Thirteen new species of butterflies (Lepidoptera: Hesperiidae) from Texas Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-01-06 2023 969 1 58 journal article 10.5281/zenodo.7710103 1942-1354 7710103 Epargyreus fractigutta Grishin , new species https://zoobank.org/ BCB1E347-AD55-48AE-85D6-1B2E4DEF3F81 ( Fig. 24 part, 25, 26a–f) Definition and diagnosis. Genomic analysis of Epargyreus Hübner, [1819] reveals that specimens identified as Epargyreus cruza Evans, 1952 (type locality Mexico : Veracruz , Cordova) partition into two clades ( Fig. 24 red and blue). Fst / Gmin statistics for these two clades are 0.48/0.004, their COI barcodes differ by 1.5% (10 bp), and specimens from these clades are likely sympatric in Costa Rica and Panama suggesting that they correspond to species-level taxa. Currently, there is no available name associated with the red clade ( Fig. 24 ) and it represents a new species. In both nuclear and mitochondrial genome trees, this new species is sister to E. cruza and keys to it (C.2.9(a)) in Evans (1952) . To facilitate phenotypic comparison, the entire type series of the new species is illustrated in Fig. 26b–f , together with E. cruza ( Fig. 26g –k ). In facies, the following characters separate the new species from E. cruza : on the forewing, the hyaline spot in cell CuA 2 -1A+2A is offset farther distad from spot in cell CuA 1 -CuA 2 , (the two spots are closer together in E. cruza and are frequently larger) and the discal cell spot is rounder, not as strongly crescent-shaped as in typical E. cruza ; on the ventral hindwing, the silver spot near the end of the discal cell more offset basad from the larger silver spot and is slightly more distant from that larger spot than in E. cruza , the area between the silver spots (both, in discal cell and between veins 1A+2A and M 3 ) and a postdiscal band of faint white spots is mostly of dark ground color and largely devoid of pale overscaling, in particular between the discal cell spot and the postdiscal spot between the veins M 1 and M 3 (this overscaling is frequently extensive in E. cruza , including the holotype , Fig. 26g ), the white spots in the postdiscal band are narrower and less diffuse that in E. cruza , pale lavender submarginal overscaling reaches the white postdiscal band, in particular in the middle and mostly in the cell CuA 1 -CuA 2 (separated from the band with ground color brown scales in E. cruza , noticeably in the cell CuA 1 -CuA 2 , especially if white overscaling is poorly expressed between the discal silver spots and the postdiscal white band). In other words, lavender/white overscaling in E. cruza is expressed first between the discal silver spots and the postdiscal white band, but in the new species, it is expressed first between the postdiscal while band and marginal pale-lavender area (which are frequently merged with each other as a result). The holotypes of both taxa reflect this tendency well ( Fig. 26b, g ). In male genitalia, harpe narrower distad than in E. cruza and less constricted before distal end. However, because this new cryptic species was discovered using genomic analysis and the extent of phenotypic variation across its range remains to be studied, DNA offers definitive identification that should be relied upon. In DNA, a combination of the following base pairs is diagnostic in nuclear genome: aly2487.16.2:A89T, aly281.7.1:C1490T, aly84.5.6:C1196A, aly84.5.6:A1197C, and aly281.7.1:G1473T, and COI barcode: T82C, T106T(not C), T530C, T547C, A559G, and 637C(not T). Figure 24. Trees of Epargyreus constructed from protein-coding regions in a) nuclear and b) mitochondrial genomes: E. fractigutta sp. n. (red), E. cruza (blue), E. gaumeri (cyan), E. clavicornis (orange), E. clarus with E. huachuca (green), and E. zestos (purple) among their relatives (black). Primary type specimens are labeled in magenta. See Fig. 1 legend for other notations. Barcode sequence of the holotype . Sample NVG-14111F08, GenBank