treatments-xml/data/07/45/AC/0745AC4D6E665AF6ACB4590F844F7BCB.xml
2024-06-21 12:28:44 +02:00

338 lines
32 KiB
XML
Raw Permalink Blame History

This file contains ambiguous Unicode characters

This file contains Unicode characters that might be confused with other characters. If you think that this is intentional, you can safely ignore this warning. Use the Escape button to reveal them.

<document ID-DOI="http://dx.doi.org/10.3897/BDJ.10.e96003" ID-Pensoft-Pub="1314-2828-10-e96003" ID-Pensoft-UUID="76077326AB2251039D2C380A594EDA2A" ID-ZooBank="2A9D4A67DC0040DC9745BF531D767F55" ModsDocID="1314-2828-10-e96003" checkinTime="1670952459602" checkinUser="pensoft" docAuthor="Chu, Chang, Lu, Ying, Li, Shuqiang &amp; Yao, Zhiyuan" docDate="2022" docId="0745AC4D6E665AF6ACB4590F844F7BCB" docLanguage="en" docName="BiodivDatJour 10: e96003" docOrigin="Biodiversity Data Journal 10" docPubDate="2022-12-12" docSource="http://dx.doi.org/10.3897/BDJ.10.e96003" docTitle="Bowie sabah S. Li &amp; Yao 2022, sp. n." docType="treatment" docVersion="1" id="76077326AB2251039D2C380A594EDA2A" lastPageNumber="96003" masterDocId="76077326AB2251039D2C380A594EDA2A" masterDocTitle="Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia" masterLastPageNumber="96003" masterPageNumber="96003" pageNumber="96003" updateTime="1670952459602" updateUser="pensoft">
<mods:mods xmlns:mods="http://www.loc.gov/mods/v3">
<mods:titleInfo>
<mods:title>Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia</mods:title>
</mods:titleInfo>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Chu, Chang</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0003-3520-5463</mods:nameIdentifier>
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Lu, Ying</mods:namePart>
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Li, Shuqiang</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-3290-5416</mods:nameIdentifier>
<mods:affiliation>Institute of Zoology, Chinese Academy of Sciences, Beijing, China</mods:affiliation>
</mods:name>
<mods:name type="personal">
<mods:role>
<mods:roleTerm>Author</mods:roleTerm>
</mods:role>
<mods:namePart>Yao, Zhiyuan</mods:namePart>
<mods:nameIdentifier type="ORCID">https://orcid.org/0000-0002-1631-0949</mods:nameIdentifier>
<mods:affiliation>College of Life Science, Shenyang Normal University, Shenyang, China</mods:affiliation>
<mods:nameIdentifier type="email">yaozy@synu.edu.cn</mods:nameIdentifier>
</mods:name>
<mods:typeOfResource>text</mods:typeOfResource>
<mods:relatedItem type="host">
<mods:titleInfo>
<mods:title>Biodiversity Data Journal</mods:title>
</mods:titleInfo>
<mods:part>
<mods:date>2022</mods:date>
<mods:detail type="pubDate">
<mods:number>2022-12-12</mods:number>
</mods:detail>
<mods:detail type="volume">
<mods:number>10</mods:number>
</mods:detail>
<mods:extent unit="page">
<mods:start>96003</mods:start>
<mods:end>96003</mods:end>
</mods:extent>
</mods:part>
</mods:relatedItem>
<mods:location>
<mods:url>http://dx.doi.org/10.3897/BDJ.10.e96003</mods:url>
</mods:location>
<mods:classification>journal article</mods:classification>
<mods:identifier type="DOI">http://dx.doi.org/10.3897/BDJ.10.e96003</mods:identifier>
<mods:identifier type="Pensoft-Pub">1314-2828-10-e96003</mods:identifier>
<mods:identifier type="ZooBank">2A9D4A67DC0040DC9745BF531D767F55</mods:identifier>
<mods:identifier type="Pensoft-UUID">76077326AB2251039D2C380A594EDA2A</mods:identifier>
</mods:mods>
<subSection pageId="0" pageNumber="96003" type="multiple">
<treatment LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB" httpUri="http://treatment.plazi.org/id/0745AC4D6E665AF6ACB4590F844F7BCB" lastPageNumber="96003" pageId="0" pageNumber="96003">
<subSubSection pageId="0" pageNumber="96003" type="nomenclature">
<paragraph pageId="0" pageNumber="96003">
