Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Cycloglypha corax Grishin , new species https://zoobank.org/ D267A571-CE78-45DD-B5D4-1C5BB65E9556 ( Fig. 3 part, 91–92, 312–314) Definition and diagnosis. Phylogenetic analysis of specimens from Southeast and Southern Brazil identified as Cycloglypha tisias (Godman and Salvin, 1896) ( type locality in Costa Rica , Panama , and Brazil : Amazon Valley) reveals their genetic differentiation ( Fig. 3 ): e.g., COI barcode difference of 2% (13 bp), and suggests that they are a new species. This new species keys to C. tisias (F.9.2) in Evans (1953) and differs from its relatives by typically stronger outlined and less diffuse postdiscal and subapical brown spots inside yellower posterior area of ventral hindwing ( Fig. 92 ), dorsally directed tooth on right harpe narrower, harpe distal end stronger bent dorsad, and right valva with bigger and more robust, rhomboid-shaped process on ampulla ( Fig. 312–314 ). Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly3241.4.3:T126C, aly10226.17.12:C156T, aly 1872.5.1 :A228G, aly 1405.12.15 :C54T, aly 1283.1.11 :A26C, and COI barcode: T187C, A211G, A217G, T235T, T394C, A550G. Barcode sequence of the holotype . Sample NVG-19112H01, GenBank OR837664, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCATTAATT GGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCAATTATAATCGGAGGATTCGGAAATT GATTAGTACCTTTAATGTTAGGGGCTCCTGATATAGCATTTCCACGAATAAATAATATAAGATTTTGATTATTACCCCCTTCATTAATATTATTAAT TTCAAGAAGAATCGTAGAAAATGGAGCAGGTACAGGTTGAACAGTTTACCCCCCTCTTTCAGCTAATATTGCTCATCAAGGTTCTTCAGTAGATTTA GCTATCTTTTCATTACATTTAGCTGGAATTTCCTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCAT TTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACAGCTTTACTTTTATTACTTTCTTTGCCTGTATTAGCAGGAGCTATTACTATACTTTT AACTGATCGAAATTTAAATACATCTTTTTTTGATCCAGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT Type material. Holotype : ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 91–92 , bears the following five rectangular labels, four white: [ RIO de JAN | GUA, BRAZIL |13 Aug 64], [Collection of | Bryant Mather], [DNA sample ID: | NVG-19112H01 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01602089], and one red [ HOLOTYPE ♂ | Cycloglypha | corax Grishin ] . Paratypes : 2♂♂ from Brazil : NVG-19112G05, USNMENT_01602081 Rio de Janeiro , Itatiaia National Park , 800 m , GPS −22.450 , −44.617 , 22-Feb-1995 , A. Caldas and students leg. [ USNM ] ; and NVG-15092B05 Santa Catarina, Fazenda Alpina , nr. Joinville , 25-Feb-1985 , J. Y. Miller leg. [ MGCL ] . Type locality. Brazil : Rio de Janeiro , Guadalupe . Etymology. Tisias and Corax were founders of ancient Greek rhetoric, and Corax was Tisias’s teacher. Although Corax and Tisias might have been the same person (Wikipedia contributors 2023), C. corax is a species distinct from but sister to C. tisias . The name is a noun in apposition. Distribution. Southeast and Southern Brazil .