540 lines
72 KiB
XML
540 lines
72 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.379.6394" ID-GBIF-Dataset="84d836c8-606e-447e-9b09-f8b07f1c6afe" ID-PMC="PMC3935228" ID-Pensoft-Pub="1313-2970-379-43" ID-PubMed="24574857" ID-ZBK="66F2B394407948E09A6B90CAD8BF96F2" ModsDocAuthor="" ModsDocDate="2014" ModsDocID="1313-2970-379-43" ModsDocOrigin="ZooKeys 379" ModsDocTitle="A new Hermeuptychia (Lepidoptera, Nymphalidae, Satyrinae) is sympatric and synchronic with H. sosybius in southeast US coastal plains, while another new Hermeuptychia species – not hermes – inhabits south Texas and northeast Mexico" checkinTime="1451246326545" checkinUser="pensoft" docAuthor="Cong, Qian & Grishin, Nick V." docDate="2014" docId="F821986750A2DEACF9C34D944347F1A1" docLanguage="en" docName="ZooKeys 379: 43-91" docOrigin="ZooKeys 379" docSource="http://dx.doi.org/10.3897/zookeys.379.6394" docTitle="Hermeuptychia hermybius Grishin, sp. n." docType="treatment" docUuid="B719B2F8-D0AD-4995-8372-6AA2FC2116E3" docUuidSource="ZooBank" docVersion="4" lastPageNumber="66" masterDocId="FF900519404AFF99FF98FFAED92DFFFA" masterDocTitle="A new Hermeuptychia (Lepidoptera, Nymphalidae, Satyrinae) is sympatric and synchronic with H. sosybius in southeast US coastal plains, while another new Hermeuptychia species - not hermes - inhabits south Texas and northeast Mexico" masterLastPageNumber="91" masterPageNumber="43" pageNumber="60" updateTime="1668157700359" updateUser="ExternalLinkService">
|
||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||
<mods:titleInfo>
|
||
<mods:title>A new Hermeuptychia (Lepidoptera, Nymphalidae, Satyrinae) is sympatric and synchronic with H. sosybius in southeast US coastal plains, while another new Hermeuptychia species - not hermes - inhabits south Texas and northeast Mexico</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Cong, Qian</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Grishin, Nick V.</mods:namePart>
|
||
</mods:name>
|
||
<mods:typeOfResource>text</mods:typeOfResource>
|
||
<mods:relatedItem type="host">
|
||
<mods:titleInfo>
|
||
<mods:title>ZooKeys</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:part>
|
||
<mods:date>2014</mods:date>
|
||
<mods:detail type="volume">
|
||
<mods:number>379</mods:number>
|
||
</mods:detail>
|
||
<mods:extent unit="page">
|
||
<mods:start>43</mods:start>
|
||
<mods:end>91</mods:end>
|
||
</mods:extent>
|
||
</mods:part>
|
||
</mods:relatedItem>
|
||
<mods:location>
|
||
<mods:url>http://dx.doi.org/10.3897/zookeys.379.6394</mods:url>
|
||
</mods:location>
|
||
<mods:classification>journal article</mods:classification>
|
||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.379.6394</mods:identifier>
|
||
<mods:identifier type="Pensoft-Pub">1313-2970-379-43</mods:identifier>
|
||
<mods:identifier type="ZBK">66F2B394407948E09A6B90CAD8BF96F2</mods:identifier>
|
||
<mods:identifier type="ZooBank">66F2B394407948E09A6B90CAD8BF96F2</mods:identifier>
|
||
</mods:mods>
|
||
<treatment ID-GBIF-Taxon="152050955" LSID="urn:lsid:zoobank.org:act:B719B2F8-D0AD-4995-8372-6AA2FC2116E3" httpUri="http://treatment.plazi.org/id/F821986750A2DEACF9C34D944347F1A1" lastPageId="23" lastPageNumber="66" pageId="17" pageNumber="60">
|
||
<subSubSection pageId="17" pageNumber="60" type="nomenclature">
|
||
<paragraph pageId="17" pageNumber="60">
|
||
<taxonomicName LSID="http://zoobank.org/B719B2F8-D0AD-4995-8372-6AA2FC2116E3" authority="Grishin" class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="17" pageNumber="60" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius Grishin</taxonomicName>
|
||
<taxonomicNameLabel pageId="17" pageNumber="60">sp. n.</taxonomicNameLabel>
|
||
Figs 48-59, 60b, e, h, k, 61b, 62
|
||
<normalizedToken originalValue="a–m">a-m</normalizedToken>
|
||
, 63 part, 64
|
||
<normalizedToken originalValue="q–z">q-z</normalizedToken>
|
||
, 66 part, 67 part, 70
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="18" lastPageNumber="61" pageId="17" pageNumber="60" type="description">
|
||
<paragraph pageId="17" pageNumber="60">Description.</paragraph>
|
||
<paragraph lastPageId="18" lastPageNumber="61" pageId="17" pageNumber="60">
|
||
Male (n = 56, Figs 48-49, 52-56, 58-59) - holotype forewing length = 16 mm. Forewing triangular, rounded at apex and tornus, costal and outer margins convex, inner margin almost straight, mildly concave mediad, two discal cell veins budged at bases, vein 2A thickened basad. Hindwing rounded, almost circular. Wings dorsally
|
||
<pageBreakToken pageId="18" pageNumber="61" start="start">dark-brown</pageBreakToken>
|
||
with sparse olive-beige overscaling and two darker-brown terminal lines. Wings ventrally pale-brown, paler towards inner margin of forewing, with extensive beige overscaling, particularly along veins in distal part in some specimens; submedial and postmedial darker- to rusty- and olive-brown lines and end-of-cell streak (smaller on hindwing) between them; hindwing postmedial line more undulate that in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
, with a stronger bend in M1-M2 cell; two terminal dark-brown evenly curved marginal lines, dark-brown sinuous submarginal line, more undulate than in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
, barely touching the eyespot in cell Cu1-Cu2, and row of submarginal eyespots basad of the sinuous line and posteriad of postmedial line, eyespots frequently reduced in size and are more uniformly sized than in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
; usually largest eyespots black-centered and pupiled with pale-blue scales: on forewing, eyespots about the same size, frequently larger posteriad, but eyespot in cell M1-M2 (usually not the largest in size) and eyespot in cell R5-M1 (in some specimens) black-centered (more eyespots black centered in some specimens); on hindwing, largest eyespots in cells M1-M2 and Cu1-Cu2, a smaller one in cell Cu2-1A+2A, even smaller, but still black-centered and pale-blue pupilled in cell Rs-M1, and two smallest, usually without black, but in some specimens pale-blue pupilled eyespots in cells M2-M3 and M3-Cu1. Fringes monochrome, a little paler than the ground color of wings. Head, palpi, thorax and abdomen dark-brown above, paler and mostly beige beneath. Antennae dark-brown above with pale scales at segments, orange-brown at the club, beneath beige basad, orange-brown in distal half. Legs brown with beige scales. Male genitalia (n = 19, Figs 60b, e, h, k, 61b, 62
|
||
<normalizedToken originalValue="a–m">a-m</normalizedToken>
|
||
, 63 part) - typical for the genus, very similar to those of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
. Tegumen dome-like, rounded at margins. Uncus leaf-shaped in dorsal view, almost flat distally but convex basally in lateral view, with a well-developed thin, membranous carina in basal half; apex of uncus appears truncated in dorsal view and sides usually less concave than in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
. Gnathos arms thin, wide apart, divergent, about the same length as uncus. Valvae narrow, but typically broader than in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
, elongated with thin cuculli extending past gnathos usually farther than a quarter of their length; cucullus usually with four apical teeth; cucullus ventrally with inner medial bulge. Saccus about the same length as cucullus, narrow. Aedeagus elongated, bent around its middle, with a medium length phallobase. Female (n = 45, Figs 50-51, 57) - similar to male in facies, with slightly more rounded wings and dorsally paler in color. Female genitalia (n = 9, Fig. 64
|
||
<normalizedToken originalValue="q–z">q-z</normalizedToken>
|
||
) as in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
, with pale, yellowish, weakly sclerotized and broad, rounder anteriad, cup-like antrum slightly asymmetric to the left. Ostium bursae ellipsoidal, its ventral margin shorter or equal to dorsal margin. Ductus and corpus bursae each in length similar to antrum; corpus bursae with two signa, spines in a signum narrow, leaf-shaped, placed in three to five irregular rows.
