treatments-xml/data/C5/75/A3/C575A3423350B2EB56556E02A23B7179.xml
2024-06-21 12:50:59 +02:00

190 lines
21 KiB
XML
Raw Permalink Blame History

This file contains ambiguous Unicode characters

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

<document ID-DOI="http://dx.doi.org/10.3897/zookeys.375.6222" ID-GBIF-Dataset="89f16d40-bb9c-4b0f-b2e6-f08e88f0fb9a" ID-PMC="PMC3921562" ID-Pensoft-Pub="1313-2970-375-15" ID-PubMed="24526844" ID-ZBK="8BCC6418E8CD470A8A1A57CC67822F53" ModsDocAuthor="" ModsDocDate="2014" ModsDocID="1313-2970-375-15" ModsDocOrigin="ZooKeys 375" ModsDocTitle="Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae)" checkinTime="1451246388436" checkinUser="pensoft" docAuthor="Leger, Theo, Landry, Bernard, Nuss, Matthias &amp; Mally, Richard" docDate="2014" docId="C575A3423350B2EB56556E02A23B7179" docLanguage="en" docName="ZooKeys 375: 15-73" docOrigin="ZooKeys 375" docSource="http://dx.doi.org/10.3897/zookeys.375.6222" docTitle="Catharylla coronata T. Leger &amp; B. Landry, sp. n." docType="treatment" docUuid="7E0EB0BE-44C4-42EC-9F4D-2C923E9299E6" docUuidSource="ZooBank" docVersion="4" lastPageNumber="41" masterDocId="9036FFB11B3EFFAFA138FFCA1A5BFFCE" masterDocTitle="Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae)" masterLastPageNumber="73" masterPageNumber="15" pageNumber="38" updateTime="1668157587888" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Systematics of the Neotropical genus Catharylla Zeller (Lepidoptera, Pyralidae s. l., Crambinae)</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Leger, Theo</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Landry, Bernard</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Nuss, Matthias</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Mally, Richard</mods:namePart>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>ZooKeys</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2014</mods:date>
<mods:detail type="volume">
<mods:number>375</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>15</mods:start>
<mods:end>73</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/zookeys.375.6222</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/zookeys.375.6222</mods:identifier>
<mods:identifier type="Pensoft-Pub">1313-2970-375-15</mods:identifier>
<mods:identifier type="ZBK">8BCC6418E8CD470A8A1A57CC67822F53</mods:identifier>
<mods:identifier type="ZooBank">8BCC6418E8CD470A8A1A57CC67822F53</mods:identifier>
</mods:mods>
<treatment ID-GBIF-Taxon="152050782" LSID="urn:lsid:zoobank.org:act:7E0EB0BE-44C4-42EC-9F4D-2C923E9299E6" httpUri="http://treatment.plazi.org/id/C575A3423350B2EB56556E02A23B7179" lastPageId="26" lastPageNumber="41" pageId="23" pageNumber="38">
<subSubSection pageId="23" pageNumber="38" type="nomenclature">
<paragraph pageId="23" pageNumber="38">
<taxonomicName LSID="http://zoobank.org/7E0EB0BE-44C4-42EC-9F4D-2C923E9299E6" authority="T. Leger &amp; B. Landry" class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="23" pageNumber="38" phylum="Arthropoda" rank="species" species="coronata">
Catharylla coronata T.
<normalizedToken originalValue="Léger">Leger</normalizedToken>
&amp; B. Landry
</taxonomicName>
<taxonomicNameLabel pageId="23" pageNumber="38">sp. n.</taxonomicNameLabel>
Figs 5, 19, 20, 38, 45
</paragraph>
</subSubSection>
<subSubSection lastPageId="24" lastPageNumber="39" pageId="23" pageNumber="38" type="type material">
<paragraph pageId="23" pageNumber="38">Type material.</paragraph>
<paragraph pageId="23" pageNumber="38">
Holotype. ♂, with labels as follows: &quot;Col. BECKER | 81552&quot;; &quot;BRASIL:ES | Linhares, 40m | 20-29.ii.1992 | V.O.Becker Col&quot;; &quot;HOLOTYPE | Catharylla | coronata |
<normalizedToken originalValue="Léger">Leger</normalizedToken>
&amp; Landry&quot; [red label]. Deposited in Becker Collection.
