treatments-xml/data/A6/D2/A4/A6D2A4995B6169EE4C9CC0F35C0E6694.xml
2024-06-21 12:46:44 +02:00

498 lines
47 KiB
XML
Raw Permalink Blame History

This file contains ambiguous Unicode characters

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

<document ID-DOI="http://dx.doi.org/10.3897/BDJ.2.e4238" ID-PMC="PMC4267105" ID-Pensoft-Pub="1314-2828-2-4238" ID-PubMed="25535487" ModsDocAuthor="" ModsDocDate="2014" ModsDocID="1314-2828-2-e4238" ModsDocOrigin="Biodiversity Data Journal 2" ModsDocTitle="Unveiling of a cryptic Dicranomyia (Idiopyga) from northern Finland using integrative approach (Diptera, Limoniidae)" checkinTime="1451253228922" checkinUser="pensoft" docAuthor="Salmela, Jukka, Kaunisto, Kari M &amp; Vahtera, Varpu" docDate="2014" docId="A6D2A4995B6169EE4C9CC0F35C0E6694" docLanguage="en" docName="BiodivDatJour 2: e4238" docOrigin="Biodiversity Data Journal 2" docSource="http://dx.doi.org/10.3897/BDJ.2.e4238" docTitle="Dicranomyia (Idiopyga) boreobaltica Salmela, sp. n." docType="treatment" docVersion="2" lastPageNumber="4238" masterDocId="FF96FFDCFFD8FF96AA14FFF2AC4EFF8E" masterDocTitle="Unveiling of a cryptic Dicranomyia (Idiopyga) from northern Finland using integrative approach (Diptera, Limoniidae)" masterLastPageNumber="4238" masterPageNumber="4238" pageNumber="4238" updateTime="1668126628151" updateUser="ExternalLinkService">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Unveiling of a cryptic Dicranomyia (Idiopyga) from northern Finland using integrative approach (Diptera, Limoniidae)</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Salmela, Jukka</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Kaunisto, Kari M</mods:namePart>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Vahtera, Varpu</mods:namePart>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>Biodiversity Data Journal</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2014</mods:date>
<mods:detail type="volume">
<mods:number>2</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>4238</mods:start>
<mods:end>4238</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/BDJ.2.e4238</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.2.e4238</mods:identifier>
<mods:identifier type="Pensoft-Pub">1314-2828-2-4238</mods:identifier>
</mods:mods>
<treatment LSID="urn:lsid:plazi:treatment:A6D2A4995B6169EE4C9CC0F35C0E6694" httpUri="http://treatment.plazi.org/id/A6D2A4995B6169EE4C9CC0F35C0E6694" lastPageNumber="4238" pageId="0" pageNumber="4238">
<subSubSection pageId="0" pageNumber="4238" type="nomenclature">
<paragraph pageId="0" pageNumber="4238">
<taxonomicName LSID="urn:lsid:zoobank.org:act:5537A033-CC12-41C0-869C-F603D8775005" authority="Salmela" class="Insecta" family="Limoniidae" genus="Dicranomyia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Dicranomyia (Idiopyga) boreobaltica" order="Diptera" pageId="0" pageNumber="4238" phylum="Arthropoda" rank="species" species="boreobaltica" subGenus="Idiopyga">Dicranomyia (Idiopyga) boreobaltica Salmela</taxonomicName>
<taxonomicNameLabel pageId="0" pageNumber="4238">sp. n.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="4238" type="materials_examined">
<paragraph pageId="0" pageNumber="4238">Materials</paragraph>
<paragraph pageId="0" pageNumber="4238">
<materialsCitation collectingDate="2005-8-11/10-8" collectingMethod="Malaise trap" collectionCode="ZMUT" collectorName="T. Nieminen" country="Finland" location="Finland" pageId="0" pageNumber="4238" specimenCode="JES- 20120094" specimenCount="1" specimenCount-male="1" typeStatus="Holotype">
Type status:
<typeStatus pageId="0" pageNumber="4238">Holotype</typeStatus>
. Occurrence: catalogNumber:
<specimenCode pageId="0" pageNumber="4238">JES-20120094</specimenCode>
; recordedBy:
<collectorName pageId="0" pageNumber="4238">T. Nieminen</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="4238">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="4238">male</specimenType>
; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country:
<collectingCountry pageId="0" pageNumber="4238">Finland</collectingCountry>
; stateProvince: Ostrobothnia borealis pars ouluensis; verbatimLocality: Oulunsalo, Papinkari; verbatimLatitude: 64.9060; verbatimLongitude: 25.3764; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol:
<collectingMethod pageId="0" pageNumber="4238">Malaise trap</collectingMethod>
; eventDate:
<collectingDate pageId="0" pageNumber="4238" value="2005-8-11/10-8">2005-8-11/10-8</collectingDate>
; habitat: Baltic coastal meadow; Record Level: institutionCode:
<collectionCode pageId="0" pageNumber="4238">ZMUT</collectionCode>
</materialsCitation>
</paragraph>
<paragraph pageId="0" pageNumber="4238">
<materialsCitation collectingDate="2005-8-11/10-8" collectingMethod="Malaise trap" collectionCode="JSO" collectorName="T. Nieminen" country="Finland" location="Finland" pageId="0" pageNumber="4238" specimenCount="1" specimenCount-male="1" typeStatus="Paratype">
Type status:
<typeStatus pageId="0" pageNumber="4238">Paratype</typeStatus>
. Occurrence: recordedBy:
<collectorName pageId="0" pageNumber="4238">T. Nieminen</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="4238">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="4238">male</specimenType>
; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country:
<collectingCountry pageId="0" pageNumber="4238">Finland</collectingCountry>
; stateProvince: Ostrobothnia borealis pars ouluensis; verbatimLocality: Hailuoto,
<normalizedToken originalValue="Pökönnokka">Poekoennokka</normalizedToken>