<taxonomicName LSID="0745AC4D-6E66-5AF6-ACB4-590F844F7BCB" authority="S. Li &amp; Yao" authorityName="S. Li &amp; Yao" authorityYear="2022" class="Arachnida" genus="Bowie" kingdom="Animalia" lsidName="Bowie sabah" order="Araneae" pageId="0" pageNumber="96003" phylum="Arthropoda" rank="species" species="sabah" status="sp. n.">Bowie sabah S. Li &amp; Yao</taxonomicName>
<taxonomicNameLabel pageId="0" pageNumber="96003">sp. n.</taxonomicNameLabel>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="materials_examined">
<paragraph pageId="0" pageNumber="96003">Materials</paragraph>
<paragraph pageId="0" pageNumber="96003">
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="Collected by hand in leaf litter" collectorName="Occurrence, Z. Chen" country="Malaysia" county="Taxon" elevation="0" latitude="5.55" location="Ctenidae" longLatPrecision="1" longitude="116.516" municipality="Araneae" pageId="0" pageNumber="96003" specimenCount="1" specimenCount-male="1" stateProvince="Sabah" typeStatus="Holotype">
<emphasis bold="true" pageId="0" pageNumber="96003">Type status:</emphasis>
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="Collected by hand in leaf litter" collectorName="Occurrence, Z. Chen" country="Malaysia" county="Taxon" elevation="0" latitude="5.55" location="Ctenidae" longLatPrecision="1" longitude="116.516" municipality="Araneae" specimenCount="43732" stateProvince="Sabah" typeStatus="Holotype">
<typeStatus pageId="0" pageNumber="96003">Holotype</typeStatus>
.
<emphasis bold="true" pageId="0" pageNumber="96003">
<collectorName>Occurrence</collectorName>
:
</emphasis>
recordedBy:
<collectorName pageId="0" pageNumber="96003">Z. Chen</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="96003" type="generic">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="96003">male</specimenType>
; lifeStage:
<specimenType pageId="0" pageNumber="96003">adult</specimenType>
;
<emphasis bold="true" pageId="0" pageNumber="96003">
<collectingCounty>Taxon</collectingCounty>
:
</emphasis>
order:
<collectingMunicipality>Araneae</collectingMunicipality>
; family:
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:7A2FC24FDBC610A414899A2CA02D0407" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Ctenidae" stateProvince="Sabah">Ctenidae</location>
; genus:
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:D202B0A6A9DC5DDAE4778CC9DCB990A3" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Bowie" stateProvince="Sabah">Bowie</location>
;
<emphasis bold="true" pageId="0" pageNumber="96003">
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:26BB5D0B8DD3B050C4B347178C2CB274" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Location" stateProvince="Sabah">Location</location>
:
</emphasis>
country:
<collectingCountry name="Malaysia" pageId="0" pageNumber="96003">Malaysia</collectingCountry>
; stateProvince:
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:18142D5FA8D324CD3C2E0E0963FD6504" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Borneo" stateProvince="Sabah">Borneo</location>
; verbatimLocality:
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:E6607C41F5CA78504D9DD4F23AC8FFEF" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="State" stateProvince="Sabah">State</location>
of
<collectingRegion country="Malaysia" name="Sabah">Sabah</collectingRegion>
,
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:E0BD6659493115C474C85DC9EAEF206C" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Mount Trus Madi" stateProvince="Sabah">Mount Trus Madi</location>
,
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:C8C981107D44EAD7944D07C78EEA3788" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Jungle Girl Camp" stateProvince="Sabah">Jungle Girl Camp</location>
; verbatimElevation:
<elevation metricMagnitude="3" metricUnit="m" metricValue="1.234" pageId="0" pageNumber="96003" unit="m" value="1234.0">
<quantity metricMagnitude="3" metricUnit="m" metricValue="1.234" unit="m" value="1234.0">1234 m</quantity>
a.s.l.
