225 lines
26 KiB
XML
225 lines
26 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.1132.91244" ID-Pensoft-Pub="1313-2970-1132-85" ID-Pensoft-UUID="E57A2873FAAC552282A3E1390FF28D3E" ID-ZooBank="4168C32E37A74912A9094912E69030AA" ModsDocID="1313-2970-1132-85" checkinTime="1669726345720" checkinUser="pensoft" docAuthor="Barroso, Maria, Moreira, Juan, Capa, Maria, Nygren, Arne & Parapar, Julio" docDate="2022" docId="03F3107D0D365CBF87347954AD5ED893" docLanguage="en" docName="ZooKeys 1132: 85-126" docOrigin="ZooKeys 1132" docPubDate="2022-11-28" docSource="http://dx.doi.org/10.3897/zookeys.1132.91244" docTitle="Terebellides atlantis Williams 1984" docType="treatment" docVersion="2" id="E57A2873FAAC552282A3E1390FF28D3E" lastPageNumber="85" masterDocId="E57A2873FAAC552282A3E1390FF28D3E" masterDocTitle="A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species" masterLastPageNumber="126" masterPageNumber="85" pageNumber="85" updateTime="1669726647669" updateUser="ExternalLinkService">
|
|
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
|
<mods:titleInfo>
|
|
<mods:title>A further step towards the characterisation of Terebellides (Annelida, Trichobranchidae) diversity in the Northeast Atlantic, with the description of a new species</mods:title>
|
|
</mods:titleInfo>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Barroso, Maria</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-9624-3602</mods:nameIdentifier>
|
|
<mods:affiliation>Departamento de Bioloxia, Universidade da Coruna, A Coruna, Spain</mods:affiliation>
|
|
<mods:nameIdentifier type="email">maria.p.barroso@udc.es</mods:nameIdentifier>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Moreira, Juan</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-1374-2033</mods:nameIdentifier>
|
|
<mods:affiliation>Departamento de Biologia (Zoologia) & Centro de Investigacion en Biodiversidad y Cambio Global (CIBC-UAM), Facultad de Ciencias, Universidad Autonoma de Madrid, Madrid, Spain</mods:affiliation>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Capa, Maria</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-5063-7961</mods:nameIdentifier>
|
|
<mods:affiliation>Departament de Biologia, Universitat de les Illes Balears, Mallorca, Spain</mods:affiliation>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Nygren, Arne</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-5761-8803</mods:nameIdentifier>
|
|
<mods:affiliation>Sjoefartmuseet Akvariet, Goeteborg, Sweden & Institutionen foer marina vetenskaper, Goeteborgs Universitet, Goeteborg, Sweden</mods:affiliation>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Parapar, Julio</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0001-7585-6995</mods:nameIdentifier>
|
|
<mods:affiliation>Departamento de Bioloxia, Universidade da Coruna, A Coruna, Spain</mods:affiliation>
|
|
</mods:name>
|
|
<mods:typeOfResource>text</mods:typeOfResource>
|
|
<mods:relatedItem type="host">
|
|
<mods:titleInfo>
|
|
<mods:title>ZooKeys</mods:title>
|
|
</mods:titleInfo>
|
|
<mods:part>
|
|
<mods:date>2022</mods:date>
|
|
<mods:detail type="pubDate">
|
|
<mods:number>2022-11-28</mods:number>
|
|
</mods:detail>
|
|
<mods:detail type="volume">
|
|
<mods:number>1132</mods:number>
|
|
</mods:detail>
|
|
<mods:extent unit="page">
|
|
<mods:start>85</mods:start>
|
|
<mods:end>126</mods:end>
|
|
</mods:extent>
|
|
</mods:part>
|
|
</mods:relatedItem>
|
|
<mods:location>
|
|
<mods:url>http://dx.doi.org/10.3897/zookeys.1132.91244</mods:url>
|
|
</mods:location>
|
|
<mods:classification>journal article</mods:classification>
|
|
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.1132.91244</mods:identifier>
|
|
<mods:identifier type="Pensoft-Pub">1313-2970-1132-85</mods:identifier>
|
|
<mods:identifier type="ZooBank">4168C32E37A74912A9094912E69030AA</mods:identifier>
|
|
<mods:identifier type="Pensoft-UUID">E57A2873FAAC552282A3E1390FF28D3E</mods:identifier>
|
|
</mods:mods>
|
|
<treatment LSID="urn:lsid:plazi:treatment:03F3107D0D365CBF87347954AD5ED893" httpUri="http://treatment.plazi.org/id/03F3107D0D365CBF87347954AD5ED893" lastPageNumber="85" pageId="0" pageNumber="85">
