306 lines
35 KiB
XML
306 lines
35 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.1132.91244" ID-Pensoft-Pub="1313-2970-1132-85" ID-Pensoft-UUID="E57A2873FAAC552282A3E1390FF28D3E" ID-ZooBank="4168C32E37A74912A9094912E69030AA" ModsDocID="1313-2970-1132-85" checkinTime="1669726345720" checkinUser="pensoft" docAuthor="Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio" docDate="2022" docId="106D1741571D5BC4A01516381CF49762" docLanguage="en" docName="ZooKeys 1132: 85-126" docOrigin="ZooKeys 1132" docPubDate="2022-11-28" docSource="http://dx.doi.org/10.3897/zookeys.1132.91244" docTitle="Terebellides lavesquei Barroso & Moreira & Capa & Nygren & Parapar 2022, sp. nov." docType="treatment" docUuid="2D993190-50A3-42C0-B11E-508EA59276B6" docUuidSource="ZooBank" docVersion="2" id="E57A2873FAAC552282A3E1390FF28D3E" lastPageNumber="85" masterDocId="E57A2873FAAC552282A3E1390FF28D3E" masterDocTitle="A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species" masterLastPageNumber="126" masterPageNumber="85" pageNumber="85" updateTime="1669726647669" updateUser="ExternalLinkService">
|
||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||
<mods:titleInfo>
|
||
<mods:title>A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Barroso, Maria</mods:namePart>
|
||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-9624-3602</mods:nameIdentifier>
|
||
<mods:affiliation>Departamento de Bioloxia, Universidade da Coruna, A Coruna, Spain</mods:affiliation>
|
||
<mods:nameIdentifier type="email">maria.p.barroso@udc.es</mods:nameIdentifier>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Moreira, Juan</mods:namePart>
|
||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-1374-2033</mods:nameIdentifier>
|
||
<mods:affiliation>Departamento de Biologia (Zoologia) & Centro de Investigacion en Biodiversidad y Cambio Global (CIBC-UAM), Facultad de Ciencias, Universidad Autonoma de Madrid, Madrid, Spain</mods:affiliation>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Capa, Maria</mods:namePart>
|
||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-5063-7961</mods:nameIdentifier>
|
||
<mods:affiliation>Departament de Biologia, Universitat de les Illes Balears, Mallorca, Spain</mods:affiliation>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Nygren, Arne</mods:namePart>
|
||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-5761-8803</mods:nameIdentifier>
|
||
<mods:affiliation>Sjoefartmuseet Akvariet, Goeteborg, Sweden & Institutionen foer marina vetenskaper, Goeteborgs Universitet, Goeteborg, Sweden</mods:affiliation>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Parapar, Julio</mods:namePart>
|
||
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-7585-6995</mods:nameIdentifier>
|
||
<mods:affiliation>Departamento de Bioloxia, Universidade da Coruna, A Coruna, Spain</mods:affiliation>
|
||
</mods:name>
|
||
<mods:typeOfResource>text</mods:typeOfResource>
|
||
<mods:relatedItem type="host">
|
||
<mods:titleInfo>
|
||
<mods:title>ZooKeys</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:part>
|
||
<mods:date>2022</mods:date>
|
||
<mods:detail type="pubDate">
|
||
<mods:number>2022-11-28</mods:number>
|
||
</mods:detail>
|
||
<mods:detail type="volume">
|
||
<mods:number>1132</mods:number>
|
||
</mods:detail>
|
||
<mods:extent unit="page">
|
||
<mods:start>85</mods:start>
|
||
<mods:end>126</mods:end>
|
||
</mods:extent>
|
||
</mods:part>
|
||
</mods:relatedItem>
|
||
<mods:location>
|
||
<mods:url>http://dx.doi.org/10.3897/zookeys.1132.91244</mods:url>
|
||
</mods:location>
|
||
<mods:classification>journal article</mods:classification>
|
||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.1132.91244</mods:identifier>
|
||
<mods:identifier type="Pensoft-Pub">1313-2970-1132-85</mods:identifier>
|
||
<mods:identifier type="ZooBank">4168C32E37A74912A9094912E69030AA</mods:identifier>
|
||
<mods:identifier type="Pensoft-UUID">E57A2873FAAC552282A3E1390FF28D3E</mods:identifier>
|
||
</mods:mods>
|
||