</elevation>
; verbatimLatitude:
<geoCoordinate degrees="5" direction="north" minutes="33.000" orientation="latitude" precision="1" value="5.55">5°33.000'N</geoCoordinate>
; verbatimLongitude:
<geoCoordinate degrees="116" direction="east" minutes="30.960" orientation="longitude" precision="1" value="116.516">116°30.960'E</geoCoordinate>
;
<emphasis bold="true" pageId="0" pageNumber="96003">Event:</emphasis>
samplingProtocol:
<collectingMethod pageId="0" pageNumber="96003">Collected by hand in leaf litter</collectingMethod>
; year: 2016; month: 5; day: 3;
<emphasis bold="true" pageId="0" pageNumber="96003">Record Level:</emphasis>
institutionCode: IZCAS-Ar
<specimenCount type="generic">
43732
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="Collected by hand in leaf litter" collectorName="Occurrence, Z. Chen" country="Malaysia" county="Taxon" elevation="0" latitude="5.55" location="Ctenidae" longLatPrecision="1" longitude="116.516" municipality="Araneae" pageId="0" pageNumber="96003" specimenCount="1" specimenCount-female="1" stateProvince="Sabah" typeStatus="Paratype">
<emphasis bold="true" pageId="0" pageNumber="96003">Type status:</emphasis>
<materialsCitation collectingDate="2022-01-01" collectingDateMax="2022-12-31" collectingDateMin="2022-01-01" collectingMethod="Collected by hand in leaf litter" collectorName="Occurrence, Z. Chen" country="Malaysia" county="Taxon" elevation="0" latitude="5.55" location="Ctenidae" longLatPrecision="1" longitude="116.516" municipality="Araneae" specimenCount="1" specimenCount-female="1" stateProvince="Sabah" typeStatus="Paratype">
<typeStatus pageId="0" pageNumber="96003">Paratype</typeStatus>
.
<emphasis bold="true" pageId="0" pageNumber="96003">
<collectorName>Occurrence</collectorName>
:
</emphasis>
recordedBy:
<collectorName pageId="0" pageNumber="96003">Z. Chen</collectorName>
; individualCount:
<specimenCount pageId="0" pageNumber="96003" type="generic">1</specimenCount>
; sex:
<specimenType pageId="0" pageNumber="96003">female</specimenType>
; lifeStage:
<specimenType pageId="0" pageNumber="96003">adult</specimenType>
;
<emphasis bold="true" pageId="0" pageNumber="96003">
<collectingCounty>Taxon</collectingCounty>
:
</emphasis>
order:
<collectingMunicipality>Araneae</collectingMunicipality>
; family:
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:F216435D436B567C3C3ADD2D8F7CC05A" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Ctenidae" stateProvince="Sabah">Ctenidae</location>
; genus:
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:CA15DEC9FDC90E1A6BDF66B3F6AF0D9C" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Bowie" stateProvince="Sabah">Bowie</location>
;
<emphasis bold="true" pageId="0" pageNumber="96003">
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:7679E4CF164209F98AE115065A8E14B6" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Location" stateProvince="Sabah">Location</location>
:
</emphasis>
country:
<collectingCountry name="Malaysia" pageId="0" pageNumber="96003">Malaysia</collectingCountry>
; stateProvince:
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:CB940ED83C6FEF1C12CD76CC84E0531C" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Borneo" stateProvince="Sabah">Borneo</location>
; verbatimLocality:
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:2C95D66414BC5D0380D1DF19B716B37D" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="State" stateProvince="Sabah">State</location>
of
<collectingRegion country="Malaysia" name="Sabah">Sabah</collectingRegion>
,
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:54233A72B407B6548826BA7F32DAE19F" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Mount Trus Madi" stateProvince="Sabah">Mount Trus Madi</location>
,
<location LSID="urn:lsid:plazi:treatment:0745AC4D6E665AF6ACB4590F844F7BCB:725CB391DDA1C1863DFA67F19D82FE0C" country="Malaysia" county="Taxon" latitude="5.55" longLatPrecision="1" longitude="116.516" municipality="Araneae" name="Jungle Girl Camp" stateProvince="Sabah">Jungle Girl Camp</location>
; verbatimElevation:
<elevation metricMagnitude="3" metricUnit="m" metricValue="1.234" pageId="0" pageNumber="96003" unit="m" value="1234.0">
<quantity metricMagnitude="3" metricUnit="m" metricValue="1.234" unit="m" value="1234.0">1234 m</quantity>
a.s.l.
