Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-01-06 2023 969 1 58 journal article 10.5281/zenodo.7710103 1942-1354 7710103 Spicauda atelis Grishin , new species https://zoobank.org/ 7F4E9AFE-1998-487A-BD6F-1841F6CB11EB ( Fig. 1 part, 2, 3a, b, 4) Definition and diagnosis. In addition to species-level status of S. zalanthus , phylogenetic analysis of nuclear genome datasets of specimens identified as Spicauda teleus (e.g., Z chromosome genes, Fig. 1a ) reveals their partitioning into 2 clades. One clade ( Fig. 1 blue) consists of specimens from South America and Panama , including specimens from the Guianas and Brazil , a region with the likely type locality of S. teleus . The other clade ( Fig. 1 red) is North American and does not have an available name. Fst / Gmin statistics for comparison of these two clades (red and blue) are 0.32/0.003 suggesting that they correspond to species-level taxa. Curiously, neither of the two species is monophyletic in mitogenomes ( Fig. 1b ) and their COI barcodes differ by only 0.3-0.6% (2-4 bp). There are no positions in the barcode that consistently differentiate the two species in all specimens we sequenced, suggesting mitochondrial introgression. The new species, represented by the red clade, is sister to S. teleus and keys to it (C.13.13) in Evans (1952) . It differs from S. teleus by a longer terminal spike in male genitalia and by a more robust and humped ampulla-costa, which is higher relative to the harpe and its spike than in S. teleus . Due to the cryptic nature of this species, most reliable identification is achieved by nuclear DNA comparison (not the COI barcodes!) and a combination of the following base pairs in the nuclear genome is diagnostic: aly5021.7.12:C2856T, aly 1779.5.1 :G723A, aly 2085.2.4 :T831A, aly536.8.1:T1305C, and aly536.8.1:C869G. Figure 1. Trees of Spicauda teleus group constructed from protein-coding regions in a) Z chromosome and b) mitochondrial genome: S. atelis sp. n. (red), S. teleus (blue), and S. zalanthus (green) rooted with S. tanna (black). Primary type specimens are labeled in magenta. Statistical bootstrap support values are shown at nodes (regular in nuclear genome trees and ultrafast in mitogenome trees). For each specimen, the name adopted in this work is given first, and a previously used name is listed in square brackets (if different), supplemented with the DNA sample number, type status (see Materials and Methods for abbreviations) and general locality. See Table S1 in the Supplemental file <https://osf.io//vkj6d/> or NCBI database entries for additional data about these specimens. Synonyms are given in parentheses preceded by “=”. The type status refers to this synonym,if the synonym name is provided. The same notations are used throughout this work in other figures showing phylogenetic trees. Barcode sequence of the holotype . Sample NVG-14112D07, GenBank OP984702, 658 base pairs: AACTTTATATTTTATTTTCGGAATTTGAGCAGGATTAGTTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAATACCAGGA TCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTG GAGGATTTGGAAATTGATTAATTCCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGTATAAATAATATAAGATTTTGATTATTAC CCCCATCTTTAACCCTTTTAATTTCAAGAAGCATTGTTGAAAATGGAGCAGGAACTGGATGAACTGTATACCCCCCTTTATCTTCTAA TATTGCCCATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCATCAATTTTAGGAGCTATTAATTTTA TTACAACTATTATTAATATACGAATTAATAATTTATCATTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACAGCTTTATTATTA TTACTTTCATTACCTGTTTTAGCAGGTGCTATTACTATATTATTAACTGATCGAAATTTAAATACCTCATTTTTTGATCCTGCTGGGGGA GGAGATCCTATTTTATACCAACACCTATTT Type material. Holotype : ♂ deposited in the Texas A&M University Insect Collection , College Station , Texas , USA ( TAMU ), illustrated in Fig. 2a , bears the following five rectangular labels, four white: [ TEXAS : | HIDALGO COUNTY | city of Mission | 10 th Street at | irrigation ditch], [coll. | 11 Sep 1972 | Roy O. Kendall | & C. A. Kendall ], [ HESPERIIDAE , | Pyrginae : | Urbanus teleus | ♂ ( Hubner, 1821 ) | det. R . O. Kendall | M. & B. No. 28], [DNA sample ID: | NVG-14112D07 | c/o Nick V . Grishin ], and one red [ HOLOTYPE ♂ | Spicauda atelis | Grishin ] . Paratypes : 6♂♂ and 2♀♀ : USA 1♀ NVG-14112D08 Texas , Hidalgo Co. , McAllen , 18-Oct-1973 , W. W. McGuire [ TAMU ], GenBank accession OP762098 ( Fig. 2b ) ; Mexico : 1♂ NVG-3280 San Luis Potosi , El Salto Falls , 24-Dec-1972 , Roy O. Kendall and C. A. Kendall leg., genitalia NVG150111-96, [ TAMU ] ( Fig. 3b , 4 ) ; others in USNM , 1♂ NVG-19121B11 Hidalgo , 40 mi N of Jacala , 18-Aug-1967 , Gary F. Hevel leg ; 1♂ NVG-19121A06 Oaxaca , Candelaria Loxicha , 6-Jul-1974 ; Guatemala 1♂ NVG-19121A07 Peten , Finca Ixobel S of Poptun , 5-10- Jun-2003 , R . Leuschner leg. ; Honduras 1♀ NVG-19121A08 Las Minas , 30-Jul-1972 , R . D. Lohman ; El Salvador 1♂ NVG-19121A09 2 km N San Isidro , 22-Oct-1967 , E. L. Todd ; Costa Rica 1♂ NVG-17106B07, 07-SRNP- 55853 Area de Conservación Guanacaste , Guanacaste Prov. , Sector Mundo Nuevo , Mariano Pereira leg. ex larva, eclosed on 23-May-2007 . Type locality. USA : Texas , Hidalgo Co., Mission, 10 th Street at irrigation ditch. Etymology. The name of its sister species in Greek is τέλειος (téleios): perfect, complete, and this new one is incomplete: ατελής (atelís), because we do not completely know yet how to unambiguously identify this species by its phenotype. The name is a noun in apposition. English name. Atelis longtail. Figure 2. Spicauda atelis sp. n . a) holotype ♂ NVG-14112D07, b) paratype ♀ NVG-14112D08 dorsal (left) and ventral (right) views, data in text. Figure 3. Three species of Spicauda . a–b) S. atelis sp. n . a) USA: TX, Hidalgo Co., Mission, 3-Nov-2020, iNaturalist observation 64178872 © Mike Rickard. b) paratype NVG-3280, data in text, genitalia in Fig. 4, note the 5 th subapical forewing spot—section of the wing magnified below. c) S. teleus , Trinidad: Couva-Tabaquite-Talparo, 4-May-2022, iNaturalist observation 115731394 © ralytt. d–e) S. zalanthus . d) NVG-19121B08 ♂ Brazil: Paraná, Curitiba, 900 m, 26-Oct-1969, O. Mielke leg. [USNM]. e) NVG-19121F07 ♀ Brazil: Santa Catarina, Apr-1945 (no other data) [USNM]. Some images were color-corrected and/or rotated and iNaturalist photographs are available under CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/ Figure 4. Male genitalia of Spicauda atelis sp. n. paratype NVG-3280 (data in text) in different views. a) left lateral, b) right dorsolateral, c) ventral, d) dorsal. Distribution. From the Lower Rio Grande Valley in South Texas to Costa Rica . Comment. The 5 th forewing apical spot is sometimes present in this species, e.g., in the paratype NVG-3280 ( Fig. 3b ), which is not U. tanna Evans, 1952 by genomics ( Fig. 1 ) and genitalia ( Fig. 4 ). Urbanus ehakernae Burns, 2014 is a junior subjective synonym of Urbanus ( Urbanus ) alva Evans, 1952 Genomic analysis reveals that the type specimens of Urbanus ehakernae Burns, 2014 (type locality in Costa Rica ) are intermixed in the same clade with specimens from Mexico (including a specimen from Veracruz ) and Belize that we identified as Urbanus alva Evans, 1952 (type locality Mexico : Veracruz , Atoyac) ( Fig. 5a purple). Their COI barcodes are 100% identical and all these specimens are phenotypically similar, including the holotype of U. alva . In particular, the iridescent overscaling is green (rather than blue), even partly yellowish, extensive on hindwing, reaching up to the distant third (females) or quarter (males), rather sharply transitioning to the dark brown submarginal area. This overscaling is less prominent on forewings, yellower in color, particularly distad, green scales confined to the base, but extensive olive-yellow scales approach the discal band composed of large (compared to other species) spots. The ventral hindwing discal band is only slightly forked towards the costal margin in males. Therefore, we propose to treat Urbanus ehakernae Burns, 2014 , new synonym , as a junior subjective synonym of Urbanus alva Evans, 1952 .