treatments-xml/data/AF/07/18/AF071857D7A550D3A3CAF8671A065CE1.xml
2024-06-21 12:47:55 +02:00

216 lines
19 KiB
XML

<document ID-DOI="http://dx.doi.org/10.3897/BDJ.10.e96003" ID-Pensoft-Pub="1314-2828-10-e96003" ID-Pensoft-UUID="76077326AB2251039D2C380A594EDA2A" ID-ZooBank="2A9D4A67DC0040DC9745BF531D767F55" ModsDocID="1314-2828-10-e96003" checkinTime="1670952459602" checkinUser="pensoft" docAuthor="Chu, Chang, Lu, Ying, Li, Shuqiang &amp; Yao, Zhiyuan" docDate="2022" docId="AF071857D7A550D3A3CAF8671A065CE1" docLanguage="en" docName="BiodivDatJour 10: e96003" docOrigin="Biodiversity Data Journal 10" docPubDate="2022-12-12" docSource="http://dx.doi.org/10.3897/BDJ.10.e96003" docTitle="Bowie engkilili S. Li &amp; Yao 2022, sp. n." docType="treatment" docVersion="1" id="76077326AB2251039D2C380A594EDA2A" lastPageNumber="96003" masterDocId="76077326AB2251039D2C380A594EDA2A" masterDocTitle="Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia" masterLastPageNumber="96003" masterPageNumber="96003" pageNumber="96003" updateTime="1670952459602" updateUser="pensoft">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Chu, Chang</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0003-3520-5463</mods:nameIdentifier>
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Lu, Ying</mods:namePart>
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Li, Shuqiang</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-3290-5416</mods:nameIdentifier>
<mods:affiliation>Institute of Zoology, Chinese Academy of Sciences, Beijing, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Yao, Zhiyuan</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-1631-0949</mods:nameIdentifier>
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
<mods:nameIdentifier type="email">yaozy@synu.edu.cn</mods:nameIdentifier>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>Biodiversity Data Journal</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2022</mods:date>
<mods:detail type="pubDate">
<mods:number>2022-12-12</mods:number>
</mods:detail>
<mods:detail type="volume">
<mods:number>10</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>96003</mods:start>
<mods:end>96003</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/BDJ.10.e96003</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.10.e96003</mods:identifier>
<mods:identifier type="Pensoft-Pub">1314-2828-10-e96003</mods:identifier>
<mods:identifier type="ZooBank">2A9D4A67DC0040DC9745BF531D767F55</mods:identifier>
<mods:identifier type="Pensoft-UUID">76077326AB2251039D2C380A594EDA2A</mods:identifier>
</mods:mods>
<treatment LSID="urn:lsid:plazi:treatment:AF071857D7A550D3A3CAF8671A065CE1" httpUri="http://treatment.plazi.org/id/AF071857D7A550D3A3CAF8671A065CE1" lastPageNumber="96003" pageId="0" pageNumber="96003">
<subSubSection pageId="0" pageNumber="96003" type="nomenclature">
<paragraph pageId="0" pageNumber="96003">
<taxonomicName LSID="AF071857-D7A5-50D3-A3CA-F8671A065CE1" authority="S. Li &amp; Yao" authorityName="S. Li &amp; Yao" authorityYear="2022" class="Arachnida" genus="Bowie" kingdom="Animalia" lsidName="Bowie engkilili" order="Araneae" pageId="0" pageNumber="96003" phylum="Arthropoda" rank="species" species="engkilili" status="sp. n.">Bowie engkilili S. Li &amp; Yao</taxonomicName>
<taxonomicNameLabel pageId="0" pageNumber="96003">sp. n.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="materials_examined">
<paragraph pageId="0" pageNumber="96003">Materials</paragraph>
<paragraph pageId="0" pageNumber="96003">
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="Collected by hand in leaf litter" collectorName="Occurrence, Z. Bai" country="Malaysia" county="Engkilili" elevation="0" latitude="1.1061167" location="Taxon" longLatPrecision="1" longitude="111.732216" municipality="Location" pageId="0" pageNumber="96003" specimenCount="1" specimenCount-female="1" typeStatus="Holotype">
<emphasis bold="true" pageId="0" pageNumber="96003">Type status:</emphasis>
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="Collected by hand in leaf litter" collectorName="Occurrence, Z. Bai" country="Malaysia" county="Engkilili" elevation="0" latitude="1.1061167" location="Taxon" longLatPrecision="1" longitude="111.732216" municipality="Location" specimenCount="1" specimenCount-female="1" typeStatus="Holotype">
<typeStatus pageId="0" pageNumber="96003">Holotype</typeStatus>
.
