228 lines
24 KiB
XML
228 lines
24 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/zookeys.667.6080" ID-GBIF-Dataset="7c655c4c-8d55-4f3b-a239-e822f82ba8f7" ID-PMC="PMC5523390" ID-Pensoft-Pub="1313-2970-667-155" ID-PubMed="28769639" ID-ZBK="F70AD730834E49FA9316153D3D82F5B2" ModsDocAuthor="" ModsDocDate="2017" ModsDocID="1313-2970-667-155" ModsDocOrigin="ZooKeys 667" ModsDocTitle="A new species of Oxynetra from Mexico (Hesperiidae, Pyrginae, Pyrrhopygini)" checkinTime="1491908633946" checkinUser="pensoft" docAuthor="Warren, Andrew D. & Grishin, Nick V." docDate="2017" docId="D08B5EFFB90E4CA12A392394746E3F22" docLanguage="en" docName="ZooKeys 667: 155-164" docOrigin="ZooKeys 667" docSource="http://dx.doi.org/10.3897/zookeys.667.6080" docTitle="Oxynetra aureopecta A. Warren & Grishin, sp. n." docType="treatment" docUuid="9325E7C1-E690-4E38-9709-BC83613B4D18" docUuidSource="ZooBank" docVersion="5" lastPageNumber="156" masterDocId="FFB7FF8FFFF6FFE4FF876D35FF9F716F" masterDocTitle="A new species of Oxynetra from Mexico (Hesperiidae, Pyrginae, Pyrrhopygini)" masterLastPageNumber="164" masterPageNumber="155" pageNumber="155" updateTime="1668164381600" updateUser="ExternalLinkService">
|
||
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
||
<mods:titleInfo>
|
||
<mods:title>A new species of Oxynetra from Mexico (Hesperiidae, Pyrginae, Pyrrhopygini)</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Warren, Andrew D.</mods:namePart>
|
||
</mods:name>
|
||
<mods:name type="personal">
|
||
<mods:role>
|
||
<mods:roleTerm>Author</mods:roleTerm>
|
||
</mods:role>
|
||
<mods:namePart>Grishin, Nick V.</mods:namePart>
|
||
</mods:name>
|
||
<mods:typeOfResource>text</mods:typeOfResource>
|
||
<mods:relatedItem type="host">
|
||
<mods:titleInfo>
|
||
<mods:title>ZooKeys</mods:title>
|
||
</mods:titleInfo>
|
||
<mods:part>
|
||
<mods:date>2017</mods:date>
|
||
<mods:detail type="volume">
|
||
<mods:number>667</mods:number>
|
||
</mods:detail>
|
||
<mods:extent unit="page">
|
||
<mods:start>155</mods:start>
|
||
<mods:end>164</mods:end>
|
||
</mods:extent>
|
||
</mods:part>
|
||
</mods:relatedItem>
|
||
<mods:location>
|
||
<mods:url>http://dx.doi.org/10.3897/zookeys.667.6080</mods:url>
|
||
</mods:location>
|
||
<mods:classification>journal article</mods:classification>
|
||
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.667.6080</mods:identifier>
|
||
<mods:identifier type="Pensoft-Pub">1313-2970-667-155</mods:identifier>
|
||
<mods:identifier type="ZBK">F70AD730834E49FA9316153D3D82F5B2</mods:identifier>
|
||
<mods:identifier type="ZooBank">F70AD730834E49FA9316153D3D82F5B2</mods:identifier>
|
||
</mods:mods>
|
||
<treatment ID-GBIF-Taxon="128345070" LSID="urn:lsid:zoobank.org:act:9325E7C1-E690-4E38-9709-BC83613B4D18" httpUri="http://treatment.plazi.org/id/D08B5EFFB90E4CA12A392394746E3F22" lastPageId="1" lastPageNumber="156" pageId="0" pageNumber="155">
|
||
<subSubSection pageId="0" pageNumber="155" type="nomenclature">
|
||
<paragraph pageId="0" pageNumber="155">
|
||
<taxonomicName LSID="http://zoobank.org/9325E7C1-E690-4E38-9709-BC83613B4D18" authority="A. Warren & Grishin" class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra aureopecta" order="Lepidoptera" pageId="0" pageNumber="155" phylum="Arthropoda" rank="species" species="aureopecta">Oxynetra aureopecta A. Warren & Grishin</taxonomicName>
|
||
<taxonomicNameLabel pageId="0" pageNumber="155">sp. n.</taxonomicNameLabel>
|
||