<treatment LSID="urn:lsid:zoobank.org:act:2D993190-50A3-42C0-B11E-508EA59276B6" httpUri="http://treatment.plazi.org/id/106D1741571D5BC4A01516381CF49762" lastPageNumber="85" pageId="0" pageNumber="85">
|
||
<subSubSection pageId="0" pageNumber="85" type="nomenclature">
|
||
<paragraph pageId="0" pageNumber="85">
|
||
<taxonomicName LSID="https://zoobank.org/2D993190-50A3-42C0-B11E-508EA59276B6" authority="Barroso & Moreira & Capa & Nygren & Parapar, 2022" authorityName="Barroso & Moreira & Capa & Nygren & Parapar" authorityYear="2022" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides lavesquei" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei" status="sp. nov.">Terebellides lavesquei</taxonomicName>
|
||
<taxonomicNameLabel pageId="0" pageNumber="85">sp. nov.</taxonomicNameLabel>
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="description">
|
||
<paragraph pageId="0" pageNumber="85">
|
||
<figureCitation captionStart="Figure 2" captionStartId="F2" captionText="Figure 2. STM photographs of live specimens of several Terebellides species (non-type specimens) A, B Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; A ZMBN 116171 B ZMBN 116181) C Terebellides lavesquei sp. nov. (species 5; GNM 15112) D, E Terebellides williamsae Jirkov, 1989 (species 2; D GNM 15108 E GNM 15109) F Terebellides gracilis Malm, 1874 (species 3; GNM 15111). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure2" httpUri="https://binary.pensoft.net/fig/775018" pageId="0" pageNumber="85">Figs 2C</figureCitation>
|
||
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. STM photographs of several Terebellides species (A, C-F non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186) B Terebellides lavesquei sp. nov. (species 5; holotype, ZMBN 116322) C Terebellides atlantis Williams, 1984 (species 16; ZMBN 116472) D Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498) E Terebellides williamsae Jirkov, 1989 (species 2; ZMBN 116269) F Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure3" httpUri="https://binary.pensoft.net/fig/775019" pageId="0" pageNumber="85">, 3B</figureCitation>
|
||
<figureCitation captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Line drawings of several Terebellides species (A, C, D non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186), anterior end, right lateral view B Terebellides lavesquei sp. nov. (holotype; ZMBN 116322), anterior end, left lateral view C Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498), anterior end, ventral view D Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283), anterior end, right lateral view. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; tm - tentacular membrane." figureDoi="10.3897/zookeys.1132.91244.figure4" httpUri="https://binary.pensoft.net/fig/775020" pageId="0" pageNumber="85">, 4B</figureCitation>
|
||
<figureCitation captionStart="Figure 6" captionStartId="F6" captionText="Figure 6. Terebellides lavesquei sp. nov. (non-type specimen, ZMBN 116332), SEM micrographs A anterior end, left lateral view B branchial lamellae, detail C ciliary row, detail D copepod E copepod, anterior end. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; cop - copepod; cr - ciliary row." figureDoi="10.3897/zookeys.1132.91244.figure6" httpUri="https://binary.pensoft.net/fig/775022" pageId="0" pageNumber="85">, 6</figureCitation>
|
||
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Terebellides lavesquei sp. nov. (non-type specimens, NTNU-VM 61387 and ZMBN 116332), SEM micrographs A TC 6 (TU 1), geniculate chaetae B thoracic uncini C double row of thoracic uncini D abdominal uncini. Abbreviations: cap - capitium; TC - thoracic chaetiger; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure7" httpUri="https://binary.pensoft.net/fig/775023" pageId="0" pageNumber="85">, 7</figureCitation>
|
||
<figureCitation captionStart="Figure 9" captionStartId="F9" captionText="Figure 9. Relationship between number of abdominal chaetigers and body length (complete specimens considered except for T. irinae)." figureDoi="10.3897/zookeys.1132.91244.figure9" httpUri="https://binary.pensoft.net/fig/775025" pageId="0" pageNumber="85">, 9</figureCitation>
