Revision of Bairdiella (Sciaenidae: Perciformes) from the western South Atlantic, with insights into its diversity and biogeography Author Marceniuk, Alexandre Pires Author Molina, Eduardo Garcia Author Caires, Rodrigo Antunes Author Rotundo, Matheus Marcos Author Wosiacki, Wolmar Benjamin Author Oliveira, Claudio text Neotropical Ichthyology 2019 2019-04-25 17 1 1 18 journal article 10.1590/1982-0224-20180024 b6b63f47-67b6-40c8-b6e9-1b7e7b0d698d 1982-0224 3649462 FAEBE302-376D-46C3-BB3C-6DA3A3530F53 Bairdiella goeldi sp. nov. ( Figure 4a , Tables 4 , 5 ) zoobank.org:act:561CDE1C-E23D-411E-BBCE-81E3B862BEB0 Fig. 3. The Atlantic coast of North, Central, and South America showing the geographic distribution of Bairdiella goeldi sp. nov. (yellow = molecular north–northeastern lineage, light blue = molecular southeastern lineage, white = no molecular data), B. ronchus (red), and B. veraecrucis (green). Some symbols represent more than one locality or a large number of specimens. Fig. 4. A. Holotype of Bairdiella goeldi sp. nov. from Bragança, Pará, Brazil, 190 mm SL, MPEG 33641. B. Syntype of Corvina ronchus from the Dominican Republic, MNHN 0095. C. Syntype of Sciaena bedoti from Cuba, BMNH 1905.3.18.2. D. Holotype of Bairdiella veraecrucis from Veracruz, Mexico, USNM 61676. Bairdiella ronchus (not of Cuvier, 1830).– Jordan , Evermann, 1898: 1436 (in part; fishes of North and Middle America; West Indies and along coast of Brazil ).– Miranda Ribeiro, 1915: 432 (Fauna Brasiliense, listed; description, distribution).– Vazzoler, 1970: 14 (fish fauna, Santos Bay, São Paulo , Brazil , listed; identification key; description).– Roux, 1973: 138 (Calypso ex- peditions; coast of South America; listed).– Chao 1978:39 (in part).– Figueiredo, Menezes, 1980: 59 , fig. 98 (marine fishes from southeastern Brazil ; description, distribution).– Camargo, Isaac 2001:142 (estuarine fishes from Pará, Brazil ).– Casatti, Menezes, 2003: 86 (catalog of marine fish species of Brazil ; listed).– Chao, 2003:1602 (in part). Holotype . MPEG 33641 , 1 , 154.0 mm SL, Brazil , Pará, Bra- gança, Furo da Ostra , 13 Feb 2014 , Alexandre Pires Mar- ceniuk, using gillnets (the same method used for all other type-specimens). Paratypes . MPEG 32860 , 1 , 146.0 mm SL, Brazil , Pará , Bra- gança, Furo da Ostra ; MPEG 33653 , 1 , 164.0 mm SL, Brazil , Pará , Bragança , Furo da Ostra , 17 Jul 2014 ; MPEG 33654 , 4 , 158.0-176.0 mm SL, Brazil , Pará , Bragança , Furo da Ostra , 10 Jul 2014 ; MPEG 34510 , 2 , 119.0-127.0 mm SL, Brazil , Pará , Bragança , Furo da Ostra , 09 Jan 2016 ; MPEG 33627 , 2 , 114.0-116.0 mm SL, Brazil , Pará , Bragança , Furo da Ostra , 21 Jan 2014 ; MPEG 33628 , 1 , 117.0 mm SL, Brazil , Pará , Bragança , Furo da Ostra , 18 Jan 2014 ; MPEG 33615 , 1 , 116.0 mm SL, Brazil , Pará , Bragança , Furo da Ostra , 17 Aug 2013 ; AZUSC 4926 , 9 , 129.0-161.0 mm SL, Brazil , Pará , Bragan- ça, Furo da Ostra ; LBP 19376 , 4 , 139.0-178.0 mm SL (tissue 76171-76174), Brazil , Pará , Bragança , Furo da Ostra , 2014 . Non-type specimens , MZUSP 68517 , 1 , 111.0 mm SL, Brazil , Maranhão , São Luís , rio Curuca ; LBP 22205 , 1 (tis- sue 84692), Brazil , Paraíba , Barra de Mamanguape ; USNM 104265 , 1 , 111.0 mm SL, Brazil , Pernambuco , Recife; MPEG 1660 , 1 (tissue 84204), Brazil , Alagoas , Barra de