Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) Author Tedersoo, Leho Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia Author Magurno, Franco 0000-0002-3117-8149 Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland Author Alkahtani, Saad 0000-0001-7381-5110 Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia Author Mikryukov, Vladimir 0000-0003-2786-2690 Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia text MycoKeys 2024 2024-08-09 107 249 271 journal article 10.3897/mycokeys.107.125549 Nikkaluokta mahdiehiae Tedersoo sp. nov. Diagnosis. Separation from other species of Nikkaluokta based on the ITS region (positions 97–116 cctgggcaaatttttttttc; one mismatch allowed) and LSU (positions 687–717 cttggatataagaagtggaatctacacaaat; one mismatch allowed) as indicated in Fig. 12 . Figure 12. Diagnostic barcodes for Nikkaluokta mahdiehiae relative to closely-related taxa in ITS 2 and LSU. Type. Soil eDNA sample TUE 100497 ( holotype ); eDNA sequence EUK 1203196 ( lectotype ); subarctic Pinus sylvestris forest (soil sample TUE 000497 ) in Nikkaluokta , Sweden , 67.85596 ° N , 19.47575 ° E . Description. Other sequences: EUK 1203537 (type locality) and EUK 1603797 ( GSMc plot G 5003, Pinus sylvestris forest soil in Naissaare, Estonia , 59.56340 ° N , 24.54510 ° E ). Etymology. Nikkaluokta (Sami) refers to type locality; and Mahdieh (Persian) refers to the first name of Mahdieh Hosseyni Moghaddam who sequenced the type materials using target capture protocols. Notes. Found in Sweden and Estonia , with ITS and LSU sequences displaying up to 1 % and 0.2 % differences, respectively.