|
|
<subSubSection pageId="0" pageNumber="85" type="nomenclature">
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<taxonomicName LSID="03F3107D-0D36-5CBF-8734-7954AD5ED893" authority="Williams, 1984" authorityName="Williams" authorityYear="1984" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides atlantis" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">Terebellides atlantis Williams, 1984</taxonomicName>
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="description">
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<figureCitation captionStart="Figure 3" captionStartId="F3" captionText="Figure 3. STM photographs of several Terebellides species (A, C-F non-type specimens) A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 (species 1; ZMBN 116186) B Terebellides lavesquei sp. nov. (species 5; holotype, ZMBN 116322) C Terebellides atlantis Williams, 1984 (species 16; ZMBN 116472) D Terebellides irinae Gagaev, 2009 (species 24; ZMBN 116498) E Terebellides williamsae Jirkov, 1989 (species 2; ZMBN 116269) F Terebellides gracilis Malm, 1874 (species 3; ZMBN 116283). Abbreviations: bdl - branchial dorsal lobe; bf - branchial filament; bvl - branchial ventral lobe; ooc - oocytes; wTC - white thoracic chaetiger." figureDoi="10.3897/zookeys.1132.91244.figure3" httpUri="https://binary.pensoft.net/fig/775019" pageId="0" pageNumber="85">Figs 3C</figureCitation>
|
|
<figureCitation captionStart="Figure 8" captionStartId="F8" captionText="Figure 8. Terebellides atlantis Williams, 1984 (species 16; non-type specimens, ZMBN 116454 and ZMBN 116459), SEM micrographs A anterior end, left lateral view B branchiae, detail C TC 6 (TU 1), geniculate chaetae D thoracic uncini E abdominal neuropodium F abdominal uncini. Abbreviations: bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure8" httpUri="https://binary.pensoft.net/fig/775024" pageId="0" pageNumber="85">, 8</figureCitation>
|
|
<figureCitation captionStart="Figure 9" captionStartId="F9" captionText="Figure 9. Relationship between number of abdominal chaetigers and body length (complete specimens considered except for T. irinae)." figureDoi="10.3897/zookeys.1132.91244.figure9" httpUri="https://binary.pensoft.net/fig/775025" pageId="0" pageNumber="85">, 9</figureCitation>
|
|
<figureCitation captionStart="Figure 10" captionStartId="F10" captionText="Figure 10. Geographic distribution of species of Terebellides in Northeast Atlantic Ocean A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 B Terebellides lavesquei sp. nov. C Terebellides atlantis Williams, 1984 D Terebellides irinae Gagaev, 2009 E Terebellides williamsae Jirkov, 1989 F Terebellides gracilis Malm, 1874. Pink star denotes the type locality of each taxon." figureDoi="10.3897/zookeys.1132.91244.figure10" httpUri="https://binary.pensoft.net/fig/775026" pageId="0" pageNumber="85">, 10C</figureCitation>
|
|
<figureCitation captionStart="Figure 11" captionStartId="F11" captionText="Figure 11. Bathymetric distribution of Terebellides species studied in this work." figureDoi="10.3897/zookeys.1132.91244.figure11" httpUri="https://binary.pensoft.net/fig/775027" pageId="0" pageNumber="85">, 11</figureCitation>
|
|
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Body MG staining patterns in ventral view of Terebellides species. Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016, Terebellides lavesquei sp. nov., Terebellides atlantis Williams, 1984, Terebellides irinae Gagaev, 2009, Terebellides williamsae Jirkov, 1989 and Terebellides gracilis Malm, 1874. Segments indicated in Arabic numbers." figureDoi="10.3897/zookeys.1132.91244.figure12" httpUri="https://binary.pensoft.net/fig/775028" pageId="0" pageNumber="85">, 12</figureCitation>
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="reference_group">
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<taxonomicName authorityName="Williams" authorityYear="1984" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides atlantis" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">Terebellides atlantis</taxonomicName>
|
|
Williams, 1984: 121-123, fig. 4, table 1.