|
||
</paragraph>
|
||
<caption pageId="18" pageNumber="61">
|
||
<paragraph pageId="18" pageNumber="61">
|
||
Figures 48-59.
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
. 48-49 holotype, others are paratypes, data in text and Table 1. Sexes and DNA or genitalia voucher codes, or data: 50-51 ♀ USA: Texas: Cameron Co., Brownsville, ex ovum, eclosed 2-Apr-2003, leg. N. V. Grishin 52 ♂ NVG-1635 53 ♂ 13385H10 54-55 ♂ NVG-1607 56 ♂ NVG-1699 57 ♀ NVG-1737 58 ♂ NVG130104-23 59 ♂ NVG130104-24. Dorsal wing surfaces are in 48, 50, 54 others are ventral. Labels are shown for the holotype and are reduced 2.5-fold compared to specimens as indicated by a smaller scale bar.
|
||
<normalizedToken originalValue="“F”">"F"</normalizedToken>
|
||
specifies mirror image (left-right inverted).
|
||
</paragraph>
|
||
</caption>
|
||
<caption pageId="18" pageNumber="61">
|
||
<paragraph pageId="18" pageNumber="61">
|
||
Figure 60. Male genitalia of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="genus">Hermeuptychia</taxonomicName>
|
||
from USA: Texas. a, d, g, j
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
, Fort Bend Co., Brazos Bend State Park, Horseshoe Lake trail, 29°22'54.96", −95°36'41.06", 15 m, 17-Aug-2013, leg. N. V. Grishin, DNA voucher NVG-1542, genitalia NVG130927-03 (forewing length 15 mm) b, e, h, k
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
sp. n. paratype, Cameron Co., E of Brownsville, 18-Jan-2003, leg. N. V. Grishin, DNA voucher NVG-1607, genitalia NVG130927-18 (specimen Figs 54-55, forewing length 15.5 mm) c, f, i, l
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
sp. n. holotype, Fort Bend Co., Brazos Bend State Park, near Hale Lake, 29°22'48.27", −95°35'05.02", 16 m, 17-Aug-2013, leg. N. V. Grishin, DNA voucher NVG-1560, genitalia NVG130927-14 [USNM] (specimen Figs 22-23, forewing length 16.5 mm). Views:
|
||
<normalizedToken originalValue="a–b">a-b</normalizedToken>
|
||
dorsal, perpendicular to the tegumen-uncus-gnathos plane
|
||
<normalizedToken originalValue="c–d">c-d</normalizedToken>
|
||
ventral, perpendicular to the plane of saccus and valvae (appears larger than dorsal view due to different projection axis)
|
||
<normalizedToken originalValue="e–f">e-f</normalizedToken>
|
||
right dorsolateral
|
||
<normalizedToken originalValue="g–h">g-h</normalizedToken>
|
||
right lateral. All images are to scale. Diagnostic characters are indicated on images. Note that
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
with larger than
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
wings has smaller genitalia.
|
||
</paragraph>
|
||
</caption>
|
||
<caption pageId="18" pageNumber="61">
|
||
<paragraph pageId="18" pageNumber="61">
|
||
Figure 61. Dorsoposterior view of male abdomens of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="genus">Hermeuptychia</taxonomicName>
|
||
from USA: Texas. a
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
, DNA voucher NVG-1548 (mirror image, i.e. left-right inverted) b
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
, DNA voucher NVG-1635 (also shown in Fig. 62j, specimen Fig. 52) c
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
, DNA voucher NVG-1553. Data in Table 1. Scales are brushed off the abdomen tip to expose distal parts of genitalia. The easiest to observe character (the shape of the distal end of uncus) is indicated.
|
||
</paragraph>
|
||
</caption>
|
||
<caption pageId="18" pageNumber="61">
|
||
<paragraph pageId="18" pageNumber="61">
|
||
Figure 62. Variation in male genitalia of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
and
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
.
|
||
<normalizedToken originalValue="a–m">a-m</normalizedToken>
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
paratypes, DNA (or genitalia, where DNA sequence is not available, and full data for these given) voucher codes: a. NVG-1609 b NVG-1610 c Texas: Cameron Co., Brownsville {10-13}-Mar-1979, T. Friedlander, NVG140104-01 d NVG-1698 e NVG-1699 (specimen Fig. 56) f NVG-1714 g NVG-1726 h NVG-1727 i NVG-1747 j NVG-1635 (also shown in Fig. 61b, specimen Fig. 52) k 13385H10 (specimen Fig. 53)
|
||
<normalizedToken originalValue="l–m">l-m</normalizedToken>
|
||
Mexico: Tamaulipas, leg. R. O. & C. A. Kendall: l Quintero cave, 7-Jan-1974, NVG130104-24 (specimen Fig. 59) m Ciudad Mante, Los Arcos Ct., 19-Dec-1973, NVG130104-23 (specimen Fig. 58) n
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
paratype, NVG-1631 (specimen Figs 28-29), diagnostic characters are indicated on the image
|
||
<normalizedToken originalValue="o–z">o-z</normalizedToken>
|
||
2
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
: o 13386A01 (specimen Fig. 47) p 13386A07, neotype (specimen Figs 9-11) q 13385H04 r 13385H08 (specimen Fig. 46) s 13385H03 t NVG-1550 u NVG-1546 v NVG-1559 w NVG-1566 x NVG-1630 y NVG-1633 z Texas: Marion Co., W of Caddo Lake, 5-Apr-1997, leg. N. V. Grishin, NVG-1634 z1 NVG-1632 z2 Texas: Wise Co., LBJ National Grassland, ex ovum, eclosed 3-Aug-1998, leg. N. V. Grishin, NVG-1604. c, l, m are in TAMU and
|
||
<normalizedToken originalValue="o–s">o-s</normalizedToken>
|
||
are in USNM collections. Data for most specimens are in Table 1, text, or specified above. Complete genitalia are shown in lateral view, and dorsal view of uncus is shown above and to the right of each specimen. Aedeagus is shown below in k DNA (or genitalia, where DNA sequence is not available) voucher codes and general localities are indicated below each genitalia image.