; verbatimLatitude: 65.0790; verbatimLongitude: 24.8883; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol:
<collectingMethod pageId="0" pageNumber="4238">Malaise trap</collectingMethod>
; eventDate:
<collectingDate pageId="0" pageNumber="4238" value="2005-8-11/10-8">2005-8-11/10-8</collectingDate>
; habitat: Baltic coastal meadow; Record Level: institutionCode:
<collectionCode pageId="0" pageNumber="4238">JSO</collectionCode>
</materialsCitation>
</paragraph>
<paragraph pageId="0" pageNumber="4238">
<materialsCitation collectingDate="2005-8-11/10-8" collectingMethod="Malaise trap" collectionCode="ZMUT" collectorName="T. Nieminen" country="Finland" location="Finland" pageId="0" pageNumber="4238" specimenCount="1" specimenCount-male="1" typeStatus="Paratype">
Type status:
<typeStatus pageId="0" pageNumber="4238">Paratype</typeStatus>
. Occurrence: recordedBy:
<collectorName pageId="0" pageNumber="4238">T. Nieminen</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="4238">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="4238">male</specimenType>
; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country:
<collectingCountry pageId="0" pageNumber="4238">Finland</collectingCountry>
; stateProvince: Ostrobothnia borealis pars ouluensis; verbatimLocality: Hailuoto,
<normalizedToken originalValue="Pökönnokka">Poekoennokka</normalizedToken>
; verbatimLatitude: 65.0790; verbatimLongitude: 24.8883; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol:
<collectingMethod pageId="0" pageNumber="4238">Malaise trap</collectingMethod>
; eventDate:
<collectingDate pageId="0" pageNumber="4238" value="2005-8-11/10-8">2005-8-11/10-8</collectingDate>
; habitat: Baltic coastal meadow; Record Level: institutionCode:
<collectionCode pageId="0" pageNumber="4238">ZMUT</collectionCode>
</materialsCitation>
</paragraph>
<paragraph pageId="0" pageNumber="4238">
<materialsCitation collectingDate="2013-8-1/9-26" collectingMethod="Malaise trap" collectionCode="JES" collectorName="J. Salmela" country="Finland" location="Finland" pageId="0" pageNumber="4238" specimenCode="DIPT-JS- 2014 - 0248" specimenCount="1" specimenCount-male="1" typeStatus="Paratype">
Type status:
<typeStatus pageId="0" pageNumber="4238">Paratype</typeStatus>
. Occurrence: catalogNumber:
<specimenCode pageId="0" pageNumber="4238">DIPT-JS-2014-0248</specimenCode>
; recordedBy:
<collectorName pageId="0" pageNumber="4238">J. Salmela</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="4238">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="4238">male</specimenType>
; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country:
<collectingCountry pageId="0" pageNumber="4238">Finland</collectingCountry>
; stateProvince: Ostrobothnia borealis pars borealis; verbatimLocality: Tornio,
<normalizedToken originalValue="Isonkummunjänkä">Isonkummunjaenkae</normalizedToken>
Mire Conservation Area, Kusiaiskorpi; verbatimLatitude: 65.8880; verbatimLongitude: 24.4792; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol:
<collectingMethod pageId="0" pageNumber="4238">Malaise trap</collectingMethod>
; eventDate:
<collectingDate pageId="0" pageNumber="4238" value="2013-8-1/9-26">2013-8-1/9-26</collectingDate>
; habitat: Rich fen, rusty spring; Record Level: institutionCode:
<collectionCode pageId="0" pageNumber="4238">JES</collectionCode>
</materialsCitation>
</paragraph>
<paragraph pageId="0" pageNumber="4238">
<materialsCitation collectingDate="2013-8-1/9-26" collectingMethod="Malaise trap" collectionCode="JES" collectorName="J. Salmela" country="Finland" location="Finland" pageId="0" pageNumber="4238" specimenCode="DIPT-JS- 2014 - 0251" specimenCount="1" specimenCount-female="1" typeStatus="Paratype">
Type status:
<typeStatus pageId="0" pageNumber="4238">Paratype</typeStatus>
. Occurrence: catalogNumber:
<specimenCode pageId="0" pageNumber="4238">DIPT-JS-2014-0251</specimenCode>
; recordedBy:
<collectorName pageId="0" pageNumber="4238">J. Salmela</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="4238">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="4238">female</specimenType>
; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country:
<collectingCountry pageId="0" pageNumber="4238">Finland</collectingCountry>
; stateProvince: Ostrobothnia borealis pars borealis; verbatimLocality: Tornio,
<normalizedToken originalValue="Isonkummunjänkä">Isonkummunjaenkae</normalizedToken>
Mire Conservation Area, Kusiaiskorpi; verbatimLatitude: 65.8880; verbatimLongitude: 24.4792; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol:
<collectingMethod pageId="0" pageNumber="4238">Malaise trap</collectingMethod>
; eventDate:
<collectingDate pageId="0" pageNumber="4238" value="2013-8-1/9-26">2013-8-1/9-26</collectingDate>
; habitat: Rich fen, rusty spring; Record Level: institutionCode:
<collectionCode pageId="0" pageNumber="4238">JES</collectionCode>
</materialsCitation>
</paragraph>
<paragraph pageId="0" pageNumber="4238">
<materialsCitation collectingDate="2013-8-1/9-26" collectingMethod="Malaise trap" collectionCode="ZMUT" collectorName="J. Salmela" country="Finland" location="Finland" pageId="0" pageNumber="4238" specimenCount="1" specimenCount-female="1" typeStatus="Paratype">
Type status:
<typeStatus pageId="0" pageNumber="4238">Paratype</typeStatus>
. Occurrence: recordedBy:
<collectorName pageId="0" pageNumber="4238">J. Salmela</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="4238">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="4238">female</specimenType>
; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country:
