200 lines
20 KiB
XML
200 lines
20 KiB
XML
<document ID-DOI="http://dx.doi.org/10.3897/BDJ.10.e96003" ID-Pensoft-Pub="1314-2828-10-e96003" ID-Pensoft-UUID="76077326AB2251039D2C380A594EDA2A" ID-ZooBank="2A9D4A67DC0040DC9745BF531D767F55" ModsDocID="1314-2828-10-e96003" checkinTime="1670952459602" checkinUser="pensoft" docAuthor="Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan" docDate="2022" docId="C5E9E60CA6685AE7A9FF89D05F8A8027" docLanguage="en" docName="BiodivDatJour 10: e96003" docOrigin="Biodiversity Data Journal 10" docPubDate="2022-12-12" docSource="http://dx.doi.org/10.3897/BDJ.10.e96003" docTitle="Amauropelma krabi S. Li & Yao 2022, sp. n." docType="treatment" docVersion="1" id="76077326AB2251039D2C380A594EDA2A" lastPageNumber="96003" masterDocId="76077326AB2251039D2C380A594EDA2A" masterDocTitle="Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia" masterLastPageNumber="96003" masterPageNumber="96003" pageNumber="96003" updateTime="1670952459602" updateUser="pensoft">
|
|
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
|
|
<mods:titleInfo>
|
|
<mods:title>Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia</mods:title>
|
|
</mods:titleInfo>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Chu, Chang</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0003-3520-5463</mods:nameIdentifier>
|
|
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Lu, Ying</mods:namePart>
|
|
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Li, Shuqiang</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-3290-5416</mods:nameIdentifier>
|
|
<mods:affiliation>Institute of Zoology, Chinese Academy of Sciences, Beijing, China</mods:affiliation>
|
|
</mods:name>
|
|
<mods:name type="personal">
|
|
<mods:role>
|
|
<mods:roleTerm>Author</mods:roleTerm>
|
|
</mods:role>
|
|
<mods:namePart>Yao, Zhiyuan</mods:namePart>
|
|
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-1631-0949</mods:nameIdentifier>
|
|
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
|
|
<mods:nameIdentifier type="email">yaozy@synu.edu.cn</mods:nameIdentifier>
|
|
</mods:name>
|
|
<mods:typeOfResource>text</mods:typeOfResource>
|
|
<mods:relatedItem type="host">
|
|
<mods:titleInfo>
|
|
<mods:title>Biodiversity Data Journal</mods:title>
|
|
</mods:titleInfo>
|
|
<mods:part>
|
|
<mods:date>2022</mods:date>
|
|
<mods:detail type="pubDate">
|
|
<mods:number>2022-12-12</mods:number>
|
|
</mods:detail>
|
|
<mods:detail type="volume">
|
|
<mods:number>10</mods:number>
|
|
</mods:detail>
|
|
<mods:extent unit="page">
|
|
<mods:start>96003</mods:start>
|
|
<mods:end>96003</mods:end>
|
|
</mods:extent>
|
|
</mods:part>
|
|
</mods:relatedItem>
|
|
<mods:location>
|
|
<mods:url>http://dx.doi.org/10.3897/BDJ.10.e96003</mods:url>
|
|
</mods:location>
|
|
<mods:classification>journal article</mods:classification>
|
|
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.10.e96003</mods:identifier>
|
|
<mods:identifier type="Pensoft-Pub">1314-2828-10-e96003</mods:identifier>
|
|
<mods:identifier type="ZooBank">2A9D4A67DC0040DC9745BF531D767F55</mods:identifier>
|
|
<mods:identifier type="Pensoft-UUID">76077326AB2251039D2C380A594EDA2A</mods:identifier>
|
|
</mods:mods>
|
|
<treatment LSID="urn:lsid:plazi:treatment:C5E9E60CA6685AE7A9FF89D05F8A8027" httpUri="http://treatment.plazi.org/id/C5E9E60CA6685AE7A9FF89D05F8A8027" lastPageNumber="96003" pageId="0" pageNumber="96003">