</paragraph>
<paragraph pageId="23" pageNumber="38">
Paratypes. 21 ♂, 4 ♀. BRAZIL: 5 ♂ with same data as holotype (1 used for DNA barcoding BC MTD 01890, 1 with genitalia on slide BL 1743); 2 ♂ with same data as holotype (1 used for DNA barcoding BC MTD 01891) except 05-09.iv.1992 (V. O. Becker n°82486); 6 ♂, 1 ♀ (1 ♂ with genitalia on slide BL 1730, ♀ with genitalia on slide BL 1731),
<normalizedToken originalValue="Paranà">Parana</normalizedToken>
, Rio Negro, 900 m, 8.ii.1973 (2 ♂), 10.ii.1973 (1 ♂), 11.ii.1973 (3 ♂), 13.ii.1973 (1 ♀) (A. &amp; J. Razowski) (ISZP); 2 ♂, 2 ♀,
<normalizedToken originalValue="Paranà">Parana</normalizedToken>
, Curitiba, 920 m, 17.ii.1975 (1 ♂) (V. O. Becker n°10167), 20.ii.1975 (1 ♀, genitalia on slide BL 1756) (V. O. Becker n°10168), 12.iii.1975 (1 ♀, genitalia on slide BL 1753) (V. O. Becker n°10166), 10.x.1975 (1 ♂) (V. O. Becker n°4010) (Becker Coll.); 1 ♂ (genitalia on
<taxonomicName family="Pyralidae" lsidName="" pageId="23" pageNumber="38" rank="family">Pyralidae</taxonomicName>
Brit. Mus. Slide No. 11357),
<normalizedToken originalValue="Paranà">Parana</normalizedToken>
, Castro, 950 m (E. D. Jones) (BMNH); 1 ♂,
<normalizedToken originalValue="Paranà">Parana</normalizedToken>
, Quatro Barras, 850 m, 27.ii.1970 (Laroca &amp; Becker) (V. O. Becker n°15442) (Becker Coll.); 1 ♂ (genitalia on
<taxonomicName family="Pyralidae" lsidName="" pageId="23" pageNumber="38" rank="family">Pyralidae</taxonomicName>
Brit. Mus. Slide No. 11337) Rio de Janeiro, Novo Friburgo (BMNH); 1 ♂ (genitalia on
<taxonomicName family="Pyralidae" lsidName="" pageId="23" pageNumber="38" rank="family">Pyralidae</taxonomicName>
Brit. Mus. Slide. No. 19019) Sao Paulo, 700 m (E. D. Jones) (BMNH); 1 ♂, 1 ♀ (♂ with genitalia on slide BL 1774, ♀ with genitalia on slide BL 1736), Santa Catarina, Rio Vermelho, 968 m, 18.ii.1973 (♂), 28. ii. 1973 (♀) (A. &amp; J. Razowski) (ISZP); 1 ♂, no locality data (V. O. Becker) (Becker Coll.).