|
||
<figureCitation captionStart="Figure 10" captionStartId="F10" captionText="Figure 10. Geographic distribution of species of Terebellides in Northeast Atlantic Ocean A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 B Terebellides lavesquei sp. nov. C Terebellides atlantis Williams, 1984 D Terebellides irinae Gagaev, 2009 E Terebellides williamsae Jirkov, 1989 F Terebellides gracilis Malm, 1874. Pink star denotes the type locality of each taxon." figureDoi="10.3897/zookeys.1132.91244.figure10" httpUri="https://binary.pensoft.net/fig/775026" pageId="0" pageNumber="85">, 10B</figureCitation>
|
||
<figureCitation captionStart="Figure 11" captionStartId="F11" captionText="Figure 11. Bathymetric distribution of Terebellides species studied in this work." figureDoi="10.3897/zookeys.1132.91244.figure11" httpUri="https://binary.pensoft.net/fig/775027" pageId="0" pageNumber="85">, 11</figureCitation>
|
||
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Body MG staining patterns in ventral view of Terebellides species. Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016, Terebellides lavesquei sp. nov., Terebellides atlantis Williams, 1984, Terebellides irinae Gagaev, 2009, Terebellides williamsae Jirkov, 1989 and Terebellides gracilis Malm, 1874. Segments indicated in Arabic numbers." figureDoi="10.3897/zookeys.1132.91244.figure12" httpUri="https://binary.pensoft.net/fig/775028" pageId="0" pageNumber="85">, 12</figureCitation>
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="reference_group">
|
||
<paragraph pageId="0" pageNumber="85">
|
||
<taxonomicName authority="Barroso & Moreira & Capa & Nygren & Parapar, 2022" authorityName="Barroso & Moreira & Capa & Nygren & Parapar" authorityYear="2022" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides lavesquei" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei" status="sp. nov.">Terebellides lavesquei</taxonomicName>
|
||
Species 5 -
|
||
<bibRefCitation DOI="https://doi.org/10.1371/journal.pone.0198356" author="Nygren, A" journalOrPublisher="Molecular Phylogenetics and Evolution" pageId="0" pageNumber="85" refId="B26" refString="Nygren, A, Parapar, J, Pons, J, Meissner, K, Bakken, T, Kongsrud, JA, Oug, E, Gaeva, D, Sikorski, A, Johansen, RA, Hutchings, PA, Lavesque, N, Capa, M, 2018. A mega-cryptic species complex hidden among one of the most common annelids in the North-East Atlantic. PLoS ONE 13(6): e0198356. https://doi.org/10.1371/journal.pone.0198356" title="A mega-cryptic species complex hidden among one of the most common annelids in the North-East Atlantic. PLoS ONE 13 (6): e 0198356." url="https://doi.org/10.1371/journal.pone.0198356" year="2018">Nygren et al. 2018</bibRefCitation>
|
||
: 18-22, figs 6, 10.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
|
||
<paragraph pageId="0" pageNumber="85">Material examined.</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
Type material.
|
||
<emphasis bold="true" italics="true" pageId="0" pageNumber="85">
|
||
<typeStatus>Holotype</typeStatus>
|
||
</emphasis>
|
||
: ZMBN116322.
|
||
<materialsCitation accessionNumber="GNM15112" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" specimenCount="16" typeStatus="Paratypes">
|
||
<emphasis bold="true" italics="true" pageId="0" pageNumber="85">
|
||
<typeStatus>Paratypes</typeStatus>
|
||
</emphasis>
|
||
(
|
||
<specimenCount type="generic">16 specimens</specimenCount>
|
||
): Skagerrak (
|
||
<accessionNumber httpUri="http://www.ncbi.nlm.nih.gov/protein/GNM15112">GNM15112</accessionNumber>
|
||
); Norwegian coast (NTNU-VM61386, NTNU-VM61387, NTNU-VM68252, ZMBN116319, ZMBN116320, ZMBN116321, ZMBN116323, ZMBN116324, ZMBN116325, ZMBN116326, ZMBN116327, ZMBN116328, ZMBN116329, ZMBN116330, ZMBN116331, ZMBN116332)
|
||
</materialsCitation>
|
||
.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="holotype">
|
||
<paragraph pageId="0" pageNumber="85">Holotype.</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
Complete specimen, 34.0 mm long and 2.0 mm wide (Fig.