|
|
</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<taxonomicName authorityName="Williams" authorityYear="1984" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" higherTaxonomySource="treatment-meta" kingdom="Animalia" lsidName="Terebellides atlantis" order="Terebellida" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">Terebellides atlantis</taxonomicName>
|
|
Species 16 -
|
|
<bibRefCitation DOI="https://doi.org/10.1371/journal.pone.0198356" author="Nygren, A" journalOrPublisher="Molecular Phylogenetics and Evolution" pageId="0" pageNumber="85" refId="B26" refString="Nygren, A, Parapar, J, Pons, J, Meissner, K, Bakken, T, Kongsrud, JA, Oug, E, Gaeva, D, Sikorski, A, Johansen, RA, Hutchings, PA, Lavesque, N, Capa, M, 2018. A mega-cryptic species complex hidden among one of the most common annelids in the North-East Atlantic. PLoS ONE 13(6): e0198356. https://doi.org/10.1371/journal.pone.0198356" title="A mega-cryptic species complex hidden among one of the most common annelids in the North-East Atlantic. PLoS ONE 13 (6): e 0198356." url="https://doi.org/10.1371/journal.pone.0198356" year="2018">Nygren et al. 2018</bibRefCitation>
|
|
: 18-22, figs 6, 10.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
|
|
<paragraph pageId="0" pageNumber="85">Material examined.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<specimenCount type="generic">15 specimens</specimenCount>
|
|
(Suppl. material 1), Barents Sea (ZMBN116454, ZMBN116455, ZMBN116458, ZMBN116459, ZMBN116460, ZMBN116462, ZMBN116463, ZMBN116465, ZMBN116467, ZMBN116468, ZMBN116470, ZMBN116471, ZMBN116472, ZMBN116474); Norwegian coast (ZMBN116476).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
|
|
<paragraph pageId="0" pageNumber="85">GenBank accession numbers of material examined (COI).</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<materialsCitation accessionNumber="MG025258, MG025259, MG025260, MG025261, MG025262, MG025263, MG025264, MG025265, MG025266, MG025267, MG025268, MG025269, MG025270, MG025271, MG025272, MG025273, MG025274, MG025275, MG025276, MG025277, MG025278, MG025279, MG025280, MG025281, MG025282, MG025283, MG025284, MG025285, MG025286, MG025287, MG025288, MG025289, MG025290, MG025291, MG025292, MG025293, MG025294, MG025295, MG025296, MG025297, MG025298, MG025299, MG025300, MG025301, MG025302, MG025303, MG025304, MG025305, MG025306, MG025307, MG025308, MG025309, MG025310, MG025311, MG025312" collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" specimenCount="1">
|
|
<accessionNumber isEnumeration="true">MG025258, MG025259, MG025260, MG025261, MG025262, MG025263, MG025264, MG025265, MG025266, MG025267, MG025268, MG025269, MG025270, MG025271, MG025272, MG025273, MG025274, MG025275, MG025276, MG025277, MG025278, MG025279, MG025280, MG025281, MG025282, MG025283, MG025284, MG025285, MG025286, MG025287, MG025288, MG025289, MG025290, MG025291, MG025292, MG025293, MG025294, MG025295, MG025296, MG025297, MG025298, MG025299, MG025300, MG025301, MG025302, MG025303, MG025304, MG025305, MG025306, MG025307, MG025308, MG025309, MG025310, MG025311, MG025312</accessionNumber>
|
|
</materialsCitation>
|
|
.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="materials_examined">
|
|
<paragraph pageId="0" pageNumber="85">Diagnostic features of studied material.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
Complete individuals ranging from 10.0-16.0 mm in length (Fig.
