279 lines
31 KiB
XML
279 lines
31 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.177.2562" ID-GBIF-Dataset="596c1d81-fdb9-4f8d-b562-6f7cf56809a0" ID-PMC="PMC3317614" ID-Pensoft-Pub="1313-2970-177-1" ID-PubMed="22532782" ModsDocAuthor="" ModsDocDate="2012" ModsDocID="1313-2970-177-1" ModsDocOrigin="ZooKeys 177" ModsDocTitle="Wernerius inyoensis, an elusive new scorpion from the Inyo Mountains of California (Scorpiones, Vaejovidae)" checkinTime="1451249246765" checkinUser="pensoft" docAuthor="Webber, Michael M., Graham, Matthew R. & Jaeger, Jef R." docDate="2012" docId="C2F460D53EE4A333736551EA78EB1B65" docLanguage="en" docName="ZooKeys 177: 1-13" docOrigin="ZooKeys 177" docSource="http://dx.doi.org/10.3897/zookeys.177.2562" docTitle="Wernerius inyoensis Webber, Graham & Jaeger, 2012, sp. n." docType="treatment" docVersion="4" lastPageNumber="9" masterDocId="5465FF9729090D31714EBB6CFFF7DE46" masterDocTitle="Wernerius inyoensis, an elusive new scorpion from the Inyo Mountains of California (Scorpiones, Vaejovidae)" masterLastPageNumber="13" masterPageNumber="1" pageNumber="3" updateTime="1668153450367" updateUser="ExternalLinkService">
|
||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||
<mods:titleInfo>
|
||
<mods:title>Wernerius inyoensis, an elusive new scorpion from the Inyo Mountains of California (Scorpiones, Vaejovidae)</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Webber, Michael M.</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Graham, Matthew R.</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Jaeger, Jef R.</mods:namePart>
|
||
</mods:name>
|
||
<mods:typeOfResource>text</mods:typeOfResource>
|
||
<mods:relatedItem type="host">
|
||
<mods:titleInfo>
|
||
<mods:title>ZooKeys</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:part>
|
||
<mods:date>2012</mods:date>
|
||
<mods:detail type="volume">
|
||
<mods:number>177</mods:number>
|
||
</mods:detail>
|
||
<mods:extent unit="page">
|
||
<mods:start>1</mods:start>
|
||
<mods:end>13</mods:end>
|
||
</mods:extent>
|
||
</mods:part>
|
||
</mods:relatedItem>
|
||
<mods:location>
|
||
<mods:url>http://dx.doi.org/10.3897/zookeys.177.2562</mods:url>
|
||
</mods:location>
|
||
<mods:classification>journal article</mods:classification>
|
||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.177.2562</mods:identifier>
|
||
<mods:identifier type="Pensoft-Pub">1313-2970-177-1</mods:identifier>
|
||
</mods:mods>
|
||
<treatment ID-GBIF-Taxon="152033609" LSID="urn:lsid:zoobank.org:act:A50D0CA5-CBE7-4C5F-9BC6-EFB155F7EFA2" httpUri="http://treatment.plazi.org/id/C2F460D53EE4A333736551EA78EB1B65" lastPageId="8" lastPageNumber="9" pageId="2" pageNumber="3">
|
||
<subSubSection pageId="2" pageNumber="3" type="nomenclature">
|
||
<paragraph pageId="2" pageNumber="3">
|
||
<taxonomicName LSID="urn:lsid:zoobank.org:act:A50D0CA5-CBE7-4C5F-9BC6-EFB155F7EFA2" class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="2" pageNumber="3" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
<taxonomicNameLabel pageId="2" pageNumber="3">sp. n.</taxonomicNameLabel>
|
||
Figs 114
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="2" pageNumber="3" type="type material">
|
||
<paragraph pageId="2" pageNumber="3">Type material.</paragraph>
|
||
<paragraph pageId="2" pageNumber="3">
|
||
United States: California: male holotype, Loretta Mine Road, Inyo Mountains, Death Valley National Park,
|
||
<geoCoordinate direction="north" orientation="latitude" precision="5" value="37.2299">37.2299°N</geoCoordinate>
|
||
,
|
||
<geoCoordinate direction="west" orientation="longitude" precision="5" value="-117.9568">117.9568°W</geoCoordinate>
|
||
, 1706 m, 9 September 2009, M.R. Graham and G.M. Graham Jr. (DEVA 54174).