|
||
<figureCitation captionStart="Figure 4" captionStartId="F4" captionText="Figure 4. Line drawings of several Terebellides species (A, C, D non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186), anterior end, right lateral view B Terebellides lavesquei sp. nov. (holotype; ZMBN 116322), anterior end, left lateral view C Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498), anterior end, ventral view D Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283), anterior end, right lateral view. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; tm - tentacular membrane." figureDoi="10.3897/zookeys.1132.91244.figure4" httpUri="https://binary.pensoft.net/fig/775020" pageId="0" pageNumber="85">4B</figureCitation>
|
||
); female with oocytes in body cavity.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
|
||
<paragraph pageId="0" pageNumber="85">GenBank accession numbers of material examined (COI).</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
<materialsCitation accessionNumber="MG025054, MG025055, MG025056, MG025057, MG025058, MG025059, MG025060, MG025061, MG025062, MG025063, MG025064, MG025065, MG025066, MG025067, MG025068, MG025069, MG025070" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" specimenCount="1">
|
||
<accessionNumber isEnumeration="true">MG025054, MG025055, MG025056, MG025057, MG025058, MG025059, MG025060, MG025061, MG025062, MG025063, MG025064, MG025065, MG025066, MG025067, MG025068, MG025069, MG025070</accessionNumber>
|
||
</materialsCitation>
|
||
.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="type material">
|
||
<paragraph pageId="0" pageNumber="85">Diagnostic features of type material.</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
Complete individuals ranging from 5.0-35.0 mm in length (Fig.
|
||
<figureCitation captionStart="Figure 9" captionStartId="F9" captionText="Figure 9. Relationship between number of abdominal chaetigers and body length (complete specimens considered except for T. irinae)." figureDoi="10.3897/zookeys.1132.91244.figure9" httpUri="https://binary.pensoft.net/fig/775025" pageId="0" pageNumber="85">9</figureCitation>
|
||
). Branchial dorsal lobes lamellae provided with well-developed papillary projections and branchial ventral lobes provided with long filaments, ranging from 125.0-250.0
|
||
<normalizedToken originalValue="µm">µm</normalizedToken>
|
||
in length (Fig.
|
||
<figureCitation captionStart="Figure 6" captionStartId="F6" captionText="Figure 6. Terebellides lavesquei sp. nov. (non-type specimen, ZMBN 116332), SEM micrographs A anterior end, left lateral view B branchial lamellae, detail C ciliary row, detail D copepod E copepod, anterior end. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; cop - copepod; cr - ciliary row." figureDoi="10.3897/zookeys.1132.91244.figure6" httpUri="https://binary.pensoft.net/fig/775022" pageId="0" pageNumber="85">6A</figureCitation>
|
||
). Between 17-42 lamellae on dorsal lobes (Fig.
|
||
<figureCitation captionStart="Figure 6" captionStartId="F6" captionText="Figure 6. Terebellides lavesquei sp. nov. (non-type specimen, ZMBN 116332), SEM micrographs A anterior end, left lateral view B branchial lamellae, detail C ciliary row, detail D copepod E copepod, anterior end. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; cop - copepod; cr - ciliary row." figureDoi="10.3897/zookeys.1132.91244.figure6" httpUri="https://binary.pensoft.net/fig/775022" pageId="0" pageNumber="85">6A, B</figureCitation>
|
||
). Ciliary rows present on lamellae inner face (Fig.
|
||
<figureCitation captionStart="Figure 6" captionStartId="F6" captionText="Figure 6. Terebellides lavesquei sp. nov. (non-type specimen, ZMBN 116332), SEM micrographs A anterior end, left lateral view B branchial lamellae, detail C ciliary row, detail D copepod E copepod, anterior end. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; cop - copepod; cr - ciliary row." figureDoi="10.3897/zookeys.1132.91244.figure6" httpUri="https://binary.pensoft.net/fig/775022" pageId="0" pageNumber="85">6B, C</figureCitation>
|
||
). Ventral branchial lobes hidden in between dorsal ones but sometimes discernible below (Fig.
|
||
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. STM photographs of several Terebellides species (A, C-F non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186) B Terebellides lavesquei sp. nov. (species 5; holotype, ZMBN 116322) C Terebellides atlantis Williams, 1984 (species 16; ZMBN 116472) D Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498) E Terebellides williamsae Jirkov, 1989 (species 2; ZMBN 116269) F Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure3" httpUri="https://binary.pensoft.net/fig/775019" pageId="0" pageNumber="85">3B</figureCitation>
|
||
). Lateral lappets present on T C1-4; dorsal projection of thoracic notopodia on TC 2-4 (Fig.
