Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Aguna esmeralda Grishin , new species https://zoobank.org/ 81C0476E-A9A8-4A6E-8EE9-F25C3C13130F ( Fig. 1 part, 29–30, 241–242) Definition and diagnosis. A species related to Aguna glaphyrus (Mabille, 1888) ( type locality in Brazil : Santa Catarina ), Aguna longicauda Austin and O. Mielke, 1998 ( type locality in Brazil : Rondônia ), and Aguna spicata Austin and O. Mielke, 1998 ( type locality in Brazil : Rondônia ) ( Fig. 1 ), but genetically differs from them more than they are from each other, e.g., COI barcode difference from A. glaphyrus is 5% (33 bp). Phenotypically can be identified by the contrasting tint of upperside green overscaling: yellower on the forewing and bluer on the hindwing ( Fig. 29 ), short and stubby tails, nearly oval valva (when taken together with harpe), longer than in A. glaphyrus and A. spicata (among others), and separated from harpe only with a small notch, harpe rounded distad rather than narrowing, sacculus expanded distad. Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly671.26.9:C88T, aly671.16.4:T181A, aly 1468.8.8 :A146G, aly 1468.8.8 :T156C, aly 1340.1.1 :C1566T, and COI barcode: A148G, A181T, TC208, T430G, T523C. Barcode sequence of the holotype . Sample NVG-18017A03, GenBank OR837634, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCCGGATCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATGATTTTTTTTATAGTAATACCTATTATAATTGGTGGATTTGGAAATT GACTTGTACCTCTCATACTAGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATAAGATTTTGACTTTTACCCCCCTCCTTAACTCTTTTAAT CTCTAGAAGCATTGTAGAAAATGGTGCAGGCACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGCACATCAGGGAGCTTCCGTAGATTTA GCAATTTTTTCTTTACATTTAGCAGGAATTTCCTCTATTCTGGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAATAATTTATCTT TCGATCAAATATCTTTATTCATTTGAGCAGTTGGTATCACTGCATTATTACTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACAATATTATT AACAGATCGAAACTTAAACACTTCATTCTTTGATCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT Type material. Holotype : ♂ deposited in the National Museum of Natural History , Smithsonian Institution , Washington, DC , USA ( USNM ), illustrated in Fig. 29–30 , bears the following four rectangular labels, three white: [ ECUADOR : Esmeraldas : | Río Chuchuví, km. 12.5 Lita- | San Lorenzo rd. 800-900m | 0° 53.01’ N 78° 30.90′ W | I.2001 I.Aldas leg.], [DNA sample ID: | NVG-18017A03 | c/o Nick V . Grishin ], [USNMENT | { QR Code } | 01450831], and one red [ HOLOTYPE ♂ | Aguna esmeralda | Grishin ] . Paratypes : 4♂♂ from Ecuador : Esmeraldas Province : 2♂♂ from the type locality: NVG-18017A04 USNMENT_01450832 the same data as the holotype, but collected in Mar-2001 [ USNM ] ; and NVG-18066C 08 Oct-2012 , ex coll. M. Büche [EBrockmann]; 1♂ NVG-18016H04, USNMENT_01450823 Km 18.5 San Mateo-Pto. Libre Road , Zapatta Hilltop , 500 m , GPS 0.884500 , −79.540333 , 6-Mar-2001 , D. H. Ahrenholz leg. [ USNM ] ; 1♂ NVG-18065E11 Durango, 500-800 m , Mar-Jun-2011, ex coll. M. Büche [EBrockmann]. Type locality. Ecuador : Esmeraldas Province , Río Chuchuví, km. 12.5 Lita-San Lorenzo Road, elevation 800– 900 m , GPS 0.883500 , −78.515000 . Etymology. The name is formed from the Esmeraldas Province , the type locality of this species. The name is a noun in apposition, originating from a Greek word meaning emerald, which also nicely reflects the emeraldgreen color on the dorsal hindwing of this species. Distribution. Currently known from northwestern Ecuador .