OP762107, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGAT CTTTAATTGGAGATGATCAAATCTATAATACTATTGTAACAGCTCATGCTTTCATTATAATTTTTTTCATAGTTATACCAATTATAATTG GAGGATTTGGAAATTGATTAATTCCCCTTATATTAGGAGCTCCAGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGATTATTAC CCCCATCACTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTCTTTCTTCCAA TATTGCCCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCTTTACACTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTA TTACAACAATTATTAATATACGAATTAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTTGGAATTACAGCTCTATTATT ATTACTTTCCTTACCTGTATTGGCAGGTGCTATTACTATATTATTAACTGACCGAAATTTAAATACCTCTTTTTTTGATCCTGCAGGAGG AGGAGACCCCATTTTATACCAACATTTATTT Figure 25. Holotype of Epargyreus fractigutta sp. n. dorsal (left) and ventral (right) views, data in text. Figure 26. Two species of Epargyreus . a) Possible E. fractigutta sp. n. , iNaturalist observation 61025624 USA: Texas, Hidalgo County, Mission area, details “obscured”, Sep-2020 © Beverly Pardue, the image is brightened, flipped, and rotated. b–f) The type series of E. fractigutta sp. n. b) holotype, NVG-14111F08 USA: TX, others are paratypes, detailed data in text. c) NVG-17097A09 MX: Chiapas, d) NVG-17097A08 MX: SLP, e) NVG- 17098A07 Panama, f) NVG-19124E11 MX: Veracruz. g–k) Epargyreus cruza . g) holotype [BMNH] © of the Trustees of the Natural History Museum London, others are in USNM. h) NVG-17097A06 Honduras. i) NVG- 16107G11, 09-SRNP-76379 Costa Rica. j) NVG-17097B06 Panama, k) NVG-17097B05 Panama. Gray F indicates that the image is flipped (left-right inverted). Photographs a) and g) are made available under CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/. Type material. Holotype : ♀ deposited in the Texas A&M University Insect Collection, College Station, Texas , USA ( TAMU ), illustrated in Fig. 25 , 26b , bears the following six rectangular labels, five white: [first TEXAS | record], [McAllen, Texas | Hidalgo Co. | 18/X/73 | W. W. McGuire, Collr.], [ Epargyreus | exadeus cruza Evans | Det. ’75 | W. W. McGuire], [ HESPERIIDAE , | Pyrginae: | Epargyreus exadeus | cruza Evans, 1952 | det. R .O. Kendall | ♀ M. & B. No. 8a], [DNA sample ID: | NVG-14111F08 | c/o Nick V . Grishin], and one red [ HOLO- TYPE ♀ | Epargyreus | fractigutta Grishin ]. Reported by McGuire and Rickard (1976) as “ Epargyreus exadeus cruza”. Paratypes : 4♂♂ , one from each locality: Mexico : NVG-17097A08 San Luis Potosi , Axtla Junction, Laurel Canyon, 21-Mar-1980 , W. H. Howe leg. [ USNM ]; NVG-19124E11 Veracruz , 3.9 km N of Omealca, 6-Aug-1981 , C. J. Durden leg. [ TMMC ]; NVG-17097A09 Chiapas , San Jeronimo, 19-Jul-1979 [ USNM ]; and Panama : NVG- 17098A07 El Valle, 31-Jan-1965 , S. S. Nicolay leg., genitalia vial H670 [ USNM ]. Type locality. USA : Texas , Hidalgo Co., McAllen. Etymology. The name is a fusion of Latin words ‘fracti’ for broken and ‘gutta’ for drop, tear, or spot, reflecting a discontinuous (broken) silver spot on ventral hindwing, a modified English name for the US sightings of this species that reflects larger separation between the two ventral hindwing sliver spots, i.e., the silver spot is “more broken” in this new species than in E. cruza . The name is a noun in apposition. English name. Broken silverdrop. Distribution. From the Lower Rio Grande Valley in South Texas to Panama . Comments. Using a combination of phenotypic characters detailed above, a live individual photographed recently in the Mission area of Hidalgo Co. in Texas (details “obscured”, Fig 26a ) is more likely to be this new species (or others),but not E. cruza . We are not aware of reliable E. cruza records from the US . We suggest changing the English name of E. cruza (if it needs one) to “bruised silverdrop” to have the “ruz” sound from the name cruza and reflect the “bruising” of the silver spot, an impression created by surrounding pale scales ( Fig. 26g –k ) that are mostly missing in the new species ( Fig. 26a–f ), so that the US species is still called “broken silverdrop.”