Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Festivia peruvia Grishin , new species https://zoobank.org/ 15FFE992-AC82-4640-864B-5C549EB970CD ( Fig. 3 part, 93–94, 315–317) Definition and diagnosis. Genomic analysis reveals that a female from Tingo Maria, Peru , identified as Festivia grippa ( Evans, 1953 ) ( type locality in eastern Ecuador ), is genetically differentiated from it ( Fig. 4 ), e.g., COI barcode difference of 2.3% (15 bp) and because no published names apply to it, represents a new species. This new species keys to “ Sostrata grippa ” (E.42.5) in Evans (1953) and differs from its relatives by a combination of the following characters: forewing discal cell with one large upper hyaline spot (lower spot absent), the two segments of the hyaline spot in forewing cell CuA 1 -CuA 2 are connected to each other at their bases on both dorsal and ventral sides, ventral forewing blue basal overscaling broader, extends from costa to cover discal cell, cell CuA 2 -1A+2A with a pale spot at 1/3 from its base, ventral hindwing with an apical blue spot and the dark brown streak in cell Sc+R 1 -RS is smaller and separated from vein Sc+R 1 by blue ( Fig. 93–94 ). Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2700.10.9 :G42A, aly300.20.2:G126A, aly116.12.4:G66T, aly 2578.2.1 :A22C, aly536.138.7:A319C, aly 1260.2.1 :T124T (not C), aly10226.27.3:A51A (not T), aly4523.3.2:C153C (not T), aly235.8.17:T150T (not C), aly10235.5.16:C81C (not T), and COI barcode: T139C, T287C, T319A, 514T, A526T, T619C. Barcode sequence of the holotype . Sample NVG-18032A01, GenBank OR837665, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACCTCACTAAGAATATTAATTCGAACTGAATTAGGAAACCCCGGATCTTTAATT GGAGATGATCAAATTTATAACACTATTGTTACAGCTCATGCCTTTATTATAATTTTTTTCATAGTTATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTCCCACTTATACTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAATACTGCTAAT TTCAAGAAGAATTGTAGAAAATGGAGCAGGTACTGGATGAACTGTTTACCCCCCTCTTTCTGCTAATATTGCTCACCAGGGCTCTTCTGTAGATTTA GCTATTTTTTCATTACATTTAGCTGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCTT TTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACTGCATTATTATTATTACTTTCACTACCAGTATTGGCTGGTGCTATTACTATACTATT AACAGATCGAAATTTAAATACTTCCTTTTTTGATCCCGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT Type material. Holotype : ♀ currently deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 93–94 , bears the following four rectangular printed labels, three white: [ PERU : Huanuco | Tingo Maria, 800 m . | May – June , 1994], [DNA sample ID: | NVG-18032A01 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01466114], and one red [ HOLOTYPE ♀ | Festivia | peruvia Grishin ]. Type locality. Peru : Huánuco , Tingo Maria, elevation 800 m . Etymology. The name derives from the country of the type locality and is a feminine adjective. Distribution. Currently known only from the holotype collected in Peru .