|
||
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. STM photographs of several Terebellides species (A, C-F non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186) B Terebellides lavesquei sp. nov. (species 5; holotype, ZMBN 116322) C Terebellides atlantis Williams, 1984 (species 16; ZMBN 116472) D Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498) E Terebellides williamsae Jirkov, 1989 (species 2; ZMBN 116269) F Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure3" httpUri="https://binary.pensoft.net/fig/775019" pageId="0" pageNumber="85">3B</figureCitation>
|
||
). Geniculate chaetae in TC 5, acutely bent, with well-defined capitium (Fig.
|
||
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Terebellides lavesquei sp. nov. (non-type specimens, NTNU-VM 61387 and ZMBN 116332), SEM micrographs A TC 6 (TU 1), geniculate chaetae B thoracic uncini C double row of thoracic uncini D abdominal uncini. Abbreviations: cap - capitium; TC - thoracic chaetiger; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure7" httpUri="https://binary.pensoft.net/fig/775023" pageId="0" pageNumber="85">7A</figureCitation>
|
||
). Ciliated papilla dorsal to thoracic notopodia not observed. From TC 7, neuropodia with one or two rows of type 3 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of four or five medium-sized teeth, followed by several smaller teeth (Fig.
|
||
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Terebellides lavesquei sp. nov. (non-type specimens, NTNU-VM 61387 and ZMBN 116332), SEM micrographs A TC 6 (TU 1), geniculate chaetae B thoracic uncini C double row of thoracic uncini D abdominal uncini. Abbreviations: cap - capitium; TC - thoracic chaetiger; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure7" httpUri="https://binary.pensoft.net/fig/775023" pageId="0" pageNumber="85">7B, C</figureCitation>
|
||
). Abdomen with 30-31 pairs of neuropodia with type 2 uncini (Fig.
|
||
<figureCitation captionStart="Figure 7" captionStartId="F7" captionText="Figure 7. Terebellides lavesquei sp. nov. (non-type specimens, NTNU-VM 61387 and ZMBN 116332), SEM micrographs A TC 6 (TU 1), geniculate chaetae B thoracic uncini C double row of thoracic uncini D abdominal uncini. Abbreviations: cap - capitium; TC - thoracic chaetiger; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure7" httpUri="https://binary.pensoft.net/fig/775023" pageId="0" pageNumber="85">7D</figureCitation>
|
||
). Copepods observed attached to body dorsal surface in one specimen (Fig.
|
||
<figureCitation captionStart="Figure 6" captionStartId="F6" captionText="Figure 6. Terebellides lavesquei sp. nov. (non-type specimen, ZMBN 116332), SEM micrographs A anterior end, left lateral view B branchial lamellae, detail C ciliary row, detail D copepod E copepod, anterior end. Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; cop - copepod; cr - ciliary row." figureDoi="10.3897/zookeys.1132.91244.figure6" httpUri="https://binary.pensoft.net/fig/775022" pageId="0" pageNumber="85">6D, E</figureCitation>
|
||
).
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="colour pattern">
|
||
<paragraph pageId="0" pageNumber="85">Colour pattern.</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
MG staining pattern characterised by compact green colourant in SG 1-6, J-shaped glandular region in SG 3-5 and striped pattern in SG 7-14 (Fig.