|
||
<normalizedToken originalValue="“F”">"F"</normalizedToken>
|
||
specifies mirror image (left-right inverted).
|
||
</paragraph>
|
||
</caption>
|
||
<caption pageId="18" pageNumber="61">
|
||
<paragraph pageId="18" pageNumber="61">
|
||
Figure 63. Morphometric differences between male genitalia of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
(black) and
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
(blue). Measurements used are marked on dorsal view of uncus (top left) and on lateral view of complete genitalia (bottom left): a width of uncus at the apex b width of uncus at the narrowest point near the base (
|
||
<normalizedToken originalValue="“neck”">"neck"</normalizedToken>
|
||
at the joint with tegumen) c distance from the uncus apex to the cross-section at the widest point d distance from the uncus apex to the cross-section at the narrowest point near the base l length of valval dorsal
|
||
<normalizedToken originalValue="“window”">"window"</normalizedToken>
|
||
h height of valva (in lateral view) at the end of the dorsal
|
||
<normalizedToken originalValue="“window”">"window"</normalizedToken>
|
||
, direction of height measurement is perpendicular to the direction of length measurement. Measurements of genitalia shown in Fig. 62 are plotted on the right. Horizontal axis combines all uncus measurements into a formula a/b+0.5*c/d and vertical axis shows measurements of valva as h/l. Each point corresponds to a specimen and a letter next to it is the same one that denote its genitalia in Fig. 62.
|
||
</paragraph>
|
||
</caption>
|
||
<caption pageId="18" pageNumber="61">
|
||
<paragraph pageId="18" pageNumber="61">
|
||
Figure 64. Antrum in female genitalia of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="genus">Hermeuptychia</taxonomicName>
|
||
from USA: Texas.
|
||
<normalizedToken originalValue="a–h">a-h</normalizedToken>
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
, Fort Bend Co., Brazos Bend State Park, 17-Aug-2013, leg. N. V. Grishin:
|
||
<normalizedToken originalValue="a–f">a-f</normalizedToken>
|
||
is from Horseshoe Lake trail, 29°22'54.96", −95°36'41.06", 15 m and
|
||
<normalizedToken originalValue="g–h">g-h</normalizedToken>
|
||
is from near Hale Lake, 29°22'48.27" −95°35'05.02", 16 m; DNA voucher|genitalia dissection codes are:
|
||
<normalizedToken originalValue="a–b">a-b</normalizedToken>
|
||
NVG-1537|NVG130927-01
|
||
<normalizedToken originalValue="c–d">c-d</normalizedToken>
|
||
NVG-1540|NVG130927-02 (specimen Fig. 12)
|
||
<normalizedToken originalValue="e–f">e-f</normalizedToken>
|
||
NVG-1552|NVG130927-06
|
||
<normalizedToken originalValue="g–h">g-h</normalizedToken>
|
||
NVG-1562|NVG130927-10
|
||
<normalizedToken originalValue="i–p">i-p</normalizedToken>
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
sp. n. paratypes, Fort Bend Co., Brazos Bend State Park, near Hale Lake, 29°22'48.27", −95°35'05.02", 16 m, 17-Aug-2013, leg. N. V. Grishin; DNA voucher|genitalia dissection codes:
|
||
<normalizedToken originalValue="i–j">i-j</normalizedToken>
|
||
NVG-1554|NVG130927-07 (specimen Fig. 24)
|
||
<normalizedToken originalValue="k–l">k-l</normalizedToken>
|
||
NVG-1558|NVG130927-08
|
||
<normalizedToken originalValue="m–n">m-n</normalizedToken>
|
||
NVG-1563|NVG130927-11
|
||
<normalizedToken originalValue="o–p">o-p</normalizedToken>
|
||
NVG-1565|NVG130927-12 (specimen Fig. 25)
|
||
<normalizedToken originalValue="q–z">q-z</normalizedToken>
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
sp. n. paratypes
|
||
<normalizedToken originalValue="q–r">q-r</normalizedToken>
|
||
Cameron Co., E of Brownsville, ex ovum ex ♀ captured on 18-Jan-2003, eclosed on 17-Mar-2003, leg. N. V. Grishin, NVG-1603|NVG130927-17
|
||
<normalizedToken originalValue="s–t">s-t</normalizedToken>
|
||
ibid., eclosed on 14-Mar-2003, NVG-1611|NVG131017-03
|
||
<normalizedToken originalValue="u–v">u-v</normalizedToken>
|
||
ibid., eclosed on 16-Mar-2003, NVG-1612|NVG131017-04
|
||
<normalizedToken originalValue="w–x">w-x</normalizedToken>
|
||
TX: Hidalgo Co., 1.5 air mi SE of Relampago, Rio Rico Rd., 26.07, -97.891, 21 m, 19-Oct-2013, leg. W. R. Dempwolf, NVG-1695|NVG131229-03
|
||
<normalizedToken originalValue="y–z">y-z</normalizedToken>
|
||
Starr Co., 0.5 mi S of Fronton, 26.399, -99.085, 50 m 10-Oct-2013, leg. W. R. Dempwolf, NVG-1737|NVG131229-11 (specimen Fig. 57). Additional data for specimens and their DNA barcodes are in Table 1. In all images, posterior end is pointing up (i.e. ostium bursae is closer to the top of each image); a, c, e, g, i, k, m, o, q, s, u, w, y are in lateral view, others are in right ventrolateral view. All images are to scale. Diagnostic characters to tell between
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
and
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
are indicated on images, each character was invariantly observed in all inspected samples of a species, but is indicated (for clarity) on a single image only. We failed to find characters distinguishing female genitalia of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
from
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
and simply illustrate genitalic variation.
|
||
</paragraph>
|
||
</caption>
|
||
<caption pageId="18" pageNumber="61">
|
||
<paragraph pageId="18" pageNumber="61">
|
||
Figure 65. DNA ID tags of specimens that are over 100 years old. ID tag #2 is shown as an example. The tag region sequence alignment of the three species:
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
,
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
, and
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
is shown in the middle and positions at which sequences differ are highlighted in cyan and boxed. Each of the three species differs from the other two by at least 2 nucleotides, and
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
is different from
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
by 4 nucleotides. Forward and reverse primer regions are shaded. DNA of the tag was amplified and sequenced in both forward and reverse directions from two over-100-years-old specimens from the same locality (SC: Clarendon Co.). Forward and reverse sequences traces for the first specimen are shown above the reference sequences and the two traces for the second specimen are shown below. It is clear from the traces that the specimen above (13385G10, Fig. 36) is
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
, (A, T, T, & C at these 4 positions, no contamination seen) and the one below (13385G08, Fig. 33) is
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="18" pageNumber="61" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
(G, C, C, & T at these 4 positions and equally unambiguous traces). Nucleotides that identify each specimen are indicated in large letters on yellow background and arrows point to the trace peaks revealing these nucleotides. This strategy was applied to identify 12 very old specimens of three species in a random order and yielded unambiguous identifications for 11 of them. One sample appeared to be contaminated, and the traces showed the presence of several nucleotides in many positions. All 11 DNA-based identifications agreed with genitalic identifications.