Santo Anto- nio ; USNM 43365 , 1 , 144.0 mm SL, Brazil , Bahia ; MZUSP 68501 , 3 , 170.0-198.0 mm SL, Brazil , Bahia , rio Paraguaçu , Cachoeira ; MZUSP 82209 , 3 , 98.0-157.0 mm SL, Brazil , Bahia , between Valença and Itacaré ; MZUSP 98958 , 1 , 143.0 mm SL, Brazil , Bahia , Comandatuba island ; AZUSC 3957 , 2 , 162.0-174.0 mm SL, Brazil , São Paulo , rio do Meio , Gua- rujá, São Paulo ; MZUSP 112337 , 5, 90.0-170.0 mm SL, Bra- zil, São Paulo , rio Cubatão ; MZUSP 2499 , 1 , 157.0 mm SL, Brazil , São Paulo , Santos; AZUSC 4222 , 3 , 153.0-186.0 mm SL, Brazil , São Paulo , Santos, estuary channel; AZUSC 363 , 2 , 154.0-169.0 mm SL, Brazil , São Paulo , Santos, rio Dia- na; AZUSC 3260 , 3 , 136.0-171.0 mm SL, Brazil , São Paulo , Santos, Caneu; AZUSC 2860 , 2 , 108.0-152.0 mm SL, Brazil , São Paulo , São Vicente , rio Mariana ; AZUSC 3103 , 2 , 100.0- 152.0 mm SL, Brazil , São Paulo , São Vicente , Mar Pequeno bridge; MZUSP 108213 , 1 , 127.0 mm SL, Brazil , São Paulo , Praia Grande; MZUSP 108229 , 1 , 129.0 mm SL, Brazil , São Paulo , Praia Grande; MZUSP 68514 , 1 , 131.0 mm SL, Brazil , São Paulo , Itanhaém; MZUSP 58712 , 1 , 144.0 mm SL, Bra- zil, São Paulo , Peruíbe , rio Guaraú ; AZUSC 3712 , 2,150.0- 197.0 mm SL, Brazil , São Paulo , Cananeia, estuary; MZUSP 46737 , 1 , 124.0 mm SL, Brazil , Santa Catarina , Porto Belo. Diagnosis . Bairdiella goeldi sp. nov. can be differentiated from B. armata , which occurs between the Gulf of Califor- nia and Colombia ( EP ), by having 50–55 scales with pores on the lateral line, rarely 48 or 49 ( vs . 46-49, Tab. 5 ); from B. chrysoura , which is found between Cape Cod ( US ) and the western Gulf of Mexico , by the presence of five pores on the chin ( vs . six), and a very robust second anal fin spine, as long as the first anal-fin ray ( vs . thin second anal fin spine, shorter than first anal-fin ray, Fig. 4a ); from B. ensifera , whi- ch is found between Mexico and Peru ( EP ), by having wavy stripes or dark spots on the body ( vs . body silvery without stripes or spots, Fig. 4a ); from B. icistia , which is found be- tween the Gulf of California and Guatemala ( EP ), by the presence of 21-24 rays in the dorsal fin ( vs . 25-29, Tab. 5 ) and the lack of a dark spot at the base of the pectoral fins ( vs . with dark spot at the base of the pectoral fins, Fig. 4a ); from B. ronchus , which is found in the Greater Caribbean Cen- tral Province, and B. veraecrucis , which is found between Florida ( US ) and the northern Gulf of Mexico , by having an orbital diameter greater than 8% SL ( vs . less than 8% SL, Fig. 5a ), and the length of the caudal peduncle 1.6-2.3 times the orbital diameter, rarely more than 2.3 ( vs. 2.4-3.8, Fig. 5b ). Bairdiella goeldi sp. nov. is further distinguished from B. veraecrucis , which is found between Florida ( US ) and the northern Gulf of Mexico , by having a larger head and shorter dorsal fin ( Tab. 4 ), with dorsal fin length 1.7-2.4 times in the head length ( vs. 1.2-1.5, Fig. 5c ), and dorsal fin length 1.8- 2.6 times in the head depth ( vs. 1.2-1.5, Fig. 5d ). Tab. 4. Genetic distances and standard error between groups based on the nucleotide substitution Kimura’s two parameter model (1980). In the main diagonal, the genetic distance and standard error within groups. n/c= not computed.