<collectingCountry pageId="0" pageNumber="4238">Finland</collectingCountry>
; stateProvince: Ostrobothnia borealis pars borealis; verbatimLocality: Tornio,
<normalizedToken originalValue="Isonkummunjänkä">Isonkummunjaenkae</normalizedToken>
Mire Conservation Area, Kusiaiskorpi; verbatimLatitude: 65.8880; verbatimLongitude: 24.4792; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol:
<collectingMethod pageId="0" pageNumber="4238">Malaise trap</collectingMethod>
; eventDate:
<collectingDate pageId="0" pageNumber="4238" value="2013-8-1/9-26">2013-8-1/9-26</collectingDate>
; habitat: Rich fen, rusty spring; Record Level: institutionCode:
<collectionCode pageId="0" pageNumber="4238">ZMUT</collectionCode>
</materialsCitation>
</paragraph>
<paragraph pageId="0" pageNumber="4238">
<materialsCitation collectingDate="2013-8-1/9-26" collectingMethod="Malaise trap" collectionCode="JES" collectorName="J. Salmela" country="Finland" location="Finland" pageId="0" pageNumber="4238" specimenCode="DIPT-JS- 2014 - 0114" specimenCount="7" specimenCount-female="4" specimenCount-male="3" typeStatus="Other material">
Type status:
<typeStatus pageId="0" pageNumber="4238">Other material</typeStatus>
. Occurrence: catalogNumber:
<specimenCode pageId="0" pageNumber="4238">DIPT-JS-2014-0114</specimenCode>
; recordedBy:
<collectorName pageId="0" pageNumber="4238">J. Salmela</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="4238">7</specimenCount>
; sex:
<specimenCount type="female">4 females</specimenCount>
,
<specimenCount type="male">3 males</specimenCount>
; Taxon: genus: Dicranomyia; subgenus: Idiopyga; specificEpithet: boreobaltica; scientificNameAuthorship: Salmela; Location: country:
<collectingCountry pageId="0" pageNumber="4238">Finland</collectingCountry>
; stateProvince: Ostrobothnia borealis pars borealis; verbatimLocality: Tornio,
<normalizedToken originalValue="Isonkummunjänkä">Isonkummunjaenkae</normalizedToken>
Mire Conservation Area, Kusiaiskorpi; verbatimLatitude: 65.8880; verbatimLongitude: 24.4792; verbatimCoordinateSystem: decimal degrees; verbatimSRS: WGS84; Event: samplingProtocol:
<collectingMethod pageId="0" pageNumber="4238">Malaise trap</collectingMethod>
; eventDate:
<collectingDate pageId="0" pageNumber="4238" value="2013-8-1/9-26">2013-8-1/9-26</collectingDate>
; habitat: Rich fen, rusty spring; Record Level: institutionCode:
<collectionCode pageId="0" pageNumber="4238">JES</collectionCode>
</materialsCitation>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="4238" type="description">
<paragraph pageId="0" pageNumber="4238">Description</paragraph>
<paragraph pageId="0" pageNumber="4238">
<taxonomicName class="Insecta" family="Limoniidae" genus="Dicranomyia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Dicranomyia (Idiopyga) intricata" order="Diptera" pageId="0" pageNumber="4238" phylum="Arthropoda" rank="species" species="intricata" subGenus="Idiopyga">Dicranomyia (Idiopyga) intricata</taxonomicName>
<bibRefCitation author="Nieminen, T." journalOrPublisher="MSc thesis, University of Jyvaeskylae, Finland" pageId="0" pageNumber="4238" pagination="1 - 37" title="Nematoceran flies (Diptera, Nematocera) of the sea-shore meadows and - forests in the northernmost part of the Gulf of Bothnia in Hailuoto and Oulunsalo." volume="1" year="2008">Nieminen 2008</bibRefCitation>
: 24 (misidentification)
</paragraph>
<paragraph pageId="0" pageNumber="4238">
<taxonomicName class="Insecta" family="Limoniidae" genus="Dicranomyia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Dicranomyia (Idiopyga) intricata" order="Diptera" pageId="0" pageNumber="4238" phylum="Arthropoda" rank="species" species="intricata" subGenus="Idiopyga">Dicranomyia (Idiopyga) cf. intricata</taxonomicName>
<bibRefCitation author="Salmela, J." journalOrPublisher="Annales Universitatis Turkuensis (Series AII)" pageId="0" pageNumber="4238" pagination="1 - 41" title="Taxonomy, species richness and biogeography of Finnish crane flies (Diptera, Tipuloidea)." volume="276" year="2013">Salmela 2013</bibRefCitation>
: 38 (preliminary annotation to the Finnish list)
</paragraph>
<paragraph pageId="0" pageNumber="4238">
Male. Head. Vertex dark brown, with short black setae. Rostrum light brown with a few short dark setae. Palpus 5-segmented; first palpomere very short, globular, 1.5 times wider than long; other palpomeres elongated, p2 length 140
<normalizedToken originalValue="µm">µm</normalizedToken>
, p3 100
<normalizedToken originalValue="µm">µm</normalizedToken>
, p4 100
<normalizedToken originalValue="µm">µm</normalizedToken>
and p5 120
<normalizedToken originalValue="µm">µm</normalizedToken>
. First palpomere with a long ventral seta, approximately 2 times longer than width of palpomere. Second and third palpomeres with 5 setae, arranged in the apical half of segments. Fourth palpomere bearing ca. 12 setae and p5 with 13-15 setae, most of these on the apices of the segments. Antennae 14-segmented, dark brown, segments bearing black setae mostly exceeding width of respective segment; setae straight on scape (ca. 10 setae) and pecidel (ca. 15 setae), straight or curved on flagellomeres (ca. 5 setae on each flagellomere). Scape cylindrical, length 200
<normalizedToken originalValue="µm">µm</normalizedToken>
, width 75
<normalizedToken originalValue="µm">µm</normalizedToken>
, pedicel wider apically than basally, length 115
<normalizedToken originalValue="µm">µm</normalizedToken>
, width 75
<normalizedToken originalValue="µm">µm</normalizedToken>
. Flagellomeres oval, longer than wide; f1 length 120
