Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-01-06 2023 969 1 58 journal article 10.5281/zenodo.7710103 1942-1354 7710103 Lerema ( Lerema ) ochrius Grishin , new species https://zoobank.org/ 3700C6D0-BE94-48C9-B78F-905885E911C0 ( Fig. 52 part, 53a, b, 54b, 55a, b, 56, 57a–f, 58) Definition and diagnosis. First, we noticed a COI barcode split in Lerema accius (J. E. Smith, 1797) ( type locality in USA : Georgia ): 1.8%–2.1% (12–14 bp) difference between the two groups and a clear partitioning into two clades in the mitochondrial genome tree ( Fig. 52b red and blue). The blue clade corresponds to eastern USA L. accius that includes other available names currently associated with it. The red clade encompasses southern and southwestern populations that do not have a name; therefore this clade represents a new taxon. Fst / Gmin statistics for the comparison of the two clades are 0.205 / 0.008 suggesting that the new taxon is a species. Curiously, while L. accius ( Fig. 52a blue) forms a strongly supported clade separated by a prominent branch from other specimens, the new species represented by the red clade in the mitogenome ( Fig. 52b ) is not monophyletic in the Z chromosome tree ( Fig. 52a ) and appears as a set of weakly supported bifurcations. This topology is a likely result of introgression from other taxa. Introgression from L. accius will bring specimens closer to the blue branch, and introgression from Mexican and Central American species, such as Lerema pattenii Scudder, 1872 ( type locality in Guatemala ), Lerema liris Evans, 1955 , or Lerema lucius Grishin, 2022 ( type locality in Panama ) will “pull” the tree branch with the specimen closer to the root. Therefore, the specimens are spread out in the nuclear tree instead of forming a clade. The new species is phenotypically similar to L. accius and keys to it (J.39.2(a)) in Evans (1955) , and differs from it ( Fig. 53c, d , 54a , 55c, d ) by being more ocherous on the ventral side ( Fig. 53a, b , 54b , 55a, b ) instead of rusty-brown in L. accius . This difference in hue (yellower vs. redder) may be most obvious by the forewing apex distad of subapical hyaline spots. Among caterpillars that we inspected, we note the following head capsule differences (numbered cyan arrows point to characters in Fig. 57a , ordered by their possible reliability). Generally, the dark-brown pattern is reduced compared to L. accius , but the vertical band is wider towards the mouth (no. 1 in Fig. 57a ) and only in very dark L. accius this band extends towards eyes ( Fig. 57l, m ); dark framing of the head capsule central groove is generally wider towards the middle (no. 2) but is the widest at the head apex in L. accius ; the vertical band is comparatively narrower near its middle (no. 3), not as wide as in L. accius , where it may be the widest in the middle; the central area right above the mouth is typically yellow-orange in L. accius , but is paler, less saturated in color in the new species (no. 4). Due to seasonal forms and extreme phenotypic variation in both species (including caterpillar head patterns and colors), reliable identification is achieved by DNA sequences: a combination of the following base pairs is diagnostic in nuclear genome: aly1357.16.2:G181A, aly173.37.11:G247A, aly84.20.1:C210A, aly6654.1.1:A1734T, and aly768.1.1:A351G, and COI barcode: T55C, T127T(not C), T247C, T340C, and T436C. Barcode sequence of the holotype . Sample NVG-22031H12, GenBank OP984705, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACTTCTTTAAGCTTATTAATTCGAACAGAATTAGGAAATCCAGGA TCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTG GAGGATTTGGTAATTGATTAATCCCATTAATACTAGGAGCTCCTGATATAGCATTTCCACGAATAAACAATATAAGATTTTGAATATTA