Phylogenetic classification of arbuscular mycorrhizal fungi: new species and higher-ranking taxa in Glomeromycota and Mucoromycota (class Endogonomycetes) Author Tedersoo, Leho Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia & Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia Author Magurno, Franco 0000-0002-3117-8149 Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences, University of Silesia in Katowice, Jagiellońska 28, 40 - 032 Katowice, Poland Author Alkahtani, Saad 0000-0001-7381-5110 Department of Zoology, College of Science, King Saud University, 12371 Riyadh, Saudi Arabia Author Mikryukov, Vladimir 0000-0003-2786-2690 Mycology and Microbiology Center, University of Tartu, 2 Liivi, 50409 Tartu, Estonia text MycoKeys 2024 2024-08-09 107 249 271 journal article 10.3897/mycokeys.107.125549 Lokruma stenii Tedersoo sp. nov. Diagnosis. Separation from other species of Lokruma based on the ITS region (positions 159–178 taacttaattttttcccgag; one mismatch allowed) as shown in Fig. 10 . There are no short barcodes in the first 700 bp of LSU that allow distinguishing L. stenii all from other congeners. Figure 10. Diagnostic barcodes for Lokruma stenii relative to closely-related taxa in ITS 2. Type. Soil eDNA sample TUE 103193 ( holotype ); type sequence EUK 1203766 ( lectotype ); GSMc plot S 689, Pinus halepensis forest (soil sample TUE 003193 ) in Lokrum , Croatia , 42.6223 ° N , 18.1241 ° E . Description. Other sequences: EUK 1603283 ( GSMc plot G 4301, Betula pendula forest soil in Männamaa, Estonia , 58.83258 ° N , 22.63346 ° E ); EUK 1604041 ( GSMc plot S 480, Populus - Picea forest soil in Käru, Estonia , 58.80407 ° N , 25.22249 ° E ); EUK 1604042 ( GSMc plot G 4734, Populus - Alnus forest soil in Urissaare, Estonia , 58.02673 ° N , 24.65739 ° E ); and EUK 1600039 (LSU: GSMc plot HB 19, Populus x wettsteinii forest plantation soil, Oja, Estonia , 58.82747 ° N , 26.37799 ° E ). Etymology. Lokrum (Serbo-Croatian) refers to type locality; and Sten (Estonian) refers to the first name of Sten Anslan who collected the materials from the type locality. Notes. Found in Croatia and Estonia , with ITS and LSU sequences displaying up to 1 % of differences.