Figs 1-4, 11 part
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="155" type="description">
|
||
<paragraph pageId="0" pageNumber="155">Description.</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">Male (Figs 1-4): right forewing length 21.8 mm (holotype). Hindwing (HW) narrow and elongate; forewing (FW) extending well beyond it. Outer wing margin slightly concave at cell CuA2‒1A+2A of FW and at cells between veins M1 and M3 of HW. Dorsal and ventral FW (including fringe) brownish-black with blue-purple metallic sheen, and with a hyaline band from anterior edge of discal cell (where it is widest) to vein 1A+2A; band divided into three aligned parts by dark-scaled veins CuA1 and CuA2; its outer edge does not extend beyond the origin of vein M3; the hyaline wedge at the very base of cell M3‒CuA1 is either very small (holotype) or lacking (paratype). Dorsal HW concolorous with FW (except fringe around tornus white), with two median, large, aligned, hyaline spots in cell Sc+R1‒Rs (oval) and in discal cell (roughly triangular), separated by vein Rs, and suggesting continuation of FW band; smaller, postmedian pair of hyaline streak-like spots in proximal ends of cells M3‒CuA1 and CuA1‒CuA2; a small patch of white hair-like scales in the discal part of cell 2A-3A. Ventral HW similar to dorsal, but with wing base white and with a diffuse patch of white scales in discal part of cell CuA2‒1A+2A. Antenna black; nudum (missing on paratype) medium brown, 20 segments. Head and body primarily brownish-black with a blue-purple sheen, marked as follows: two small white spots at base of antenna and one small spot at dorsoposterior margin of eye; first and second segments of palpi orange ventrally; forecoxae orange; white patches at posterior margin of each sternite and on sides of abdomen; large orange spot on anterior half of tegula; five orange bands across terga III to VII. Genitalia not dissected. Female unknown.</paragraph>
|
||
<caption pageId="0" pageNumber="155">
|
||
<paragraph pageId="0" pageNumber="155">
|
||
Figures 1-10. Males of
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra" order="Lepidoptera" pageId="0" pageNumber="155" phylum="Arthropoda" rank="genus">Oxynetra</taxonomicName>
|
||
. 1-4
|
||
<taxonomicName lsidName="O. aureopecta" pageId="0" pageNumber="155" rank="species" species="aureopecta">O. aureopecta</taxonomicName>
|
||
sp. n. holotype (1-2) and paratype (3-4), data in text 5-6
|
||
<taxonomicName lsidName="O. hopfferi" pageId="0" pageNumber="155" rank="species" species="hopfferi">O. hopfferi</taxonomicName>
|
||
, Costa Rica: Puntarenas, Monteverde, 1997, voucher 97-ZFuentes-055 [USNM] 7-8
|
||
<taxonomicName lsidName="O. hopfferi" pageId="0" pageNumber="155" rank="species" species="hopfferi">O. hopfferi</taxonomicName>
|
||
holotype, Panama: Chiriqui [ZMHB] 9-10
|
||
<taxonomicName lsidName="O. stangelandi" pageId="0" pageNumber="155" rank="species" species="stangelandi">O. stangelandi</taxonomicName>
|
||
holotype, Costa Rica: Guanacaste, eclosed on 19.VIII.2002, voucher 02-SRNP-23284 [USNM]. Dorsal and ventral surfaces are shown on odd- and even-numbered figures, respectively. Labels are shown for the holotype of the new species and are reduced 1.5 times compared to specimens: smaller scale bar above the top labels refers to labels, and larger scale bars refer to specimens. Pinholes and some imperfections have been removed to emphasize actual wing patterns.
