Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Gindanes variegatus Grishin , new species https://zoobank.org/ 1855A4ED-6F31-4ED4-9416-C43CDC581D57 ( Fig. 2 part, 39–40, 252–253) Definition and diagnosis. A specimen from Mato Grosso , Brazil , identified (incorrectly) as Gindanes homer ( Evans, 1953 ) ( type locality in Brazil : Mato Grosso ) is genetically differentiated from it ( Fig. 2 ): e.g., COI barcodes differ by 4.9% (32 bp). The new species keys (incompletely) to “ Pythonides homer ” (E.41.10) or “ Pythonides herennius herennius ” (E.41.7a) in Evans (1953) and differs from them and Gindanes nides (Mielke and Casagrande, 2002) ( type locality in Brazil : Espírito Santo ) by a more variegated appearance, larger forewing hyaline spots, conjoined forewing cell spots, and more extensive whitish coloration of ventral hindwing that includes its anterior part: a prominent central brown spot near costa is framed by white on both sides. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly26.1.2:C18T, aly4305.19.19:G123A, aly4305.19.19:G120T,aly264.4.18:C93T,aly253.13.3:G99A, aly276558.27.2:C121C (not A), aly276558.27.2:C144C (not T), aly 1158.11.3 :G702G (not A), aly1281.15.3:C82C (not G), aly6954.10.6:C1206C (not T), and COI barcode: A22G, T121T, C205C, C343G, T442C. Barcode sequence of the holotype . Sample NVG-19087G12, GenBank OR837639, 658 base pairs: AACTTTATATTTTATTTTTGGGATTTGGGCAGGAATAATTGGAACATCTTTAAGCCTACTAATTCGAACTGAATTAGGTAATCCAGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATT GATTAGTACCCTTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGAATAAACAATATAAGATTTTGATTATTACCTCCATCTTTATTATTATTAAT TTCAAGAAGTATTGTTGAAAATGGAGCAGGAACAGGATGAACTGTTTATCCGCCTCTTTCTGCTAATATTGCTCATCAAGGTTCATCTGTAGATTTA GCTATTTTTTCTTTACATTTAGCAGGTATTTCCTCAATTTTAGGAGCTATTAACTTTATTACTACAATTATTAATATACGAATTAATAATCTTTCAT TTGATCAAATACCTTTATTTATTTGAGCAGTGGGAATTACAGCATTACTTTTATTATTATCTCTTCCTGTTTTAGCAGGTGCTATTACTATATTATT AACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGTGGGGGTGATCCAATCTTATATCAACATTTATTT Type material. Holotype : ♂ currently deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 39–40 , bears the following four rectangular labels, three white: [ BRASIL : Mato Grosso | Diamantino, 350–400m | Alto Rio Arinos | 14°13′S 56°12′W | 18 August 1990 | Leg. E. Furtado ], [DNA sample ID: | NVG-19087G12 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01588890], and one red [ HOLOTYPE ♂ | Gindanes | variegatus Grishin ]. Type locality. Brazil : Mato Grosso , Diamantino, Alto Rio Arinos, elevation 350-400 m , GPS −14.217 , −56.200 . Etymology. The name is given for the variegated appearance of this species. The name is a masculine perfect passive participle. Distribution. Known only from the holotype collected in Brazil : Mato Grosso .