|
||
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Body MG staining patterns in ventral view of Terebellides species. Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016, Terebellides lavesquei sp. nov., Terebellides atlantis Williams, 1984, Terebellides irinae Gagaev, 2009, Terebellides williamsae Jirkov, 1989 and Terebellides gracilis Malm, 1874. Segments indicated in Arabic numbers." figureDoi="10.3897/zookeys.1132.91244.figure12" httpUri="https://binary.pensoft.net/fig/775028" pageId="0" pageNumber="85">12</figureCitation>
|
||
). Similar to pattern 9.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="nucleotide diagnostic features">
|
||
<paragraph pageId="0" pageNumber="85">Nucleotide diagnostic features.</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
All sequences of
|
||
<taxonomicName authorityName="Barroso & Moreira & Capa & Nygren & Parapar" authorityYear="2022" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides lavesquei" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides lavesquei</emphasis>
|
||
</taxonomicName>
|
||
sp. nov. share and are distinguished from other available
|
||
<taxonomicName class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="genus">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides</emphasis>
|
||
</taxonomicName>
|
||
sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 78-99: TCAACCCGGTGCTTACCTCGGT, 156-174: TTTAGTTATGCCAGTCTTC, 261-264: GTTA, 270-279: TCCAGCACTT, 315-336: AGTTGGGACCGGTTGAACCGTT, 351-369: AGACAATATAGCTCATGCG, 405-411: CTTGGCT, 426-447: CCTAGGATCAATTAACTTTATC, 459-483: CAACATACGCTGAAAAGGTTTACGA, 510-525: GTCCGCGGTTATCACA, 534-558: ACTTCTTTTATCCCTTCCAGTCTTG, 573-580: CATGCTTC, 606-627: CTTTTTCGACCCAGCTGGTGGG.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="type locality">
|
||
<paragraph pageId="0" pageNumber="85">Type locality.</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
Hordaland, Lysefjord (Norway),
|
||
<geoCoordinate degrees="60" direction="north" minutes="07" orientation="latitude" precision="925" value="60.116665">60°07'N</geoCoordinate>
|
||
,
|
||
<geoCoordinate degrees="05" direction="east" minutes="04" orientation="longitude" precision="925" value="5.0666666">05°04'E</geoCoordinate>
|
||
; 119 m deep.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="distribution">
|
||
<paragraph pageId="0" pageNumber="85">Distribution and bathymetry.</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
Norwegian coast and shelf, Skagerrak; 115-534 m deep; ~ 50% of specimens collected at depths above 200 m (Figs
|
||
<figureCitation captionStart="Figure 10" captionStartId="F10" captionText="Figure 10. Geographic distribution of species of Terebellides in Northeast Atlantic Ocean A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 B Terebellides lavesquei sp. nov. C Terebellides atlantis Williams, 1984 D Terebellides irinae Gagaev, 2009 E Terebellides williamsae Jirkov, 1989 F Terebellides gracilis Malm, 1874. Pink star denotes the type locality of each taxon." figureDoi="10.3897/zookeys.1132.91244.figure10" httpUri="https://binary.pensoft.net/fig/775026" pageId="0" pageNumber="85">10B</figureCitation>
|
||
,
|
||
<figureCitation captionStart="Figure 11" captionStartId="F11" captionText="Figure 11. Bathymetric distribution of Terebellides species studied in this work." figureDoi="10.3897/zookeys.1132.91244.figure11" httpUri="https://binary.pensoft.net/fig/775027" pageId="0" pageNumber="85">11</figureCitation>
|
||
, Suppl. material 1).
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="etymology">
|
||
<paragraph pageId="0" pageNumber="85">Etymology.</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
This species is dedicated to Nicolas Lavesque, Station Marine
|
||
<normalizedToken originalValue="d’Arcachon">d'Arcachon</normalizedToken>
|
||
, CNRS (France) for his remarkable recent contributions to the diversity of
|
||
<taxonomicName class="Polychaeta" family="Terebellidae" kingdom="Animalia" lsidName="" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="family">Terebellidae</taxonomicName>
|
||
and
|
||
<taxonomicName class="Polychaeta" family="Trichobranchidae" kingdom="Animalia" lsidName="" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="family">Trichobranchidae</taxonomicName>
|
||
in Atlantic waters.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="85" type="remarks">
|
||
<paragraph pageId="0" pageNumber="85">Remarks.</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
<taxonomicName authorityName="Barroso & Moreira & Capa & Nygren & Parapar" authorityYear="2022" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides lavesquei" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides lavesquei</emphasis>
|
||
</taxonomicName>
|
||
sp. nov. is a medium-sized species, reaching up to 35 mm in length. It is characterised by the lack of papillae on margins of branchial lamellae and by having branchiae of type 2, filaments on ventral branchial lobes, thoracic uncini of type 3 and abdominal uncini of type 2 (Table
|
||
<tableCitation captionStart="Table 1" captionStartId="T1" captionText="Table 1. Comparison of discriminating taxonomic characters of the species studied in this work. Cells in italics show discriminatory characters of each subgroup. (1) sensu Parapar et al. (2016 a); (2) sensu Parapar et al. (2020 b); (3) sensu Parapar et al. (2020 a); (4) dominant trend in bold; (5) Skagerrak." httpUri="http://table.plazi.org/id/D35598DC856676ACF7BB2895D92EA844" pageId="0" pageNumber="85" tableUuid="D35598DC856676ACF7BB2895D92EA844">1</tableCitation>
|
||
).