</elevation>
; verbatimLatitude:
<geoCoordinate degrees="5" direction="north" minutes="33.000" orientation="latitude" precision="1" value="5.55">5°33.000'N</geoCoordinate>
; verbatimLongitude:
<geoCoordinate degrees="116" direction="east" minutes="30.960" orientation="longitude" precision="1" value="116.516">116°30.960'E</geoCoordinate>
;
<emphasis bold="true" pageId="0" pageNumber="96003">Event:</emphasis>
samplingProtocol:
<collectingMethod pageId="0" pageNumber="96003">Collected by hand in leaf litter</collectingMethod>
; year: 2016; month: 5; day: 3;
<emphasis bold="true" pageId="0" pageNumber="96003">Record Level:</emphasis>
institutionCode: IZCAS-Ar 43733
</materialsCitation>
</materialsCitation>
</specimenCount>
</materialsCitation>
</materialsCitation>
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="description">
<paragraph pageId="0" pageNumber="96003">Description</paragraph>
<paragraph pageId="0" pageNumber="96003">
<emphasis bold="true" pageId="0" pageNumber="96003">Male</emphasis>
(IZCAS-Ar 43732): PL 6.4, PW 5.1, AW 2.3, OL 4.8, OW 3.6. Eye diameters and interdistances: AME 0.22, ALE 0.17, PME 0.27, PLE 0.23, AME-AME 0.25, AME-ALE 0.40, PME-PME 0.34, PME-PLE 0.49, AME-PME 0.17, ALE-PLE 0.29, clypeus AME 0.11, clypeus ALE 0.52. Palp and leg measurements: palp 8.2 (3.0, 1.2, 1.6, -, 2.4), I 20.5 (5.6, 2.6, 5.4, 5.1, 1.8), II 17.4 (5.1, 2.5, 4.3, 4.2, 1.3), III 14.5 (4.3, 2.2, 3.2, 3.7, 1.1), IV 22.4 (6.1, 2.2, 5.4, 6.8, 1.9). Leg formula 4123. Spination of palp and legs: palp 161, 001, 111; femora I p021, d111, r1111, II p112, d111, r112, III p001, d222, r112, IV p012, d111, r112; patellae I-IV 101; tibiae I p110, d111, r11, v22222, II p110, d11, r11, v22222, III-IV p11, d111, r11, v222; metatarsi I-II p111, d012, r111, v222, III p111, d002, r111, v222, IV p111, d012, r111, v222. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 23 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 6 bristles. Sparse scopula on all tarsi and metatarsi I-III. Leg claws I with 5, II with 4, III with 5 and IV with 6 secondary teeth. Position of tarsal organ: I with 1.64, II 1.15, III 0.96, IV 1.28.
</paragraph>
<paragraph pageId="0" pageNumber="96003">
Palp (Fig.
<figureCitation captionStart="Figure 26" captionStartId="F8184711" captionText="Figure 26. Bowie sabah sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, DPO = dorso-proximal outgrowth of cymbium, E = embolus, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure26" httpUri="https://binary.pensoft.net/fig/751911" pageId="0" pageNumber="96003">26</figureCitation>
a-c). RTA arising from tibia subdistally, with slightly hooked tip. Cymbium tip slightly conical and with weakly-developed dorso-proximal outgrowth. Embolus (Fig.
<figureCitation captionStartId="F8239451" pageId="0" pageNumber="96003">28</figureCitation>
<figureCitation captionStartId="F8239460" pageId="0" pageNumber="96003">e</figureCitation>
) arising at 8
<normalizedToken originalValue="oclock">o'clock</normalizedToken>
position, with membranous extension at its base and with spermophor opening situated subapically. Conductor arising at 10
<normalizedToken originalValue="oclock">o'clock</normalizedToken>
position. Tegular apophysis arising at 6
<normalizedToken originalValue="oclock">o'clock</normalizedToken>
position, its base situated on a slightly proximally protruding part of tegulum.
</paragraph>
<paragraph pageId="0" pageNumber="96003">
Colour (Fig.
