Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Myrinia manchada Grishin , new species https://zoobank.org/ F341D06C-4741-4C54-ABCE-A7BD83C5C264 ( Fig. 2 part, 67–68, 282–284) Definition and diagnosis. Sequencing of the holotype of Myrinia laddeyi (E. Bell, 1942) (type locality in Ecuador ) revealed that it is a species related to Myrinia binoculus (Möschler, 1877) (type locality in Suriname ) and not the species Evans (1953) identified as M. laddeyi ( Fig. 2 ). Therefore, the species that Evans misidentified as M. laddeyi does not have an available name and is new. In USNM, we found a specimen that keys to E. 24.4 in Evans (1953) and is distinguished from its relatives, including the true M. laddeyi , by larger size (forewing typically longer than 21 mm ), more segments in nudum (more than 25 segments), the lack of eyespot on the ventral forewing, large dark tornal spot on the ventral hindwing, short and rounded harpe of the right valva, style of the left valva longer than harpe. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly798.33.50:A117G, aly 2149.2.8 :G45A, aly38.5.1:T141C, aly767.7.2:T78C, aly767.7.2:T468A, aly651.4.5:T106T (not C), aly536.173.2:C78C (not T), aly17.12.4:C112C (not T), aly17.12.4:A336A (not G), aly 1022.2.1 :G96G (not A), and COI barcode: T82C, 277C, T364A, T352C, T386C. Barcode sequence of the holotype . Sample 11-BOA-13383A10, GenBank OR837652, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACATCTTTAAGTTTATTAATTCGAACTGAATTAGGTAACCCAGGATCATTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATT GACTTGTACCATTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCCTTAATATTATTAAT CTCCAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACTGTTTATCCCCCTTTATCCGCTAATATTGCACACCAAGGATCTTCAGTAGACCTA GCTATTTTTTCTCTACATTTAGCTGGAATTTCATCTATTTTAGGAGCTATCAATTTTATTACAACAATTATTAATATACGTATTAATAATCTTTCAT TTGATCAAATACCATTATTCGTTTGAGCTGTAGGAATCACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATACTTCT AACAGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT Type material. Holotype : deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 67–68 , bears the following five rectangular labels, four white: [ GUYANA : Region 8 | Potaro River nr. Tukeit | 250′ – 1000′ | 18-23 Mar 1999 | leg. S. Fratello ], [DNA sample ID: | 11-BOA-13383A10 | c/o Nick V . Grishin ], [DNA sample ID: | NVG-22034H05 | c/o Nick V . Grishin ], [{ QR Code }| USNM ENT 00232398 ], and one red [ HOLOTYPE | Myrinia | manchada Grishin ] . Paratype : 1♂ : NVG-23026F10, EL83681 French Guiana, Saint-Laurent-du-Maroni, 1905, E. Le Moult leg. [ MNHP ]. Type locality. Guyana : Potaro-Siparuni Region , Potaro River nr. Tukeit. Etymology. In Spanish, manchada means stained, spotted, spotty, or smudgy. The name is given for the large tornal spot on the ventral hindwing and is a noun in apposition. Distribution. The Guianas.