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="2" pageNumber="3" type="etymology">
|
||
<paragraph pageId="2" pageNumber="3">Etymology.</paragraph>
|
||
<paragraph pageId="2" pageNumber="3">The specific epithet refers to the type locality in the Inyo Mountains, California.</paragraph>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="4" lastPageNumber="5" pageId="2" pageNumber="3" type="diagnosis">
|
||
<paragraph pageId="2" pageNumber="3">Diagnosis.</paragraph>
|
||
<paragraph pageId="2" pageNumber="3">Small in size, with the only known adult male less than 17 mm in total length. Yellow-orange base color with darker carinae on the pedipalps, and segments of the metasoma. Genital operculum divided below posterior one fifth, carapace very slightly emarginate; pectine count 11-11; 7 inner (ID) denticles on the pedipalp movable finger and 6 on the fixed finger.</paragraph>
|
||
<paragraph lastPageId="4" lastPageNumber="5" pageId="2" pageNumber="3">
|
||
Although specimens of
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="2" pageNumber="3" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
and
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius mumai" order="Scorpiones" pageId="2" pageNumber="3" phylum="Arthropoda" rank="species" species="mumai">Wernerius mumai</taxonomicName>
|
||
were not available for study (Sissom pers. comm.), based on the original descriptions of these species (
|
||
<bibRefCitation author="Haradon, RM" journalOrPublisher="The Pan-Pacific Entomologist" pageId="8" pageNumber="9" pagination="23 - 27" title="Vaejovis spicatus: A new scorpion from California." volume="50" year="1974">Haradon 1974</bibRefCitation>
|
||
,
|
||
<bibRefCitation author="Sissom, WD" journalOrPublisher="Journal of Arachnology" pageId="8" pageNumber="9" pagination="64 - 68" title="A new species of Vaejovis (Scorpiones, Vaejovidae) from western Arizona, with supplemental notes on the male of Vaejovis spicatus Haradon." url="10.3958/059.036.0108" volume="21" year="1993">Sissom 1993</bibRefCitation>
|
||
), it appears that
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="2" pageNumber="3" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. is morphologically most similar to
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="2" pageNumber="3" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
. Both species share ID denticle counts, have similar femur and patella L/W ratios, and overlap in pectine tooth counts. However,
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="2" pageNumber="3" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. differs from
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="spicatus">
|
||
<pageBreakToken pageId="3" pageNumber="4" start="start">Wernerius</pageBreakToken>
|
||
spicatus
|
||
</taxonomicName>
|
||
by having larger metasomal and pedipalp dimensions.
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. also differs from
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
in hemispermatophore morphology. The length of the lamellar hook in
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. is relatively short and the dorsal trough is shallow as indicated by the ratio of the lamellar hook length/length of the entire lamina (0.338) when compared to that of
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
(0.439). In addition, the basal constriction is less well-defined in
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. as indicated by the ratio of width at lamellar hook/lamina length (
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. = 0.169;
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
= 0.123). The distal end of the lamina is also straighter and wider than
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="3" pageNumber="4" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
, which exhibits a slight curve and tapers posteriorly (ratio of width at distal end of lamina/width at lamina midpoint;
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="inyoensis">
|
||
<pageBreakToken pageId="4" pageNumber="5" start="start">Wernerius</pageBreakToken>
|
||
inyoensis
|
||
</taxonomicName>
|
||
= 0.900,
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
= 0.652). The ratio of the total width of the lamina at the midpoint/inner surface of the lamina groove to the right lateral surface of the lamina, indicates that the lamellar spine of
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. (1.33) is wider than that of
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
(1.09).
|
||
</paragraph>
|
||
<caption pageId="4" pageNumber="5">
|
||
<paragraph pageId="4" pageNumber="5">
|
||
Figure 2.