<figureCitation captionStart="Figure 27" captionStartId="F8184713" captionText="Figure 27. Bowie sabah sp. n. a: Paratype female, epigyne, ventral view; b: Same, vulva, dorsal view; c: Holotype male, habitus, dorsal view; d: Same, habitus, ventral view; e: Paratype female, habitus, dorsal view; f: Same, habitus, ventral view. FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c-f)." figureDoi="10.3897/BDJ.10.e96003.figure27" httpUri="https://binary.pensoft.net/fig/751912" pageId="0" pageNumber="96003">27</figureCitation>
c and d). Yellowish-brown with darker patterns. Dorsal prosoma with characteristic lighter median band, widened behind eyes, eye field with sparse white hairs, with distinctly marked fovea and radial markings. Sternum and ventral coxae III + IV yellowish-brown with patches, coxae I + II yellowish-brown without patterns, labium and gnathocoxae yellowish-brown with lighter distal lips. Chelicerae dark yellowish-brown with longitudinal patterns. Palps and legs yellowish-brown, legs III + IV with distinct patterns. Dorsal opisthosoma yellowish-brown with black patches, anterior margin and central region light. Lateral opisthosoma spotted. Ventral opisthosoma dark brown with posteriorly converging lines of spots. Anterior lateral spinnerets laterally dark, posterior lateral and median spinnerets and anal tubercle light.
</paragraph>
<paragraph pageId="0" pageNumber="96003">
<emphasis bold="true" pageId="0" pageNumber="96003">Female</emphasis>
(IZCAS-Ar 43733): PL 5.9, PW 4.4, AW 3.0, OL 5.2, OW 3.5. Eye diameters and interdistances: AME 0.23, ALE 0.19, PME 0.27, PLE 0.25, AME-AME 0.20, AME-ALE 0.44, PME-PME 0.33, PME-PLE 0.52, AME-PME 0.17, ALE-PLE 0.28, clypeus AME 0.13, clypeus ALE 0.51. Palp and leg measurements: palp 5.8 (2.1, 1.1, 1.2, -, 1.4), I 13.9 (4.0, 2.1, 3.6, 3.1, 1.1), II 12.8 (3.8, 2.1, 3.0, 2.9, 1.0), III 11.3 (3.5, 1.7, 2.4, 2.7, 1.0), IV 16.7 (4.6, 1.9, 3.8, 4.9, 1.5). Leg formula 4123. Spination of palp and legs: palp 131, 001, 112, 203; femora I p021, d111, r011, II p012, d111, r111, III p112, d111, r112, IV p002, d111, r112; patellae I-II 000, III-IV 101; tibiae I-II v22222, III-IV p11, d111, r11, v222; metatarsi I-II v222, III-IV p111, d012, r111, v222. Chelicerae with 3 promarginal, 4 retromarginal teeth and with elongated patch of 12 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 7 bristles. Sparse scopula restricted almost entirely to tarsi, only metatarsi I-II with sparse scopula hairs. Palpal claw with 5 secondary teeth, leg claws I with 2, II with 3, III with 4 and IV with 3 secondary teeth. Position of tarsal organ: I 0.97, II 0.84, III 0.75, IV 1.06.
</paragraph>
<paragraph pageId="0" pageNumber="96003">
Copulatory organ (Fig.
<figureCitation captionStart="Figure 27" captionStartId="F8184713" captionText="Figure 27. Bowie sabah sp. n. a: Paratype female, epigyne, ventral view; b: Same, vulva, dorsal view; c: Holotype male, habitus, dorsal view; d: Same, habitus, ventral view; e: Paratype female, habitus, dorsal view; f: Same, habitus, ventral view. FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c-f)." figureDoi="10.3897/BDJ.10.e96003.figure27" httpUri="https://binary.pensoft.net/fig/751912" pageId="0" pageNumber="96003">27</figureCitation>
a and b). Epigynal field roughly as long as wide; constrictive anterior width/widest width: 0.53/1.15. Lateral teeth originating at posterior margin of median plate. Internal duct system with two large vulval folds laterally. Spermathecae bottle gourd-shaped. Vulval folds separated by less than the spermathecae length and subparallel medially. Fertilisation ducts pointing antero-medially.
</paragraph>
<paragraph pageId="0" pageNumber="96003">
Colour (Fig.
<figureCitation captionStart="Figure 27" captionStartId="F8184713" captionText="Figure 27. Bowie sabah sp. n. a: Paratype female, epigyne, ventral view; b: Same, vulva, dorsal view; c: Holotype male, habitus, dorsal view; d: Same, habitus, ventral view; e: Paratype female, habitus, dorsal view; f: Same, habitus, ventral view. FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c-f)." figureDoi="10.3897/BDJ.10.e96003.figure27" httpUri="https://binary.pensoft.net/fig/751912" pageId="0" pageNumber="96003">27</figureCitation>
e and f). As in male, except for being darker, reddish-brown. Chelicerae dark reddish-brown without pattern.