|
||
</paragraph>
|
||
</caption>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="19" lastPageNumber="62" pageId="18" pageNumber="61" type="barcode sequences">
|
||
<paragraph pageId="18" pageNumber="61">Barcode sequences.</paragraph>
|
||
<paragraph pageId="18" pageNumber="61">Full length DNA barcodes were obtained for 19 paratypes (GenBank accessions: KJ025569-KJ025587). The most common haplotype present in 17 sequences (including all 5 barcoded siblings of the holotype) is exemplified by the voucher NVG-1603, Genbank accession KJ025569, 658 base pairs:</paragraph>
|
||
<paragraph lastPageId="19" lastPageNumber="62" pageId="18" pageNumber="61">
|
||
AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACATCATTAAGTTTAATTATTCGAATAGAGTTAGGTAATCCAGGATTTT
|
||
<pageBreakToken pageId="19" pageNumber="62" start="start">TAATTGGAGATGACCAAATTTATAACACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGACTTATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGTATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAATTTTATTAATTTCTAGTAGTATTGTAGAAAATGGAAGTGGAACAGGATGAACTGTTTACCCCCCTCTTTCATCTAATATTGCCCATAGAGGTTCTTCAGTAGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCCATTAATTTTATTACAACAATTATTAATATACGAATTAATAATATATCTTATGATCAAATACCTTTATTTATTTGAGCTGTAGGAATTACAGCTCTTCTTTTACTTCTCTCATTACCTGTTTTAGCAGGAGCTATTACCATACTTCTTACTGATCGAAATTTAAATACATCATTTTTTGACCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT</pageBreakToken>
|
||
</paragraph>
|
||
<paragraph pageId="19" pageNumber="62">The 2 remaining sequences were identical to each other (Fig. 66b) and differed from the sequence shown above by a single base pair (0.15%). Barcode from the oldest and westernmost specimen (TX: Laredo, 15-Apr-1949) was additionally verified with both DNA ID tags as described in Materials and methods section and confirmed to be this species.</paragraph>
|
||
<caption pageId="19" pageNumber="62">
|
||
<paragraph pageId="19" pageNumber="62">
|
||
Figure 66. DNA-derived data. a Analysis of named
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia" order="Lepidoptera" pageId="19" pageNumber="62" phylum="Arthropoda" rank="genus">Hermeuptychia</taxonomicName>
|
||
species b relationships between
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia" order="Lepidoptera" pageId="19" pageNumber="62" phylum="Arthropoda" rank="genus">Hermeuptychia</taxonomicName>
|
||
specimens from USA in a form of BioNJ (
|
||
<bibRefCitation author="Dereeper, A" journalOrPublisher="Nucleic Acids Research" pageId="29" pageNumber="72" pagination="W 465 - W 469" title="Phylogeny. fr: robust phylogenetic analysis for the non-specialist." volume="36" year="2008">Dereeper et al. 2008</bibRefCitation>
|
||
) distance tree. a DNA barcode distance matrix is shown on the right and a BioNJ distance tree corresponding to it is on the left. The tree is rooted with
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Megisto" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Megisto cymela" order="Lepidoptera" pageId="19" pageNumber="62" phylum="Arthropoda" rank="species" species="cymela">Megisto cymela</taxonomicName>
|
||
(Cramer, 1777) sequence. A more comprehensive tree that includes several specimens of each species (except those described herein) and their detailed analyses are given in
|
||
<bibRefCitation author="Seraphim, N" journalOrPublisher="Molecular Ecology Resources" pageId="31" pageNumber="74" pagination="39 - 49" title="Morphological and molecular marker contributions to disentangling the cryptic Hermeuptychia hermes species complex (Nymphalidae: Satyrinae: Euptychiina)." url="10.1111/1755-0998.12161" volume="14" year="2014">Seraphim et al. (2014)</bibRefCitation>
|
||
and is not repeated here. Only a single representative sequence for each species is used in a for clarity. The scale bar corresponding to about 1% difference in sequences is placed below the tree. Bootstrap support values are shown by each node in the tree; values below 0.5 indicate possibly incorrect groupings. GenBank accessions (http://genbank.gov/) for sequences are given after species names. NT, PT and HT refer to neotype, paratype and holotype, respectively. Data for specimens are in Table 1. Specimens 4-11 were not examined and their identification follows that of the authors who performed sequencing studies and analyses (
|
||
<bibRefCitation author="Pena, C" journalOrPublisher="Zoologica Scripta" pageId="31" pageNumber="74" pagination="243 - 258" title="Biogeographic history of the butterfly subtribe Euptychiina (Lepidoptera, Nymphalidae, Satyrinae)." url="10.1111/j.1463-6409.2010.00421.x" volume="39" year="2010">
|
||
<normalizedToken originalValue="Peña">Pena</normalizedToken>
|
||
et al. 2010
|
||
</bibRefCitation>
|
||
,
|
||
<bibRefCitation author="Silva-Brandao, KL" journalOrPublisher="Genetics and Molecular Biology" pageId="31" pageNumber="74" pagination="719 - 725" title="Exploitation of mitochondrial nad 6 as a complementary marker for studying population variability in Lepidoptera." url="10.1590/S1415-47572011000400028" volume="34" year="2011">
|
||
<normalizedToken originalValue="Silva-Brandão">Silva-Brandao</normalizedToken>
|
||
et al. 2011
|
||
</bibRefCitation>
|
||
,
|
||
<bibRefCitation author="Seraphim, N" journalOrPublisher="Molecular Ecology Resources" pageId="31" pageNumber="74" pagination="39 - 49" title="Morphological and molecular marker contributions to disentangling the cryptic Hermeuptychia hermes species complex (Nymphalidae: Satyrinae: Euptychiina)." url="10.1111/1755-0998.12161" volume="14" year="2014">Seraphim et al. 2014</bibRefCitation>
|
||
). Percent difference and the number of different nucleotides are shown below and above the diagonal in the matrix, respectively, and the length of each sequence segment (bp) used in the analysis is on the diagonal. Most instructive values discussed in the text are shown in bold font b GenBank accession numbers (those that start with letters G or K) for sequences retrieved from GenBank or DNA voucher numbers (those that start from a number or letter N) for sequences obtained in this study and locality data for specimens are given for each sequence. Further details about the specimens are provided in Table 1.
