Primula sunhangii (Primulaceae): a new species from Hubei, Central China Author Sun, Jiao CAS Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, Hubei 430074, China & CAS Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, Yunnan 650201, China & University of Chinese Academy of Sciences, Beijing 100049, China https://orcid.org/0000-0002-5028-8132 Author Zhang, Dai-Gui CAS Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, Hubei 430074, China Author Huang, Xian-Han CAS Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, Yunnan 650201, China Author Tojibaev, Komiljon Central Herbarium of Uzbekistan, Institute of Botany, Academy Sciences of Uzbekistan, Tashkent 100025, Uzbekistan Author Yang, Jing-Yuan Administration of Shennongjia National Park, Shennongjia, Hubei 44241, China 290753238@qq.com Author Wang, Heng-Chang CAS Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, Hubei 430074, China hcwang@wbgcas.cn Author Deng, Tao CAS Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, Yunnan 650201, China dengtao@mail.kib.ac.cn text PhytoKeys 2020 156 103 112 http://dx.doi.org/10.3897/phytokeys.156.49137 journal article http://dx.doi.org/10.3897/phytokeys.156.49137 1314-2003-156-103 AAD4849367965E749B4876EC50F920E0 Primula sunhangii T. Deng, D. G. Zhang & Jiao Sun sp. nov. Type. China, Hubei Province, Shennongjia Forestry District, Hongping, Dashuping. 31°26.67'N , 110°16.01'E Alt. 2877 m. 5 Jun 2011, D. G. Zhang et al. Zdg20110605023 (Holotype KUN !) (Fig. 1 ). - Isotype : China, Hubei Province, Shennongjia Forestry District, Hongping, Dashuping. 31°26.67'N , 110°16.01'E Alt. 2877 m. 5 Jun 2011, D. G. Zhang et al. Zdg20110605023 ( JIU !). Figure 1. Holotype of Primula sunhangii T. Deng, D. G. Zhang & Jiao Sun, sp. nov. Diagnosis. Primula sunhangii is similar to P. involucrata in glabrous, efarinose, ovate leaves, and lanceolate bracts base prolonged below into auriculate appendage and its length. But it differs from P. involucrata in the following characters: glabrous sepal, cylindrical calyx and capsule, truncate or acute leaves base, and shorter scape (at most 3 times the leaves). Description. Herbs perennial, glabrous, efarinose. Leaves 5-10, all basal in a rosette; petiole green, basal white to pink, 1-5.6 cm long, 0.2-0.4 cm diam.; leaf blade green, ovate or oblong, 0.8-4.8 cm long, 0.5-2 cm wide, papery, base truncate or acute, margin entire or slightly denticulate, apex obtuse to rounded. Scapes 5-19 cm in length; umbels 2-4-flowered; bracts 5, lanceolate, 5-10 mm long, 1-3 mm wide, membranous, base prolonged below into 3-6 mm auriculate appendage. Pedicel 0.5-3.5 cm. Calyx 5-7 mm in length, 3 mm diam., cylindrical, parted to 1/4 to 1/3; lobes lanceolate, apex narrowly acute. Corolla funnel-form, pink or purple; tube 8-10 mm in length, 8-10 mm diam., limb 1-2 cm diam.; lobes obovate, deeply emarginated apex. Pin flowers: corolla tube ca. 8.5 mm; stamens ca. 3.5 mm above base of corolla tube; the style is not or slightly exerted. Thrum flowers: corolla tube ca. 1 cm; stamens toward apex of corolla tube; the style is slightly shorter than calyx. Capsule cylindric, apex irregular dehisces. (Fig. 2 ) Distribution and habitat. Fissures of rocks on mountain slopes; ca. 2,800 m. Shennongding (Hongping, Shennongjia, Hubei), Laojunshan (Muyu, Shennongjia, Hubei). (Fig. 3 ) Figure 2. Images of live Primula sunhangii T. Deng, D. G. Zhang & Jiao Sun, sp. nov. A habitat B inflorescence C leaves D flower, front and back side E toot. Scale bars: 1 cm in ( C, D, E ). Photographer: Qun Liu. Figure 3. Distribution of Prunus sunhangii T. Deng, D. G. Zhang & Jiao Sun. Phenology. Primula sunhangii flowers from June to July. Etymology. The specific epithet refers to the Chinese botanist Hang Sun. Vernacular name: Simplified Chinese: 神农架报春 ; Chinese Pinyin: Shennongjia Baochūn . Conservation status and IUCN preliminary assessment. The new species has only two known populations described thus far. The populations are both in subareas of Shennongjia, one in Shennongding and another in Laojunshan. Each population has ca. 40 individuals. The habitats are situated in a tourist attraction zone, with an average of 20,000 tourists visiting daily. According to IUCN red list categories and criteria, conservation status of this species should be Critically Endangered (CR) (B2abiii). Relationship with related species. Based on its glabrous, efarinose, ovate leaves, lanceolate bracts base prolonged below into auriculate appendage, and its length, P. sunhangii is most morphologically similar to P. involucrata ( Hu 1990 ; Hu and Kelso 1996 ). But P. sunhangii differs from P. involucrata in glabrous sepal, cylindrical calyx and capsule, truncate or acute leaves base, and shorter scape (at most 3 times the leaves). (Table 1 ). Table 1. Diagnostic morphological characters comparison between Primula sunhangii and P. involucrata .
Characteristics P. sunhangii P. involucrata
Base of leaves truncate or acute cuneate, rounded to slightly cordate
Sepal glabrous glandular ciliolate
Calyx shape cylindrical campanulate
Capsule shape cylindrical oblong
Ratio of scape to leaves less than 3 times 3-5 times
We performed phylogenetic analyses using nuclear ITS as well as rbcL and matK of P. sunhangii and related species. Separate analyses for all three markers get six trees (ML and Bayesian) with similar structures. Combined molecular phylogenetic analyses shows that P. sunhangii and P. involucrata are sister taxa, with high support (Fig. 4 ). They have 19 different sites in the 2020 bp nucleotide sequence. These genetic results and morphological data clearly support that Primula sunhangii be recognized as a distinct new species. Figure 4. Bayesian tree of selected species in Primula , focused on Sect. Aleuritia . Based on a combined sequences from nuclear ITS and rbcL , matK of cpDNA genes. Numbers above the branches represent the Bayesian posterior probabilities, and below showing the maximum likelihood values. (* multifurcation in Maximum-likelihood tree). Table 2. Primers used in PCR amplification and sequencing.
DNA fragments Primer name 5'-3' Sequences
ITS ITS1 GTCCACTGAACCTTATCATTTAG
ITS4 TCCTCCGCTTATTGATATGC
rbcL rbcLa_f ATGTCACCACAAACAGAGACTAAAGC
724R TCGCATGTACCTGCAGTAGC
matK 3F-KIM CGTACAGTACTTTTGTGTTTACGAG
XF TAATTTACGATCAATTCATTC
trnH-psbA trnH-05 CGCGCATGGTGGATTCACAAATC
psbA3 GTTATGCATGAACGTAATGCTC