1	2	3	4	5	5	7
1 Bairdiella chrysoura	0.001±0.001
2 Bairdiella goeldi sp. nov.	0.180±0.018	0.005±0.002
3 Bairdiella ronchus	0.183±0.019	0.018±0.005	n/c
4 Bairdiella veraecrucis	0.185±0.019	0.039±0.008	0.0300.007	n/c
5 Corvula macrops	0.165±0.017	0.164±0.017	0.1620.017	0.171±0.019	0.005±0.003
6 Corvula sanctaeluciae	0.177±0.018	0.191±0.020	0.1830.020	0.194±0.021	0.140±0.016	0.004±0.002
7 Odontoscion dentex	0.180±0.018	0.178±0.018	0.1740.018	0.179±0.019	0.150±0.017	0.180±0.019	0.002±0.001

Tab. 5. Molecular diagnosis of Bairdiella species from the western Atlantic based on partial COI sequence. Position in gray are exclusive of B. goeldi sp. nov. Number are relative do complete mtDNA of Lutjanus sebae (Cuvier, 1816) (GenbankFJ824742) .

1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	1	2	2	2	2	2	2	2	2	2	2	2	2	2	2	2	2	2
0	0	0	0	1	1	2	2	2	3	3	3	4	4	5	6	6	7	7	8	8	9	1	1	1	2	2	2	3	4	4	5	5	6	7	7	7	8	9
0	3	6	9	5	8	1	4	7	0	4	9	2	5	4	0	3	5	8	1	7	6	4	5	7	0	3	9	2	1	7	0	6	8	1	4	7	6	5
Bairdiella goeldi Para Brazil 76174	C	C	C	C	T	G	A	T	G	C	T	T	T	G	G	C	T	A	T	C	T	T	T	G	T	G	C	A	T	G	T	C	A	A	C	G	C	A	T
Bairdiella goeldi Para Brazil 76171	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi Para Brazil 76172	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi Para Brazil 76173	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi Para Brazil KJ907230	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi Paraíba Brazil 84692	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi Sergipe Brazil 84204	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi São Paulo Brazil JX124740	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	C
Bairdiella goeldi São Paulo Brazil JQ365241	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	C
Bairdiella goeldi São Paulo Brazil KJ907232	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	C	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	C
Bairdiella goeldi São Paulo Brazil KJ907231	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	C
Bairdiella rochus Venezuela 29508	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	C	.	.	.	.	.	.	.	.	.	.	.	C	.	.	.	.	.	A	.	C
Bairdiella veraecrucis Mexico	A	.	.	.	.	.	.	.	.	T	.	.	.	.	.	.	.	.	C	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	A	.	C
Bairdiella chrysoura Mexico GU225148	.	A	G	T	C	A	T	C	A	T	G	C	C	A	A	T	C	G	A	T	C	.	C	A	C	A	T	C	C	A	A	T	G	C	T	A	A	G	.
3	3	3	3	3	3	3	3	3	3	3	3	3	3	3	3	3	3	3	3	3	3	4	4	4	4	3	4	4	4	4	4	4	4	4	4	4	5	5
7	7	8	8	9	1	1	1	2	2	2	3	4	4	4	5	5	6	6	6	7	7	6	6	6	7	9	0	0	0	0	1	2	3	3	4	4	4	4
6	9	2	8	1	3	6	9	2	8	9	4	3	6	9	5	8	1	4	7	0	3	3	6	9	2	7	0	3	6	9	8	4	3	9	2	8	4	5
Bairdiella goeldi Para Brazil 76174	G	C	A	A	G	C	T	C	C	T	T	T	T	A	T	G	T	G	G	G	C	G	C	C	C	C	T	T	C	G	A	A	C	A	C	C	C	C	C
Bairdiella goeldi Para Brazil 76171	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi Para Brazil 76172	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi Para Brazil 76173	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi Para Brazil KJ907230	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi Paraíba Brazil 84692	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi Sergipe Brazil 84204	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.