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="diagnosis">
<paragraph pageId="0" pageNumber="96003">Diagnosis</paragraph>
<paragraph pageId="0" pageNumber="96003">
Medium-sized
<taxonomicName class="Arachnida" family="Ctenidae" kingdom="Animalia" lsidName="" order="Araneae" pageId="0" pageNumber="96003" phylum="Arthropoda" rank="family">Ctenidae</taxonomicName>
(total length male 11.2, female 11.1). The new species is assigned to the
<emphasis italics="true" pageId="0" pageNumber="96003">scarymonsters</emphasis>
-species group with the characteristics of embolus with a basal, ventral bulge (best seen in prolateral view), tegulum bulging proximally at tegular apophysis base, the subdistally arising, apically pointed RTA in males, transversally oval median plate and lateral teeth situated at posterior margin of epigyne and spermathecae bottle gourd-shaped. It resembles
<taxonomicName lsidName="B. neukoeln" pageId="0" pageNumber="96003" rank="species" species="neukoeln">
<emphasis italics="true" pageId="0" pageNumber="96003">B. neukoeln</emphasis>
</taxonomicName>
<normalizedToken originalValue="Jäger">Jaeger</normalizedToken>
, 2022 (see
<bibRefCitation author="Jaeger, P" journalOrPublisher="Zootaxa" pageId="0" pageNumber="96003" pagination="1 - 200" refId="B8184614" refString="Jaeger, P, 2022. Bowie gen. nov., a diverse lineage of ground-dwelling spiders occurring from the Himalayas to Papua New Guinea and northern Australia (Araneae: Ctenidae: Cteninae). Zootaxa 5170 (1): 1 - 200" title="Bowie gen. nov., a diverse lineage of ground-dwelling spiders occurring from the Himalayas to Papua New Guinea and northern Australia (Araneae: Ctenidae: Cteninae)." volume="5170 (1)" year="2022">
<normalizedToken originalValue="Jäger">Jaeger</normalizedToken>
2022
</bibRefCitation>
: figs 440-446 and 448-460) by having similar dorso-proximal cymbial outgrowth, RTA (Fig.
<figureCitation captionStart="Figure 26" captionStartId="F8184711" captionText="Figure 26. Bowie sabah sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, DPO = dorso-proximal outgrowth of cymbium, E = embolus, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure26" httpUri="https://binary.pensoft.net/fig/751911" pageId="0" pageNumber="96003">26</figureCitation>
a-c) and lateral teeth (Fig.
<figureCitation captionStart="Figure 27" captionStartId="F8184713" captionText="Figure 27. Bowie sabah sp. n. a: Paratype female, epigyne, ventral view; b: Same, vulva, dorsal view; c: Holotype male, habitus, dorsal view; d: Same, habitus, ventral view; e: Paratype female, habitus, dorsal view; f: Same, habitus, ventral view. FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c-f)." figureDoi="10.3897/BDJ.10.e96003.figure27" httpUri="https://binary.pensoft.net/fig/751912" pageId="0" pageNumber="96003">27</figureCitation>
a), but can be distinguished by the embolus tip visible in ventral view (Fig.
<figureCitation captionStart="Figure 26" captionStartId="F8184711" captionText="Figure 26. Bowie sabah sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, DPO = dorso-proximal outgrowth of cymbium, E = embolus, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure26" httpUri="https://binary.pensoft.net/fig/751911" pageId="0" pageNumber="96003">26</figureCitation>
b and Fig.
<figureCitation captionStartId="F8239451" pageId="0" pageNumber="96003">28</figureCitation>
<figureCitation captionStartId="F8239460" pageId="0" pageNumber="96003">e</figureCitation>
; tegular apophysis covering the embolus tip in ventral view in
<taxonomicName lsidName="B. neukoeln" pageId="0" pageNumber="96003" rank="species" species="neukoeln">
<emphasis italics="true" pageId="0" pageNumber="96003">B. neukoeln</emphasis>
</taxonomicName>
), by the tegular apophysis longitudinally orientated (Fig.