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. in vivo.
|
||
</paragraph>
|
||
</caption>
|
||
<paragraph pageId="4" pageNumber="5">
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n.can be distinguished from
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius mumai" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="mumai">Wernerius mumai</taxonomicName>
|
||
by the following combination of characters: smaller adult size (of the holotype, <17 mm), more robust femur (L/W ratio 3.54) and a shorter, thinner pedipalp, 5 OD denticles on the pedipalp movable finger in addition to 5 on the fixed finger, and ventral metasomal setae counts. Inframedian carinae are crenulate and complete on metasomal segment I, and cover the posterior half of metasomal segments II and III. A comparison of characters is provided in Table 1.
|
||
</paragraph>
|
||
<caption pageId="4" pageNumber="5">
|
||
<paragraph pageId="4" pageNumber="5">
|
||
Table 1. Measurements (in millimeters) of all known adult specimens in genus
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="genus">Wernerius</taxonomicName>
|
||
.
|
||
</paragraph>
|
||
</caption>
|
||
<paragraph pageId="4" pageNumber="5">
|
||
<table pageId="4" pageNumber="5">
|
||
<tr pageId="4" pageNumber="5">
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n.
|
||
</th>
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
</th>
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
</th>
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
</th>
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius mumai" order="Scorpiones" pageId="4" pageNumber="5" phylum="Arthropoda" rank="species" species="mumai">Wernerius mumai</taxonomicName>
|
||
</th>
|
||
</tr>
|
||
<tr pageId="4" pageNumber="5">
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">Sex</th>
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">Male</th>
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">Male</th>
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">Female (Holo)</th>
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">Female (Para)</th>
|
||
<th colspan="1" pageId="4" pageNumber="5" rowspan="1">Female (Holo)</th>
|
||
</tr>
|
||
</table>
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="4" pageNumber="5" type="description">
|
||
<paragraph pageId="4" pageNumber="5">Description of holotype.</paragraph>
|
||
<paragraph pageId="4" pageNumber="5">Color: Carapace, tergites, femur, patella, and metasoma have a yellow-orange base color with dark brown to black markings on the chela and along carinae of the metasoma. Legs are yellow and slightly lighter in color than the rest of the body. Pedipalp chela is yellow-orange in color with darker reddish-brown coloration at the anterior portion of the palm where the fixed finger and movable finger meet. Chelicerae are yellow with mottling on distal half. Telson is dark-yellow to orange bordered by dark brown carinae. Pectines and genital operculum are light yellow.</paragraph>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="7" lastPageNumber="8" pageId="4" pageNumber="5" type="morphology">
|
||
<paragraph pageId="4" pageNumber="5">Morphology.</paragraph>
|
||
<paragraph lastPageId="7" lastPageNumber="8" pageId="4" pageNumber="5">
|
||
Carapace: anterior margin very slightly emarginate, with three lateral eyes on each side; moderately convex dorsolaterally; finely granular with scattered small granules, with larger granules symmetrically flanking the median furrow; median furrow is slight and traverses length of carapace, excluding the median eyes; ratio of median eyes location (from anterior edge)/carapace length = 0.32; carapace length/width at median eyes = 1.44. Tergites: slightly granular with weak median carinae from distal half of tergite I, and terminating at the middle of segment VII; strong granular
|
||
<pageBreakToken pageId="5" pageNumber="6" start="start">dorsolateral</pageBreakToken>
|
||
and lateral supramedian carina on posterior 4/5s of VII; pretergites very finely granular. Sternites:
|
||
<normalizedToken originalValue="I–V">I-V</normalizedToken>
|
||
smooth to very finely granular and without carinae; V with granular ventral lateral carinae on posterior 1/5 to posterior 3/5. Spiracles: ovoid with median side parallel to posterior sternite margin. Genital Operculum: sclerites separated on posterior 1/5 with genital papillae protruding slightly beyond posterior of operculum plates. Pectines:tooth count 11/11; middle lamellae 5/6. Metasoma: ratio of segment I length/width 0.81; segment II length/width 0.91; segment III lengt
|
||
<pageBreakToken pageId="6" pageNumber="7" start="start">h</pageBreakToken>
|
||
/width 0.89; segment IV length/width 1.14; segment V length/width 1.58. Segments
|
||
<normalizedToken originalValue="I–IV">I-IV</normalizedToken>
|
||
: dorsolateral carinae are strong and serrate, with distal denticle of
|
||
<normalizedToken originalValue="I–IV">I-IV</normalizedToken>
|
||
enlarged and spinoid; denticle size is largest on segments III and IV and smaller on segments I and II; possesses intermediary carinae on segments I, II, and III; inframedian carinae are crenulate, and traverse the entire length of segment I, and
|
||
<normalizedToken originalValue="½">1/2</normalizedToken>
|
||
of the posterior portion of segments II and III, lateral supramedian carinae
|
||
<normalizedToken originalValue="I–III">I-III</normalizedToken>
|
||
possesses serrated granules and enlarged spinoid distal denticle; carinae of segment IV are less pronounced, crenulate to serrate, and flared on distal terminus; a space exists between the dorsolateral and supramedian carinae of segments
|
||
<normalizedToken originalValue="I–III">I-III</normalizedToken>
|
||
, and 1/3 of segment III; intermediary carinae are less distinct and are more granular than the ventrolateral carinae; ventral carinae are weakly serrate, but less distinct than dorsal carinae; ventrolateral carinae I strong, crenulate to serrulate; on
|
||
<normalizedToken originalValue="II–III">II-III</normalizedToken>
|
||
serrulate to serrate; on IV crenulate to serrate; ventral submedian setae 3/3:3/3:3/3:3/3:3/3. Segment V: dorsolateral carinae moderate, granular; lateromedian carinae moderate and granular on anterior 4/5, obsolete on
|
||
<pageBreakToken pageId="7" pageNumber="8" start="start">distal</pageBreakToken>
|
||
1/5; ventrolateral and ventromedian carinae crenulate to weakly serrate; intercarinal spaces are finely granular; ventrolateral setae 2/2:2/2:2/2:2/2:3/3.