<emphasis bold="true" pageId="0" pageNumber="96003">
<collectorName>Occurrence</collectorName>
:
</emphasis>
recordedBy:
<collectorName pageId="0" pageNumber="96003">Z. Bai</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="96003" type="generic">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="96003">female</specimenType>
; lifeStage:
<specimenType pageId="0" pageNumber="96003">adult</specimenType>
;
<emphasis bold="true" pageId="0" pageNumber="96003">
<location LSID="urn:lsid:plazi:treatment:AF071857D7A550D3A3CAF8671A065CE1:CF65FB106D9700E3B48749C8192F81B8" country="Malaysia" county="Engkilili" latitude="1.1061167" longLatPrecision="1" longitude="111.732216" municipality="Location" name="Taxon">Taxon</location>
:
</emphasis>
order:
<location LSID="urn:lsid:plazi:treatment:AF071857D7A550D3A3CAF8671A065CE1:2A2F11646FC2A858824ADD3D9611F841" country="Malaysia" county="Engkilili" latitude="1.1061167" longLatPrecision="1" longitude="111.732216" municipality="Location" name="Araneae">Araneae</location>
; family:
<location LSID="urn:lsid:plazi:treatment:AF071857D7A550D3A3CAF8671A065CE1:7946C10F50C24BE190A1770A132E98F1" country="Malaysia" county="Engkilili" latitude="1.1061167" longLatPrecision="1" longitude="111.732216" municipality="Location" name="Ctenidae">Ctenidae</location>
; genus:
<location LSID="urn:lsid:plazi:treatment:AF071857D7A550D3A3CAF8671A065CE1:94D1D41F35DA14A8EEA4B24E0A1E4E24" country="Malaysia" county="Engkilili" latitude="1.1061167" longLatPrecision="1" longitude="111.732216" municipality="Location" name="Bowie">Bowie</location>
;
<emphasis bold="true" pageId="0" pageNumber="96003">
<collectingMunicipality>Location</collectingMunicipality>
:
</emphasis>
country:
<collectingCountry name="Malaysia" pageId="0" pageNumber="96003">Malaysia</collectingCountry>
; locality:
<location LSID="urn:lsid:plazi:treatment:AF071857D7A550D3A3CAF8671A065CE1:CEE9CBE44C884654E3AE6F0B90308940" country="Malaysia" county="Engkilili" latitude="1.1061167" longLatPrecision="1" longitude="111.732216" municipality="Location" name="Engkilili" pageId="0" pageNumber="96003">
<collectingCounty>Engkilili</collectingCounty>
</location>
; verbatimElevation:
<elevation metricMagnitude="0" metricUnit="m" metricValue="5.0" pageId="0" pageNumber="96003" unit="m" value="5.0">
<quantity metricMagnitude="0" metricUnit="m" metricValue="5.0" unit="m" value="5.0">5 m</quantity>
a.s.l.
</elevation>
; verbatimLatitude:
<geoCoordinate degrees="1" direction="north" minutes="6.367" orientation="latitude" precision="1" value="1.1061167">1°6.367'N</geoCoordinate>
; verbatimLongitude:
<geoCoordinate degrees="111" direction="east" minutes="43.933" orientation="longitude" precision="1" value="111.732216">111°43.933'E</geoCoordinate>
;
<emphasis bold="true" pageId="0" pageNumber="96003">Event:</emphasis>
samplingProtocol:
<collectingMethod pageId="0" pageNumber="96003">Collected by hand in leaf litter</collectingMethod>
; year: 2018; month: 9; day: 10;
<emphasis bold="true" pageId="0" pageNumber="96003">Record Level:</emphasis>
institutionCode: IZCAS-Ar 43731
</materialsCitation>
</materialsCitation>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="description">
<paragraph pageId="0" pageNumber="96003">Description</paragraph>
<paragraph pageId="0" pageNumber="96003">
<emphasis bold="true" pageId="0" pageNumber="96003">Male</emphasis>
</paragraph>
<paragraph pageId="0" pageNumber="96003">Unknown.</paragraph>
<paragraph pageId="0" pageNumber="96003">
<emphasis bold="true" pageId="0" pageNumber="96003">Female</emphasis>
(IZCAS-Ar 43731): PL 4.5, PW 3.6, AW 2.3, OL 3.9, OW 2.3. Eye diameters and interdistances: AME 0.21, ALE 0.11, PME 0.26, PLE 0.23, AME-AME 0.15, AME-ALE 0.31, PME-PME 0.27, PME-PLE 0.35, AME-PME 0.13, ALE-PLE 0.17, clypeus AME 0.14, clypeus ALE 0.41. Palp and leg measurements: palp 4.7 (1.6, 0.9, 1.1, -, 1.1), I missing, II 10.8 (3.0, 1.7, 2.7, 2.5, 0.9), III 10.2 (2.7, 1.7, 2.2, 2.5, 1.1), IV 14.4 (3.7, 1.6, 3.4, 4.2, 1.5). Leg formula 4123. Spination of palp and legs: palp 131, 001, 112, 2012; femora II p110, d111, r112, III p012, d111, r112, IV p002, d111, r112; patellae II 000, III-IV 101; tibiae II v22222, III-IV p11, d111, r11, v222; metatarsi II v222, III p112, d010, r112, v222, IV p112, d010, r112, v2222. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 5 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 5 bristles. Sparse scopula restricted almost entirely to tarsi. Palpal claw with 7 secondary teeth, leg claws II-IV with 3 secondary teeth. Position of tarsal organ: II 0.75, IV 0.85.