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="19" pageNumber="62" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
specimens with sequences obtained from GenBank were not examined and their identification follows that of the authors who performed sequencing studies (
|
||
<bibRefCitation author="Murray, D" journalOrPublisher="Molecular Phylogenetics and Evolution" pageId="30" pageNumber="73" pagination="67 - 80" title="Molecular phylogenetics and evolutionary history of the neotropical Satyrine Subtribe Euptychiina (Nymphalidae: Satyrinae)." url="10.1007/BF01731581" volume="34" year="2004">Murray and Prowell 2004</bibRefCitation>
|
||
,
|
||
<bibRefCitation author="Hebert, PDN" journalOrPublisher="Biology Letters" pageId="30" pageNumber="73" pagination="359 - 362" title="DNA barcodes for 1 / 1000 of the animal kingdom." url="10.1098/rsbl.2009.0848" volume="6" year="2010">Hebert et al. 2010</bibRefCitation>
|
||
&
|
||
<bibRefCitation author="Seraphim, N" journalOrPublisher="Molecular Ecology Resources" pageId="31" pageNumber="74" pagination="39 - 49" title="Morphological and molecular marker contributions to disentangling the cryptic Hermeuptychia hermes species complex (Nymphalidae: Satyrinae: Euptychiina)." url="10.1111/1755-0998.12161" volume="14" year="2014">Seraphim et al. 2014</bibRefCitation>
|
||
). All
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="19" pageNumber="62" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
and
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="19" pageNumber="62" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
specimens are paratypes, except the holotype marked with
|
||
<normalizedToken originalValue="“HT”">"HT"</normalizedToken>
|
||
. Scale bar shown below indicates about 0.5% difference.
|
||
</paragraph>
|
||
</caption>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="20" lastPageNumber="63" pageId="19" pageNumber="62" type="type material">
|
||
<paragraph pageId="19" pageNumber="62">Type material.</paragraph>
|
||
<paragraph lastPageId="20" lastPageNumber="63" pageId="19" pageNumber="62">
|
||
Holotype: ♂, has the following two rectangular labels: white printed - || USA: TEXAS: Cameron Co. | E of Brownsville, ex ovum | ex ♀ collected 18-Jan-2003 | ecl. 12-Mar-2003 Grishin N.V. ||; red printed - || HOLOTYPE ♂ |
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia" order="Lepidoptera" pageId="20" pageNumber="63" phylum="Arthropoda" rank="genus">
|
||
<pageBreakToken pageId="20" pageNumber="63" start="start">Hermeuptychia</pageBreakToken>
|
||
</taxonomicName>
|
||
| hermybius Grishin ||. The holotype is illustrated in Figs 48-49. Upon publication, the holotype will be deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC (USNM). Paratypes: 55 ♂♂ and 45 ♀♀, from USA: Texas, unless indicated otherwise. Of these, 9 ♂♂ and 12 ♀♀ are siblings of the holotype read from ova, with the same data, their sexes, eclosion dates and GenBank accessions|DNA voucher numbers|genitalia codes (where available, and in this format for other paratypes) are: 1 ♀ 8-Mar-2003; 1 ♂ 9-Mar-2003, KJ025572|NVG-1610|NVG131017-02 (Fig. 62b); 2 ♂♂ and 1 ♀ 9-Mar-2003; 1 ♂ and 1 ♀ 10-Mar-2003; 1 ♂ and 1 ♀ 11-Mar-2003; 3 ♂♂ 12-Mar-2003; 1 ♀ 14-Mar-2003, KJ025573|NVG-1611|NVG131017-03 (Fig. 64
|
||
<normalizedToken originalValue="s–t">s-t</normalizedToken>
|
||
); 1 ♀ 15-Mar-2003; 1 ♀ 16-Mar-2003, KJ025574|NVG-1612|NVG131017-04 (Fig. 64
|
||
<normalizedToken originalValue="u–v">u-v</normalizedToken>
|
||
); 1 ♀ 17-Mar-2003, KJ025569|NVG-1603|NVG130927-17 (Fig. 64
|
||
<normalizedToken originalValue="q–r">q-r</normalizedToken>
|
||
); 2 ♀♀ 17-Mar-2003; 1 ♀ 21-Mar-2003; 1 ♂ 30-Mar-2003, KJ025571|NVG-1609|NVG131017-01 (Fig. 62a); 1 ♀ 2-Apr-2003 (Figs 50-51). Other paratypes are: 1 ♂ ibid., collected on wing 18-Jan-2003, KJ025570|NVG-1607|NVG130927-18 (Figs 54-55, 60b, e, h, k). 1 ♀ Cameron Co., E of Brownsville, 19-Oct-1997, leg. N. V. Grishin, KJ025575|NVG-1628|NVG131017-05. 1 ♂ Cameron Co., Brownsville, {10-13}-Mar-1979, leg. T. Friedlander, NVG140104-01 [TAMU] (Fig. 62c). 1 ♂ (06-Jun-2007) 1 ♀ (07-Jun-2007) Cameron Co., Los Fresnos, Ted Hunt & Loop Rd., leg. William R. Dempwolf. 4 ♀♀ Hidalgo Co., 1.5 air mi SE of Relampago, Rio Rico Rd., 26.07, -97.891, 21 m, 13-Jun-2013, leg. W. R. Dempwolf; 2 ♂♂ ibid., 19-Oct-2013, KJ025577|NVG-1698|NVG131229-04 (Fig. 62d) and KJ025578|NVG-1699|NVG131229-05 (Figs 56, 62e); 1 ♀ ibid., 19-Oct-2013, KJ025576|NVG-1695|NVG131229-03 (Fig. 64
|
||
<normalizedToken originalValue="w–x">w-x</normalizedToken>
|
||
); 3 ♂♂ 4 ♀♀ ibid., 19-Oct-2013; 2 ♂♂ 4 ♀♀ ibid., 21-Oct-2013; 3 ♂♂ ibid., 24-Oct-2013. 1 ♀ TX: Starr Co., Rio Grande City, Fort Ringgold, 26.3707, -98.8064, 45 m, 12-Nov-2010, leg. W. R. Dempwolf; 1 ♀ ibid., 13-Jun-2013; 1 ♂ ibid., 20-Oct-2013, KJ025580|NVG-1714|NVG131229-07 (Fig. 62f); 1 ♀ ibid., 20-Oct-2013, KJ025579|NVG-1712|NVG131229-06; 2 ♂♂ ibid., 20-Oct-2013; 1 ♂ ibid., 23-Oct-2013; 2 ♂♂ 1 ♀ ibid., 9-Nov-2013. 2 ♂♂ Starr Co., Roma, S of Roma International Bridge, 26.4035, -99.0175, 50 m, 20-Oct-2013, leg. W. R. Dempwolf, KJ025581|NVG-1726|NVG131229-08 (Fig. 62g) and KJ025582|NVG-1727|NVG131229-09 (Fig. 62h); 8 ♂♂ 7 ♀♀ ibid., 20-Oct-2013. 1 ♀ Starr Co., Roma Creek, Hwy 650/Hwy 83, 29-Oct-2007, leg. W. R. Dempwolf. 2 ♀♀ Starr Co., 0.5 mi S of Fronton, 26.399, -99.085, 50 m, 20-Oct-2013, leg. W. R. Dempwolf, KJ025583|NVG-1735|NVG131229-10 and KJ025584|NVG-1737|NVG131229-11 (Figs 57, 64
|
||
<normalizedToken originalValue="y–z">y-z</normalizedToken>
|
||
); 7 ♂♂ 3 ♀♀ ibid., 20-Oct-2013. 1 ♂ Starr Co., Salineno @ Rio Grande, 26.51463, -99.11633, 53 m, 23-Oct-2013, leg. W. R. Dempwolf, KJ025585|NVG-1747|NVG131229-12 (Fig. 62i). 1 ♂ Zapata Co., San Ygnacio @ Rio Grande, 92 m, 7-Oct-2007, leg. N. V. Grishin, KJ025586|NVG-1635|NVG131017-12 (Figs 52, 61b, 62j). 1 ♂ Webb Co., Laredo, 15-Apr-1949, leg. E. L. Todd KJ025587|13385H10|NVG131102-53 [USNM] (Figs 53, 62k). 1 ♂ Mexico: Tamaulipas: Rt. 101 at Rio Corona, 1-Jan-1980, leg. P. W. Kovarik & D. S. Bogar, NVG140104-04 [TAMU]. 1 ♂ Mexico: Tamaulipas: El Canindo, nr. Ejido San