</paragraph>
<paragraph pageId="24" pageNumber="39">
<pageBreakToken pageId="24" pageNumber="39" start="start">COI</pageBreakToken>
barcode sequence of paratype BC MTD 01890 (654 bp): ACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATCTCTTATTGGAGATGATCAAATCTATAATACTATTGTAACCGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTTCCCTTAATATTAGGAGCACCAGATATAGCTTTTCCTCGAATAAATAACATAAGATTTTGATTATTACCCCCCTCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATAGTGGAAGATCCGTAGATTTAGCAATCTTTTCCCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATCAATAATCTTTCATTTGATCAAATACCTCTTTTTGTTTGATCAGTAGGAATTACAGCTTTACTTCTTCTTTTATCATTACCAGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCCGCAGGAGGAGGAGATCCTATTTTATATCAACATTTA
</paragraph>
</subSubSection>
<subSubSection pageId="24" pageNumber="39" type="diagnosis">
<paragraph pageId="24" pageNumber="39">Diagnosis.</paragraph>
<paragraph pageId="24" pageNumber="39">
From
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName>
and
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName>
,
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="coronata">Catharylla coronata</taxonomicName>
can be separated with characters of the male genitalia: the uncus is apically bifid and grooved on distal 1/5 in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="coronata">Catharylla coronata</taxonomicName>
whereas it is only indented medially at apex in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName>
and
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName>
; the costal arm of the valva is short and the apex is curved inward in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="coronata">Catharylla coronata</taxonomicName>
whereas the costal arm is longer and points postero-dorsally in the other two species; the transtilla forms a pair of sclerotized arms slightly bent inward distally, ventrally with a row of short spines increasing in size from base to apex whereas it forms a pair of short, narrow sclerotized arms with pointed tips, projecting posterad, and with a pair of brushes directed medio-ventrally in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName>
and a pair of sclerotized arms strongly bent inward on distal 1/4 and with a string of long spines of same length medially along it in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName>
; the juxta is shorter than in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName>
, and regularly narrowing toward apex whereas it is strongly narrowing on distal 1/4 in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName>
; the ventral projections of the juxta form a pair of shallow pockets whereas they are bell-shaped in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName>
and thumb-like in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName>
; the vesica has a row of 6-7 cornuti in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="coronata">Catharylla coronata</taxonomicName>
whereas it does not show any cornuti in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName>
and
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName>
. In the female genitalia of
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="coronata">Catharylla coronata</taxonomicName>
, the anterior angle of sternite VIII is not projected whereas it is rounded, projected anterad and covered with short spinules in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName>
, and projected downward in
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="24" pageNumber="39" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName>
. The anterior apophyses are quadrangular, anvil shaped whereas they are spine like in the other two species.
</paragraph>
</subSubSection>
<subSubSection lastPageId="25" lastPageNumber="40" pageId="24" pageNumber="39" type="description">
<paragraph pageId="24" pageNumber="39">Description.</paragraph>
<paragraph lastPageId="25" lastPageNumber="40" pageId="24" pageNumber="39">
Male (n = 21) (Fig. 5): Head white with ochreous chaetosemata. Antenna brown, with whitish ochreous scales and patch of brown scales at base. Maxillary palpi light ochreous to ochreous, white tipped. Labial palpi: 1.6-1.85 mm long; light ochreous, white tipped. Thorax white, with ochreous patch at collar. Foreleg coxa white; femur white, dorsally dark brown; tibia and tarsomeres ochreous, distally ringed with brown; midleg and hindleg white to light ochreous, tarsomeres
<normalizedToken originalValue="IIV">II-V</normalizedToken>
ochreous, upperside brown, with white ringed tips. Forewing length: 10-13 mm; costal margin
<pageBreakToken pageId="25" pageNumber="40" start="start">line</pageBreakToken>
thin, light ochreous, apically faded; median transverse line light ochreous, concave on costal half, more or less disrupted; subterminal transverse line ochreous, curving toward base on costal half; R5 vein faintly marked apically with ochreous; outer margin ochreous with 7 pronounced dark brown spots more or less triangular between veins, sometimes connecting; fringes brass colored; underside white ochreous to ochreous, costal margin basally brown; outer margin with pronounced spots. Hindwing white to creamy white, usually with marginal brown spots between Sc+R1, Rs, M1, M2, M3, CuA1 and CuA2, forming more or less continuous line; fringes white; underside light ochreous, with dark brown marginal spots pronounced.