</paragraph>
<paragraph pageId="0" pageNumber="96003">
Copulatory organ (Fig.
<figureCitation captionStart="Figure 24" captionStartId="F8184641" captionText="Figure 24. Bowie engkilili sp. n., holotype female. a: Epigyne, ventral view; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. AB = anterior bulge of median plate, FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure24" httpUri="https://binary.pensoft.net/fig/768939" pageId="0" pageNumber="96003">24</figureCitation>
a, b and Fig.
<figureCitation captionStart="Figure 25" captionStartId="F8239471" captionText="Figure 25. Bowie engkilili sp. n., epigyne, posterior view. AB = anterior bulge of median plate, LT = lateral teeth. Scale bar: 0.1 mm." figureDoi="10.3897/BDJ.10.e96003.figure25" httpUri="https://binary.pensoft.net/fig/768868" pageId="0" pageNumber="96003">25</figureCitation>
). Epigynal field slightly longer than wide, with narrow separated anterior bands laterally. Median plate with a median bulge in anterior half, laterally with two separate sclerotised patches, constricted at lateral teeth, the latter moderately pointed. Spermathecae small, separated by more than twice their diameter, roundish, smaller chamber bend at right angle, laterad.
</paragraph>
<paragraph pageId="0" pageNumber="96003">
Colour (Fig.
<figureCitation captionStart="Figure 24" captionStartId="F8184641" captionText="Figure 24. Bowie engkilili sp. n., holotype female. a: Epigyne, ventral view; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. AB = anterior bulge of median plate, FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure24" httpUri="https://binary.pensoft.net/fig/768939" pageId="0" pageNumber="96003">24</figureCitation>
c and d). Reddish-brown to yellowish with dark patterns. Dorsal prosoma with characteristic lighter median band, widened behind eyes, distinctly marked fovea and indistinct radial markings. Sternum and ventral coxae yellowish, labium and gnathocoxae reddish-brown. Chelicerae black. Leg reddish-brown. Dorsal and lateral opisthosoma black. Ventral opisthosoma black with light patterns. Spinnerets and anal tubercle black.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="diagnosis">
<paragraph pageId="0" pageNumber="96003">Diagnosis</paragraph>
<paragraph pageId="0" pageNumber="96003">
Small
<taxonomicName class="Arachnida" family="Ctenidae" kingdom="Animalia" lsidName="" order="Araneae" pageId="0" pageNumber="96003" phylum="Arthropoda" rank="family">Ctenidae</taxonomicName>
(total length female 8.4). The new species resembles
<taxonomicName lsidName="B. withinyou" pageId="0" pageNumber="96003" rank="species" species="withinyou">
<emphasis italics="true" pageId="0" pageNumber="96003">B. withinyou</emphasis>
</taxonomicName>
<normalizedToken originalValue="Jäger">Jaeger</normalizedToken>
, 2022 (see
<bibRefCitation author="Jaeger, P" journalOrPublisher="Zootaxa" pageId="0" pageNumber="96003" pagination="1 - 200" refId="B8184614" refString="Jaeger, P, 2022. Bowie gen. nov., a diverse lineage of ground-dwelling spiders occurring from the Himalayas to Papua New Guinea and northern Australia (Araneae: Ctenidae: Cteninae). Zootaxa 5170 (1): 1 - 200" title="Bowie gen. nov., a diverse lineage of ground-dwelling spiders occurring from the Himalayas to Papua New Guinea and northern Australia (Araneae: Ctenidae: Cteninae)." volume="5170 (1)" year="2022">
<normalizedToken originalValue="Jäger">Jaeger</normalizedToken>
2022
</bibRefCitation>
: figs 629-630 and 634-636) by having similar fertilisation ducts (Fig.
<figureCitation captionStart="Figure 24" captionStartId="F8184641" captionText="Figure 24. Bowie engkilili sp. n., holotype female. a: Epigyne, ventral view; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. AB = anterior bulge of median plate, FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure24" httpUri="https://binary.pensoft.net/fig/768939" pageId="0" pageNumber="96003">24</figureCitation>
b), but can be distinguished by the lateral teeth pointing medially (Fig.