<normalizedToken originalValue="µm">µm</normalizedToken>
, width 65
<normalizedToken originalValue="µm">µm</normalizedToken>
, f2 length 8
<normalizedToken originalValue="µm">µm</normalizedToken>
, width 5
<normalizedToken originalValue="µm">µm</normalizedToken>
, f10 length 110
<normalizedToken originalValue="µm">µm</normalizedToken>
, width 40
<normalizedToken originalValue="µm">µm</normalizedToken>
. Thorax mainly dark brown. Prescutum dark brown, only small yellowish spots on hind lateral corners. Scutum dark brown with longitudinal yellow median line and yellow lateral spots near wing base. Mediotergite and anepisternum dark brown, mediotergite sometimes with narrow yellowish anterior margin. Laterotergite and anepimeron yellowish brown. Katepisternum bicolored: anterior half dark brown, posterior half yellowish brown. Fore coxa brown, mid and hind coxae yellowish brown. Femorae light brown or brown, tibiae and tarsi dark brown. Length of fore femora 4500
<normalizedToken originalValue="µm">µm</normalizedToken>
, tibia 5250
<normalizedToken originalValue="µm">µm</normalizedToken>
, t1 3500
<normalizedToken originalValue="µm">µm</normalizedToken>
, t2 1100
<normalizedToken originalValue="µm">µm</normalizedToken>
, t3 875
<normalizedToken originalValue="µm">µm</normalizedToken>
, t4 300
<normalizedToken originalValue="µm">µm</normalizedToken>
, t5 175
<normalizedToken originalValue="µm">µm</normalizedToken>
, claw 130
<normalizedToken originalValue="µm">µm</normalizedToken>
. Length of mid femora 5575
<normalizedToken originalValue="µm">µm</normalizedToken>
, tibia 5625
<normalizedToken originalValue="µm">µm</normalizedToken>
, t1 3200
<normalizedToken originalValue="µm">µm</normalizedToken>
, t2 1150
<normalizedToken originalValue="µm">µm</normalizedToken>
, t3 625
<normalizedToken originalValue="µm">µm</normalizedToken>
, t4 275
<normalizedToken originalValue="µm">µm</normalizedToken>
, t5 175
<normalizedToken originalValue="µm">µm</normalizedToken>
, claw 130
<normalizedToken originalValue="µm">µm</normalizedToken>
. Length of hind femora 5600
<normalizedToken originalValue="µm">µm</normalizedToken>
, tibia 5750
<normalizedToken originalValue="µm">µm</normalizedToken>
, t1 3050
<normalizedToken originalValue="µm">µm</normalizedToken>
, t2 1150, t3 650
<normalizedToken originalValue="µm">µm</normalizedToken>
, t4 275
<normalizedToken originalValue="µm">µm</normalizedToken>
, t5 178
<normalizedToken originalValue="µm">µm</normalizedToken>
, claw 130
<normalizedToken originalValue="µm">µm</normalizedToken>
. Halter grayish-brown. Wing clear, veins light brown - brown, pterostigma brown (Fig. 1). Apical part of Sc1, R1, Rs, R3, R4+5, M1+2, M3, CuA1, CuA2, apices of A1 and A2 with macrotrichia, other veins bare. Sc1 ending in C before or opposite base of Rs (Fig. 1). Wing length 6.0-6.5 mm. Abdomen light brown - dark brown, tergites mainly dark, anterior sternites lighter than caudal sternites. Both sternites and tergites covered with short brown setae. 9th tergite and proctiger as in Fig. 2. Gonocoxite and gonostylus with complicated structure. Gonocoxite dark brown, sparsely covered with dark setae. Ventromesal lobe of gonocoxite consisting of two main branches, the main lobe (lgx) and its appendage (algx, Fig. 3). The main lobe (lgx) is rod-like, straight and elongated, apex angular, medially with a patch of hyaline curly setae. The appendage (algx) with two branches, proximal branch smaller, having a small hairy lobe, caudal branch larger in size, apically with tuft of rather long hyaline setae (Fig. 3a). Inner appendage of gonocoxite (iagx, Fig. 4a, b, c) sclerotized, curved structure, apically with number of stout, short setae; apex of iagx rounded and slightly wider than its stalk. Gonostylus consisting of two main lobes (dorsal [dg] and ventral [vg]), ventrobasal lobe of ventral gonostylus (lvg), rostral prolongation (rostrum) of ventral gonostylus (rm) and subrostral prolongation of ventral gonostylus (srm) (Figs 3b, 4). Dg long, narrow, pointed and bare, vg ball-like, weakly sclerotized, bearing setae and microtrichia (Figs 3b, 4a). Lvg tail-like, sinuous and weakly sclerotized, having patches of hyaline setae both basally and apically; apex of lvg oval (Fig. 3). Basal part of rm dorsally covered with dark brown plate, rm light brown, well sclerotized and elongated, bearing two strong spines; apex of rm rounded and rather narrow, bearing a few short setae (Fig. 4a). Srm strongly sclerotized, approximately as long as rm, projected proximad (i.e. toward parameres), being widest medially; srm with number of median and subapical stout black spines; apex rounded in dorsal view, bearing one black and two hyaline stout setae (Fig. 4c, d). Ventral surface of aedeagus bearing hyaline setosity, lateral margin of parameres weakly serrated (Fig. 5).
</paragraph>
<paragraph pageId="0" pageNumber="4238">
Female. In general, similar to male. Wing length 6.5 mm. Cerci short, ca. 240
<normalizedToken originalValue="µm">µm</normalizedToken>
in length. Infra-anal plate with a strong caudal peak (Fig. 6a). Other parts of the female post-abdomen are presented in Fig. 6.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="4238" type="diagnosis">
<paragraph pageId="0" pageNumber="4238">Diagnosis</paragraph>
<paragraph pageId="0" pageNumber="4238">
Brownish, small species, very close to
<taxonomicName lsidName="D. (I.) intricata" pageId="0" pageNumber="4238" rank="species" species="intricata" subGenus="I.">D. (I.) intricata</taxonomicName>