|
||
</paragraph>
|
||
</caption>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="155" type="barcode sequence of the holotype">
|
||
<paragraph pageId="0" pageNumber="155">Barcode sequence of the holotype.</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">Genbank Accession KT272397, voucher NVG-14113A02, 658 base pairs:</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">AACTTTATATTTTATATTTGGAATTTGAGCAGGAATAATTGGAACTTCATTAAGATTACTAATTCGAACTGAATTAGGTA</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">CCCCCGGATCTTTAATTGGAAATGATCAAATTTACAATACTATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATA</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">GTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCACCAGATATAGCTTTTCCTCG</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">TATAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGAACTGTAGAAAATGGTGTTG</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">GAACTGGATGAACAGTTTATCCCCCCCTCTCTTCTAATATTGCTCATCAAGGGGCCTCAGTTGATTTAGCTATTTTTTCT</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">CTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTT</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">ATCTTTTGATCAAATACCTCTTTTTGTATGAGCAGTAGGAATTACTGCATTACTATTATTATTATCTTTACCTGTATTAG</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">CAGGTGCTATTACTATACTTTTAACAGATCGAAATATTAATACTTCTTTTTTTGACCCAGCAGGTGGAGGAGATCCTATT</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">TTATATCAACATTTATTT</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="155" type="types">
|
||
<paragraph pageId="0" pageNumber="155">Types.</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">
|
||
Holotype ♂ (Figs 1-2) with the following four rectangular labels: white, printed and handprinted - || PUERTO DEL CABALLO, | HIDALGO, MEXICO | SEPT. 8. '87. ||; white, printed - || WILLIAM H. HOWE | COLLECTOR ||; red, printed - || HOLOTYPE ♂ |
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra aureopecta" order="Lepidoptera" pageId="0" pageNumber="155" phylum="Arthropoda" rank="species" species="aureopecta">Oxynetra aureopecta</taxonomicName>
|
||
| A. Warren & Grishin ||; white printed - || DNA sample ID: | NVG-14113A02 | c/o Nick V. Grishin ||. The holotype is in the Los Angeles County Museum of Natural History, Los Angeles, CA, USA (LACM). Paratype ♂ (Figs 3-4) from MEXICO: Veracruz, Presidio, R.
|
||
<normalizedToken originalValue="Mϋller">Mϋller</normalizedToken>
|
||
Coll., in CNIABM.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="155" type="type locality">
|
||
<paragraph pageId="0" pageNumber="155">Type locality.</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">MEXICO: Hidalgo: Puerto del Caballo, elevation about 1020 m, GPS approximately 21°10', −98°55'.</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="155" type="etymology">
|
||
<paragraph pageId="0" pageNumber="155">Etymology.</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">
|
||
The name of this new species refers to its orange
|
||
<normalizedToken originalValue="“chest”">"chest"</normalizedToken>
|
||
, including palpi beneath and forecoxae, which is the most obvious diagnostic character. The name is an adjective.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection pageId="0" pageNumber="155" type="distribution">
|
||
<paragraph pageId="0" pageNumber="155">Distribution and habitat.</paragraph>
|
||
<paragraph pageId="0" pageNumber="155">
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra aureopecta" order="Lepidoptera" pageId="0" pageNumber="155" phylum="Arthropoda" rank="species" species="aureopecta">Oxynetra aureopecta</taxonomicName>
|
||
is known only from the holotype and one paratype, both males, from Puerto del Caballo, Hidalgo, and Presidio, Veracruz, which are about 300 km from each other in eastern Mexico. Puerto del Caballo is situated at about 1020 m in the central Sierra Madre Oriental, along Hwy. 85, about 4.5 air km southwest of the San Luis
|
||
<normalizedToken originalValue="Potosí">Potosi</normalizedToken>
|
||
border. This area is comprised of cloud forest vegetation, near the transition at lower elevations to tropical deciduous forest. The Presidio, Veracruz area has been extensively modified, and very few forested areas remain; material labeled from Presidio includes species typical of tropical deciduous and cloud forest habitats. The similar
|
||
<taxonomicName lsidName="O. hopfferi" pageId="0" pageNumber="155" rank="species" species="hopfferi">O. hopfferi</taxonomicName>
|
||
and
|
||