|
||
<taxonomicName authorityName="Barroso & Moreira & Capa & Nygren & Parapar" authorityYear="2022" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides lavesquei" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides lavesquei</emphasis>
|
||
</taxonomicName>
|
||
sp. nov. is genetically close to
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. shetlandica" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. shetlandica</emphasis>
|
||
</taxonomicName>
|
||
and
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. atlantis" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. atlantis</emphasis>
|
||
</taxonomicName>
|
||
but mostly differs from them regarding branchiae features (Table
|
||
<tableCitation captionStart="Table 1" captionStartId="T1" captionText="Table 1. Comparison of discriminating taxonomic characters of the species studied in this work. Cells in italics show discriminatory characters of each subgroup. (1) sensu Parapar et al. (2016 a); (2) sensu Parapar et al. (2020 b); (3) sensu Parapar et al. (2020 a); (4) dominant trend in bold; (5) Skagerrak." httpUri="http://table.plazi.org/id/D35598DC856676ACF7BB2895D92EA844" pageId="0" pageNumber="85" tableUuid="D35598DC856676ACF7BB2895D92EA844">1</tableCitation>
|
||
). Lobes are partially fused and have many tightly packed lamellae (17-42) in comparison with these species.
|
||
<taxonomicName authorityName="Barroso & Moreira & Capa & Nygren & Parapar" authorityYear="2022" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides lavesquei" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides lavesquei</emphasis>
|
||
</taxonomicName>
|
||
sp. nov. is also similar to
|
||
<taxonomicName authorityName="Lavesque, Hutchings, Daffe, Nygren & Londono-Mesa" authorityYear="2019" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides parapari" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="parapari">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides parapari</emphasis>
|
||
</taxonomicName>
|
||
Lavesque, Hutchings, Daffe, Nygren &
|
||
<normalizedToken originalValue="Londoño-Mesa">Londono-Mesa</normalizedToken>
|
||
, 2019 in having filaments in ventral branchial lobes and the presence of glandular regions, but they differ in the branchial morphology, with lobes fused ca. half of their length in
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. lavesquei" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. lavesquei</emphasis>
|
||
</taxonomicName>
|
||
sp. nov. and fused only at the base in
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. parapari" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="parapari">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. parapari</emphasis>
|
||
</taxonomicName>
|
||
. They also differ in TC 1 notochaetae length, being all similar in
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. lavesquei" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. lavesquei</emphasis>
|
||
</taxonomicName>
|
||
sp. nov. but longer than those in following chaetigers in
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. parapari" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="parapari">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. parapari</emphasis>
|
||
</taxonomicName>
|
||
.
|
||
</paragraph>
|
||
<paragraph pageId="0" pageNumber="85">
|
||
Branchial shape of
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. lavesquei" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. lavesquei</emphasis>
|
||
</taxonomicName>
|
||
sp. nov. is similar to that of
|
||
<taxonomicName authorityName="Hutchings & Peart" authorityYear="2000" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides narribri" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="narribri">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides narribri</emphasis>
|
||
</taxonomicName>
|
||
Hutchings & Peart, 2000, because both lobes are fused to each other for ca. half their length and have a high number of tightly packed lamellae. However,
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. narribri" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="narribri">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. narribri</emphasis>
|
||
</taxonomicName>
|
||
have thoracic uncini of type 1 whereas
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. lavesquei" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. lavesquei</emphasis>
|
||
</taxonomicName>
|
||
sp. nov. have thoracic uncini of type 3. Furthermore,
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. lavesquei" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. lavesquei</emphasis>
|
||
</taxonomicName>
|
||
sp. nov. and
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. shetlandica" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. shetlandica</emphasis>
|
||
</taxonomicName>
|
||
seem to have a more restricted bathymetric distribution in shallow waters (down to 534 and 375 m, respectively) whereas
|
||
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. atlantis" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
|
||
<emphasis italics="true" pageId="0" pageNumber="85">T. atlantis</emphasis>
|
||
</taxonomicName>
|
||
reaches depths of 2750 m (see below).
|
||
</paragraph>
|
||
</subSubSection>
|
||
</treatment>
|
||
</document> |