<figureCitation captionStart="Figure 26" captionStartId="F8184711" captionText="Figure 26. Bowie sabah sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, DPO = dorso-proximal outgrowth of cymbium, E = embolus, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure26" httpUri="https://binary.pensoft.net/fig/751911" pageId="0" pageNumber="96003">26</figureCitation>
b; tegular apophysis diagonally orientated in
<taxonomicName lsidName="B. neukoeln" pageId="0" pageNumber="96003" rank="species" species="neukoeln">
<emphasis italics="true" pageId="0" pageNumber="96003">B. neukoeln</emphasis>
</taxonomicName>
), by the conductor nearly quadrilateral (Fig.
<figureCitation captionStart="Figure 26" captionStartId="F8184711" captionText="Figure 26. Bowie sabah sp. n., palp, holotype. a: Prolateral view; b: Ventral view; c: Retrolateral view. C = conductor, DPO = dorso-proximal outgrowth of cymbium, E = embolus, RTA = retrolateral tibial apophysis, TA = tegular apophysis. Scale bar: 0.5 mm (a-c)." figureDoi="10.3897/BDJ.10.e96003.figure26" httpUri="https://binary.pensoft.net/fig/751911" pageId="0" pageNumber="96003">26</figureCitation>
b; conductor nearly elliptic in
<taxonomicName lsidName="B. neukoeln" pageId="0" pageNumber="96003" rank="species" species="neukoeln">
<emphasis italics="true" pageId="0" pageNumber="96003">B. neukoeln</emphasis>
</taxonomicName>
) and by the constrictive anterior width/widest width: 1/2 (Fig.
<figureCitation captionStart="Figure 27" captionStartId="F8184713" captionText="Figure 27. Bowie sabah sp. n. a: Paratype female, epigyne, ventral view; b: Same, vulva, dorsal view; c: Holotype male, habitus, dorsal view; d: Same, habitus, ventral view; e: Paratype female, habitus, dorsal view; f: Same, habitus, ventral view. FD = fertilisation duct, LT = lateral teeth, SP = spermathecae. Scale bars: 0.2 mm (a, b), 2.0 mm (c-f)." figureDoi="10.3897/BDJ.10.e96003.figure27" httpUri="https://binary.pensoft.net/fig/751912" pageId="0" pageNumber="96003">27</figureCitation>
a; constrictive anterior width/widest width: 1/3 in
<taxonomicName lsidName="B. neukoeln" pageId="0" pageNumber="96003" rank="species" species="neukoeln">
<emphasis italics="true" pageId="0" pageNumber="96003">B. neukoeln</emphasis>
</taxonomicName>
).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="etymology">
<paragraph pageId="0" pageNumber="96003">Etymology</paragraph>
<paragraph pageId="0" pageNumber="96003">The specific name refers to the type locality and is a noun in apposition.</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="distribution">
<paragraph pageId="0" pageNumber="96003">Distribution</paragraph>
<paragraph pageId="0" pageNumber="96003">
Malaysia (Borneo, type locality; Fig.
<figureCitation captionStart="Figure 1" captionStartId="F8184120" captionText="Figure 1. Distribution records of ctenid spiders from Asia in this study. 1. Amauropelma krabi sp. n.; 2. Am. phangnga sp. n.; 3. Am. saraburi sp. n.; 4. Anahita medog sp. n.; 5. An. popa; 6. Bowie fascination; 7. B. ninhbinh sp. n.; 8. B. vinhphuc sp. n.; 9. B. borneo sp. n.; 10. B. engkilili sp. n.; 11. B. sabah sp. n." figureDoi="10.3897/BDJ.10.e96003.figure1" httpUri="https://binary.pensoft.net/fig/770652" pageId="0" pageNumber="96003">1</figureCitation>
).