<taxonomicName lsidName="O. stangelandi" pageId="0" pageNumber="155" rank="species" species="stangelandi">O. stangelandi</taxonomicName>
|
||
are both cloud forest denizens, the latter reported to use
|
||
<taxonomicName class="Magnoliopsida" family="Rosaceae" genus="Prunus" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Prunus annularis" order="Rosales" pageId="0" pageNumber="155" phylum="Tracheophyta" rank="species" species="annularis">Prunus annularis</taxonomicName>
|
||
(
|
||
<taxonomicName family="Rosaceae" lsidName="" pageId="0" pageNumber="155" rank="family">Rosaceae</taxonomicName>
|
||
) as a larval foodplant (
|
||
<bibRefCitation author="Grishin, NV" journalOrPublisher="Journal of the Lepidopterists' Society" pageId="1" pageNumber="156" pagination="1 - 14" title="Oxynetra: facies and DNA barcodes point to a new species from Costa Rica (Hesperiidae: Pyrginae: Pyrrhopygini)." url="https://doi.org/10.18473/lepi.v67i1.a1" volume="67" year="2013">Grishin et al. 2013</bibRefCitation>
|
||
). Various
|
||
<taxonomicName class="Magnoliopsida" family="Rosaceae" genus="Prunus" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Prunus" order="Rosales" pageId="0" pageNumber="155" phylum="Tracheophyta" rank="genus">Prunus</taxonomicName>
|
||
species are likely present in the Puerto del Caballo area, including
|
||
<taxonomicName lsidName="P. samydoides" pageId="0" pageNumber="155" rank="species" species="samydoides">P. samydoides</taxonomicName>
|
||
Schlecht.,
|
||
<taxonomicName lsidName="P. salicifolia" pageId="0" pageNumber="155" rank="species" species="salicifolia">P. salicifolia</taxonomicName>
|
||
HBK. and
|
||
<taxonomicName lsidName="P. microphylla" pageId="0" pageNumber="155" rank="species" species="microphylla">P. microphylla</taxonomicName>
|
||
(Kunth) Hemsl. (
|
||
<bibRefCitation author="Standley, PC" journalOrPublisher="Contributions from the United States National Herbaroum" pageId="2" pageNumber="157" pagination="1 - 848" title="Trees and shrubs of Mexico (Gleicheniaceae - Betulaceae)." volume="23" year="1920">Standley 1920</bibRefCitation>
|
||
, Pennington and
|
||
<normalizedToken originalValue="Sarukhán">Sarukhan</normalizedToken>
|
||
2005), which could serve as foodplants for
|
||
<taxonomicName lsidName="O. aureopecta" pageId="0" pageNumber="155" rank="species" species="aureopecta">O. aureopecta</taxonomicName>
|
||
.
|
||
</paragraph>
|
||
</subSubSection>
|
||
<subSubSection lastPageId="1" lastPageNumber="156" pageId="0" pageNumber="155" type="diagnosis">
|
||
<paragraph pageId="0" pageNumber="155">Diagnosis.</paragraph>
|
||
<paragraph lastPageId="1" lastPageNumber="156" pageId="0" pageNumber="155">
|
||
This new species belongs to
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra" order="Lepidoptera" pageId="0" pageNumber="155" phylum="Arthropoda" rank="genus">Oxynetra</taxonomicName>
|
||
because it has the traits of the genus as defined by
|
||
<bibRefCitation author="Evans, WH" journalOrPublisher="British Museum (Natural History), London" pageId="1" pageNumber="156" title="A catalogue of the American Hesperiidae indicating the classification and nomenclature adopted in the British Museum (Natural History). Part I. Introduction and Group A, Pyrrhopyginae." year="1951">Evans (1951)</bibRefCitation>
|
||
. In particular, "F end cell upright, convergent with termen at tornus" (Evans, 1951). By the COI DNA barcode, this species groups within
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra" order="Lepidoptera" pageId="0" pageNumber="155" phylum="Arthropoda" rank="genus">Oxynetra</taxonomicName>
|
||
as a sister to the
|
||
<taxonomicName lsidName="O. hopfferi" pageId="0" pageNumber="155" rank="species" species="hopfferi">O. hopfferi</taxonomicName>
|
||
and
|
||
<taxonomicName lsidName="O. stangelandi" pageId="0" pageNumber="155" rank="species" species="stangelandi">O. stangelandi</taxonomicName>
|
||
clade, in accord with similarities in appearance to these two species, and away from the
|
||
<taxonomicName lsidName="O. semihyalina" pageId="0" pageNumber="155" rank="species" species="semihyalina">O. semihyalina</taxonomicName>
|
||
and
|
||
<taxonomicName lsidName="O. confusa" pageId="0" pageNumber="155" rank="species" species="confusa">O. confusa</taxonomicName>
|
||
clade (Fig. 11). A combination of the following characters identifies males of
|
||
<taxonomicName lsidName="O. aureopecta" pageId="0" pageNumber="155" rank="species" species="aureopecta">O. aureopecta</taxonomicName>
|
||
: (1) orange
|
||
<normalizedToken originalValue="“chest”">"chest"</normalizedToken>