. Ventrobasal lobe of ventral gonostylus sinuous, apex oval. Inner appendage of gonocoxite apically rounded. Rostral prolongantion of ventral apically rather narrow and subrostral prolongation simple, not bilobed, bearing dark stout spines. Female infra-anal plate with strong caudal peak.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="4238" type="etymology">
<paragraph pageId="0" pageNumber="4238">Etymology</paragraph>
<paragraph pageId="0" pageNumber="4238">Boreo (borealis, Latin)= north, baltica (Latin)= referring to the Baltic Sea. The species is so far known from the northern Baltic area. The species name is deemed to be a latinized adjective in nominative singular.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="4238" type="distribution">
<paragraph pageId="0" pageNumber="4238">Distribution</paragraph>
<paragraph pageId="0" pageNumber="4238">
European, only known from Finland. The species is hitherto known from five separate localities; four of these are shore meadows in Oulunsalo and Hailuoto island (see
<bibRefCitation author="Nieminen, T." journalOrPublisher="MSc thesis, University of Jyvaeskylae, Finland" pageId="0" pageNumber="4238" pagination="1 - 37" title="Nematoceran flies (Diptera, Nematocera) of the sea-shore meadows and - forests in the northernmost part of the Gulf of Bothnia in Hailuoto and Oulunsalo." volume="1" year="2008">Nieminen 2008</bibRefCitation>
), and the fifth locality is in Tornio, a rich fen ca. 12 km inland from the coast line, 15 m above sea level (Fig. 14).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="4238" type="ecology">
<paragraph pageId="0" pageNumber="4238">Ecology</paragraph>
<paragraph pageId="0" pageNumber="4238">
The species is probably halophilous, occurring in Baltic coastal meadows characterised by vascular plants such as
<taxonomicName class="Liliopsida" family="Poaceae" genus="Phragmites" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Phragmites australis" order="Poales" pageId="0" pageNumber="4238" phylum="Tracheophyta" rank="species" species="australis">Phragmites australis</taxonomicName>
,
<taxonomicName class="Magnoliopsida" family="Primulaceae" genus="Lysimachia" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Lysimachia thyrsiflora" order="Ericales" pageId="0" pageNumber="4238" phylum="Tracheophyta" rank="species" species="thyrsiflora">Lysimachia thyrsiflora</taxonomicName>
,
<taxonomicName class="Liliopsida" family="Cyperaceae" genus="Eleocharis" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Eleocharis palustris" order="Poales" pageId="0" pageNumber="4238" phylum="Tracheophyta" rank="species" species="palustris">Eleocharis palustris</taxonomicName>
,
<taxonomicName class="Liliopsida" family="Cyperaceae" genus="Carex" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Carex halophila" order="Poales" pageId="0" pageNumber="4238" phylum="Tracheophyta" rank="species" species="halophila">Carex halophila</taxonomicName>
and
<taxonomicName lsidName="C. paleacea" pageId="0" pageNumber="4238" rank="species" species="paleacea">C. paleacea</taxonomicName>
(
<bibRefCitation author="Nieminen, T." journalOrPublisher="MSc thesis, University of Jyvaeskylae, Finland" pageId="0" pageNumber="4238" pagination="1 - 37" title="Nematoceran flies (Diptera, Nematocera) of the sea-shore meadows and - forests in the northernmost part of the Gulf of Bothnia in Hailuoto and Oulunsalo." volume="1" year="2008">Nieminen 2008</bibRefCitation>
, as
<taxonomicName lsidName="D. (I.) intricata" pageId="0" pageNumber="4238" rank="species" species="intricata" subGenus="I.">D. (I.) intricata</taxonomicName>
). These coastal meadows are produced by a phenomenon called land uplift, that is, the rebound of earth's crust after the retreating of the ice sheet; in the Bothnian Bay the rate of land uplift is about 8 mm/year (
<bibRefCitation author="Rehell, Sakari" journalOrPublisher="The Finnish Environment" pageId="0" pageNumber="4238" pagination="145 - 154" title="Land uplift phenomenon and its effects on mire vegetation. In: Lindholm, T. &amp; Heikkilae, R. (eds.) Finland - Land of mires." volume="23" year="2006">Rehell 2006</bibRefCitation>
). In addition to the meadows influenced by brackish water, the species has been collected from a calcareous rich spring fen. This rich spring fen is known to have high concentrations of e.g. Ca (53 mg/l), Na (5.3 mg/l), Fe (32 mg/l) and having high specific conductivity (42.7 mS/m), alkalinity (4.85 mmol/l) and pH (7.9, T. Sallantaus, personal communication). This spring fen is located quite close to the current shore line, and extrapolating from
<bibRefCitation author="Okkonen, J." journalOrPublisher="Acta universitatis ouluensis" pageId="0" pageNumber="4238" pagination="1 - 303" title="Graves of Giants and Cairns of Dread: The archaeology of Ostrobothnian stone structures" volume="B 52" year="2003">Okkonen 2003</bibRefCitation>
(fig. 21), one may estimate that this fen was on the Baltic shore some 600-700 years ago. It may be that high concentrations of dissolved minerals in the fen resemble brackish water habitat, allowing the survival of this halophilous crane fly species. It may thus be assumed that
<taxonomicName lsidName="D. (I.) boreobaltica" pageId="0" pageNumber="4238" rank="species" species="boreobaltica" subGenus="I.">D. (I.) boreobaltica</taxonomicName>
Salmela sp.n. is a recent relict species in the fen. It should be noted that some plants typical for the Baltic shores or brackish water have isolated populations on calcareous ponds or mires far from coastal areas (e.g.
