Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Clito congruens Grishin , new species https://zoobank.org/ 1F3053D3-130E-4382-894F-8C5A3EEE0D70 ( Fig. 3 part, 89–90, 310–311) Definition and diagnosis. Phylogenetic analysis of specimens from Panama and Guatemala identified as Clito aberrans (Draudt, 1924) (type locality in Brazil : Amazonas, holotype sequenced as NVG-18093A08) reveals their genetic differentiation at the species level ( Fig. 3 ): e.g., COI barcodes differ by 2% (13 bp). This species does not have an available name and is, therefore, new. This new species keys to “ Clito clito ” (which is C. aberrans ) (E.52.3) in Evans (1953) and differs from its relatives by narrower lobe of ampulla that is twisted perpendicular to the plane of valva and extends inward, closely approaching the dorsal end of harpe with its distal margin; both this lobe over its entire surface and harpe distally are serrated ( Fig. 310–311 ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2388.3.1 :G181A, aly6940.3.8:G84C, aly 1689.4.2 :T51C, aly1779.17.11:A168G, aly151.30.3:A30G, and COI barcode: T49C, A79A, T85T, C235C, T284T, T653C. Barcode sequence of the holotype . Sample NVG-14064A06, GenBank OR837663, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGATCAGGAATAGTGGGAACTTCCTTAAGTATATTAATTCGAACTGAATTAGGAAATCCTGGATCTTTAATT GGAGATGACCAAATTTATAATACTATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCAATTATAATCGGAGGATTTGGAAATT GATTAGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAATATTATTAAT TTCAAGTAGTATTGTAGAAAATGGTGCAGGAACAGGGTGAACTGTTTACCCCCCTTTATCTGCTAATATTGCCCATCAAGGATCTTCTGTAGATTTA GCTATTTTCTCATTACACTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGTGTTAGAAATTTATCAT TTGATCAAATACCTTTATTTGTATGAGCAGTAGGTATTACTGCACTATTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACAATACTTTT AACAGATCGAAATTTAAATACATCTTTTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATCTATTT Type material. Holotype : deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 89–90 , bears the following three rectangular labels, two white: [ PANAMA : CANAL ZONE | Gatun | 9° 17′W 79° 57′W | 10.XII.1978 | leg. G.B.Small ], [DNA sample ID: | NVG-14064A06 | c/o Nick V . Grishin ], and one red [ HOLOTYPE | Clito congruens | Grishin ] . Paratypes : 1♂ and 2♀♀ in [ USNM ]: 1♂ NVG-14064A08 Panama : Colon , 1000′, 6-Jan-1973 , G. B. Small leg. ; 2♀♀ Guatemala : Cayuga, around 1900, Schaus and Barnes collection: NVG-14064B06 May, genitalia No. X-6371 J. M. Burns 2006 and NVG-14064B07 April . Type locality. Panama : Colón Province , Gatún, GPS 9.2833 , −79.9500 . Etymology. In Latin, aberrans means wandering, straying, or deviating. The word congruens means agreeing, according, or consistent and is an antonym of aberrans . The name is a present active participle in the nominative case. Distribution. Currently known from Guatemala and Panama .