|
|
<subSubSection pageId="0" pageNumber="96003" type="nomenclature">
|
|
<paragraph pageId="0" pageNumber="96003">
|
|
<taxonomicName LSID="C5E9E60C-A668-5AE7-A9FF-89D05F8A8027" authority="S. Li & Yao" authorityName="S. Li & Yao" authorityYear="2022" class="Arachnida" family="Ctenidae" genus="Amauropelma" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Amauropelma krabi" order="Araneae" pageId="0" pageNumber="96003" phylum="Arthropoda" rank="species" species="krabi" status="sp. n.">Amauropelma krabi S. Li & Yao</taxonomicName>
|
|
<taxonomicNameLabel pageId="0" pageNumber="96003">sp. n.</taxonomicNameLabel>
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="96003" type="materials_examined">
|
|
<paragraph pageId="0" pageNumber="96003">Materials</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">
|
|
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectorName="Occurrence, Z. Chen" country="Thailand" county="Taxon" elevation="0" latitude="8.3378" location="Ctenidae" longLatPrecision="1" longitude="98.74512" municipality="Araneae" pageId="0" pageNumber="96003" specimenCount="1" specimenCount-female="1" stateProvince="Krabi" typeStatus="Holotype">
|
|
<emphasis bold="true" pageId="0" pageNumber="96003">Type status:</emphasis>
|
|
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectorName="Occurrence, Z. Chen" country="Thailand" county="Taxon" elevation="0" latitude="8.3378" location="Ctenidae" longLatPrecision="1" longitude="98.74512" municipality="Araneae" specimenCount="1" specimenCount-female="1" stateProvince="Krabi" typeStatus="Holotype">
|
|
<typeStatus pageId="0" pageNumber="96003">Holotype</typeStatus>
|
|
.
|
|
<emphasis bold="true" pageId="0" pageNumber="96003">
|
|
<collectorName>Occurrence</collectorName>
|
|
:
|
|
</emphasis>
|
|
recordedBy:
|
|
<collectorName pageId="0" pageNumber="96003">Z. Chen</collectorName>
|
|
; individualCount:
|
|
<specimenCount pageId="0" pageNumber="96003" type="generic">1</specimenCount>
|
|
; sex:
|
|
<specimenType pageId="0" pageNumber="96003">female</specimenType>
|
|
; lifeStage:
|
|
<specimenType pageId="0" pageNumber="96003">adult</specimenType>
|
|
;
|
|
<emphasis bold="true" pageId="0" pageNumber="96003">
|
|
<collectingCounty>Taxon</collectingCounty>
|
|
:
|
|
</emphasis>
|
|
order:
|
|
<collectingMunicipality>Araneae</collectingMunicipality>
|
|
; family:
|
|
<location LSID="urn:lsid:plazi:treatment:C5E9E60CA6685AE7A9FF89D05F8A8027:F1158FADC5B40B5B33971C992BB9D59D" country="Thailand" county="Taxon" latitude="8.3378" longLatPrecision="1" longitude="98.74512" municipality="Araneae" name="Ctenidae" stateProvince="Krabi">Ctenidae</location>
|
|
; genus:
|
|
<location LSID="urn:lsid:plazi:treatment:C5E9E60CA6685AE7A9FF89D05F8A8027:45966CECA5C6E313C5EF885984D55C96" country="Thailand" county="Taxon" latitude="8.3378" longLatPrecision="1" longitude="98.74512" municipality="Araneae" name="Amauropelma" stateProvince="Krabi">Amauropelma</location>
|
|
;
|
|
<emphasis bold="true" pageId="0" pageNumber="96003">
|
|
<location LSID="urn:lsid:plazi:treatment:C5E9E60CA6685AE7A9FF89D05F8A8027:6A3194626E11E49B71B4E6300FDE5A4C" country="Thailand" county="Taxon" latitude="8.3378" longLatPrecision="1" longitude="98.74512" municipality="Araneae" name="Location" stateProvince="Krabi">Location</location>
|
|
:
|
|
</emphasis>
|
|
country:
