Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Oligoria ( Oligoria ) obtena Grishin , new species https://zoobank.org/ 74FCABDE-324D-4C60-A191-BD4C1E8F1B3B ( Fig. 4 part, 101–102, 324–327) Definition and diagnosis. Phylogenetic analysis of specimens from Ecuador identified as Oligoria lucifer (Hübner, [1831]) ( type locality in Suriname ) reveals that they are not monophyletic with it and instead are sister to both Oligoria maculata (W. H. Edwards, 1865) ( type locality in USA : Louisiana ) and Oligoria percosius (Godman, 1900) ( type locality in Mexico , Guatemala , and Panama ), being genetically differentiated from them ( Fig. 4 ): e.g., COI barcodes of Ecuadorian specimens differ from O. maculata and O. percosius by 5.3% (35bp) and 4.6% (30 bp), respectively, and therefore they represent a new species. This new species keys to “ Decinea lucifer ” (L.11.8) in Evans (1955) but differs from its relatives by a small spot and reduced pale overscaling around it in ventral forewing cell CuA 2 -1A+2A. Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3446.8.5:C48T, aly3446.8.5:T87C, aly127.87.2:C51T, aly127.87.2:G75A, aly903.2.14:T860C, and COI barcode: A166G, T277A, T530C, T553A, A628T. Barcode sequence of the holotype . Sample NVG-18118B05, GenBank OR837669, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGATTATTAATTCGTACAGAATTAGGTAATCCAGGATCATTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTCGGAAATT GATTAGTTCCTTTAATATTAGGAGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGAATGTTACCCCCCTCATTAACATTATTAAT TTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTATCCTCCTTTATCTTCTAATATTGCCCACCAAGGATCTTCTGTTGATTTA GCAATTTTTTCCCTTCATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCAT TTGATCAAATACCTTTATTTGTTTGATCTGTAGGTATTACTGCTCTATTATTACTTTTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTACT TACTGATCGAAATCTTAATACCTCATTTTTTGATCCAGCAGGAGGTGGTGATCCAATTTTATACCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 101–102 , bears the following five rectangular labels, four white: [ ECUADOR : Napo Prov | 4 km Tena-Pano Rd | 1° 02′S , 77 ° 50′W | 28 Sep 1990 600 m | DH Ahrenholz leg | SS Nicolay curator], [ Decinea | lucifer ♂ | Det. Hbn | S.S. Nicolay ], [DNA sample ID: | NVG-18118B05 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01531769], and one red [ HOLOTYPE ♂ | Oligoria (Oligoria) | obtena Grishin ] . Paratype : 1♂ NVG-18118B07, USNMENT_01531771 Ecuador : Napo , Jatun Sacha Biological Reserve, GPS −1.0667 , −77.6000 , 30-Sep-1991 , D. H. Ahrenholz leg., genitalia H1096 ( Fig. 324–325 ) [ USNM ]. Type locality. Ecuador : Napo Province , km 4 of Tena-Pano Rd., elevation 600 m , GPS −1.033 , −77.833 . Etymology. In Latin, obtenebro means darken, make dark, obscure, or conceal. The name is given for the reduced pale scaling near the ventral forewing tornus compared to its congeners and is a noun in apposition. Distribution. Currently known only from the Napo Province in Ecuador .