A report on species of phyllidiid and polycerid nudibranch including two species new to Korea Author Jung, Daewui Department of Green Life Science, Sangmyung University, Seoul 110 - 743, Korea Author Kim, Jongrak Lee and Chang-Bae text Journal of Species Research 2013 2013-02-28 2 1 7 14 journal article 10.12651/JSR.2013.2.1.007 2713-8615 12753457 Triopha catalinae ( Cooper, 1863 ) ( Fig. 4 ) Triopa catalinae Cooper, 1863: 59 . Triopa carpenteri Stearns, 1873: 78 , fig. 2 (cited from McDonald , 1983 ). Triopha carpenteri : Bergh, 1880: 112-117 (cited from McDonald , 1983 ); MacFarland, 1966: 106, pls. 19, 29, 31; Okutani, 2000: 779 , fig. 2. Triopha modesta Bergh, 1880: 261-266 , pl. 14, figs. 17- 20 (cited from McDonald , 1983 ). Triopa modesta : Fischer, 1887: 527 (cited from McDonald , 1983 ). Triopha catalinae : Cockerell, 1915: 229 (cited from McDonald , 1983 ); Ferreira, 1977: 388-396 , figs. 1-11, 16; McDonald , 1983: 215 ; Goddard, 1984: 153 ; Debelius and Kuiter, 2007: 46 ; Gosliner et al. , 2008: 277 . Fig. 3. Thecacera pennigera (Montagu, 1815) . A. dorsal view. B. lateral view. C. rhinophores and rhinophoral sheath. D. gills and extrabranchia appendages. E. habitus, living animal. F. pattern of spots. A, B. preserved specimen. C-F. living animal. Scales=1 mm. Triopha scrippsiana Cockerell, 1915: 228-229 (cited from McDonald , 1983 ). Triopha elioti O’Donoghue, 1921: 165-167 (cited from McDonald , 1983 ). Material examined. 1 individual, Gangwon-do, Goseonggun, Toseong-myeon, Bongpo-ri, 28 May 2012 ; 3 individuals, Gangwon-do, Yangyang-gun, Hyeonbuk-myeon, Gisamun-ri, 6 Jun 2012 ; 3 individuals ( KOSPIV000016 5265), Gangwon-do, Goseong-gun, Jugwang-myeon, Munamjin-ri, 18 Aug 2012 . Diagnosis. Body elongate (length: 46-100 mm , width: 15-38 mm ) and translucent pale white, Anterior rounded, Posterior pointed ( Fig. 4A ). Head flattened and expanded wider than body ( Fig. 4B ). Several margin process of frontal veil along anterior of head ( Fig. 4C ). Rhinophores lamellate and retractable ( Fig. 4D ). Gills five of simple tripinnate and non-retractable ( Fig. 4E ). Dorsum slightly arched, Usually several rounded end tubercles on edge of dorsum ( Fig. 4E ). Same orange color present tip of appendage: Rhionophores, Dorsal-lateral papillae, Dorsal tubercles, Frontal veil margin process, Gill branch, Posterior end. Fig. 4. Triopha catalinae ( Cooper, 1863 ) . A. dorsal view. B. lateral view. C. head. D. rhinophore. E. gills. F. tubercles. A-F. living animal. Scales=5 mm. Distribution. Korea , Japan , Alaska, Baja California , Mexico . DNA barcode. COI sequences of the first mentioned specimen in the “Material examined” are as follows: 5′- AGCTGGTGCATTTCTAGGGGATGATCATTTTTA TAATGTCATTGTAACTGCTCATGCGTTCGTAAT AATTTTTTTTATAGTTATGCCGTTAATAATCGGA GGATTTGGTAACTGAATAGTTCCTTTACTAATT GGAGCACCTGATATAAGTTTTCCTCGAATAAAT AATATAAGATTTTGACTTCTTCCCCCCTCATTTA TTTTATTGTTGTGTTCAACATTAATAGAAGGAG GAGCTGGGACAGGATGAACTGTGTACCCTCCTT TATCTGGTCCTGTGGGTCATGGAGGTACGTCTG TAGATCTTGCTATTTTTTCTCTCCATTTAGCTGG CGCATCTTCTTTACTTGGGGCCATTAATTTTATT ACTACTATTTTTAATATACGCTCTTCGGCTATAA CTATAGAACGATTAAGTTTATTCGTTTGGTCTGT TTTGGTGACTGCTTTTCTACTCTTGCTTTCTTTA CCTGTACTAGCCGGAGCTATTACTATACTAT-3′. According to BLAST search to GenBank, this sequence matches 99% with a COI record of Triopha catalinae ( GQ 292040) available in the GenBank. This may support the morphological identification of the species. Remarks. Triopha catalinae distributed from Alaska to Baja California in the Eastern Pacific. From the Western Pacific Okutani (2000) recorded this species from Sanriku and Hokkaido. The present report of T. catalinae from Korea showed a distributional extension of its previously known range.