CCTCCTTCATTAATACTATTAATTTCAAGTAGAATTGTAGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCACCTTTATCTTCTAA TATTGCCCATCAAGGAGCATCAGTTGATTTAGCAATTTTTTCTCTTCATTTAGCAGGTATTTCTTCAATTTTAGGAGCCATTAATTTTA TTACTACAATTATTAATATACGAATTAGAAATTTATCTTTTGATCAAATACCTTTATTTGTTTGATCTGTCGGAATTACAGCATTATTATT ATTACTTTCACTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACTTCTTTTTTTGATCCTGCAGGAGG TGGTGATCCTATTTTATACCAACATTTATTT Figure 53. Reared specimens of Lerema from USA: Texas, N. V. Grishin leg., in dorsal (left of the letter) and ventral (right of the letter) views. a–b) L. ochrius sp. n. from Hidalgo Co., 1.5 air mi SE of Relampago, Old Rio Rico Rd.: a) paratype ♂, eclosed 7-Jul-2015; b) holotype ♀ NVG-22031H12, eclosed 14-Jun-2015. c–d) L. accius from Denton Co., Flower Mound, nr. Grapevine Lake: c) ♂ eclosed 31-Jul-1997; d) ♀ eclosed 29-Sep-1997. Figure 54. Reared specimens of Lerema from USA: Texas, Brewster Co., Big Bend National Park, Rio Grande Village campground,N. V. Grishin leg., females, ex larva, in dorsal (above) and ventral (below) views. a) L. accius NVG-22054A02 eclosed 23-Jun-2005. b) paratype of L. ochrius sp. n. NVG-22054A03 eclosed 1-Jun-2005. Figure 55. Two species of Lerema from the USA, iNaturalist observations. a–b) L. orchius sp. n. , Texas, Hidalgo Co. a) 104144271 Mission, 1-Jan-2022 © Cin-Ty Lee. b) 130093189 Edinburg, 8-Oct-2021 © Scott. c–d) L. accius . c) 138909684 Georgia, Clarke Co., Athens, 15-Oct-2022 © Diego Huet. d) 136277302 Illinois, Johnson Co., Cypress, 22-Sep-2022 © Harlan Ratcliff. Some images are color-corrected, rotated, and/or flipped. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/. Type material. Holotype : ♀ deposited in the National Museum of Natural History , Smithsonian Institution , Washington , DC , USA ( USNM ), illustrated in Fig. 53b , bears the following three rectangular labels, two white: Figure 56. Male genitalia of Lerema ochrius sp. n. paratype NVG-3258 (data in text) in different views: a) left lateral, b) dorsal (uncus twisted to the right to expose harpe), c) left dorsolateral, d) right dorsolateral. Figure 57. Heads of Lerema 5 th instar caterpillars from USA: Texas, 2015. a–f) Lerema ochrius sp. n . a) Starr Co., Roma 7-Aug. b–e) The type locality, 7-Sep. f) Cameron Co., River Dr., 1.4 mi S of Santa Maria, 25-Jun. g–m) Lerema accius . g–h) Dallas Co., Dallas: Norbuck Park, 7-Aug. Moss Park: i) 7-Aug, j) 11-Aug, l) 19-Jul. k , m) nr. White Rock Lake, 22-Jul. Numbered cyan arrows in 57a refer to characters discussed in text. [ 26.0682 , −97.8912 | USA : Texas , Hidalgo Co. | 1.5 air mi SE of Relampago | Old Rio Rico Rd. , ex ♀ | ex ovum, ecl. 14-Jun-2015 | Nick V . Grishin leg.], [DNA sample ID: | NVG-22031H12 | c/o Nick V . Grishin], and one red [ HOLOTYPE ♀ | Lerema | ochrius Grishin ]. Paratypes : 22♂♂ and 16♀♀ : USA : Texas : Cameron Co. : E of Brownsville : 1♂ , 1♀ 10-Nov-1996 ; 1♀ 11-Nov-1996 ; ex ♀ ex ovum, eclosed: 1♂ 12-Mar-2003 , 1♂ 13-Mar- 2003 , 1♂ and 1♀ 14-Mar-2003 , 1♂ and 1♀ 15-Mar-2003 , 1♂ 16-Mar-2003 ; River Dr. , 1.4 mi S of Santa Maria : 1♂ NVG-3350 23-May-2015 [ UTSW ] ; 1♀ 14-Jun-2015 ; 1♀ NVG-3650 2.5 mi SW of Sebastian , 13-Jun-2015 [ UTSW ] ; 1♂ NVG-3198 Brownsville , 22-Oct-1972 , R . O. Kendall and C. A. Kendall leg., genitalia NVG15011-14 [ TAMU ] ; Hidalgo Co. : 1♂ NVG-22054A05 Edinburg , ex larva, eclosed on 17-Jun-2015 ; 1.5 air mi SE of Relampago , Old Rio Rico Rd. , 26.0682 , −97.8912 : 1♀ NVG-3380 [ UTSW ], 1♀ 24-May-2015 ; 2♂♂ ex ♀ ex ovum, eclosed 7-Jul-2015 and 24-Sep-2015 ; 1♂ NVG-3993 10-Jul-2015 [ UTSW ], GenBank accession OP762116 ; 1♀ ex larva, eclosed 23-Sep-2015 ; 1♂ Mission , Military Rd. W of Urban Road No. 1016, 25-Oct-2004 ; 