Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Flaccilla lactea Grishin , new species https://zoobank.org/ CB051F7E-A99E-4DE6-B233-993276D1F393 ( Fig. 7 part, 189–190, 425–426) Definition and diagnosis. Sequencing of an unusual specimen of Flaccilla Godman, 1901 ( type species Papilio aecas Stoll, 1781 ) from Peru with largely cream-colored ventral hindwing confirms its expected prominent genetic differentiation from F. aecas ( type locality in Surinam ) ( Fig. 7 ): e.g., their COI barcodes differ by 7% (46 bp), and therefore it represents a new species. This new species (incompletely) keys to “ Aecas aecas ” (J.13.1) in Evans (1955) but differs from it by the lack of purple sheen on the ventral side and hindwing cream in color with discal brown spots and brown marginal spots nearly fused into a band. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly123.8.1:A51T, aly123.8.1:T72G, aly1779.16.4:C84T, aly1779.16.4:G111A, aly13170.2.2:A27G, aly1139.48.20:T97T (not C), aly1139.48.20:G102G (not A), aly499.35.1:G419G (not A), aly 2096.12.3 :A137A (not C), aly 2096.12.3 :T155T (not G), and COI barcode: A35T, T142C, A241T, 484C, T580C. Barcode sequence of the holotype . Sample NVG-19017E11, GenBank OR837709, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGATTATTAGGAACTTCATTAAGATTATTAATTCGGACAGAACTAGGAAACCCAGGTTCTTTAATC GGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATCGGAGGATTTGGAAATT GATTAGTTCCATTAATATTAGGAGCTCCTGACATAGCCTTCCCACGTATAAATAATATAAGATTTTGAATACTACCCCCATCATTAACTTTATTAAT TTCAAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACTGTTTATCCGCCCCTTTCCTCTAATATTGCCCATCAAGGTTCTTCTGTTGATTTA GCAATTTTTTCATTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATCACTACAATTATTAATATACGAATTAAAAATATATCCT TTGATCAAATACCATTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACCATACTCCT TACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTT Type material. Holotype : ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington , DC , USA ( USNM ), illustrated in Fig. 189–190 , bears the following five rectangular labels, four white: [ PERU : Cuzco : Cosñipata Valley | Quebrada Quitacalzón 1,050m . | 13° 01′ 13″S , 71° 29′ 50″W | 12 August 2009 Brian Harris], [ Flaccilla sp. n. ], [DNA sample ID: | NVG-19017E11 | c/o Nick V . Grishin], [USNMENT | {QR Code} | 01532369], and one red [ HOLOTYPE ♂ | Flaccilla | lactea Grishin ]. Type locality. Peru : Cuzco Region , Cosñipata Valley, Quebrada Quitacalzón, elevation 1050 m , GPS −13.020278 , −71.497222 . Etymology. In Latin, lacteus means milky. The name is given for the milky-colored hindwing and is a feminine adjective. Distribution. Currently known only from the holotype collected in the Cosñipata Valley, Peru .