Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) Author Tedersoo, Leho Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia Author Magurno, Franco 0000-0002-3117-8149 Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland Author Alkahtani, Saad 0000-0001-7381-5110 Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia Author Mikryukov, Vladimir 0000-0003-2786-2690 Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia text MycoKeys 2024 2024-08-09 107 249 271 journal article 10.3897/mycokeys.107.125549 Kelottijaervia shannonae Tedersoo sp. nov. Diagnosis. Separation from other species of Kelottijaervia based on the ITS region (positions 212–239 taatgtgagtgcaggaaatattatgact; one mismatch allowed) and LSU (positions 600–619 ctttggggtggcggtcgctg; one mismatch allowed) as indicated in Fig. 6 . Diagnostic barcodes for Kelottijaervia shannonae relative to closely-related taxa in ITS 2 and LSU. Type. eDNA sample TUE 100189 ( holotype ); eDNA sequence EUK 1202520 ( lectotype ); GSMc plot G 2836 Finland , subpolar Betula pubescens forest (soil sample TUE 000189 ) in Kelottijärvi , Finland , 68.60353 ° N , 21.74517 ° E . Description. Other sequences: EUK 1603540, ( GSMc plot G 4196, Populus - Picea - Pinus forest soil in Kahvena , Estonia , 58.27991 ° N , 25.23165 ° E ); EUK 1603663 ( GSMc plot G 4406, mixed coniferous forest soil in Tarumaa, Estonia , 59.20745 ° N , 27.15333 ° E ); EUK 1602832 ( GSMc plot G 5828, Malus domestica orchard soil in Mooste, Estonia , 58.15335 ° N , 27.19642 ° E ); and KP 889965 (coniferous forest soil in British Columbia , Canada ) that was first isolated by Shannon H. A. Guichon ( Guichon 2015 ). Etymology. Kelottijärvi (Finnish) refers to type locality; and Shannon (English) refers to the first name of Shannon H. A. Guichon who collected the first materials belonging to this genus. Notes. Found in Estonia , Finland and Canada , with ITS and LSU sequences displaying up to 2 % and 1 % of differences, respectively.