</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="dna barcode">
<paragraph pageId="0" pageNumber="96003">DNA Barcode</paragraph>
<paragraph pageId="0" pageNumber="96003">Male (IZCAS-Ar 43732):</paragraph>
<paragraph pageId="0" pageNumber="96003">GGTTTGGAGCTTGAGCTTCTATAGTAGGAACATCTATAAGAGTATTAATTCGTATAGAATTAGGACATTCTGGAAGATTATTAGGAGATGATCATTTATATAATGTAGTTGTTACTGCTCATGCTTTTGTTATGATTTTTTTTATAGTAATGCCTATTTTAATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCTCCTGATATATCTTTTCCTCGAATAAATAATTTATCATTTTGATTACTTCCTCCTTCTTTATTCTTATTATTTATGTCTTCTATAACTGAGATAGGAGTAGGAGCTGGTTGAACAGTATATCCTCCCTTAGCTTCTAGAATAGGACATATGGGAAGATCAATGGATTTTGCTATTTTTTCTCTTCATTTAGCTGGGGCTTCCTCTATTATAGGAGCTATTAATTTTATTTCTACAATTATTAATATACGATTATTGGGAATAAGAATAGAGAAAGTTCCATTATTTGTGTGGTCTGTTTTTATTACTGCGGTATTGTTGTTATTGTCTTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACGGATCGTAATTTTAATACTTCTTTTTTTGACCCAGCTGGGGGGGGGGATCCCATTTTATTTCAACATTTATTTTGATTTTTGC (GenBank accession number OP572111).</paragraph>
<paragraph pageId="0" pageNumber="96003">Female (IZCAS-Ar 43733):</paragraph>
<paragraph pageId="0" pageNumber="96003">GGTTTGGAGCTTGAGCTTCTATAGTAGGAACATCTATAAGAGTATTAATTCGTATAGAATTAGGACATTCTGGAAGATTATTAGGAGATGATCATTTATATAATGTAGTTGTTACTGCTCATGCTTTTGTTATGATTTTTTTTATAGTAATGCCTATTTTAATTGGAGGTTTTGGAAATTGATTAGTTCCTCTAATATTAGGGGCTCCTGATATATCTTTTCCTCGAATAAATAATTTATCATTTTGATTACTTCCTCCTTCTTTATTCTTATTATTTATGTCTTCTATAACTGAGATAGGAGTAGGAGCTGGTTGAACAGTATATCCTCCCTTAGCTTCTAGAATAGGACATATGGGAAGATCAATGGATTTTGCTATTTTTTCTCTTCATTTAGCTGGGGCTTCCTCTATTATAGGAGCTATTAATTTTATTTCTACAATTATTAATATACGATTATTGGGAATAAGAATAGAGAAAGTTCCATTATTTGTGTGGTCTGTTTTTATTACTGCGGTATTGTTGTTATTGTCTTTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACGGATCGTAATTTTAATACTTCTTTTTTTGACCCAGCTGGGGGGGGGGATCCCATTTTATTTCAACATTTATTTTGATTTTTGC (GenBank accession number OP572109).</paragraph>
</subSubSection>
<subSubSection pageId="0" pageNumber="96003" type="note">
<paragraph pageId="0" pageNumber="96003">Note</paragraph>
<paragraph pageId="0" pageNumber="96003">
<taxonomicName lsidName="B. sabah" pageId="0" pageNumber="96003" rank="species" species="sabah">
<emphasis italics="true" pageId="0" pageNumber="96003">B. sabah</emphasis>
</taxonomicName>
sp. n. belongs to the
<emphasis italics="true" pageId="0" pageNumber="96003">scarymonsters</emphasis>
-species group because of the abovementioned characteristics, so the &quot;diagonally orientated TA&quot; in the diagnosis of the
<emphasis italics="true" pageId="0" pageNumber="96003">scarymonsters</emphasis>
-species group in
<bibRefCitation author="Jaeger, P" journalOrPublisher="Zootaxa" pageId="0" pageNumber="96003" pagination="1 - 200" refId="B8184614" refString="Jaeger, P, 2022. Bowie gen. nov., a diverse lineage of ground-dwelling spiders occurring from the Himalayas to Papua New Guinea and northern Australia (Araneae: Ctenidae: Cteninae). Zootaxa 5170 (1): 1 - 200" title="Bowie gen. nov., a diverse lineage of ground-dwelling spiders occurring from the Himalayas to Papua New Guinea and northern Australia (Araneae: Ctenidae: Cteninae)." volume="5170 (1)" year="2022">
<normalizedToken originalValue="Jäger">Jaeger</normalizedToken>
(2022)
</bibRefCitation>
should be changed to &quot;tegulum bulging proximally at TA base&quot;.
</paragraph>
</subSubSection>
</treatment>
</subSection>
</document>