A newly recognised species of Cryptes Maskell 1892 (Hemiptera: Coccidae) from Western Australia Author Lin, Yen-Po Author Kondo, Takumasa Author Gullan, Penny J. Author Cook, Lyn G. text Zootaxa 2018 2018-10-30 4508 1 101 114 journal article 28057 10.11646/zootaxa.4508.1.6 b732f1bc-50fa-422e-b9e2-7f21c2626144 1175-5326 2606878 3ED57EDA-4870-4E70-918B-B7BD3AA977B4 Cryptes utzoni Lin, Kondo & Cook sp. n. ( Fig. 4 ) urn:lsid:zoobank.org:act: 8509AE5F-35CB-4546-9E78-2217ED214152 Material examined. Holotype . Adult female (ID: LGC02307f6). Yeo Lake Nature Reserve , WA ,/ Australia . - 28.08° S , 124.32° E ./ ex Acacia aneura , 1.x.2013 ,/ L. G. Cook ( WAM : 1 female on 1 slide). GenBank accession numbers: 18S : MH 844470 ; 28S : MH 886632 ; COI : MH 886618 ; EF-1 α : MH 886635 . Paratype . Adult female (ID: LGC02307f4). Same data as for holotype ( WAM : 1 female on 1 slide). GenBank accession numbers: 18S : MH 844468 ; 28S : MH886630 ; COI : MH886616 ; EF-1 α : MH886633 . Paratype . Adult female (ID: LGC02307f5). Same data as for holotype ( ANIC : 1 female on 1 slide). GenBank accession numbers: 18S : MH 844469 ; 28S : MH886631 ; COI : MH886617 ; EF-1 α : MH886634 . Paratypes . Adult females (ID: LGC02307f1, LGC02307f2). Same data as for holotype ( WAM : 2 females on 2 slides) . Paratypes . Adult females (ID: LGC02307f3, LGC02307f7, LGC02307f8). Same data as for holotype ( ANIC : 3 females on 3 slides) . FIGURE 4. Adult female of Cryptes utzoni Lin, Kondo & Cook sp. n. dsp: dorsal simple pore; mset: marginal seta; stgset: stigmatic seta; dtbdt: dorsal tubular duct; ldset: long dorsal seta; sdset: short dorsal seta; anplt: anal plate; mdp: multilocular disc-pores; vset: ventral seta; vmic: ventral microduct; vtbdt: ventral tubular duct; spp: spiracular disc-pore. Diagnosis. Adult females of C . utzoni can be identified and distinguished from C . baccatus and A . hakearum by the following combination of morphological character states (the contrasting states for the other two species are given in Table 3 ): (i) live adult female with a pale linear stripe with irregular black borders running longitudinally from head to area anterior to anal plates on mid dorsum; slide-mounted female with (ii) dorsal setae of two sizes; (iii) tubular ducts abundant on body margin and submargin on dorsum; on venter, present throughout more abundant near margin, but absent from anterior to mouthparts (iv) each anal plate almost half-circular in shape, appearing crescentic when open, with three apical setae and two discal setae; (v) marginal setae setose, often with slightly curved apices; (vi) sclerotised areas on derm near stigmatic spines absent; (vii) anterior stigmatic areas each with two stigmatic spines, posterior stigmatic areas each with a single stigmatic spine; (viii) anal cleft shallow; (ix) each antenna 8-segmented; (x) cup-shaped invaginations of ventral tubular ducts of two sizes; (xi) tibio-tarsal articulatory sclerosis absent; (xii) claw denticle present; and (xiii) both claw digitules slender. Cryptes utzoni differs from C . baccatus at the following DNA sequence positions (mapped to the GenBank reference sequence listed for each gene). Dashes (-) represent deletions. 18S : Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH844467 . Site# 156 (A), 171 (T), 252 (T), 314 (T). 28S : Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886629 . Site# 11 (T), 29 (G), 31–53 (TGGTCGTCGCGCTCGCGCGACGG), 55–56 (TT), 146 (C), 155 (A), 162–163 (GT), 176–193 (ACGTTTAGGCGTGCGTGG), 195 (T), 209 (A), 249 (A), 275 (G), 277–288 (TG), 280–281 (GT), 283 (A), 285 (G), 289–296 (AAAT----), 298–300 (TTA), 303–305 (CGC), 337 (C), 420 (A), 429–430 (--), 437–445 (--- ------), 4 47–450 (----), 453 (G), 456–459 (---A), 461 (A), 467 (A), 469–470 (AA), 477 (C), 485 (G), 554 (C), 572 (G), 576 (C), 598 (T), 600 (A), 604 (A), 607–608 (CT), 617 (G), 649–650 (AT), 661 (C), 677–688 (TGCTTTTCGGAG), 694–695 (CG), 701 (A). COI : Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886615 . Site# 6 (T), 9 (G), 27 (T), 32 (T), 64 (T), 66 (A), 69 (C), 90 (C), 96 (G), 108 (C), 120 (A), 126 (A), 133 (A), 135 (T), 142 (A), 159 (C), 177 (T), 207 (T), 221–223 (CAA), 227 (T), 234 (G), 241–242 (AC), 245–246 (GA), 248–249 (GA), 252 (G), 257 (A), 264 (G), 273 (A), 279 (T), 282–283 (AT), 288 (C), 300 (T), 303 (T), 306 (T), 342–343 (TA), 351 (A), 355 (T), 363 (T), 366 (G), 380–381 (GG), 387–388 (AT), 390 (G), 397 (A), 399 (T), 404 (G), 408 (G), 410 (A), 412 (A), 415–417 (TAT), 420 (T), 423–426 (AAGA), 435 (C), 438 (G), 447 (T), 453 (T), 456 (A), 459 (A), 466 (G), 477 (C), 489 (A), 492 (G), 534 (G), 543 (C), 546–547 (CT), 558 (A), 573 (C), 579 (T). EF-1α : Reference sequence: Cryptes baccatus (ID: LGC03026): GenBank accession number: MH886640 . Site# 15 (G), 66 (C), 87 (C), 102–103 (AC), 107 (G), 111 (C), 113 (C), 117–119 (TGG), 124 (T), 128 (A), 130–132 (TGT), 136–137 (AG), 143–144 (GT), 151 (C), 153 (T), 157 (A), 161 (C), 195 (C), 207 (C), 219 (T), 222 (A), 258 (C), 267 (C), 279 (C), 300 (T), 321 (G), 339 (C), 369 (G), 372 (T), 378–379 (TT), 399 (T), 408 (C), 423 (G), 426 (T), 451 (T), 455 (A), 458 (C), 463 (T), 467–470 (TTGT), 474–475 (GC), 483 (G), 486 (A), 490–491 (GT), 495 (C), 500 (A), 508–510 (TCT), 516 (C), 522 (C), 561 (T), 573 (T), 597 (T), 600 (T), 609 (T). Description. Adult female ( Figs 4 , 1B ) (drawing and measurements based on eight specimens: LGC02307f1 to LGC02307f8, all in good condition). Unmounted specimens. Live adult female ( Fig. 1B ) body highly convex, truncated dorsally, yellowish to light brown in colour; with a white longitudinal stripe with irregular black border that is composed of pigments (which disappear during slide-mounting processes) running longitudinally from head to area anterior to anal plates on mid dorsum ( Fig. 1 ); with some small, raised, irregularly-rounded black spots on the dorsum of unmounted specimens. Part of body margin covered by a thin layer of white wax, with ventral and upper part of body devoid of wax, at least on young females. All specimens were found on the stems of the host plant. Slide-mounted specimens . Body of young adult female ( Fig. 4 ) circular, 2.0– 3.6 mm long, 1.5–3.4 mm wide. Dorsum. Dorsum mostly membranous but sclerotised around anal plates on older specimens (not illustrated on Figure 4 as drawing was based on a young adult female). Dorsal setae setose and of 2 sizes: (i) shorter setae each 8–10 Μ m long, sparsely scattered throughout dorsum except absent medially from end of head to anal plates; and (ii) longer setae each 20–40 Μ m long, restricted to a broad band submedially on each side. Dorsal tubular ducts of 1 type , each with a cup-shaped invagination 5–7 Μ m wide, a broad outer ductule 25–40 Μ m long, a narrow inner ductule 13–20 Μ m long, with a well-developed terminal gland; abundant in a broad marginal to submedial band around dorsum. Dorsal pores flat, simple and ovoid, each about 3–4 Μ m in maximum dimension, scattered throughout dorsum. Dorsal microducts, dorsal tubercles and preopercular pores absent. Anal plates each half- circular, 145–165 Μ m long, 50–65 Μ m wide; with 3 setae apically on each plate plus 2 discal setae, each seta 45–55 Μ m long. Ano-genital fold probably with 2 pairs of setae on anterior margin and 5 pairs laterally. Anal ring well sclerotised, 45–50 Μ m in diameter, probably bearing 5 pairs of setae, each about 125 Μ m long (but only 1 female , LGC02307f5, could be measured). Margin . Marginal setae setose and often with apex slightly bent, 30–55 Μ m long, arranged in a single marginal row; with 11–18 setae on head between stigmatic areas, 2–5 on each side between anterior and posterior stigmatic areas, and 10–14 on each side of abdomen; marginal setae at apex of abdomen not differentiated from others. Anal cleft present, shallow. Stigmatic cleft absent; stigmatic spines each 21–30 Μ m long with a rounded apex, some with apex slightly bent; sometimes bifurcated in anterior stigmatic area (e.g., on specimen LGC02307f7); with 2 spines in each anterior stigmatic area and with 1 in each posterior stigmatic area. No eyespots detected. TABLE 4. Sequences used in this study.