|
|
<collectingCountry name="Thailand" pageId="0" pageNumber="96003">Thailand</collectingCountry>
|
|
; stateProvince:
|
|
<collectingRegion country="Thailand" name="Krabi">Krabi</collectingRegion>
|
|
; verbatimLocality:
|
|
<location LSID="urn:lsid:plazi:treatment:C5E9E60CA6685AE7A9FF89D05F8A8027:D162A507F7F428D1F4278BFAFA29B1BD" country="Thailand" county="Taxon" latitude="8.3378" longLatPrecision="1" longitude="98.74512" municipality="Araneae" name="Ao Luk District" stateProvince="Krabi">Ao Luk District</location>
|
|
,
|
|
<location LSID="urn:lsid:plazi:treatment:C5E9E60CA6685AE7A9FF89D05F8A8027:D999A1C3CCBDEE42163D52A97D9A0E3B" country="Thailand" county="Taxon" latitude="8.3378" longLatPrecision="1" longitude="98.74512" municipality="Araneae" name="Klang Cave" stateProvince="Krabi">Klang Cave</location>
|
|
; verbatimElevation:
|
|
<elevation metricMagnitude="1" metricUnit="m" metricValue="3.6" pageId="0" pageNumber="96003" unit="m" value="36.0">
|
|
<quantity metricMagnitude="1" metricUnit="m" metricValue="3.6" unit="m" value="36.0">36 m</quantity>
|
|
a.s.l.
|
|
</elevation>
|
|
; verbatimLatitude:
|
|
<geoCoordinate degrees="8" direction="north" minutes="20.268" orientation="latitude" precision="1" value="8.3378">8°20.268'N</geoCoordinate>
|
|
; verbatimLongitude:
|
|
<geoCoordinate degrees="98" direction="east" minutes="44.707" orientation="longitude" precision="1" value="98.74512">98°44.707'E</geoCoordinate>
|
|
;
|
|
<emphasis bold="true" pageId="0" pageNumber="96003">Event:</emphasis>
|
|
year: 2015; month: 10; day: 12;
|
|
<emphasis bold="true" pageId="0" pageNumber="96003">Record Level:</emphasis>
|
|
institutionCode: IZCAS-Ar 43530
|
|
</materialsCitation>
|
|
</materialsCitation>
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="96003" type="description">
|
|
<paragraph pageId="0" pageNumber="96003">Description</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">
|
|
<emphasis bold="true" pageId="0" pageNumber="96003">Male</emphasis>
|
|
</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">Unknown.</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">
|
|
<emphasis bold="true" pageId="0" pageNumber="96003">Female</emphasis>
|
|
(IZCAS-Ar 43530): PL 3.3, PW 2.4, AW 1.6, OL 3.1, OW 1.6. Eye diameters and interdistances: AME 0.10, ALE 0.13, PME 0.11, PLE 0.11, AME-AME 0.04, AME-ALE 0.11, PME-PME 0.06, PME-PLE 0.24, AME-PME 0.06, ALE-PLE 0.08, clypeus AME 0.12, clypeus ALE 0.17. Palp and leg measurements: palp 3.8 (1.3, 0.7, 0.8, -, 1.0), I 10.3 (2.8, 1.6, 2.8, 2.1, 1.0), II 9.2 (2.4, 1.4, 2.4, 2.0, 1.0), III 9.0 (2.4, 1.3, 2.0, 2.2, 1.1), IV 12.2 (3.1, 1.4, 2.9, 3.5, 1.3). Leg formula 4123. Spination of palp and legs: palp 130, 100, 1111, 1212; femora I p002, d111, r010, II p010, d111, r010, III p111, d111, r012, IV p002, d111, r102; patellae I-IV 001; tibiae I-II v22222, III p11, d111, r11, v222, IV p111, d11, r11, v222; metatarsi I-II v222, III p112, d010, r112, v222, IV p112, r112, v222. Chelicerae with 3 promarginal, 4 + 1 retromarginal teeth, without denticles. Retromargin of chelicerae close to fang base without bristle. Tarsi and metatarsi without scopula. Claw tufts arising separately, but intermingle with each other distally. Palpal claw with 3 secondary teeth, leg claws I-II with 3, III with 2 and IV with 3 secondary teeth. Position of tarsal organ: I 0.76, II 0.72, III 0.68.