|
||
</paragraph>
|
||
<paragraph pageId="7" pageNumber="8">
|
||
Telson: smooth to slightly granular with very pronounced subaculear tubercule; 3/1 LAS denticles (
|
||
<bibRefCitation author="Fet, V" journalOrPublisher="Euscorpius" pageId="8" pageNumber="9" pagination="1 - 19" title="Laterobasal aculear serrations (LAS) in scorpion family Vaejovidae (Scorpiones: Chactoidea)." volume="45" year="2006">Fet et al. 2006</bibRefCitation>
|
||
). Chelicerae:dorsal edge of movable cheliceral finger with two subdistal (sd) denticles; ventral edge smooth to well developed serrula on distal 2/3. Pedipalps:trichobothrial pattern type C (Figs 3-9); ratio of chela length/width 3.84; femur length/width 3.54; patella length/width 3.69; fixed finger length/carapace length 0.36. Chela:carinae weak and smooth except for a few weak to moderate granules on D4 and D5; median (MD) denticles of fixed finger aligned and divided into six subrows by five outer (OD) denticles flanked by six inner (ID) denticles; movable finger with six subrows, five OD denticles and seven ID denticles; movable finger shorter than the carapace and slightly shorter than metasomal segment V. Femur: dorsoexternal, dorsointernal, and ventrointernal carinae denticulate, ventroexternal is slightly serrate; internal surface covered with small granules throughout. Patella:internal carinae are granulose with 5 dentate denticles; all other carinae weak to non-existent. Legs: ventral surface of tarsus with single median row of spinules terminating distally with one spinule pair. Hemispermatophore (Figs 11-12): the specimen has a wide hemispermatophore trunk with a well defined truncal flexure; the dorsal trough is shallow, with its base terminating at the distal end of the truncal flexure and tapers posteriorly; the lamellar hook is relatively large and strongly bifurcated at the distal tip, and also possesses a strong groove and slight basal constriction; the length of the lamellar hook is relatively short and the dorsal trough is shallow as indicated by the ratio of the lamellar hook length to the length of the entire lamina (0.338).
|
||
</paragraph>
|
||
<caption pageId="7" pageNumber="8">
|
||
<paragraph pageId="7" pageNumber="8">
|
||
Figures 3-10. Trichobothrial patterns of
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="7" pageNumber="8" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. based on male holotype 3 Right pedipalp chela, external 4 Right pedipalp chela, ventral 5 Right pedipalp chela, internal 6 Right pedipalp femur, dorsal 7 Right pedipalp patella, dorsal 8 Right pedipalp patella, internal 9 Right pedipalp patella, ventral 10 Lateral aspect of metasomal segments IV and V, and telson.
