Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Aides nobra Grishin , new species https://zoobank.org/ 3466088D-C59F-48E0-BEE9-4231E4D349A7 ( Fig. 8 part, 199–200, 438–439) Definition and diagnosis. Phylogenetic trees reveal that specimens from Panama identified as Aides ocrinus show prominent genetic differentiation from a syntype of Hesperia ocrinus Plötz, 1882 (type locality in Colombia , NVG-15035A10, see above for its synonymization) ( Fig. 8 ): e.g., their COI barcodes differ by 3.6% (24 bp), and therefore represent a new species. This new species keys to “ Aides ocrinus ” (O.12.6) in Evans (1955) , which he misidentified, and specimens he identified as “ A. ocrinus ” are probably this species. Differs from its relatives by the lack of brands in males, redder (instead of more olive in color) ventral wing coloration, and harpe with broad and rounded end. This species is not cryptic and is diagnosed reliably by phenotype. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly1222.14.21:A112T, aly1222.14.21:A228G, aly7999.4.21:G189A, aly19602.6.1:G288A, aly19602.6.1:G574T, and COI barcode: T10C, T154C, T171C, T367C, A628T. Barcode sequence of the holotype . Sample NVG-18012E05, GenBank OR837714, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGAGCAGGTATATTAGGAACTTCCTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCAGGATCATTAATT GGAGATGATCAAATTTATAATACTATTGTTACTGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCTACTATAATTGGAGGATTTGGAAATT GACTAGTCCCTCTAATACTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCTCCCTCACTTACTTTACTAAT TTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCTCACCAAGGATCATCAGTTGATTTA GCAATTTTTTCTCTTCACTTAGCAGGTATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCTT TTGACCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCTTTATTATTACTTTTATCATTACCAGTATTAGCCGGAGCCATTACAATACTCCT TACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCTGGAGGTGGTGATCCAATTTTATACCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 199–200 , bears the following four rectangular labels, three white: [ COCO SOLO | PANAMA CANAL ZONE | 1 APRIL 1944 | W. M. WAGNER, JR.], [DNA sample ID: | NVG-18012E05 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01450333], and one red [ HOLOTYPE ♂ | Aides nobra | Grishin ] . Paratypes : 3♂♂ and 3♀♀ from Panama, Canal Zone : 1♂ NVG-18012E04, USNMENT_01450332 the same data as the holotype but collected on 30-Mar-1944 ; 1♂ Gulf of Panama nr. Cape Mala , 30-Sep-1024 [ BMNH ] ; 1♂ Pedro Miguel , G. Tryhane leg. [ BMNH ] ; 1♀ 1-Feb-1913 , A. Hall leg. [ BMNH ] ; 2♀♀ [ AMNH ]: NVG-18021C10 no other data than “Panama ” ; and NVG-18021C 11 May-1911 , collection F. E. Watson. Type locality. Panama : Colón Province , Cativá [formerly Coco Solo]. Etymology. The name reflects the lack of brands: no + bra [nds] and is a noun in apposition. Distribution. Currently known only from central Panama .