|
||
<normalizedToken originalValue="José">Jose</normalizedToken>
|
||
, 7.5 km W
|
||
<normalizedToken originalValue="Gómez">Gomez</normalizedToken>
|
||
<normalizedToken originalValue="Farías">Farias</normalizedToken>
|
||
, 1400 m, {19-21}-Jul-1994, leg. C. Cate & T. Riley, NVG140104-67 [TAMU]. 2 ♂♂ Mexico: Tamaulipas: Ciudad Mante, Los Arcos Ct., 19-Dec-1973, leg. R. O. & C. A. Kendall, NVG140104-22 and NVG130104-23 [TAMU] (Figs 58, 62m); 1 ♂ ibid., 28-Jan-1995, ex larva, foodplant
|
||
<taxonomicName class="Liliopsida" family="Poaceae" genus="Panicum" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Panicum maximus" order="Poales" pageId="20" pageNumber="63" phylum="Tracheophyta" rank="species" species="maximus">Panicum maximus</taxonomicName>
|
||
Jacq., NVG140104-24 [TAMU]. 1 ♂ Mexico: Tamaulipas: Quintero cave [22.6333, -99.0333], 7-Jan-1974, leg. R. O. & C. A. Kendall, NVG130104-24 [TAMU] (Figs 59, 62l). 1 ♂ 1 ♀ Mexico: San Luis
|
||
<normalizedToken originalValue="Potosí">Potosi</normalizedToken>
|
||
: El Salto Falls, 30-Dec-1979, leg. P. W. Kovarik & D. S. Bogar, NVG140104-03 and NVG140104-02 [TAMU].
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="20" pageNumber="63" type="type locality">
|
||
<paragraph pageId="20" pageNumber="63">Type locality.</paragraph>
|
||
<paragraph pageId="20" pageNumber="63">
|
||
USA: Texas: Cameron County, east of Brownsville. It is a shaded area covered in Guinea grass (
|
||
<taxonomicName class="Liliopsida" family="Poaceae" genus="Panicum" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Panicum maximus" order="Poales" pageId="20" pageNumber="63" phylum="Tracheophyta" rank="species" species="maximus">Panicum maximus</taxonomicName>
|
||
), situated near a ravine and overgrown with taller trees.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="20" pageNumber="63" type="etymology">
|
||
<paragraph pageId="20" pageNumber="63">Etymology.</paragraph>
|
||
<paragraph pageId="20" pageNumber="63">
|
||
The name is a fusion of two words: herm[es] beginning and [sos]ybius ending. It symbolizes that this species traditionally and previously regarded as
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermes" order="Lepidoptera" pageId="20" pageNumber="63" phylum="Arthropoda" rank="species" species="hermes">Hermeuptychia hermes</taxonomicName>
|
||
is phylogenetically closer to
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="20" pageNumber="63" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
, and yet is distinct from it. The resulting word is unique and currently unknown to internet search engines, which is expected to ease its searches. The name is a noun in apposition.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="21" lastPageNumber="64" pageId="20" pageNumber="63" type="distribution">
|
||
<paragraph pageId="20" pageNumber="63">Distribution.</paragraph>
|
||
<paragraph lastPageId="21" lastPageNumber="64" pageId="20" pageNumber="63">
|
||
This species is currently recorded from the lower Rio Grande Valley region of Texas along the Rio Grande from Laredo to the Gulf coast (Webb, Za
|
||
<pageBreakToken pageId="21" pageNumber="64" start="start">pata</pageBreakToken>
|
||
, Starr, Hidalgo, and Cameron Counties, Fig. 67) and in neighboring Mexico (Tamaulipas, San Luis
|
||
<normalizedToken originalValue="Potosí">Potosi</normalizedToken>
|
||
).
|
||
</paragraph>
|
||
<caption pageId="21" pageNumber="64">
|
||
<paragraph pageId="21" pageNumber="64">
|
||
Figure 67. USA localities of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="genus">Hermeuptychia</taxonomicName>
|
||
specimens with available DNA barcode information. Color of circles corresponds to species:
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
- black;
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
- blue,
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
- red, split red/black circles mark localities where both
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
and
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
were recorded. Type localities are indicated with a corresponding name followed by
|
||
<normalizedToken originalValue="“TL”">"TL"</normalizedToken>
|
||
.
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermes subsp. kappeli" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="subSpecies" species="hermes" subSpecies="kappeli">Hermeuptychia hermes kappeli</taxonomicName>
|
||
was treated as a junior subjective synonym of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
by
|
||
<bibRefCitation author="Pelham, JP" journalOrPublisher="Journal of Research on the Lepidoptera" pageId="31" pageNumber="74" pagination="1 - 652" title="A catalogue of the butterflies of the United States and Canada with a complete bibliography of the descriptive and systematic literature." volume="40" year="2008">Pelham (2008)</bibRefCitation>
|
||
. DNA barcode of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermes subsp. kappeli" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="subSpecies" species="hermes" subSpecies="kappeli">Hermeuptychia hermes kappeli</taxonomicName>
|
||
holotype is 100% identical with the barcode of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
neotype. DNA barcode amplification failed for
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
specimen from LA: Jonesboro and for
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
specimen from TX: Brazoria Co., and their identification is based on genitalia only. Specimens from all localities except those from TN and NC (data from GenBank, specimens not inspected) and from FL: St. Petersburg (specimen lacked abdomen) were dissected, and genitalia-based identification agreed with DNA barcode-based identification in all cases (see Fig. 66).
|
||
</paragraph>
|
||
</caption>
|
||
<caption pageId="21" pageNumber="64">
|
||
<paragraph pageId="21" pageNumber="64">
|
||
Figure 68. DNA-barcoded
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="genus">Hermeuptychia</taxonomicName>
|
||
specimens from USA: Texas: Fort Bend Co., Brazos Bend State Park.