Bairdiella goeldi São Paulo Brazil JX124740	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	T	.	.	.	.	.	.	.	T
Bairdiella goeldi São Paulo Brazil JQ365241	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	C	.	.	.	.	.	.	.	.	T	.	.	.	.	.	.	.	T
Bairdiella goeldi São Paulo Brazil KJ907232	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	T	.	.	.	.	.	.	.	.
Bairdiella goeldi São Paulo Brazil KJ907231	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	T	.	.	.	.	.	.	.	T
Bairdiella rochus Venezuela 29508	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	A	T	.	.	.	.	C	.	.	.	.	.	.	.	.	.	.	T
Bairdiella veraecrucis Mexico	.	.	.	C	A	.	.	.	.	C	.	.	.	G	.	A	.	.	.	.	.	A	T	.	.	.	.	C	.	.	.	G	.	.	.	.	.	.	T
Bairdiella chrysoura Mexico GU225148	A	A	C	C	A	T	C	T	T	G	C	C	C	.	A	.	A	T	C	A	A	C	T	A	A	T	C	G	T	T	.	G	T	G	T	T	T	T

.

Tab. 5. (continued)

55444455556665555555555556666666
45778902331225556677888890011122
70351380259283692347034621203928
Bairdiellagoeldi ParaBrazil 76174	ACCAATTCACCAACATCCTTCATGGCTTACAA
Bairdiellagoeldi ParaBrazil 76171	................................
Bairdiellagoeldi ParaBrazil 76172	... G ............................
Bairdiellagoeldi ParaBrazil 76173	....................... A ........
Bairdiellagoeldi ParaBrazilKJ907230	....................... A ........
Bairdiellagoeldi ParaíbaBrazil 84692	................................
Bairdiellagoeldi SergipeBrazil 84204	................................
Bairdiellagoeldi SãoPauloBrazilJX124740	....................... A ........
Bairdiellagoeldi SãoPauloBrazilJQ365241	....................... A ........
Bairdiellagoeldi SãoPauloBrazilKJ907232	....................... A ........
Bairdiellagoeldi SãoPauloBrazilKJ907231	....................... A ........
Bairdiellarochus Venezuela 29508	.... GC ........ G ........ A ........
Bairdiellaveraecrucis Mexico	..... C .. G .. GG ..... C .... A ...... GG
Bairdiellachrysoura MexicoGU225148	GTT. C. CAGTAG. A. CTTCAATCAAACCCAG.

Fig. 5. Plots of the standard length versus orbital diameter (A) , head length versus dorsal fin length (B) , and head depth versus dorsal fin length (C) in Bairdiella goeldi sp. nov. (circles), B. ronchus (triangles), and B. veraecrucis (squares). Molecular diagnosis. The haplotypes of B. goeldi sp. nov. differed by four bases from those of all the other Atlantic species analyzed, by nine bases from B. ronchus , 19 bases from B. veraecrucis , and 97 bases from B. chrysoura ( Tab. 3 ), with genetic distances of 0.018±0.005 from B. ronchus , 0.039±0.008 from B. veraecrucis , and 0.180±0.018 from B. chrysoura ( Tab. 2 ). A total of 11 haplotypes were identified in the 14 specimens of B. goeldi sp. nov. sequenced, whi- ch formed two distinct lineages: (1) the specimens from the Brazilian states of Pará , Paraiba , and Sergipe , and (2) the specimens from São Paulo state ( Fig. 2 ). These lineages are differentiated by a genetic distance of 0.007±0.003 and two base pairs, at positions 295 and 409 ( Tabs. 2 , 3 ). Description: Morphometric and meristic data were em- ployed in Tabs. 4 , 5. D. X +I.21-24; A.II.8-10; P. 15-18; gill rakers 22-26; pored lateral line scales to caudal fin base 48- 55; scale rows above lateral line 8-10, below 9-12. Body moderately long and compressed, maximum depth at dorsal fin origin. Dorsal profile straight, ascending until dorsal fin origin, posteriorly convex until caudal peduncle, especially on larger specimens. Ventral profile flattened from pelvic fin to anal fin origin. Head relatively long and high. Snout blunt in lateral view, dorsal profile naked. Mouth nearly terminal, oblique in lateral view; posterior tip of premaxilla reaching vertical through middle of orbit. Teeth conical, premaxilla with 3-5 rows, external row with 15-20 enlarged teeth, den- tary with 2-4 rows. Orbit lateral; eye round, very large, or- bital diameter greater than snout length. Interorbital space smaller than orbital diameter, slightly convex, covered with ctenoid scales (cycloid anteriorly). Nostrils visible with naked eye, anterior nostril oval, posterior nostril larger and teardrop like, close to anterior eye margin, over or nearly above horizontal line through middle