|
|
</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">
|
|
Copulatory organ (Fig.
|
|
<figureCitation captionStart="Figure 2" captionStartId="F8184118" captionText="Figure 2. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 1.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure2" httpUri="https://binary.pensoft.net/fig/768849" pageId="0" pageNumber="96003">2</figureCitation>
|
|
a, b, Fig.
|
|
<figureCitation captionStart="Figure 3" captionStartId="F8221026" captionText="Figure 3. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b)." figureDoi="10.3897/BDJ.10.e96003.figure3" httpUri="https://binary.pensoft.net/fig/768850" pageId="0" pageNumber="96003">3</figureCitation>
|
|
a and b). Epigynal plate width/length: 9.8/6.5; anterior width/posterior width: 9.8/7.5; heart-shaped and with a mating plug, the anterior part with a pair of pointed apophyses ventrally. Lateral teeth pointing postero-medially. Internal duct system with small oval spermathecae not fully visible, separated from each other by more than their diameter; fertilisation ducts elongate and laminar, pointing postero-medially.
|
|
</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">
|
|
Colour (Fig.
|
|
<figureCitation captionStart="Figure 2" captionStartId="F8184118" captionText="Figure 2. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 1.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure2" httpUri="https://binary.pensoft.net/fig/768849" pageId="0" pageNumber="96003">2</figureCitation>
|
|
c and d). Reddish-brown to yellowish without patterns. Dorsal prosoma slightly reddish-brown to yellowish, with eyes marked with black rings, fovea distinct, reddish-brown. Chelicerae reddish-brown. Sternum, ventral coxae, labium yellowish-brown without patterns. Gnathocoxae yellowish-brown with lighter distal lips. Legs yellowish-brown. Opisthosoma yellowish. Spinnerets yellowish.
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="96003" type="diagnosis">
|
|
<paragraph pageId="0" pageNumber="96003">Diagnosis</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">
|
|
Small
|
|
<taxonomicName class="Arachnida" family="Ctenidae" kingdom="Animalia" lsidName="" order="Araneae" pageId="0" pageNumber="96003" phylum="Arthropoda" rank="family">Ctenidae</taxonomicName>
|
|
(total length female 6.4). The new species can be distinguished from all known congeners by the median plate roughly heart-shaped and with a mating plug (Fig.
|
|
<figureCitation captionStart="Figure 2" captionStartId="F8184118" captionText="Figure 2. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 1.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure2" httpUri="https://binary.pensoft.net/fig/768849" pageId="0" pageNumber="96003">2</figureCitation>
|
|
a and Fig.
|
|
<figureCitation captionStart="Figure 3" captionStartId="F8221026" captionText="Figure 3. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b)." figureDoi="10.3897/BDJ.10.e96003.figure3" httpUri="https://binary.pensoft.net/fig/768850" pageId="0" pageNumber="96003">3</figureCitation>
|
|
a), by the anterior part of median plate with a pair of pointed apophyses ventrally (arrowed in Fig.
|
|
<figureCitation captionStart="Figure 2" captionStartId="F8184118" captionText="Figure 2. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 1.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure2" httpUri="https://binary.pensoft.net/fig/768849" pageId="0" pageNumber="96003">2</figureCitation>
|
|
a, arrowed in Fig.
|
|
<figureCitation captionStart="Figure 3" captionStartId="F8221026" captionText="Figure 3. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b)." figureDoi="10.3897/BDJ.10.e96003.figure3" httpUri="https://binary.pensoft.net/fig/768850" pageId="0" pageNumber="96003">3</figureCitation>
|
|
a), by the internal duct system with small oval spermathecae not fully visible (Fig.