Species and Code GenBank accession no. ( 18S )	GenBank accession no. ( 28S )	GenBank accession no. ( COI )	GenBank accession no. ( EF-1α )
Cryptes utzoni sp. n.
LGC02307f4 MH844468	MH886630	MH886616	MH886633
LGC02307f5 MH844469	MH886631	MH886617	MH886634
LGC02307f6 MH844470	MH886632	MH886618	MH886635
Cryptes baccatus (Maskell)
YPL 0 0 0 0 4 MH844463	MH886625	MH886611	MH886636
YPL 0 0 257 MH844464	MH886626	MH886612	MH886637
YPL 0 0 749 MH844465	MH886627	MH886613	MH886638
YPL 0 0 798 MH844466	MH886628	MH886614	MH886639
LGC03026 MH844467	MH886629	MH886615	MH886640
Austrolichtensia hakearum (Fuller)
YPL00757 MH844461	MH886623	MH886609	MH886641
YPL00766 MH844462	MH886624	MH886610	MH886642
Ceronema banksiae Maskell
YPL00431 MH844460	MH886619	MH886605	MH886643
Coccus hesperidum Linnaeus
YPL00076 JX566902	JX627324	JX843722	JX945995
Didesmococcus koreanus Borchsenius
YPL00714 MH844459	MH886622	MH886608	MH886646
Eulecanium kuwanai (Kanda)
YPL00664 MH844458	MH886621	MH886607	MH886645
Metaceronema japonica (Maskell)
YPL00637 MH844457	MH886620	MH886606	MH886644

Venter. Derm entirely membranous; segmentation visible on mid-areas of thorax and abdomen. Ventral setae setose, each 10–15 µ m long, sparsely scattered across venter. Pregenital segment (VII) with a single pair of pregenital setae, each seta 23–33 Μ m long. Multilocular disc-pores each about 8 Μ m in diameter and with 8–10 loculi; abundant around genital opening, becoming progressively less frequent across preceding abdominal segments where present in irregular transverse rows, plus in submedial clusters on each abdominal and meta- and mesothoracic segments. Each stigmatic furrow with a band of spiracular disc-pores, each pore mostly with 5 loculi and about 6 Μ m in diameter, with 22–25 pores present between each spiracle and body margin. Ventral microducts each with an outer ductule 3 Μ m wide and an inner ductule that divides into 2–4 long filaments; sparsely scattered throughout venter but abundant on head between antennae and posterior to labium. Ventral tubular ducts each with a broad outer ductule 25–33 Μ m long, and a narrow inner ductule 13–15 Μ m long with a well-developed terminal gland; ducts of two types : one with a cup-shaped invagination 5–7 Μ m wide, mostly present in a broad marginal to submarginal band and sparsely present in median areas of abdomen and thorax but absent from the area immediately anterior to mouthparts; and another with a cup-shaped invagination 4–5 Μ m wide present medially on thorax, especially near mouthparts. Spiracles well developed: anterior spiracle + peritreme 102–114 Μ m long, peritreme 48–66 Μ m wide; posterior spiracle + peritreme 108–120 Μ m long, peritreme 60–66 Μ m wide. Legs well developed; each with tibio-tarsal articulation but no articulatory sclerosis; each claw 33–36 Μ m long, with a denticle; both claw digitules fine and slightly shorter than thin tarsal digitules; trochanter + femur 1 50–180 Μ m and tibia + tarsus 150–180 Μ m. Antennae each with 8 segments, total length 210–252 Μ m; scape and pedicel each with about 2 setae, segments III and IV without setae, segment V with 1 short seta and 2 longer setae, segment VI with 1 fleshy seta, segment VII with 1 fleshy and 2 setose setae, and segment VIII with a pair of fleshy setae, about 4 stiff setae and 3 setose setae. Clypeolabral shield 192–210 Μ m long, 186–210 Μ m wide. Labium 66–72 Μ m long, 90–120 Μ m wide, with 3 pairs of setae. Etymology. The species epithet honours Danish architect Jørn Utzon, who designed the UNESCO World Heritage-Listed Sydney Opera House (Sydney, Australia ) and frequently used sculptural curves in his designs. In life, the adult females of C. utzoni (Utzon's scale) and their tests invoke the curves of the arching white shells of the Sydney Opera House.