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
is above the line and
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
is below the line, photographed prior to removal of body parts for DNA extraction. DNA voucher codes (see Table 1 for data) are shown below each specimen. Hypothetical field marks are indicated on the first specimen of each species. NVG-1537-NVG-1553 are from Horseshoe Lake trail, 29°22'54.96", −95°36'41.06", 15 m; and NVG-1554-NVG-1567 are from near Hale Lake, 29°22'48.27", −95°35'05.02", 16 m, all collected on 17-Aug-2013. Both species are present in each locality. Images are scaled approximately.
|
||
<normalizedToken originalValue="“F”">"F"</normalizedToken>
|
||
specifies mirror image (left-right inverted).
|
||
</paragraph>
|
||
</caption>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="22" lastPageNumber="65" pageId="21" pageNumber="64" type="diagnosis">
|
||
<paragraph pageId="21" pageNumber="64">Diagnosis.</paragraph>
|
||
<paragraph pageId="21" pageNumber="64">
|
||
In wing pattern, the new species is most similar to
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
, but typically can be differentiated from it by: (a) eyespots that are not only smaller, but also more uniform in size, i.e. out of 5 forewing eyespots, 4 (except the one near costa) are usually about the same size, and the eyespot that is black-ringed in most specimens (second from costa) is typically not the largest (this eyespot is frequently the largest in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
), but the next-to-last eyespot (4th from the costa) is usually the largest one; (b) more undulate postmedial line on ventral hindwing, that frequently strongly bulges basad by the largest eyespot near apex (in cell M1-M2); (c) more undulate submarginal sinuous line, which on ventral hindwing barely touches the largest eyespot near the tornus (in cell Cu1-Cu2, second eyespot from tornus, indicated in Fig. 57)-this line is usually fully merged with this eyespot border for some distance in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="21" pageNumber="64" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
. Wing-based identification is not absolute due to extensive pattern variation in both species.
|
||
</paragraph>
|
||
<paragraph lastPageId="22" lastPageNumber="65" pageId="21" pageNumber="64">
|
||
In male genitalia, the new species is also closest to
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="sosybius">
|
||
<pageBreakToken pageId="22" pageNumber="65" start="start">Hermeuptychia</pageBreakToken>
|
||
sosybius
|
||
</taxonomicName>
|
||
and should be attributed to the same morphogroup 4 of
|
||
<bibRefCitation author="Seraphim, N" journalOrPublisher="Molecular Ecology Resources" pageId="31" pageNumber="74" pagination="39 - 49" title="Morphological and molecular marker contributions to disentangling the cryptic Hermeuptychia hermes species complex (Nymphalidae: Satyrinae: Euptychiina)." url="10.1111/1755-0998.12161" volume="14" year="2014">Seraphim et al. (2014)</bibRefCitation>
|
||
. It differs from
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
in the following trends (Figs 60-61): (1) uncus is less convex and narrower on the sides in dorsal (or ventral) view, with a broader truncated apex, the width at the apex is usually more than 2/3 of the width at the narrowest point near the base (Figs 60b, e, 61b); (2) valva is typically
|
||
<normalizedToken originalValue="“higher”">"higher"</normalizedToken>
|
||
in lateral view (dorso-ventral direction), more square at the base (Fig. 60k) and is less extended (Fig. 60h); (3) aedeagus is somewhat broader and is frequently bent near its middle, with a medium length phallobase (Fig. 60e); (4) usually more obtuse angle formed by the tegumen and vinculum in lateral view (Fig. 60k). These characters are quite subtle, and as illustrated in Fig. 62 (compare panels
|
||
<normalizedToken originalValue="a–m">a-m</normalizedToken>
|
||
with panels
|
||
<normalizedToken originalValue="o–z">o-z</normalizedToken>
|
||
2) are subject to significant variation. In contrast, distinction of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia intricata" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="intricata">Hermeuptychia intricata</taxonomicName>
|
||
(Fig. 62n for comparison) is always definitive and clear-cut. To evaluate the confidence of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
identification by male genitalia and to test the ability to differentiate this new species from
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
by objective criteria, we resorted to morphometric analysis (Fig. 63). For simplicity, we have chosen to exploit only two trends listed above: (1) shape of uncus in dorsal view and (2) shape of valva base in lateral view. The shape of uncus was measured by the ratio of width at the apex (a) to the width at the narrowest point near the base (b), and by the ratio of the distance from apex to the widest point in cross-section (c) to the distance from apex to the narrowest point near the base (d). We noticed that both of these ratios tend to be smaller in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
. Instead of applying PCA or other similar data-driven technique, which may be biased by the data at hand (i.e. the resulting transformation would change with the dataset used), we combined these measurements in a data-independent transformation. We used a weighted sum of the two ratios, with the weight of the second ratio arbitrarily set to half the weight of the first one: a/b+0.5c/d, since the ratio of widths (first ratio) seemed to tell the species apart better than the ratio of lengths (second ratio). The shape of the valva base in lateral view was quantified by the ratio of length of the dorsal
|
||
<normalizedToken originalValue="“window”">"window"</normalizedToken>
|
||
(less sclerotized, membranous and flat segment along dorsal side near the base) to the height of the valva at the distal end of the
|
||
<normalizedToken originalValue="“window”">"window"</normalizedToken>
|
||
. These variables were measured and computed on a diverse sample of 27 genitalia illustrated in Fig. 62. The resulting plot (Fig. 63 on the right) separated the two species. Therefore these simple measurements could be used to tell between these two cryptic
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="genus">Hermeuptychia</taxonomicName>
|
||
species by male genitalia. However, we were not able to find characters in female genitalia to differentiate the new species from
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
.