|
|
<figureCitation captionStart="Figure 2" captionStartId="F8184118" captionText="Figure 2. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 1.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure2" httpUri="https://binary.pensoft.net/fig/768849" pageId="0" pageNumber="96003">2</figureCitation>
|
|
b and Fig.
|
|
<figureCitation captionStart="Figure 3" captionStartId="F8221026" captionText="Figure 3. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b)." figureDoi="10.3897/BDJ.10.e96003.figure3" httpUri="https://binary.pensoft.net/fig/768850" pageId="0" pageNumber="96003">3</figureCitation>
|
|
b) and by the fertilisation ducts which are elongate and laminar, almost twice as long as the spermathecae (Fig.
|
|
<figureCitation captionStart="Figure 2" captionStartId="F8184118" captionText="Figure 2. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view; c: Habitus, dorsal view; d: Habitus, ventral view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 1.0 mm (c, d)." figureDoi="10.3897/BDJ.10.e96003.figure2" httpUri="https://binary.pensoft.net/fig/768849" pageId="0" pageNumber="96003">2</figureCitation>
|
|
b and Fig.
|
|
<figureCitation captionStart="Figure 3" captionStartId="F8221026" captionText="Figure 3. Amauropelma krabi sp. n., holotype female. a: Epigyne, ventral view, arrow points at pointed apophysis; b: Vulva, dorsal view. FD = fertilisation duct, IF = internal fold, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b)." figureDoi="10.3897/BDJ.10.e96003.figure3" httpUri="https://binary.pensoft.net/fig/768850" pageId="0" pageNumber="96003">3</figureCitation>
|
|
b).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="96003" type="etymology">
|
|
<paragraph pageId="0" pageNumber="96003">Etymology</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">The specific name refers to the type locality and is a noun in apposition.</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="96003" type="distribution">
|
|
<paragraph pageId="0" pageNumber="96003">Distribution</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">
|
|
Thailand (Krabi, type locality; Fig.
|
|
<figureCitation captionStart="Figure 1" captionStartId="F8184120" captionText="Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n." figureDoi="10.3897/BDJ.10.e96003.figure1" httpUri="https://binary.pensoft.net/fig/770652" pageId="0" pageNumber="96003">1</figureCitation>
|
|
).
|
|
</paragraph>
|
|
</subSubSection>
|
|
<subSubSection pageId="0" pageNumber="96003" type="dna barcode">
|
|
<paragraph pageId="0" pageNumber="96003">DNA Barcode</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">Female (IZCAS-Ar 43530):</paragraph>
|
|
<paragraph pageId="0" pageNumber="96003">TGTTTGGAGCTTGAGCTGCTATAGCAGGAACTGGAATAAGAGTGTTGATTCGAATAGAGTTAGGTCATCCTGGTAGATTGTTAGGAGATGATCATTTATATAATGTTATTGTAACTGCTCATGCTTTTGTAATGATTTTTTTTATAGTAATACCAATTTTGATTGGTGGATTTGGAAATTGATTAGTTCCGTTGAGATTGGAGCACCTGATATATCATTTCCTCGAATAAATAATTTGTCGTTTTGATTACTACCTCCTTCTTTATTTTTATTAATAATATCATCAATAGTAGAAATAGGTGTTGGAGCGGGATGAACTGTTTATCCTCCTTTAGCATCTAGTATTGGGCATATAGGAAGATCTATAGATTTTGCTATTTTTTCTCTTCATTTGGCTGGAGCTTCTTCTATTATAGGAGCAGTAAATTTTATTTCTACTATTATTAATATACGGTTGTATGGAATGAGTATAGAAAAGGTTCCTTTGTTTGTGTGGTCTGTTTTTATTACTGCTATTTTGTTATTATTGTCGTTACCTGTGTTAGCAGGTGCTATTACTATATTATTGACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCGGGAGGGGGAGATCCTATTTTGTTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP561682).</paragraph>
|
|
</subSubSection>
|
|
</treatment>
|
|
</document> |