|
||
, i.e., forecoxae and palpi beneath (males of both
|
||
<taxonomicName lsidName="O. hopfferi" pageId="0" pageNumber="155" rank="species" species="hopfferi">O. hopfferi</taxonomicName>
|
||
and
|
||
<taxonomicName lsidName="O. stangelandi" pageId="0" pageNumber="155" rank="species" species="stangelandi">O. stangelandi</taxonomicName>
|
||
have white forecoxae and palpi); (2) no postdiscal white spot on ventral hindwing in cell CuA2-2A (the other two species possess this white spot in addition to the discal spot in that cell); (3) narrower forewing hyaline band barely extending distad the base of M3-CuA1 cell, and very small (or lacking) spot at the base
|
||
<pageBreakToken pageId="1" pageNumber="156" start="start">of</pageBreakToken>
|
||
this cell (the band prominently extends distad of M3-CuA1 cell and the hyaline spot at the base of this cell is more prominent in the other two species); (4) longer (and narrower), streak-like spots in hindwing cells M3-CuA1 and CuA1-CuA2 (the spots, in particular the one in cell CuA1-CuA2, are rounder in the other two species); (5) five orange bands on the abdomen above, similarly to
|
||
<taxonomicName lsidName="O. hopfferi" pageId="1" pageNumber="156" rank="species" species="hopfferi">O. hopfferi</taxonomicName>
|
||
(only a single complete band is present in
|
||
<taxonomicName lsidName="O. stangelandi" pageId="1" pageNumber="156" rank="species" species="stangelandi">O. stangelandi</taxonomicName>
|
||
, Fig. 9); (6) a weakly developed white streak of a few hair-like scales near the anal fold on dorsal hindwing (the streak is absent in
|
||
<taxonomicName lsidName="O. stangelandi" pageId="1" pageNumber="156" rank="species" species="stangelandi">O. stangelandi</taxonomicName>
|
||
, Fig. 9, but is well-defined in
|
||
<taxonomicName lsidName="O. hopfferi" pageId="1" pageNumber="156" rank="species" species="hopfferi">O. hopfferi</taxonomicName>
|
||
, Figs 5, 7); (7) DNA COI barcode 6.1% and 4.7% different from that of
|
||
<taxonomicName lsidName="O. hopfferi" pageId="1" pageNumber="156" rank="species" species="hopfferi">O. hopfferi</taxonomicName>
|
||
and
|
||
<taxonomicName lsidName="O. stangelandi" pageId="1" pageNumber="156" rank="species" species="stangelandi">O. stangelandi</taxonomicName>
|
||
, respectively. Characters (1) and (3) appear to be the most easily observed. The female of
|
||
<taxonomicName lsidName="O. aureopecta" pageId="1" pageNumber="156" rank="species" species="aureopecta">O. aureopecta</taxonomicName>
|
||
is unknown but may be mostly black similar to females of the other two species.
|
||
</paragraph>
|
||
<caption pageId="1" pageNumber="156">
|
||
<paragraph pageId="1" pageNumber="156">
|
||
Figure 11. COI DNA barcode trees of
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra" order="Lepidoptera" pageId="1" pageNumber="156" phylum="Arthropoda" rank="genus">Oxynetra</taxonomicName>
|
||
species. The trees are obtained by a RAxML under
|
||
<normalizedToken originalValue="“GTRGAMMA”">"GTRGAMMA"</normalizedToken>
|
||
model; and b MrBayes under
|
||
<normalizedToken originalValue="“propinv”">"propinv"</normalizedToken>
|
||
model with 2 states (see Materials and Methods) and show identical topology. The taxa are arranged in the same sequence in both trees. The trees are rooted with
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Olafia" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Olafia" order="Lepidoptera" pageId="1" pageNumber="156" phylum="Arthropoda" rank="genus">Olafia</taxonomicName>
|
||
<normalizedToken originalValue="Nemésio">Nemesio</normalizedToken>
|
||
, 2005 sequences. Bootstrap fractions (a) and posterior probabilities (b) are shown (except for nodes within species). Sequences with NVG- voucher codes were obtained in this work. For other sequences, ACG voucher codes (with -SRNP- and -ZFuentes-, Janzen & Hallwachs 2014), INBio voucher codes (starting with INB,
|
||
<bibRefCitation author="Grishin, NV" journalOrPublisher="Journal of the Lepidopterists' Society" pageId="1" pageNumber="156" pagination="1 - 14" title="Oxynetra: facies and DNA barcodes point to a new species from Costa Rica (Hesperiidae: Pyrginae: Pyrrhopygini)." url="https://doi.org/10.18473/lepi.v67i1.a1" volume="67" year="2013">Grishin et al. 2013</bibRefCitation>
|
||
), GenBank accessions (starting from GU and HM, http://genbank.gov/), or Ernst Brockmann collection voucher codes (with HESP-EB) are indicated for each sequence. The general locality of each specimen is indicated.