|
|
<figureCitation captionStart="Figure 9" captionStartId="F9" captionText="Figure 9. Relationship between number of abdominal chaetigers and body length (complete specimens considered except for T. irinae)." figureDoi="10.3897/zookeys.1132.91244.figure9" httpUri="https://binary.pensoft.net/fig/775025" pageId="0" pageNumber="85">9</figureCitation>
|
|
). Branchial dorsal lobes lamellae provided with well-developed papillary projections and branchial ventral lobes (Fig.
|
|
<figureCitation captionStart="Figure 8" captionStartId="F8" captionText="Figure 8. Terebellides atlantis Williams, 1984 (species 16; non-type specimens, ZMBN 116454 and ZMBN 116459), SEM micrographs A anterior end, left lateral view B branchiae, detail C TC 6 (TU 1), geniculate chaetae D thoracic uncini E abdominal neuropodium F abdominal uncini. Abbreviations: bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure8" httpUri="https://binary.pensoft.net/fig/775024" pageId="0" pageNumber="85">8A, B</figureCitation>
|
|
) provided with long filaments (sometimes broken), 175.0
|
|
<normalizedToken originalValue="µm">µm</normalizedToken>
|
|
in length. Between 10-11 lamellae on dorsal lobes. Lateral lappets present on TC 1-4; dorsal projection of thoracic notopodia on TC 2-4 (Fig.
|
|
<figureCitation captionStart="Figure 8" captionStartId="F8" captionText="Figure 8. Terebellides atlantis Williams, 1984 (species 16; non-type specimens, ZMBN 116454 and ZMBN 116459), SEM micrographs A anterior end, left lateral view B branchiae, detail C TC 6 (TU 1), geniculate chaetae D thoracic uncini E abdominal neuropodium F abdominal uncini. Abbreviations: bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure8" httpUri="https://binary.pensoft.net/fig/775024" pageId="0" pageNumber="85">8A</figureCitation>
|
|
). Geniculate chaetae in TC 5, acutely bent, with well-defined capitium (Fig.
|
|
<figureCitation captionStart="Figure 8" captionStartId="F8" captionText="Figure 8. Terebellides atlantis Williams, 1984 (species 16; non-type specimens, ZMBN 116454 and ZMBN 116459), SEM micrographs A anterior end, left lateral view B branchiae, detail C TC 6 (TU 1), geniculate chaetae D thoracic uncini E abdominal neuropodium F abdominal uncini. Abbreviations: bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure8" httpUri="https://binary.pensoft.net/fig/775024" pageId="0" pageNumber="85">8C</figureCitation>
|
|
). Ciliated papilla dorsal to thoracic notopodia not observed. From TC 7, neuropodia with one row of
|
|
<typeStatus>type</typeStatus>
|
|
3 thoracic uncini per torus, with rostrum/capitium length ratio of ~ 2:1 and capitium with a first row of three or four medium-sized teeth, followed by several smaller teeth (Fig.
|
|
<figureCitation captionStart="Figure 8" captionStartId="F8" captionText="Figure 8. Terebellides atlantis Williams, 1984 (species 16; non-type specimens, ZMBN 116454 and ZMBN 116459), SEM micrographs A anterior end, left lateral view B branchiae, detail C TC 6 (TU 1), geniculate chaetae D thoracic uncini E abdominal neuropodium F abdominal uncini. Abbreviations: bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure8" httpUri="https://binary.pensoft.net/fig/775024" pageId="0" pageNumber="85">8D</figureCitation>
|
|
). Abdomen with 23-28 pairs of neuropodia with
|
|
<typeStatus>type</typeStatus>
|
|
2 uncini (Fig.
|
|
<figureCitation captionStart="Figure 8" captionStartId="F8" captionText="Figure 8. Terebellides atlantis Williams, 1984 (species 16; non-type specimens, ZMBN 116454 and ZMBN 116459), SEM micrographs A anterior end, left lateral view B branchiae, detail C TC 6 (TU 1), geniculate chaetae D thoracic uncini E abdominal neuropodium F abdominal uncini. Abbreviations: bf - branchial filament; bvl - branchial ventral lobe; cap - capitium; dpn - dorsal projection of notopodium; TC - thoracic chaetiger; TU - thoracic unciniger." figureDoi="10.3897/zookeys.1132.91244.figure8" httpUri="https://binary.pensoft.net/fig/775024" pageId="0" pageNumber="85">8E, F</figureCitation>
|
|
).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="colour pattern">
|
|
<paragraph pageId="0" pageNumber="85">Colour pattern.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
MG staining pattern characterised by compact green colourant in SG 1-6, J-shaped glandular region in SG 3-5 and striped pattern in SG 7-14 (Fig.