|
||
</paragraph>
|
||
<paragraph pageId="22" pageNumber="65">
|
||
Finally, the most confident identification is provided by DNA barcode sequences (Fig. 66) that show little variation within each species (most sequences are identical across the range, maximum difference below 1% in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
), but reveal a definitive 2% hiatus between central and south Texas populations (Figs 66-67). We selected all positions that were invariant in the barcode sample of each species but different between the two species as characters to differentiate
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
from
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
. The resulting 11 positions are listed in the format "k X (not Y)", where k is a sequential number of the position (numbering is from 1 to 658 for the barcode sequence shown above as a reference), X is a nucleotide in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
barcodes and Y is a nucleotide in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="22" pageNumber="65" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
barcodes: 64 T (not C), 73 G (not A), 82 T (not C), 118 C (not T), 133 C (not T), 235 C (not T), 238 A (not G), 364 C (not T), 436 C (not T), 526 A (not T), 616 C (not T). These positions distinguish the two species; however, some of the positions are expected to show variation when a larger sample of sequence is accumulated.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="23" lastPageNumber="66" pageId="22" pageNumber="65" type="life history">
|
||
<paragraph pageId="22" pageNumber="65">Life history.</paragraph>
|
||
<paragraph lastPageId="23" lastPageNumber="66" pageId="22" pageNumber="65">
|
||
The holotype of the new species, along with 21 paratypes are specimen reared in the lab from ova obtained from a captive female. All life history stages are illustrated in Fig. 70, and could be compared to the images of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="species" species="sosybius">
|
||
<pageBreakToken pageId="23" pageNumber="66" start="start">Hermeuptychia</pageBreakToken>
|
||
sosybius
|
||
</taxonomicName>
|
||
life history (Fig. 69). Immature stages of both species are very similar and without larger sample it is difficult to derive solid conclusions about the differences. Nevertheless, the following observations were made. Natural foodplants seems to be
|
||
<taxonomicName class="Liliopsida" family="Poaceae" genus="Panicum" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Panicum maximus" order="Poales" pageId="23" pageNumber="66" phylum="Tracheophyta" rank="species" species="maximus">Panicum maximus</taxonomicName>
|
||
(Guinea grass) per R. O. Kendall & C. A. Kendall, who reared caterpillars found on this grass in Mexico: Tamaulipas [TAMU collection]. This plant is also common in the lower Rio Grande Valley and is ubiquitously present where
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="genus">Hermeuptychia</taxonomicName>
|
||
adults were encountered. Caterpillars hatched from eggs in captivity readily accepted
|
||
<taxonomicName class="Liliopsida" family="Poaceae" genus="Cynodon" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Cynodon dactylon" order="Poales" pageId="23" pageNumber="66" phylum="Tracheophyta" rank="species" species="dactylon">Cynodon dactylon</taxonomicName>
|
||
(L.) Pers. (Bermuda grass) and were successfully reared on it. Both
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
and
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
caterpillars go through four instars prior to pupation, and the first instar has black head capsule (Figs 69
|
||
<normalizedToken originalValue="b–d">b-d</normalizedToken>
|
||
, 70
|
||
<normalizedToken originalValue="b–c">b-c</normalizedToken>
|
||
). In subsequent instars, head capsule is green and round, without horns and projections (Figs 69
|
||
<normalizedToken originalValue="e–m">e-m</normalizedToken>
|
||
, 70
|
||
<normalizedToken originalValue="d–m">d-m</normalizedToken>
|
||
). Caterpillars of both species typically rest below leaves on loosely made silk pads, frequently in pairs, when two caterpillars face each other
|
||
<normalizedToken originalValue="“head-to-head”">"head-to-head"</normalizedToken>
|
||
(Figs 69h, 70c). When disturbed, caterpillars first curl into a C head-to-tail while legs being attached to the leaf (Figs 69f, j, 70e), then to a full O, head-to-legs (Fig. 70g). White dorsolateral spots in ultimate instar seem to be more pronounced in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
than in
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
(compare Fig. 70
|
||
<normalizedToken originalValue="g–k">g-k</normalizedToken>
|
||
with 69k). Pupae of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
were stronger patterned with brown on the sides (Fig. 70o) than those of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
from two distant-from-each-other Texas localities (Fig. 69
|
||
<normalizedToken originalValue="n–o">n-o</normalizedToken>
|
||
), and some
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
pupae were brown in color (Fig. 70n).
|
||
</paragraph>
|
||
<caption pageId="23" pageNumber="66">
|
||
<paragraph pageId="23" pageNumber="66">
|
||
Figure 69. Life history of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia sosybius" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="species" species="sosybius">Hermeuptychia sosybius</taxonomicName>
|
||
. USA: TX: Brazoria County, Bar-X Ranch, Rd. 971N, 29.13252, -95.58340, ex ovum ex ♀ collected on 4-Mar-2000, except o, which is TX: Wise Co., LBJ National Grassland. a ovum, 6-Mar-2000
|
||
<normalizedToken originalValue="b–d">b-d</normalizedToken>
|
||
1st instars, photographed on 14- 14- & 16-Mar-2000, respectively
|
||
<normalizedToken originalValue="e–g">e-g</normalizedToken>
|
||
2nd instars photographed on 21- 19- & 21-Mar-2000 e, f are just after molt, shed larval skins are behind and 1st instar head capsule (black) is on the left in e, f is in a curled position adopted when disturbed h pre-molt quiescent 2nd instar larvae in a typical
|
||
<normalizedToken originalValue="“head-to-head”">"head-to-head"</normalizedToken>
|
||
resting position, 24-Mar-2000
|
||
<normalizedToken originalValue="i–j">i-j</normalizedToken>
|
||
3rd instars, 24- & 27-Mar-2000
|
||
<normalizedToken originalValue="k–l">k-l</normalizedToken>
|
||
4th (ultimate) instars, ♂♂, 3- & 6-Apr-2000 l close to pupation, note the color and shape change m prepupa, 6-Apr-2000
|
||
<normalizedToken originalValue="n–p">n-p</normalizedToken>
|
||
pupae, 9-Apr-2000, 8-Aug-1998, & 17-Apr-2000 o is from Wise Co., wing color is starting to develop p near eclosion, dark adult is seen through semi-transparent pupal cuticle. Most images show different individuals. Images
|
||
<normalizedToken originalValue="a–g">a-g</normalizedToken>
|
||
are enlarged 2 times (scale on f) compared to the rest (scale on l).
|
||
</paragraph>
|
||
</caption>
|
||
<caption pageId="23" pageNumber="66">
|
||
<paragraph pageId="23" pageNumber="66">
|
||
Figure 70. Life history of
|
||
<taxonomicName class="Insecta" family="Nymphalidae" genus="Hermeuptychia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Hermeuptychia hermybius" order="Lepidoptera" pageId="23" pageNumber="66" phylum="Arthropoda" rank="species" species="hermybius">Hermeuptychia hermybius</taxonomicName>
|
||
. USA: TX: Cameron County, E of Brownsville, ex ovum ex ♀ collected on 18-Jan-2003. a ovum, 23-Jan-2003
|
||
<normalizedToken originalValue="b–c">b-c</normalizedToken>
|
||
1st instars, photographed on 30-Jan & 1-Feb-2003, respectively b prior to feeding, thus is white in color, c shows two caterpillars in a typical
|
||
<normalizedToken originalValue="“head-to-head”">"head-to-head"</normalizedToken>
|
||
resting position d 2nd instar, 10-Feb-2003
|
||
<normalizedToken originalValue="e–f">e-f</normalizedToken>
|
||
3rd instars 14- & 15-Feb-2003
|
||
<normalizedToken originalValue="g–k">g-k</normalizedToken>
|
||
4th (ultimate) instars, 25- 28- 26- 26- & 25-Feb-2003 g is in a curled position adopted when disturbed;
|
||
<normalizedToken originalValue="l–m">l-m</normalizedToken>
|
||
prepupae, 26- & 23-Feb-2003
|
||
<normalizedToken originalValue="n–p">n-p</normalizedToken>
|
||
pupae, 10-Mar 25-Feb & 4-Mar-2003 n is a brown form, shed larval skin is still attached near cremaster in o and p and is hanging behind the pupa in n, p near eclosion, dark adult is seen through semi-transparent pupal cuticle. Most images show different individuals, those that eclosed are paratypes. Images
|
||
<normalizedToken originalValue="a–d">a-d</normalizedToken>
|
||
are enlarged 2 times (scale on d) compared to the rest (scale on k).
|
||
</paragraph>
|
||
</caption>
|
||
</subSubSection>
|
||
</treatment>
|
||
</document> |