of orbit. Lateral sen- sory canal on head visible on infraorbital, dentary and preopercle; five ventral pores on dentary tip, one central smal- ler, oval, and two pores on each side; small circular pore on anterior preopercle border. Preopercle margin serrated, with about 10-15 spines, two or three at angle largest. Oper- cle tip angled, slightly posterior to vertical line that passes through pectoral-fin base. Gill rakers well developed. Scales ctenoid on trunk, belly, pectoral fin base, opercle, preoper- cle, infraorbital (two ventral most rows) and interorbital re- gion in specimens larger than 150 mm SL; scales cycloid on infraorbital (anteriorly), preorbital region below nostrils, opercle and interobital, specially in specimens smaller than 150 mm SL. Lateral line simple, slightly arched below first dorsal fin to middle of second dorsal fin, straight elsewhere. First dorsal fin without scales, membranes of second dorsal fin and anal fin with one or two series of 5-7 small cycloid scales. Base of pectoral fin covered by scales, cycloid scales to proximal third of fin present in largest specimens. Caudal fin base covered with cluster of small cycloid scales, rows of cycloid scales on caudal-fin rays, nearly three quarters of their length. Spinous dorsal fin short, first spine shortest, spines III-V longest; small notch between first and second dorsal fin. Origin of second dorsal fin slightly in front of vertical through pectoral fin tip, with second dorsal soft rays slightly shorter than longest first dorsal spines. Pectoral fin falcate, relatively long, length approximately equal to second anal fin spine length. Pelvic fin origin behind verti- cal though pectoral fin base. Anal fin emarginated, second anal-fin spine very stout and longer than remaining spines. ±Caudal peduncle depth about equal to eye length, 9.6-12.2 % SL; length 16.2-21.4% SL; caudal fin truncated to slightly rhomboidal, central rays longest. Color in alcohol . Grayish above lateral line, silvery below lateral line, dark stripes slightly more evident in the fresh specimens, oblique above lateral line, but more or less parallel below lateral line. Dorsal, anal, and caudal fins blackish, basal portion of the anal and caudal fins yellowish. Pectoral and pelvic fins yellowish, but with some dark pigmentation. Distribution and habitat . Widely distributed on the Atlantic coast of Brazil , from at least the equatorial northern state of Pará to Santa Catarina . The southern limit of occurrence is apparently determined by the absence of mangrove forests in estuaries. The species is relatively rare in the northeastern coast of Brazil , but is abundant in estuarine waters on sandy or muddy bottoms on the northern and southeastern coasts of Brazil ( Fig. 3 ). Ecological notes . This species has no commercial importan- ce in Brazil (as Bairdiella ronchus in Itagaki et al ., 2007 ). It is incidentally caught as bycatch in bottom trawls, gillnets, and seines, as well as by cast nets in mangrove swamps. Etymology. Bairdiella goeldi sp. nov. is named in honor of the Goeldi Museum (Museu Paraense Emílio Goeldi) in Belém, Pará ( Brazil ), that supported taxonomic research on the marine and estuarine fish of Brazil ( APM ), and the expe- ditions for the collection of specimens on the northern and northeastern coasts of Brazil . Conservation status. Bairdiella goeldi is frequent and abundant. No specific threats were detected, and the spe- cies can be categorized as Least Concern ( LC ) according to IUCN criteria ( IUCN , 2016). Remarks . Günther (1860) recorded Corvina ronchus (= Bairdiella ronchus ) from the Brazilian coast based on a sin- gle specimen from Bahia state, while Jordan , Eigenmann (1889) identified specimens from Rio de Janeiro state as Bairdiella ronchus . This classification was followed by Mi- randa-Ribeiro (1915), Vazzoler (1970) , Menezes, Figuei- redo (1980), and Menezes et al . (2003) . Meek, Hildebrand (1925) found individual variation among Bairdiella populations, although they decided that these differences were not sufficient to justify the recognition of two distinct species of the genus in the western Atlantic.