<taxonomicName genus="Tricloghin" lsidName="Tricloghin maritima" pageId="0" pageNumber="4238" rank="species" species="maritima">Tricloghin maritima</taxonomicName>
,
<taxonomicName class="Liliopsida" family="Potamogetonaceae" genus="Potamogeton" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Potamogeton filiformis" order="Alismatales" pageId="0" pageNumber="4238" phylum="Tracheophyta" rank="species" species="filiformis">Potamogeton filiformis</taxonomicName>
,
<bibRefCitation author="Haemet-Ahti, L." journalOrPublisher="Kasvimuseo, Helsinki" pageId="0" pageNumber="4238" title="Field Flora of Finland" year="1998">
<normalizedToken originalValue="Hämet-Ahti">Haemet-Ahti</normalizedToken>
et al. 1998
</bibRefCitation>
)
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="4238" type="conservation">
<paragraph pageId="0" pageNumber="4238">Conservation</paragraph>
<paragraph pageId="0" pageNumber="4238">
Due to its apparent rarity, that is, small area of occupancy and extent of occurrence, the species could most likely be assessed as a threatened species according to IUCN criteria. Habitats of this species are highly endangered, usually small and isolated. There are a total of ca. 4200 ha of Baltic coastal meadows along the Finnish coast, and all such habitat types are red-listed (
<bibRefCitation author="Schulman, A." journalOrPublisher="Suomen ympaeristoekeskus, Helsinki" pageId="0" pageNumber="4238" title="Perinnebiotoopit. In. Raunio, A. Schulman, A. &amp; Kontula, T. (eds.). Suomen luontotyyppien uhanalaisuus Osa II: Luontotyyppien kuvaukset., Helsinki." year="2008">Schulman et al. 2008</bibRefCitation>
). Also spring fens are threatened habitats (
<bibRefCitation author="Leka, J." journalOrPublisher="Suomen luontotyyppien uhanalaisuus - Osa 2: Luontotyyppien kuvaukset" pageId="0" pageNumber="4238" pagination="89 - 142" title="3 Sisaevedet ja rannat. In: Raunio, A., Schulman, A. &amp; Kontula, T. (eds.)" volume="2" year="2008">Leka et al. 2008</bibRefCitation>
). Furthermore, Salmela (
<bibRefCitation author="Salmela, Jukka" journalOrPublisher="Master of Science Thesis, University of Jyvaskyla" pageId="0" pageNumber="4238" pagination="1 - 56" title="Biodiversity and community structure of nematoceran flies and mosses of springs in the Lapland triangle region" volume="1" year="2005">Salmela 2005</bibRefCitation>
) studied adult crane fly fauna of 20 springs, of which 10 were calcareous springs, only some 30-60 km northeast from Kusiaskorpi rich fen, and
<taxonomicName lsidName="D. (I.) boreobaltica" pageId="0" pageNumber="4238" rank="species" species="boreobaltica" subGenus="I.">D. (I.) boreobaltica</taxonomicName>
Salmela sp.n. was absent from the samples. This and other negative records (i.e. absence) from&gt;500 Malaise trapping sites in Finnish wetlands (
<bibRefCitation author="Salmela, Jukka" journalOrPublisher="Psyche: A Journal of Entomology" pageId="0" pageNumber="4238" pagination="1 - 20" title="Biogeographic Patterns of Finnish Crane Flies (Diptera, Tipuloidea)" volume="2012" year="2012">Salmela 2012</bibRefCitation>
,
<bibRefCitation author="Salmela, J." journalOrPublisher="Annales Universitatis Turkuensis (Series AII)" pageId="0" pageNumber="4238" pagination="1 - 41" title="Taxonomy, species richness and biogeography of Finnish crane flies (Diptera, Tipuloidea)." volume="276" year="2013">Salmela 2013</bibRefCitation>
, J. Salmela unpublished) indicate a very restricted range of this species. In a matter of fact, there are some endemic or highly disjunct plant (e.g.
<taxonomicName class="Liliopsida" family="Alismataceae" genus="Alisma" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Alisma wahlenbergii" order="Alismatales" pageId="0" pageNumber="4238" phylum="Tracheophyta" rank="species" species="wahlenbergii">Alisma wahlenbergii</taxonomicName>
,
<taxonomicName class="Magnoliopsida" family="Orobanchaceae" genus="Euphrasia" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Euphrasia bottnica" order="Lamiales" pageId="0" pageNumber="4238" phylum="Tracheophyta" rank="species" species="bottnica">Euphrasia bottnica</taxonomicName>
,
<taxonomicName class="Magnoliopsida" family="Primulaceae" genus="Primula" higherTaxonomySource="CoL" kingdom="Plantae" lsidName="Primula nutans" order="Ericales" pageId="0" pageNumber="4238" phylum="Tracheophyta" rank="species" species="nutans">Primula nutans</taxonomicName>
) and insect (
<taxonomicName class="Insecta" family="Elachistidae" genus="Elachista" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Elachista vonschantzi" order="Lepidoptera" pageId="0" pageNumber="4238" phylum="Arthropoda" rank="species" species="vonschantzi">Elachista vonschantzi</taxonomicName>
,
<taxonomicName class="Insecta" family="Chrysididae" genus="Holopyga" higherTaxonomySource="GBIF" kingdom="Animalia" lsidName="Holopyga metallica" order="Hymenoptera" pageId="0" pageNumber="4238" phylum="Arthropoda" rank="species" species="metallica">Holopyga metallica</taxonomicName>
,
<taxonomicName class="Insecta" family="Chrysomelidae" genus="Macroplea" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Macroplea pubipennis" order="Coleoptera" pageId="0" pageNumber="4238" phylum="Arthropoda" rank="species" species="pubipennis">Macroplea pubipennis</taxonomicName>
) species in the Baltic coastal areas (
<bibRefCitation author="Hulten, Eric" journalOrPublisher="Geologiska Foereningan i Stockholm. Foerhandlingar" pageId="0" pageNumber="4238" pagination="1 - 512" title="Atlas oever vaexternas utbredning i Norden" volume="72" year="1950">
<normalizedToken originalValue="Hultén">Hulten</normalizedToken>
1950
</bibRefCitation>
,
<bibRefCitation author="Dahl, Eilif" journalOrPublisher="Cambridge University Press" pageId="0" pageNumber="4238" title="The Phytogeography of Northern Europe" year="1998">Dahl 1998</bibRefCitation>
,
<bibRefCitation author="Mutanen, Marko" journalOrPublisher="Entomologisk Tidskrift" pageId="0" pageNumber="4238" pagination="183 - 186" title="Remarks on the life history, female external appearance and conservation status of Elachista vonschantzi Svensson, 1976 (Lepidoptera, Elachistidae) in Fennoscandia" volume="124 (3): 183 - 186." year="2003">Mutanen 2003</bibRefCitation>
,
<bibRefCitation author="Koelsch, Gregor" journalOrPublisher="Insect Systematics &amp; Evolution" pageId="0" pageNumber="4238" pagination="467 - 479" title="Species delimitation in the leaf beetle genus Macroplea (Coleoptera, Chrysomelidae) based on mitochondrial DNA, and phylogeographic considerations" volume="37" year="2006">
<normalizedToken originalValue="Kölsch">Koelsch</normalizedToken>
et al. 2006
</bibRefCitation>
,
<bibRefCitation author="Paukkunen, Juho" journalOrPublisher="Zootaxa" pageId="0" pageNumber="4238" pagination="1 - 67" title="Faunistic review of the cuckoo wasps of Fennoscandia, Denmark and the Baltic countries (Hymenoptera: Chrysididae)." volume="3864" year="2014">Paukkunen et al. 2014</bibRefCitation>
