae, Clubionidae)- representative of a new and peculiar species-group. Bulletin of the National Museum of Nature and Science Tokyo A (12): 117 - 121" title="Little-known Japanese spider, Clubiona zilla (Araneae, Clubionidae) - representative of a new and peculiar species-group" volume="A" year="1986">Ono 1986</bibRefCitation>
: 119, figures 6-8) by the hood represented by a transverse sclerotised plate (hoods represented by pairs of guide pockets in all other
<taxonomicName authorityName="Donitz &amp; Strand" authorityYear="1906" class="Arachnida" family="Clubionidae" genus="Clubiona" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Clubiona zilla" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="zilla">
<emphasis italics="true" pageId="0" pageNumber="66260">Clubiona zilla</emphasis>
</taxonomicName>
-group species) and differ from
<taxonomicName class="Arachnida" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" lsidName="C. zilla" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="zilla">
<emphasis italics="true" pageId="0" pageNumber="66260">C. zilla</emphasis>
</taxonomicName>
by: (1) copulatory openings closely spaced and partly fused, situated at the medial portion of epigynal plate posterior margin (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F6756711" captionText="Figure 3. Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A-D); 1 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.9.e66260.figure3" httpUri="https://binary.pensoft.net/fig/511635" pageId="0" pageNumber="66260">3</figureCitation>
A and B) (vs. copulatory openings well separated by ca. 0.8 diameters, situated basolaterally in
<taxonomicName class="Arachnida" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" lsidName="C. zilla" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="zilla">
<emphasis italics="true" pageId="0" pageNumber="66260">C. zilla</emphasis>
</taxonomicName>
); (2) the proximal half of copulatory ducts close together (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F6756711" captionText="Figure 3. Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A-D); 1 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.9.e66260.figure3" httpUri="https://binary.pensoft.net/fig/511635" pageId="0" pageNumber="66260">3</figureCitation>
A and B) (vs. the proximal half of copulatory ducts well separated by more than 4 diameters); (3) spermatheca oval and large, its diameter nearly 1/2 of epigynal width (Fig.
<figureCitation captionStart="Figure 3" captionStartId="F6756711" captionText="Figure 3. Clubiona jiugong sp. nov., female paratype and male holotype. A. Intact epigyne, ventral view; B. Cleared epigyne, ventral view; C. Cleared vulva, dorsal view; D. Vulva, cleared and embedded in Arabic gum, dorsal view; E. Male habitus, dorsal view; F. Male habitus, lateral view; G. Female habitus, dorsal view; H. Female habitus, ventral view. Abbreviations: BS = bursa; CD = copulatory duct; CO = copulatory opening; H = hood; SP = spermatheca. Scale bars: 0.1 mm (equal for A-D); 1 mm (equal for E and F, equal for G and H)." figureDoi="10.3897/BDJ.9.e66260.figure3" httpUri="https://binary.pensoft.net/fig/511635" pageId="0" pageNumber="66260">3</figureCitation>
C and D) (vs. spermatheca globular and small, its diameter slightly less than 1/5 of epigynal width).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="66260" type="etymology">
<paragraph pageId="0" pageNumber="66260">Etymology</paragraph>
<paragraph pageId="0" pageNumber="66260">The species name is derived from the name of the type locality; noun in apposition.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="66260" type="distribution">
<paragraph pageId="0" pageNumber="66260">Distribution</paragraph>
<paragraph pageId="0" pageNumber="66260">
Known from the Mt. Jiugong, Hubei Province, China (Fig.
<figureCitation captionStart="Figure 1" captionStartId="F6756700" captionText="Figure 1. Clubiona jiugong sp. nov. A. Distribution record (red circles); B. Male holotype; C. Male left palp of the holotype, ventral view. Abbreviations: C = conductor; E = embolus; EP = embolar part; EPA = embolar part apophysis; RTA = retrolateral tibial apophysis; ST = subtegulum. Scale bar: 0.1 mm (C). The photograph of the living spider was provided by Qianle Lu (Shenzhen, Guangdong)." figureDoi="10.3897/BDJ.9.e66260.figure1" httpUri="https://binary.pensoft.net/fig/534389" pageId="0" pageNumber="66260">1</figureCitation>
A).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="66260" type="biology">
<paragraph pageId="0" pageNumber="66260">Biology</paragraph>
<paragraph pageId="0" pageNumber="66260">
The holotype of
<taxonomicName class="Arachnida" higherTaxonomySource="GBIF,CoL" kingdom="Animalia" lsidName="C. jiugong" order="Araneae" pageId="0" pageNumber="66260" phylum="Arthropoda" rank="species" species="jiugong">
<emphasis italics="true" pageId="0" pageNumber="66260">C. jiugong</emphasis>
</taxonomicName>
sp. nov. was obtained from foliage in a bush close to a mountain road in the core zone of Jiugong mountain range.
</paragraph>
</subSubSection>
</treatment>
</document>