</paragraph>
<paragraph pageId="25" pageNumber="40">Tympanal organs (n = 7): Transverse ridge more or less regularly rounded. Tympanic pocket extending faintly beyond transverse ridge, rounded. Tympanic drum glomerular, not reaching transverse ridge.</paragraph>
<paragraph pageId="25" pageNumber="40">Male genitalia (n = 7) (Figs 19, 20): Uncus about 3/4 length of tegumen arms, downcurved; uncus arms basally with ventro-lateral tuft of setae; dorsal furrow pronounced medially with row of few setae on each side; thin, bifid on distal 1/5, slightly grooved, with apex slightly pointed; with shallow cavity ventro-apically. Gnathos arms connecting at 1/3 of length; shaft slightly downcurved, with apex pointing upward. Tegumen arms enlarging progressively toward uncus; tegumen connection about 1/3 arms length. Costa of valva basally narrow, with quadrangular projection, apically narrowing into arm pointing posterad with short tip curved inward; cucullus curved upward in distal 1/3, with apex rounded. Juxta triangular, regularly narrowing toward apex with shallow pockets projected ventro-laterally; with baso-lateral angles curved upward. Transtilla modified into two arms projecting posterad, slightly curved inward in distal 1/4, with longitudinal string of short spines ventrally at base, medially along arms, and at apex, increasing in size from base to apex in factor of about 1 to 4-5. Phallus almost straight, apex dorsally triangular; vesica basally covered with tiny spicules, microspicules barely visible all along vesica, also with row of 5-6 straight, short spine-like cornuti wider at their base.</paragraph>
<paragraph pageId="25" pageNumber="40">Female (n = 4): Labial palpi: 1.6-2.2 mm long. Forewing length 14-16 mm. Frenulum triple.</paragraph>
<paragraph pageId="25" pageNumber="40">
Female genitalia (n = 4) (Fig. 38): Papillae anales straight, thick. Posterior apophyses 0.3-0.5
<normalizedToken originalValue="×">x</normalizedToken>
length of papillae anales, wide at base, about half of length of papillae. Intersegmental membrane between segment VIII and IX covered with microspines. Sternite VIII laterally about 1/3 longer than tergite VIII. Sternite VIII formed by 2 lobes regularly narrowing downward into triangle, not connected ventrally, densely covered with spinules, with spinules longer ventrally. Anterior apophyses about 0.05
<normalizedToken originalValue="×">x</normalizedToken>
length of papillae anales, quadrangular, anvil shaped. Anterior margin of sternite VIII latero-dorsally strongly sclerotized, thicker; posterior margin with dorsal line of setae. Sterigma membranous, covered with spinules. Ductus bursae regularly enlarging into corpus bursae, basally directed downward. Corpus bursae more or less rounded, faintly delimited from ductus bursae, with one oval signum.
</paragraph>
</subSubSection>
<subSubSection pageId="25" pageNumber="40" type="distribution">
<paragraph pageId="25" pageNumber="40">Distribution.</paragraph>
<paragraph pageId="25" pageNumber="40">
The species occurs in Brazil in the following states: Bahia, Espirito Santo,
<normalizedToken originalValue="Paranà">Parana</normalizedToken>
, Rio de Janeiro, Santa Catarina,
<normalizedToken originalValue="Saõ">Sao</normalizedToken>
Paulo (Fig. 45).
</paragraph>
</subSubSection>
<subSubSection pageId="26" pageNumber="41" type="etymology">
<paragraph pageId="26" pageNumber="41">
<pageBreakToken pageId="26" pageNumber="41" start="start">Etymology</pageBreakToken>
.
</paragraph>
<paragraph pageId="26" pageNumber="41">The name comes from the latin coronatus, a, um: crowned, referring to the longitudinal string of short spines of the transtilla in the male genitalia.</paragraph>
</subSubSection>
<subSubSection pageId="26" pageNumber="41" type="notes">
<paragraph pageId="26" pageNumber="41">Notes.</paragraph>
<paragraph pageId="26" pageNumber="41">
Based on our combined phylogenetic analysis,
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla coronata" order="Lepidoptera" pageId="26" pageNumber="41" phylum="Arthropoda" rank="species" species="coronata">Catharylla coronata</taxonomicName>
is the sister species of the
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla tenellus" order="Lepidoptera" pageId="26" pageNumber="41" phylum="Arthropoda" rank="species" species="tenellus">Catharylla tenellus</taxonomicName>
+
<taxonomicName class="Insecta" family="Crambidae" genus="Catharylla" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Catharylla serrabonita" order="Lepidoptera" pageId="26" pageNumber="41" phylum="Arthropoda" rank="species" species="serrabonita">Catharylla serrabonita</taxonomicName>
pair (Fig. 42).
</paragraph>
</subSubSection>
</treatment>
</document>