Integrative characterisation of the Northwestern European species of Anacharis Dalman, 1823 (Hymenoptera, Cynipoidea, Figitidae) with the description of three new species Author Vogel, Jonathan 0000-0002-7102-0231 Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany Author Forshage, Mattias Swedish Museum of Natural History, Department of Zoology, P. O. Box 50007, 104 05 Stockholm, Stockholms län, Sweden Author Bartsch, Saskia B. Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany Author Ankermann, Anne Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany Author Mayer, Christoph 0000-0001-5104-6621 Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany Author von Falkenhausen, Pia Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany Author Rduch, Vera 0000-0002-6499-2876 Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany Author Müller, Björn 0000-0001-6233-5410 Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany Author Braun, Christoph https://orcid.org/0009-0003-1312-5953 Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany Author Krammer, Hans-Joachim https://orcid.org/0009-0008-7012-1752 Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany Author Peters, Ralph S. 0000-0001-7784-9203 Leibniz Institute for the Analysis of Biodiversity Change, Museum Koenig Bonn, Adenauerallee 127, 53113 Bonn, North Rhine-Westphalia, Germany text Journal of Hymenoptera Research 2024 2024-08-29 97 621 698 journal article 10.3897/jhr.97.131350 EA190992-B01B-4F1B-A362-A4549C725580 Anacharis typica Walker, 1835 stat. rev. Figs 2 D , 3 D , 17 A – E Anacharis typicus Walker, 1835: 520 - lectotype ( NHMUK ) ♀ , photographs examined (Fig. 16 A – C ). Diagnosis (n = 10). Belongs to the eucharioides species group . Medium sized species (2.9–3.5, mean 3.2 mm , similar to A. eucharioides , A. martinae and A. petiolata ). Differing from A. eucharioides and A. martinae by having a centrally smooth mesoscutellum (Fig. 17 D, E , centrally carinate in A. eucharioides and A. martinae ) and a smooth lateromedial area of the pronotum (Fig. 17 B , rugose to obliquely carinate in A. eucharioides and A. martinae ). Differs from A. petiolata mainly by having the hind coxa often distinctly bicoloured, with noticable paling apically (Fig. 17 A , hind coxa less distinctly bicoloured, though weak paling is notable apically in A. petiolata ). The hind trochanter in A. typica has a similar pattern of paling as hind coxa or is as pale as in hind femur (hind trochanter similarly dark as the hind coxa in A. petiolata ). Additional to morphological differences, A. typica is exclusively collected in temperate environments below 700 meters above sea level (whilst A. petiolata is collected from boreal environments above 1,000 meters above sea level). Anacharis typica , female ( ZFMK -TIS-2640806 ) A habitus B mesosoma lateral C face D mesosoma dorsal E mesosoma posterior view. CO 1 barcode. n = 10. Maximum intraspecific distance: 0.5 %. Minimum distance to closest species ( A. eucharioides ): 5.7 %. CO 1 barcode consensus sequence: AATTTTATACTTTATTTTAGGAATTTGATCAGGAATAATAGGATCAAGATTAAGAATAATTATTCGAAT AGAATTAGGGACCCCCTCTCAATTAATTATAAATGATCAAATTTATAACTCAATTGTAACTGCTCATGCA TTTATTATAATTTTCTTTATAGTCATACCTATTATAGTAGGAGGATTCGGAAATTATTTAGTGCCTTTAA TATTAATCTCTCCTGATATAGCTTTCCCCCGATTAAATAATTTAAGATTTTGATTTTTAATCCCCTCTTT ATTTTTAATAACAATTAATTTATTTATTGACCAAGGAGCAGGAACAGGGTGAACTGTATACCCCCCATTA TCATCACTCACAGGTCATCCATCTATATCGGTAGATTTAGTTATTTATTCATTACATTTAAGTGGAATTT CCTCAATTCTTGGTTCTATTAATTTTATTGTAACCATTTTAAATATACGAATAACTGTTATATCTATAGA CAAAATTTCATTATTTATTTGATCTATTTTTTTAACTACAATTTTATTATTATTATCTTTACCAGTACTA GCAGGAGGTTTAACTATATTACTATTTGATCGAAATTTAAATACATCTTTTTTTGACCCTACAGGAGGAG GGGATCCAATCCTTTATCAACACTTATTT Type material. Lectotype of Anacharis typicus Walker, 1835 81 61 [on backside of mounting board] 2. Type In Coll under typical B. M. 1981. Under typica LECTOTYPE LECTOTYPE Anacharis typica Walker det. N. D. M. Fergusson, 1981 B. M. TYPE HYM 7. 