|
|
<figureCitation captionStart="Figure 12" captionStartId="F12" captionText="Figure 12. Body MG staining patterns in ventral view of Terebellides species. Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016, Terebellides lavesquei sp. nov., Terebellides atlantis Williams, 1984, Terebellides irinae Gagaev, 2009, Terebellides williamsae Jirkov, 1989 and Terebellides gracilis Malm, 1874. Segments indicated in Arabic numbers." figureDoi="10.3897/zookeys.1132.91244.figure12" httpUri="https://binary.pensoft.net/fig/775028" pageId="0" pageNumber="85">12</figureCitation>
|
|
). Similar to pattern 9.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="nucleotide diagnostic features">
|
|
<paragraph pageId="0" pageNumber="85">Nucleotide diagnostic features.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
All sequences of
|
|
<taxonomicName authorityName="Williams" authorityYear="1984" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides atlantis" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides atlantis</emphasis>
|
|
</taxonomicName>
|
|
share and are distinguished from other available
|
|
<taxonomicName class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="genus">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides</emphasis>
|
|
</taxonomicName>
|
|
sequences in unique combinations of nucleotides (underlined) at the given position of our alignment: 60-84: TATTCGTATTGAGCTAGGGCAACCT, 132-150: ACATGCATTTTTAATAATC, 171-189: TTTTATTGGTGGATTTGGT, 213-231: GGGAGCTCCTGATATAGCC, 264-294: ACTACCACCAGCCTTAATCTTATTAGTAAGC, 345-363: ATTATCTGATAATATGGCT, 384-399: CCTTGCTATTTTTTCA, 477-484: GCTACGAC, 549-573: TCCAGTCTTAGCTGGTGCAATCACT, 558-591: CCGT, 615-630: TCCAGCTGGTGGTGGT.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="type locality">
|
|
<paragraph pageId="0" pageNumber="85">Type locality.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
Atlantic Ocean, off New England,
|
|
<geoCoordinate degrees="39" direction="north" minutes="56.5" orientation="latitude" precision="92" value="39.941666">39°56.5'N</geoCoordinate>
|
|
,
|
|
<geoCoordinate degrees="70" direction="west" minutes="39.9" orientation="longitude" precision="92" value="-70.665">70°39.9'W</geoCoordinate>
|
|
(
|
|
<bibRefCitation author="Williams, SJ" editor="Hutchings, PA" journalOrPublisher="The Linnean Society of New South Wales" pageId="0" pageNumber="85" pagination="118 - 142" refId="B41" refString="Williams, SJ, 1984. The status of Terebellides stroemi (Polychaeta; Trichobranchidae) as a cosmopolitan species, based on a worldwide morphological survey, including description of new species. In: Hutchings, PA, Ed., Proceedings of the First International Polychaete Conference, Sydney, Australia, 1984. The Linnean Society of New South Wales: 118 - 142" title="The status of Terebellides stroemi (Polychaeta; Trichobranchidae) as a cosmopolitan species, based on a worldwide morphological survey, including description of new species." volumeTitle="Proceedings of the First International Polychaete Conference, Sydney, Australia, 1984." year="1984">Williams 1984</bibRefCitation>
|
|
).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="distribution">
|
|
<paragraph pageId="0" pageNumber="85">Distribution and bathymetry.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
Barents Sea, Greenland Sea, South Iceland, Norwegian coast and shelf; 219-2750 m deep (Figs
|
|
<figureCitation captionStart="Figure 10" captionStartId="F10" captionText="Figure 10. Geographic distribution of species of Terebellides in Northeast Atlantic Ocean A Terebellides shetlandica Parapar, Moreira & O'Reilly, 2016 B Terebellides lavesquei sp. nov. C Terebellides atlantis Williams, 1984 D Terebellides irinae Gagaev, 2009 E Terebellides williamsae Jirkov, 1989 F Terebellides gracilis Malm, 1874. Pink star denotes the type locality of each taxon." figureDoi="10.3897/zookeys.1132.91244.figure10" httpUri="https://binary.pensoft.net/fig/775026" pageId="0" pageNumber="85">10C</figureCitation>