1♂ NVG- 3258 Bentsen-Rio Grande Valley State Park , World Birding Center , 27-Oct-2004 , J. and F. Preston leg., genitalia NVG15011-74 [ TAMU ] ; 1♀ NVG-5177 Chihuahua , 15-Nov-2015 [ UTSW ] ; Peñitas , around GPS 26.2260 , −98.4347 : 1♀ 4-Nov-2005 ; ex larva, eclosed 1♀ 26-Mar-2006 ; ex ♀ ex ovum, eclosed: 1♂ and 1♀ 22-Jan-2005 , 1♂ 23-Jan-2005 , 2♂♂ 25-Jan-2005 ; Starr Co. : 1♂ Rio Grande City , Fort Ringgold , 14-Nov-2015 ; Roma , nr. international bridge [ UTSW ]: 1♀ NVG-3808 28-Jun-2015 ; 1♂ NVG-3997 11-Jul-2015 ; 1♂ NVG-22054A04, Maverick Co. , Eagle Pass 21-Mar-2009 ; Brewster Co. , Big Bend National Park : 1♀ NVG-3197, Chisos Basin , 5280’, 6-Oct- 1966 , R . O. Kendall and C. A. Kendall leg., genitalia NVG15011-13 [ TAMU ] ; 1♂ NVG-3256 15-Aug-1968 , J. E. Hafernik leg., genitalia NVG15011-72 [ TAMU ] ; Rio Grande Village : 1♀ NVG-22054A03 ex larva, eclosed 1-Jun- 2005 ( Fig. 54b ). All N. V . Grishin leg., unless indicated otherwise . Figure 58. Eggs and caterpillars of Lerema ochrius sp. n. from USA: Texas, 2015. Photographs taken on the same date show the same individuals, except 58k, which is a different individual from the caterpillar in 58l–n. a–c) Eggs. d–n) Caterpillars of different instars: 1 st ( d–i ), 3 rd just molted with exuviae behind and the head capsule in front ( j ), 4 th feeding ( k ), 5 th ( l–n ). Cameron Co., River Dr., 1.4 mi S. of Santa Maria: a–b) 19-Jun, d–e) 23-Jun; f–g) 2.5 mi SW of Sebastian, 25-Jun; Starr Co., Roma: c) 5-Jul, h–i) 9-Jul, j) 27-Jul, k–n) 4-Aug. Type locality. USA : Texas , Hidalgo Co., 1.5 air mi SE of Relampago, Old Rio Rico Rd., GPS 26.0682 , −97.8912 . Etymology. The name is for the ocherous (brownish-yellow) color typical of this species ventral side. The name is a noun in apposition, similar to those of its close and similar-looking relatives L. accius and L. lucius . English name. Ocherous skipper. Distribution. Currently known from South and West Texas and Mexico . Curiously, the new species was found in sympatry with L. accius in the Big Bend National Park ( USA : Texas , Brewster Co.). Two specimens (NVG- 22054A02 and NVG-22054A03), both females, were reared in the lab from caterpillars collected in the Rio Grande Village campground area. Genetically ( Fig. 52 ) and phenotypically ( Fig. 54 ) they are identified as two different species. Lerema accius specimen ( Fig. 54a , NVG-22054A02) is not a result of accidental introduction with the locally growing foodplant into the lab in Dallas, because it is genetically different from Dallas specimens. However, the Rio Grande Village campground, where the caterpillar was found, is an area that receives many travelers, campers, and nature enthusiasts. Lerema accius is one of the most common Hesperiidae species throughout Texas and eastern US with caterpillars feeding on roadside grasses. Therefore, accidental introduction of L. accius to the campground area cannot be excluded, and additional studies of the two Lerema species in west Texas are of interest. Life history. Eggs white, glued to leaves either singly or in small groups ( Fig. 58a–c ), developing caterpillar heads can be seen through the transparent eggshell ( Fig. 58c ). Caterpillars hatch white ( Fig. 58d, e ), become green upon feeding ( Fig. 58f–i ), head and collar in the 1 st and 2 nd instars jet-black, in the 3 rd to 5 th instars head whitish with a characteristic brown pattern, frequently orangish on top and in front to varying degree ( Fig. 56a–f , 58j–n ), body yellowish-green with darker, greenish dots, spots, and several longitudinal bands, anal plate concolorous with body, collar dark-brown. Feed on a variety of grasses. Pupa green with a narrow conical projection on the head.