|
||
</paragraph>
|
||
</caption>
|
||
</subSubSection>
|
||
<subSubSection pageId="1" pageNumber="156" type="discussion">
|
||
<paragraph pageId="1" pageNumber="156">Discussion.</paragraph>
|
||
<paragraph pageId="1" pageNumber="156">
|
||
The description of
|
||
<taxonomicName lsidName="O. aureopecta" pageId="1" pageNumber="156" rank="species" species="aureopecta">O. aureopecta</taxonomicName>
|
||
adds a fifth species to
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra" order="Lepidoptera" pageId="1" pageNumber="156" phylum="Arthropoda" rank="genus">Oxynetra</taxonomicName>
|
||
, and confirms the occurrence of the genus in Mexico. While the damaged paratype specimen in CNIABM has been examined by many researchers, its authenticity has been questioned since it was apparently the only specimen of the genus labeled from Mexico (
|
||
<bibRefCitation author="De la Maza, J" journalOrPublisher="Revista de la Sociedad Mexicana de Lepidopterologia" pageId="1" pageNumber="156" pagination="3 - 44" title="La fauna de mariposas de Mexico. Part II. Hesperioidea (Lepidoptera: Rhopalocera)." volume="14" year="1991">De la Maza et al. 1991</bibRefCitation>
|
||
,
|
||
<bibRefCitation pageId="1" pageNumber="156">Warren 2000</bibRefCitation>
|
||
). Thus, the discovery of the holotype specimen in the LACM, in much better condition than the paratype-and nearly identical in appearance-confirms the provenance of
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra" order="Lepidoptera" pageId="1" pageNumber="156" phylum="Arthropoda" rank="genus">Oxynetra</taxonomicName>
|
||
in Mexico. Based on the known distribution of
|
||
<taxonomicName lsidName="O. aureopecta" pageId="1" pageNumber="156" rank="species" species="aureopecta">O. aureopecta</taxonomicName>
|
||
in cloud forest habitats of the Sierra Madre Oriental, we suspect that the species might be endemic to Mexico.
|
||
</paragraph>
|
||
<paragraph pageId="1" pageNumber="156">
|
||
However,
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra" order="Lepidoptera" pageId="1" pageNumber="156" phylum="Arthropoda" rank="genus">Oxynetra</taxonomicName>
|
||
species remain unknown from Guatemala, El Salvador, Honduras and Nicaragua. Given the rarity of species in the
|
||
<taxonomicName lsidName="hopfferi" pageId="1" pageNumber="156" rank="species" species="hopfferi">hopfferi</taxonomicName>
|
||
group- the only group of the genus thus far known to occur in Mesoamerica, it may be that the genus has merely gone undetected in those countries (significant rearing efforts were necessary to detect the presence of
|
||
<taxonomicName lsidName="O. stangelandi" pageId="1" pageNumber="156" rank="species" species="stangelandi">O. stangelandi</taxonomicName>
|
||
in northwestern Costa Rica). Therefore, much more fieldwork must be conducted before the overall distributions of
|
||
<taxonomicName class="Insecta" family="Hesperiidae" genus="Oxynetra" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Oxynetra" order="Lepidoptera" pageId="1" pageNumber="156" phylum="Arthropoda" rank="genus">Oxynetra</taxonomicName>
|
||
species in Mesoamerica can be defined.
|
||
</paragraph>
|
||
</subSubSection>
|
||
</treatment>
|
||
</document> |