163 [QR code] NHMUK 012858913 [for images, see Fig. 16 A – C and https://data.nhm.ac.uk/dataset/56e711e6-c847-4f99-915a-6894bb5c5dea/resource/05ff2255-c38a-40c9-b657-4ccb55ab2feb/record/10470199 ] Other material examined. DNA barcode vouchers. Austria • 1 ♂ ; Styria , NP Gesäuse , Gsengquelle ; 47.5683 ° N , 14.5902 ° E ; ca 680 m a. s. l. ; 2 Sep. 2015 ; Haseke leg.; ZFMK -TIS-2640691 . Belgium • 1 ♀ ; West Flanders , Beernem , Centrum ; 51.1259 ° N , 3.3202 ° E ; ca 10 m a. s. l. ; 8 May 2022 ; De Ketelaere , Augustijn leg.; hand picked ; ZFMK -TIS-2640858 . • 1 ♀ ; West Flanders , Beernem , Gevaerts ; 51.1411 ° N , 3.3215 ° E ; ca 10 m a. s. l. ; 24 Apr. 2022 ; De Ketelaere , Augustijn leg.; hand picked ; ZFMK -TIS-2640857 . Germany • 1 ♀ ; Hesse , Waldeck-Frankenberg , National park Kellerwald-Edersee , Maierwiesen ; 51.1555 ° N , 9.0015 ° E ; ca 370 m a. s. l. ; 22 Jun. - 8 Jul. 2021 ; GBOL III leg.; Malaise trap (Krefeld version) ; ZFMK -TIS-2640806 . • 3 ♂♂ ; Hesse , Waldeck-Frankenberg , NP Kellerwald-Edersee , „ Banfe-Haus “; 51.167 ° N , 8.9749 ° E ; ca 270 m a. s. l. ; 7–21 Jul. 2022 ; GBOL III leg.; Malaise trap ; ZFMK -TIS-2640757 , ZFMK -TIS-2640758 , ZFMK -TIS-2640760 . • 1 ♀ ; Mecklenburg-Vorpommern , Vorpommern-Rügen , Großer Vilm , Biosphärenreservat ; 54.325 ° N , 13.539 ° E ; ca 30 m a. s. l. ; 24 May- 3 Jun. 2016 ; Rulik , Björn et al. leg.; Malaise trap ; ZFMK -TIS-2629503 . • 1 ♀ ; North Rhine-Westphalia , Rhein-Sieg-Kreis , Schladern near Windeck , Sieg river , right river bank ; 50.8 ° N , 7.585 ° E ; ca 130 m a. s. l. ; 4–11 Jul. 2017 ; ZFMK et al. leg.; Malaise trap ; ZFMK -TIS-2629276 . Lithuania • 1 ♀ ; Silute distr. , Sysa , Sysa , control plot ; 55.3127 ° N , 21.4049 ° E ; ca 0 m a. s. l.; 14–25 Jun. 2020 ; Petrasiunas , Andrius leg.; Malaise trap ; ZFMK -TIS-2637717 . Material without DNA barcode. Belgium • 2 ♂♂ ; Walloon Brabant , Ottignies ; 9–16 Jul. 1983 ; Paul Dessart leg.; Malaise trap ; JV_Prel_0074 ( RBINS ), JV_Prel_0045 ( RBINS ) . • 2 ♂♂ ; same collection data as for preceding 28 May- 4 Jun. 1983 ; JV_Prel_0075 ( RBINS ), JV_Prel_0076 ( RBINS ) . • 1 ♂ ; West Flanders , Harelbeke , Gavers , Wetland with pools ; 50.8379 ° N , 3.3215 ° E ; ca 10 m a. s. l. ; 11 Jun. 2022 ; Bart Lemey leg.; hand caught ; JV_Prel_0052 ( RBINS ) . Germany • 1 ♂ ; Hesse , Werra-Meißner-Kreis , Großalmerode , Private garden, Siedlerweg , semi-abandoned garden with wet spot, ivy hedge and salix ; 51.2591 ° N , 9.7871 ° E ; ca 380 m a. s. l. ; 12–20 Jul. 2022 ; Jonathan Vogel leg.; Malaise trap ; ZFMK -TIS-2640704 . • 1 ♂ ; North Rhine-Westphalia , Rhein-Sieg-Kreis , Schladern near Windeck , Sieg river , right river bank ; 50.8 ° N , 7.585 ° E ; ca 130 m a. s. l. ; 18–25 Jul. 2017 ; ZFMK et al. leg.; Malaise trap ; ZFMK -HYM-00039677 . • 2 ♂♂ ; same collection data as for preceding 1–8 Aug. 2017 ; ZFMK -HYM-00039674 , ZFMK -HYM-00039675 . Italy • 1 ♂ ; Val d’Aoste , Boertolaz , (Villeneuve); ca 800 m a. s. l. ; 15 Sep. 1978 ; L. Martile leg.; Malaise trap ; NHRS - HEVA 000023180 ( NHRS ) . Sweden • 1 ♂ ; Gotland , Eksta sn, Stora Karlsö , calcarous low herb pasture ; 57.2873 ° N , 17.9775 ° E ; ca 40 m a. s. l. ; 26–29 Aug. 2014 ; Hymenoptera Inventory 2014 leg.; Malaise trap ; MT Loc # 2; NHRS - HEVA 000023181 ( NHRS ) . • 1 ♂ ; Gotska sandön , Kapellängen ; 7 Jul. 1964 ; Bror Hanson leg.; NHRS - HEVA 000023182 ( NHRS ) . • 1 ♂ ; Öland , Glömminge , Gillsättra ; 4 Aug. 2004 ; Mattias Forshage leg.; specimen in coll MF . • 1 ♀ ; Öland , Kastlösa ; 26 Jun. 1962 ; Karl-Johan Hedqvist leg.; NHRS - HEVA 000023198 ( NHRS ) . • 1 ♂ ; Öland , Kastlösa ; 28 Jun. 1962 ; Tor-Erik Leiler leg.; NHRS - HEVA 000023197 ( NHRS ) . • 2 ♂♂ ; Scania , Kristianstads kommun , Trunelän , Degeberga , Grazed meadow at alder stand along stream ; 55.7746 ° N , 14.2156 ° E ; ca 80 m a. s. l. ; 1–13 Aug. 2019 ; Swedish Insect Inventory Programme (SIIP), Station Linné leg.; Malaise trap ; NHRS - HEVA 000023184 ( NHRS ), NHRS - HEVA 000023185 ( NHRS ) . • 1 ♂ ; Scania , Lomma ; 10 Jul. 1963 ; Hans von Rosen leg.; NHRS - HEVA 000023188 ( NHRS ) . • 1 ♂ ; same collection data as for preceding 13 Aug. 1963 ; NHRS - HEVA 000023189 ( NHRS ) . • 2 ♀♀ ; same collection data as for preceding 14 Aug. 1963 ; NHRS - HEVA 000023186 ( NHRS ), NHRS - HEVA 000023187 ( NHRS ) . • 1 ♂ ; Scania , Saxtorp ; 5 Jun. 1961 ; Karl-Johan Hedqvist leg.; NHRS - HEVA 000023183 ( NHRS ) . • 1 ♂ ; Scania , Stenshuvuds NP , lush mixed oak forest ; 55.6603 ° N , 14.2755 ° E ; ca 30 m a. s. l. ; 22 Sep. - 1 Nov. 2004 ; Swedish Malaise Trap Project (Swedish Museum of Natural History) leg.; Malaise trap ; NHRS - HEVA 000023190 ( NHRS ) . • 1 ♀ , 1 ♂ ; Småland ; [18 xx]; Carl Henning Boheman leg.; female - NHRS - HEVA 000023191 ( NHRS ); male - NHRS - HEVA 000023192 ( NHRS ) . • 1 ♂ ; Södermanland , Tockenön Jul. 1950 ; Anton Jansson leg.; NHRS - HEVA 000023193 ( NHRS ) . • 1 ♂ ; Uppland , Vallentuna ; 7 Jun. 1959 ; Karl-Johan Hedqvist leg.; NHRS - HEVA 000023195 ( NHRS ) . • 1 ♀ ; same collection data as for preceding 15 Sep. 1962 ; NHRS - HEVA 000023194 ( NHRS ) . • 1 ♂ ; Västmanland , Köping ; 18 May 1975 ; Walter Siering leg.; NHRS - HEVA 000023196 ( NHRS ) . Switzerland • 1 ♀ ; Grisons , Pontresina ; unknown leg.; specimen at NMBE . Biology. Summer species, flying mainly from April to September, peak in July. No clear preferences in terms of habitat. Distribution. Austria , Belgium , Germany , Italy , Lithuania , Sweden , Switzerland , United Kingdom (locus typicus of A. typica : southern England , near London or Isle of Wight ). Found in elevations up to 400 m a. s. l., rarely up to 800 m a. s. l. Remarks. The specimen labelled as lectotype is clearly a female, not a male as stated by Fergusson (1986) . Despite this incongruence we acknowledge the specimen labelled as lectotype by Fergusson as such. The lectotype is glued to its ventral side on cardboard, face down, wings also glued to the board. It is overall intact, though the 13 th antennal segment is either broken in half and the fragment is lost, or the segment is malformed. The tarsomeres of the right fore leg are missing from second tarsomere onwards. Both wings and legs obscure the lateral mesosoma on both sides. With 2.6 mm body length, the lectotype is a comparably small specimen of this species (average body length 3.2 mm ). Additionally, the lectotype is unusual by its overall reddish colouration, which may have been caused by ageing. Otherwise, it is morphologically well-fitting with the specimens we examined. For a comparison of the similar A. typica and A. petiolata , see the remarks section of A. petiolata . One specimen from Belgium ( JV _Prel_0076 ) was similarly coloured as the Bavarian specimens ( BC- ZSM -HYM-27596 -F 10 & BC- ZSM -HYM-27596 -F 09 , see variation section in description of A. martinae ) of A. martinae , having the head distinctly darker than the otherwise pale body. In the distribution section we only list those records that we can verify by having seen actual specimens. Additional distribution records can be inferred from sequences from BOLD , if they match with our species cluster of A. typica . They were obtained from specimens originating from Canada (e. g. SMTPI 9646-14). The identities of these sequences as A. typica need to be confirmed by examination of the physical specimens before reliably citing A. typica for Canada .