). Hence, by using the above mentioned plants and insects as surrogates,
<taxonomicName lsidName="D. (I.) boreobaltica" pageId="0" pageNumber="4238" rank="species" species="boreobaltica" subGenus="I.">D. (I.) boreobaltica</taxonomicName>
Salmela sp.n. could either be i) a recently evolved allopatric species that survived Pleistocene glaciations and is currently only present in the Baltic area or ii) a disjunct species having populations in other (coastal) areas.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="4238" type="taxon discussion">
<paragraph pageId="0" pageNumber="4238">Taxon discussion</paragraph>
<paragraph pageId="0" pageNumber="4238">
Based on morphology and COI sequence divergence, the new species is very closely related to the Holarctic species
<taxonomicName lsidName="D. (I.) intricata" pageId="0" pageNumber="4238" rank="species" species="intricata" subGenus="I.">D. (I.) intricata</taxonomicName>
. As already stated in the title of this article, the new species is cryptic, meaning that it is hard to distinguish from its sister species by morphological characters. Strictly speaking, cryptic species may mean taxa that are morphologically indisguishable (
<bibRefCitation author="Pfenninger, Markus" journalOrPublisher="BMC Evolutionary Biology" pageId="0" pageNumber="4238" pagination=": 121" title="Cryptic animal species are homogeneously distributed among taxa and biogeographical regions" volume="7" year="2007">Pfenninger and Schwenk 2007</bibRefCitation>
, but see
<bibRefCitation author="Tan, Denise S. H." journalOrPublisher="Zoologica Scripta" pageId="0" pageNumber="4238" pagination="51 - 61" title="From ' cryptic species' to integrative taxonomy: an iterative process involving DNA sequences, morphology, and behaviour leads to the resurrection of Sepsis pyrrhosoma (Sepsidae: Diptera)" volume="39" year="2010">Tan et al. 2010</bibRefCitation>
), but the new species described here can be separated from its sister species by using a genetic marker (barcoding region of COI) and morphology. However, morphological differences between these two species are not great and the only reliable diagnostic characters are found from male and female genitalia. These two species are allopatric, their closest known populations lay some 180 km apart. Despite these species not being from sympatric populations, we assume that their differences are well sufficient to keep their gene pools separated even in the case of possible secondary contact. Their COI divergence or K2P distance (5 %) is far too high to be considered as an intraspecific variation among majority of other insects (e.g.
<bibRefCitation author="Hausmann, Axel" journalOrPublisher="PLoS ONE" pageId="0" pageNumber="4238" pagination=": e 17134" title="DNA Barcoding the Geometrid Fauna of Bavaria (Lepidoptera): Successes, Surprises, and Questions" volume="6" year="2011">Hausmann et al. 2011</bibRefCitation>
,
<bibRefCitation author="Park, Doo-Sang" journalOrPublisher="PLoS ONE" pageId="0" pageNumber="4238" pagination=": e 18749" title="Barcoding Bugs: DNA-Based Identification of the True Bugs (Insecta: Hemiptera: Heteroptera)" volume="6" year="2011">Park et al. 2011</bibRefCitation>
) or crane flies (
<bibRefCitation author="Pilipenko, Valentin" journalOrPublisher="ZooKeys" pageId="0" pageNumber="4238" pagination=": 51" title="Description and DNA barcoding of Tipula (Pterelachisus) recondita sp. n. from the Palaearctic region (Diptera, Tipulidae)" volume="192" year="2012">Pilipenko et al. 2012</bibRefCitation>
). Instead, intraspecific variation among insects is typically smaller than 2 % and higher COI divergence usually indicates two separate species (
<bibRefCitation author="Mutanen, Marko" journalOrPublisher="Scientific Reports" pageId="0" pageNumber="4238" pagination=": 2901" title="Wide-ranging barcoding aids discovery of one-third increase of species richness in presumably well-investigated moths" volume="3" year="2013">Mutanen et al. 2013</bibRefCitation>
,
<bibRefCitation author="Pentinsaari, Mikko" journalOrPublisher="PLoS ONE" pageId="0" pageNumber="4238" pagination=": e 108651" title="Barcoding Beetles: A Regional Survey of 1872 Species Reveals High Identification Success and Unusually Deep Interspecific Divergences" volume="9" year="2014">Pentinsaari et al. 2014</bibRefCitation>
). Considering morphology, there is a recent case study from Israel (
<bibRefCitation author="Stary, J." journalOrPublisher="Israel Journal of Entomology" pageId="0" pageNumber="4238" pagination="107 - 114" title="A new Phyllolabis from Israel with reduced wings and halteres (Diptera: Limoniidae) 41 - 42: 107 - 114" volume="41 - 42" year="2012">Stary et al. 2012</bibRefCitation>
) showing that two closely related, allopatric
<taxonomicName class="Insecta" family="Limoniidae" genus="Phyllolabis" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Phyllolabis" order="Diptera" pageId="0" pageNumber="4238" phylum="Arthropoda" rank="genus">Phyllolabis</taxonomicName>
crane flies were treated as separate species although they have almost identical genitalia and the closest populations of these species live only 30 km apart. In Israel, the species were separated by a dispersal barrier (Rift Valley,
<bibRefCitation author="Stary, J." journalOrPublisher="Israel Journal of Entomology" pageId="0" pageNumber="4238" pagination="107 - 114" title="A new Phyllolabis from Israel with reduced wings and halteres (Diptera: Limoniidae) 41 - 42: 107 - 114" volume="41 - 42" year="2012">Stary et al. 2012</bibRefCitation>
); in Fennoscandia,
<taxonomicName lsidName="D. (I.) boreobaltica" pageId="0" pageNumber="4238" rank="species" species="boreobaltica" subGenus="I.">D. (I.) boreobaltica</taxonomicName>
Salmela sp.n. and
<taxonomicName lsidName="D. (I.) intricata" pageId="0" pageNumber="4238" rank="species" species="intricata" subGenus="I.">D. (I.) intricata</taxonomicName>
are not separated by a distinct barrier, they have non-overlapping ranges perhaps because of biogeographic factors driven by climate (see e.g.
<bibRefCitation author="Luoto, M." journalOrPublisher="Journal of Biogeography" pageId="0" pageNumber="4238" pagination="1764 - 1778" title="Determinants of the biogeographical distribution of butterflies in boreal regions" volume="33" year="2006">Luoto et al. 2006</bibRefCitation>
,
<bibRefCitation author="Vaeisaenen, R." journalOrPublisher="Annales Zoologi Fennici" pageId="0" pageNumber="4238" pagination="57 - 81" title="Biogeography of Northern European insects: province records in multivariate analysis (Saltatoria; Lepidoptera: Sesiidae; Coleoptera: Buprestidae, Cerambycidae). 28: 57 - 81." volume="28" year="1992">
<normalizedToken originalValue="Väisänen">Vaeisaenen</normalizedToken>
et al. 1992
</bibRefCitation>
) and availability of habitat (brackish water, calcareous springs in the vicinity of coast line).