|
||
</paragraph>
|
||
</caption>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="8" lastPageNumber="9" pageId="7" pageNumber="8" type="dna barcode (coi)">
|
||
<paragraph pageId="7" pageNumber="8">DNA barcode (COI)</paragraph>
|
||
<paragraph lastPageId="8" lastPageNumber="9" pageId="7" pageNumber="8">
|
||
- GCTTCTATGGTAGGGACAGCTTTGAGAT TAATAATTCGTATTGAGATTGGAAGTCCTGGGTCTTTTATTGGAGA TGATCAAATTTATAATGTTGTTGTTACTGCTCATGCTTTTGTAAT GATTTTTTTTATGGTAATACCAATTATAATTGGAGGTTTTGGAAATTG GTTAGTCCCTTTAATGTTGGGGGCTCCTGATATGGCTTTCCCTCGTT TAAATAATATAAGTTTTTGGTTATTACCTCCTGCATTTTTTTTATTATT AGGGTCAGCTTCATTGGAAAGAGGCGCAGGGACAGGCTGAACTGT GTACCCGCCTCTTTCCTCATATATGTTCCATTCTGGTGGTTCTGTT GATATGACTATTTTTTCTTTACATTTAGCTGGAGTTTCTTCAATTT TAGGAGCTATTAATTTTATTACTACTATTTTAAATATACGTATAAGTG GAATATTATTGGAGCGTATTCCTTTGTTTGTATGATCTGTAAGGAT TACTGCTATTTTATTACTTCTTTCTCTTCCCGTTCTTGCAGGGGC TATTACTATACTATTAACTGATCGAAATTTTAATACTTCTTTTTTT GATCCTGCAGGAGGGGGAGATCCCATTTTATATCAGCATT TATTTTGATTTTTTGGACATCCTGAAGTTTATATTTTAATTCTTC CTGGGTTTGGAATGGTTTCTCATATTATTAGTCATCATACTG GAAAGAGGGAGCCTTTTGGAGCTTTGGGAATGATTTATGCAATG GTTGCTATTGGGTTTTTAGGATTTGTTGTTTGGGCTCATCATAT GTTTACTGTTGGAATAGATGTTGATACTCGAGCTTATTTTACT GCTGCTACTATGGTTATTGCTGTTCCTACTGGGATCAAAATTTT TAGATGATTAGCTACTTTACATGGTTCTTATTTTGTCTTTACGC
|
||
<pageBreakToken pageId="8" pageNumber="9" start="start">CCCCTCTTTTGTGGGCTTTGGGATTTGTTTTTCTATTTACTG</pageBreakToken>
|
||
TAGGAGGTTTAACTGGTGTAATTTTAGCTAATTCTTCTTTGGA TATTGTTCTTCATGATACTTATTATGTTGTAGCTCATTTTCAT TATGTTTTGTCTATAGGAGCAGTTTTTGCCATTATTGCTGGAATT GTTGAATGGTTTCCTCTATTTTTAGGTTGTCAGATGAGTGAGCG TATATTAAAAATTCATTTTTTTGTGATGCTTTTGGGGGTAAAT
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="8" pageNumber="9" type="mensuration (mm)">
|
||
<paragraph pageId="8" pageNumber="9">Mensuration (mm).</paragraph>
|
||
<paragraph pageId="8" pageNumber="9">Male holotype: total length 16.4; carapace length 2.38; mesosoma length 4.89; metasoma length 7.48 (excluding telson); Metasoma: segment I length/width 1.05/1.29; segment II length/width 1.19/1.31; segment III length/width 1.24/1.40; segment IV length/width 1.71/1.50; segment V length/width 2.29/1.45. Telson: length 2.27; vesicle length/width/depth 1.67/1.10/0.76; aculeus length 0.60. Pedipalps: total length 7.95; femur length/width 2.02/0.57; patella length/width 2.36/0.64; chela length 3.57; palm length/width/depth 1.98/0.93/1.12; movable finger length 2.24; fixed finger length 1.79.</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="8" pageNumber="9" type="distribution">
|
||
<paragraph pageId="8" pageNumber="9">Distribution.</paragraph>
|
||
<paragraph pageId="8" pageNumber="9">Known only from the type locality in the Inyo Mountains of California where it was collected at an elevation of 1706 m.</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="8" pageNumber="9" type="subterranean hypothesis">
|
||
<paragraph pageId="8" pageNumber="9">Subterranean hypothesis.</paragraph>
|
||
<paragraph pageId="8" pageNumber="9">
|
||
The southwestern United States is one of most well-studied areas in the world in terms of scorpions, so it is puzzling that a genus as widespread as
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius" order="Scorpiones" pageId="8" pageNumber="9" phylum="Arthropoda" rank="genus">Wernerius</taxonomicName>
|
||
is so infrequently encountered. Previous authors have attributed their rarity to low densities or sporadic surface activity (
|
||
<bibRefCitation author="Sissom, WD" journalOrPublisher="Journal of Arachnology" pageId="8" pageNumber="9" pagination="64 - 68" title="A new species of Vaejovis (Scorpiones, Vaejovidae) from western Arizona, with supplemental notes on the male of Vaejovis spicatus Haradon." url="10.3958/059.036.0108" volume="21" year="1993">Sissom 1993</bibRefCitation>
|
||
), but we provide a third potential explanation, that
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius" order="Scorpiones" pageId="8" pageNumber="9" phylum="Arthropoda" rank="genus">Wernerius</taxonomicName>
|
||
are primarily subterranean.