<figureCitation captionStart="Figure 24" captionStartId="F8184641" captionText="Figure 24. Bowie engkilili sp. n., holotype female. a: Epigyne, ventral view; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. AB = anterior bulge of median plate, FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure24" httpUri="https://binary.pensoft.net/fig/768939" pageId="0" pageNumber="96003">24</figureCitation>
a; lateral teeth pointing postero-medially in
<taxonomicName lsidName="B. withinyou" pageId="0" pageNumber="96003" rank="species" species="withinyou">
<emphasis italics="true" pageId="0" pageNumber="96003">B. withinyou</emphasis>
</taxonomicName>
), by the median plate with two separate sclerotised patches laterally and a longer median bulge in anterior half (Fig.
<figureCitation captionStart="Figure 24" captionStartId="F8184641" captionText="Figure 24. Bowie engkilili sp. n., holotype female. a: Epigyne, ventral view; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. AB = anterior bulge of median plate, FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure24" httpUri="https://binary.pensoft.net/fig/768939" pageId="0" pageNumber="96003">24</figureCitation>
a and Fig.
<figureCitation captionStart="Figure 25" captionStartId="F8239471" captionText="Figure 25. Bowie engkilili sp. n., epigyne, posterior view. AB = anterior bulge of median plate, LT = lateral teeth. Scale bar: 0.1 mm." figureDoi="10.3897/BDJ.10.e96003.figure25" httpUri="https://binary.pensoft.net/fig/768868" pageId="0" pageNumber="96003">25</figureCitation>
; median plate with shorter median bulge in anterior half in
<taxonomicName lsidName="B. withinyou" pageId="0" pageNumber="96003" rank="species" species="withinyou">
<emphasis italics="true" pageId="0" pageNumber="96003">B. withinyou</emphasis>
</taxonomicName>
) and by the spermathecae separated by more than twice their diameter (Fig.
<figureCitation captionStart="Figure 24" captionStartId="F8184641" captionText="Figure 24. Bowie engkilili sp. n., holotype female. a: Epigyne, ventral view; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. AB = anterior bulge of median plate, FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure24" httpUri="https://binary.pensoft.net/fig/768939" pageId="0" pageNumber="96003">24</figureCitation>
b; spermathecae separated by 1.5 times their diameter in
<taxonomicName lsidName="B. withinyou" pageId="0" pageNumber="96003" rank="species" species="withinyou">
<emphasis italics="true" pageId="0" pageNumber="96003">B. withinyou</emphasis>
</taxonomicName>
).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="etymology">
<paragraph pageId="0" pageNumber="96003">Etymology</paragraph>
<paragraph pageId="0" pageNumber="96003">The specific name refers to the type locality and is a noun in apposition.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="distribution">
<paragraph pageId="0" pageNumber="96003">Distribution</paragraph>
<paragraph pageId="0" pageNumber="96003">
Malaysia (Engkilili, type locality; Fig.
<figureCitation captionStart="Figure 1" captionStartId="F8184120" captionText="Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n." figureDoi="10.3897/BDJ.10.e96003.figure1" httpUri="https://binary.pensoft.net/fig/770652" pageId="0" pageNumber="96003">1</figureCitation>
).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="dna barcode">
<paragraph pageId="0" pageNumber="96003">DNA Barcode</paragraph>
<paragraph pageId="0" pageNumber="96003">Female (IZCAS-Ar 43731):</paragraph>
<paragraph pageId="0" pageNumber="96003">TATTTGGGGCTTGAGCTTCTATAGCTGGTACATCTATAAGTGTTTTGATTCGTATGGAGTTGGGACATTCGGGGAGAATATTGGGAGATGATCATCTCTATAATGTTATTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTTTAATTGGAGGTTTTGGTAATTGGTTGGTTCCTTTAATGTTAGGGGCTCCTGATATGTCGTTTCCTCGAATAAATAATTTGTCTTTTTGGTTACTTCCTCCTTCTTTATTTTTATTGTTTATGTCTTCTATAACTGAAATAGGGGTAGGAGCTGGTTGAACGGTGTATCCTCCTTTGGCTTCAAGAATGGGTCATGCTGGTAGATCTATGGATTTTGCTATTTTTTCTCTTCATTTAGCTGGGGCGTCTTCTATTATAGGTGCTATTAATTTTATTTCTACTATTATTAATATGCGTTTATTAGGAATGAGAATAGAGAAAGTTCCTTTGTTTGTATGGTCTGTTTTTATTACTGCGGTATTGTTATTATTGTCTCTTCCTGTTTTGGCAGGAGCTATTACTATATTGTTAACTGATCGTAATTTTAATACTTCTTTTTTTGATCCGGCTGGAGGGGGAGATCCGATTTTATTTCAACATTTATTTTGATTTTTT (GenBank accession number OP572106).</paragraph>
</subSubSection>
</treatment>
</document>