</paragraph>
<paragraph pageId="0" pageNumber="4238">
External characters, such as wing venation and body coloration, between
<taxonomicName lsidName="D. (I.) boreobaltica" pageId="0" pageNumber="4238" rank="species" species="boreobaltica" subGenus="I.">D. (I.) boreobaltica</taxonomicName>
Salmela sp.n. and
<taxonomicName lsidName="D. (I.) intricata" pageId="0" pageNumber="4238" rank="species" species="intricata" subGenus="I.">D. (I.) intricata</taxonomicName>
are practically identical. The most important differences in male and female post-abdomen between the species are summarized in Table 2. Among other
<taxonomicName lsidName="D. (Idiopyga)" pageId="0" pageNumber="4238" rank="subGenus" subGenus="Idiopyga">D. (Idiopyga)</taxonomicName>
species, the new species is quite close to
<taxonomicName lsidName="D. (I.) esbeni" pageId="0" pageNumber="4238" rank="species" species="esbeni" subGenus="I.">D. (I.) esbeni</taxonomicName>
. Besides other details, the ventrobasal lobe of gonocoxite in
<taxonomicName lsidName="D. (I.) esbeni" pageId="0" pageNumber="4238" rank="species" species="esbeni" subGenus="I.">D. (I.) esbeni</taxonomicName>
is sinuous (see
<bibRefCitation author="Stary, Jaroslav" journalOrPublisher="Casopis Slezskeho Musea v Opava (A)" pageId="0" pageNumber="4238" pagination="23 - 36" title="Nomenclatural changes in West Palaearctic Limoniidae and Pediciidae (Diptera), II" volume="56" year="2007">Stary 2007</bibRefCitation>
, fig. 1), and rather straight in
<taxonomicName lsidName="D. (I.) boreobaltica" pageId="0" pageNumber="4238" rank="species" species="boreobaltica" subGenus="I.">D. (I.) boreobaltica</taxonomicName>
Salmela sp.n. Dicranomyia (I.) melleicauda complicata de Meijere is also quite close to the new species, but has rather stout iagx and apically wide lvg (see
<bibRefCitation author="de Meijere, J. C. H." journalOrPublisher="Tijdschrift voor Entomologie" pageId="0" pageNumber="4238" pagination="52 - 97" title="Studien ueber palaearktische, vorwiegend hollandische Limnobiiden, insbesondere ueber ihre Kopulationsorgane" volume="62" year="1919">de Meijere 1919</bibRefCitation>
, plates 5-6). Males of other species are easily separated from the new species based on differences in the stucture of hypopygium. Considering females, we refrain from further discussion due to the lack of comparative material.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="4238" type="dna barcode">
<paragraph pageId="0" pageNumber="4238">DNA barcode</paragraph>
<paragraph pageId="0" pageNumber="4238">
Standard 5 region (658 bp) of the cytochrome c oxidase I (COI) sequence of
<taxonomicName class="Insecta" family="Limoniidae" genus="Dicranomyia" higherTaxonomySource="CoL" kingdom="Animalia" lsidName="Dicranomyia (I.) boreobaltica" order="Diptera" pageId="0" pageNumber="4238" phylum="Arthropoda" rank="species" species="boreobaltica" subGenus="I.">Dicranomyia (I.) boreobaltica</taxonomicName>
Salmela sp.n. BOLD Sample ID JES-20120094, holotype specimen:
</paragraph>
<paragraph pageId="0" pageNumber="4238">TACCTTATACTTTATTTTTGGAGCTTGAGCAGGAATAGTGGGAACTTCATTAAGTATTATTATTCGAGCAGAATTAGGACACCCAGGTGCATTAATTGGAGACGACCAGATTTATAATGTGGTAGTTACTGCCCATGCTTTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTCGGTAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGAATACTTCCCCCTTCTTTAACTTTATTATTAGCTAGAAGCATAGTTGAAAACGGGGCAGGAACTGGCTGAACAGTATACCCTCCCCTTTCTTCTGGAATTGCCCATTCAGGGGCTTCTGTAGATTTAGCTATTTTTTCTCTTCACCTAGCAGGTATTTCTTCTATTTTAGGAGCTGTTAATTTTATTACAACTGTTATTAATATACGTTCAGCAGGAATTTCATTTGATCGAATACCATTATTTGTTTGATCAGTAGTAATTACTGCTATTTTATTGCTTTTATCACTTCCTGTTTTAGCCGGAGCTATTACAATATTATTAACAGATCGAAACTTAAATACTTCATTTTTTGATCCCGCAGGTGGAGGAGACCCTATTTTATATCAGCATTTATTT</paragraph>
<paragraph pageId="0" pageNumber="4238">
Based on K2P (
<bibRefCitation author="Kimura, M." journalOrPublisher="Journal of Molecular Evolution" pageId="0" pageNumber="4238" pagination="111 - 120" title="A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences." volume="16" year="1980">Kimura 1980</bibRefCitation>
) distances, the new species is closest to
<taxonomicName lsidName="D. (I.) intricata" pageId="0" pageNumber="4238" rank="species" species="intricata" subGenus="I.">D. (I.) intricata</taxonomicName>
(K2P distance 5.13 %),
<taxonomicName lsidName="D. (I.) esbeni" pageId="0" pageNumber="4238" rank="species" species="esbeni" subGenus="I.">D. (I.) esbeni</taxonomicName>
(7.16 %) and
<taxonomicName lsidName="D. (I.) magnicauda" pageId="0" pageNumber="4238" rank="species" species="magnicauda" subGenus="I.">D. (I.) magnicauda</taxonomicName>
(9.51 %); other distances within examined
<taxonomicName lsidName="D. (Idiopyga)" pageId="0" pageNumber="4238" rank="subGenus" subGenus="Idiopyga">D. (Idiopyga)</taxonomicName>
species range between 10.76 and 15.70 %.
</paragraph>
</subSubSection>
</treatment>
</document>