|
|
,
|
|
<figureCitation captionStart="Figure 11" captionStartId="F11" captionText="Figure 11. Bathymetric distribution of Terebellides species studied in this work." figureDoi="10.3897/zookeys.1132.91244.figure11" httpUri="https://binary.pensoft.net/fig/775027" pageId="0" pageNumber="85">11</figureCitation>
|
|
, Suppl. material 1).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="85" type="remarks">
|
|
<paragraph pageId="0" pageNumber="85">Remarks.</paragraph>
|
|
<paragraph pageId="0" pageNumber="85">
|
|
<taxonomicName authorityName="Williams" authorityYear="1984" class="Polychaeta" family="Trichobranchidae" genus="Terebellides" kingdom="Animalia" lsidName="Terebellides atlantis" order="Canalipalpata" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">Terebellides atlantis</emphasis>
|
|
</taxonomicName>
|
|
is a small species, reaching up to 16 mm in length. It is characterised by the lack of papillae on margins of branchial lamellae, and by having branchiae of type 3 and filaments in ventral branchial lobes, thoracic uncini of type 3 and abdominal uncini of type 2 (Table
|
|
<tableCitation captionStart="Table 1" captionStartId="T1" captionText="Table 1. Comparison of discriminating taxonomic characters of the species studied in this work. Cells in italics show discriminatory characters of each subgroup. (1) sensu Parapar et al. (2016 a); (2) sensu Parapar et al. (2020 b); (3) sensu Parapar et al. (2020 a); (4) dominant trend in bold; (5) Skagerrak." httpUri="http://table.plazi.org/id/D35598DC856676ACF7BB2895D92EA844" pageId="0" pageNumber="85" tableUuid="D35598DC856676ACF7BB2895D92EA844">1</tableCitation>
|
|
). The most similar species to
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. atlantis" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. atlantis</emphasis>
|
|
</taxonomicName>
|
|
are
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. shetlandica" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="shetlandica">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. shetlandica</emphasis>
|
|
</taxonomicName>
|
|
and
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. lavesquei" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. lavesquei</emphasis>
|
|
</taxonomicName>
|
|
sp. nov. but
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. atlantis" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. atlantis</emphasis>
|
|
</taxonomicName>
|
|
differs from the latter in the size and type of branchiae (see remarks for
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. lavesquei" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="lavesquei">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. lavesquei</emphasis>
|
|
</taxonomicName>
|
|
sp. nov. above). Branchial lobes are often missing as previously highlighted by
|
|
<bibRefCitation DOI="https://doi.org/10.11646/zootaxa.2983.1.1" author="Parapar, J" journalOrPublisher="Zootaxa" pageId="0" pageNumber="85" pagination="1 - 20" refId="B29" refString="Parapar, J, Moreira, J, Helgason, GV, 2011. Taxonomy and distribution of Terebellides (Polychaeta, Trichobranchidae) in Icelandic waters, with the description of a new species. Zootaxa 2983 (1): 1 - 20, DOI: https://doi.org/10.11646/zootaxa.2983.1.1" title="Taxonomy and distribution of Terebellides (Polychaeta, Trichobranchidae) in Icelandic waters, with the description of a new species." url="https://doi.org/10.11646/zootaxa.2983.1.1" volume="2983" year="2011">Parapar et al. (2011)</bibRefCitation>
|
|
. Finally,
|
|
<taxonomicName class="Polychaeta" kingdom="Animalia" lsidName="T. atlantis" pageId="0" pageNumber="85" phylum="Annelida" rank="species" species="atlantis">
|
|
<emphasis italics="true" pageId="0" pageNumber="85">T. atlantis</emphasis>
|
|
</taxonomicName>
|
|
has the widest geographical distribution and depth range (219 to 2750 m) among Group B species.
|
|
</paragraph>
|
|
</subSubSection>
|
|
</treatment>
|
|
</document> |