|
||
</paragraph>
|
||
<paragraph pageId="8" pageNumber="9">
|
||
Recent studies of invertebrates inhabiting the deep soil strata (euedaphon) in Bulgaria have revealed a rich spider fauna (
|
||
<bibRefCitation author="Deltshev, C" journalOrPublisher="Arachnologische Mitteilungen" pageId="8" pageNumber="9" pagination="33 - 46" title="A survey of spiders (Araneae) inhabiting the euedaphic soil stratum and the superficial underground compartment in Bulgaria." url="10.5431/aramit4005" volume="40" year="2011">Deltshev et al. 2011</bibRefCitation>
|
||
). Incredibly, the different soil strata each contained a unique assemblage of spiders, many of which exhibited various degrees of morphological adaptations to underground environments. One species,
|
||
<taxonomicName class="Arachnida" family="Anapidae" genus="Zangherella" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Zangherella relicta" order="Araneae" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="relicta">Zangherella relicta</taxonomicName>
|
||
(
|
||
<bibRefCitation author="Kratochvil, J" journalOrPublisher="Prace Moravske prirodovedecke spolecnosti" pageId="8" pageNumber="9" pagination="1 - 25" title="Araignees cavernicoles de Krivosije." volume="9" year="1935">
|
||
<normalizedToken originalValue="Kratochvíl">Kratochvil</normalizedToken>
|
||
1935
|
||
</bibRefCitation>
|
||
), was only found within the deepest strata surveyed. We hypothesize that
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. may inhabit similar environments in the North American Southwest, particularly areas of piled rock or talus slopes (Fig. 13, 14). Despite the fact that
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius" order="Scorpiones" pageId="8" pageNumber="9" phylum="Arthropoda" rank="genus">Wernerius</taxonomicName>
|
||
are uncommonly encountered, two other lines of evidence support our hypothesis. Each species has only been collected from extremely rocky habitats, and each species is incredibly small (<25 mm), perhaps enabling them to easily maneuver within the interstitial spaces of piled rock and talus. If true, then perhaps these small and mysterious scorpions occur at higher densities across a much wider distribution than currently known.
|
||
</paragraph>
|
||
<caption pageId="8" pageNumber="9">
|
||
<paragraph pageId="8" pageNumber="9">
|
||
Figures 11-12. Dorsal aspect of right hemispermatophore: 11
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. (dotted line indicates the ventral trough) 12
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius spicatus" order="Scorpiones" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="spicatus">Wernerius spicatus</taxonomicName>
|
||
(redrawn from
|
||
<bibRefCitation author="Sissom, WD" journalOrPublisher="Journal of Arachnology" pageId="8" pageNumber="9" pagination="64 - 68" title="A new species of Vaejovis (Scorpiones, Vaejovidae) from western Arizona, with supplemental notes on the male of Vaejovis spicatus Haradon." url="10.3958/059.036.0108" volume="21" year="1993">Sissom (1993)</bibRefCitation>
|
||
)
|
||
</paragraph>
|
||
</caption>
|
||
<caption pageId="8" pageNumber="9">
|
||
<paragraph pageId="8" pageNumber="9">
|
||
Figures 13-14. Type locality of
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n. 13 Desert wash where the species was first discovered. 14 Talus slope that might provide a subterranean habitat for
|
||
<taxonomicName class="Arachnida" family="Vaejovidae" genus="Wernerius" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Wernerius inyoensis" order="Scorpiones" pageId="8" pageNumber="9" phylum="Arthropoda" rank="species" species="inyoensis">Wernerius inyoensis</taxonomicName>
|
||
sp. n.
|
||
</paragraph>
|
||
</caption>
|
||
</subSubSection>
|
||
</treatment>
|
||
</document> |