Supplementary Materials and Appendix Author Zhang, Jing McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Cong, Qian McDermott Center for Human Growth and Development and Department of Biophysics University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 8816 USA Author Grishin, Nick V. Departments of Biophysics and Biochemistry University of Texas Southwestern Medical Center 5323 Harry Hines Blvd., Dallas, TX, 75390 - 9050 USA text Insecta Mundi 2023 2023-12-29 2023 26 1 115 http://dx.doi.org/10.5281/zenodo.10396362 journal article 10.5281/zenodo.10396362 1942-1354 Vernia clara Grishin , new species https://zoobank.org/ D20A8C16-E197-4F52-806F-01921EE16C07 ( Fig. 4 part, 99–100, 322–323) Definition and diagnosis. Genomic analysis of specimens from Mexico and Panama identified as Vernia dares ( Plötz, 1883 ) ( type locality not specified) reveals that they differ significantly from the South American V. dares ( Fig. 4 ): e.g., COI barcodes differ by 5.8% (38 bp) and, therefore, this complex consists of at least two species. Although we were not able to locate primary type specimens, according to the original description ( Plötz 1883 ) and the illustration in Draudt (1921 –1924), which probably is a copy of an unpublished drawing by Plötz, V.dares is of a darker phenotype that corresponds to South American specimens. Therefore, North and Central American specimens that are characterized by more extensive yellow-orange coloration represent a new species. This new species keys to “ Pompeius dares ” (M.15.5) in Evans (1955) , but differs from it by larger yellow-orange spots, more developed yellow-orange overscaling, and less contrasting dark spots on the ventral hindwing. Due to the cryptic nature of this species, most reliable identification is achieved by DNA and a combination of the following base pairs is diagnostic in the nuclear genome: aly2487.24.2:T675G, aly2487.24.2:T765C, aly536.138.7:T78C, aly82.18.3:T303C, aly82.18.3:G321A, and COI barcode: T5C, 31C, T46C, T193C, A283T, T536C. Barcode sequence of the holotype . Sample NVG-22035A08, GenBank OR837668, 658 base pairs: AACTCTATATTTTATTTTCGGTATTTGAGCCGGTATATTAGGAACCTCTCTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGTTCTTTAATT GGAGATGATCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGGTTTGGAAACT GATTAGTCCCATTAATATTAGGAGCCCCTGACATAGCTTTCCCACGAATAAATAACATAAGATTTTGAATATTACCCCCATCTTTAACTCTTTTAAT CTCAAGTAGAATTGTAGAAAATGGTGCAGGAACAGGTTGAACTGTTTATCCTCCTTTATCATCAAATATTGCTCACCAAGGATCTTCTGTTGATTTA GCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAACTTATCAT TTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACAGCTTTATTACTACTTTTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTACT TACTGATCGAAATTTAAACACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTCTTTACCAACATCTTTTC Type material. Holotype : ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington , DC , USA ( USNM ), illustrated in Fig. 99–100 , bears the following three rectangular labels, two white: [ Panama : Chiriqui | Santa Cruz | 10.VIII.1975 | G.B. Small], [DNA sample ID: | NVG-22035A08 | c/o Nick V . Grishin], and one red [ HOLOTYPE ♂ | Vernia | clara Grishin ]. Paratypes : 2♂♂ and 3♀♀ : Mexico : 1♂ NVG-22102C01, CASENT 8566973 Nayarit , 20 air mi NE of San Blas, 23-Dec-1971 , C. D. MacNeill leg. [ CAS ]; 1♀ NVG-18021D01 San Luis Potosi , Valles, 10-Jun-1966 , H. A. Freeman leg. [ AMNH ]; Chiapas : 1♂ NVG-18115C04, USNMENT_01531564 35 mi W of Tuxtla Gutierrez, 16-Aug-1972 , G. F. and S. Hevel leg. [ USNM ]; 1♀ NVG-21044A02 3 mi S of Simojovel, 3000′, 22-Jun-1989 , J. Kemner leg., genitalia SRS-4469 [ MGCL ] and Panama : 1♀ NVG-18115C05, USNMENT_01531565 Panama, Cerro Campana, 2000 ′, GPS 8.6833 , −79.9167 , 9-Mar-1963 , G. B. Small leg. [ USNM ]. Type locality. Panama : Chiriquí Province , Santa Cruz. Etymology. The name clara , which is Latin for bright and clear, is given for the brighter colors of this species. The name is an adjective. Distribution. From Mexico to Panama .